RetinoblastomaInactivationInducesaProtumoral ... · in the tumor microenvironment, linking retinoblastoma loss to immunosuppression. Introduction The tumor microenvironment (TME)

Tumor Biology and Immunology

Retinoblastoma Inactivation Induces aProtumoralMicroenvironment via EnhancedCCL2 SecretionFengkai Li1, Shunsuke Kitajima1,2, Susumu Kohno1, Akiyo Yoshida1,3,Shoichiro Tange4, Soichiro Sasaki5, Nobuhiro Okada1,6, Yuuki Nishimoto1,Hayato Muranaka1, Naoko Nagatani1, Misa Suzuki1, Sayuri Masuda7, Tran C. Thai3,Takumi Nishiuchi8, Tomoaki Tanaka9, David A. Barbie2, Naofumi Mukaida5, andChiaki Takahashi1

Abstract

Cancer cell–intrinsic properties caused by oncogenic muta-tions have been well characterized; however, how specificoncogenes and tumor suppressors impact the tumor micro-environment (TME) is notwell understood. Here, we present anovel non–cell-autonomous function of the retinoblastoma(RB) tumor suppressor in controlling the TME. RB inactivationstimulated tumor growth and neoangiogenesis in a syngeneicand orthotropicmurine soft-tissue sarcomamodel, which wasassociated with recruitment of tumor-associatedmacrophages(TAM) and immunosuppressive cells such as Gr1þCD11bþ

myeloid-derived suppressor cells (MDSC) or Foxp3þ regula-tory T cells (Treg). Gene expression profiling and analysisof genetically engineered mouse models revealed that RBinactivation increased secretion of the chemoattractant CCL2.Furthermore, activation of the CCL2–CCR2 axis in the TME

promoted tumor angiogenesis and recruitment of TAMsand MDSCs into the TME in several tumor types includingsarcoma and breast cancer. Loss of RB increased fattyacid oxidation (FAO) by activating AMP-activated proteinkinase that led to inactivation of acetyl-CoA carboxylase,which suppresses FAO. This promoted mitochondrialsuperoxide production and JNK activation, which enhancedCCL2 expression. Thesefindings indicate that theCCL2–CCR2axis could be an effective therapeutic target in RB-deficienttumors.

Significance: These findings demonstrate the cell-nonautonomous role of the tumor suppressor retinoblastomain the tumor microenvironment, linking retinoblastoma lossto immunosuppression.

IntroductionThe tumor microenvironment (TME) in solid tumors consists

of extracellular matrix as well as the associated stromal cells

including immune cells, fibroblasts, and vascular networks. Bidi-rectional interactions between tumor cells and the TME enhancetumor progression at multiple levels: by supplying a variety ofcytokines and growth factors, and nurturing cancer cells via thepromotion of angiogenesis (1). Immune checkpoint blockade(ICB) accelerates the antitumor function of the TME throughcytotoxic T-cell–mediated immunosurveillance, which is fre-quently attenuated by the aberrant expression of immune check-point molecules such as PD-L1 (2). Furthermore, the recruitmentof immunosuppressive cells such as myeloid-derived suppressorcells (MDSC) and regulatory T cells (Treg) into the TME also leadsto a poorly immunogenic tumor; thus the ratio of tumor-infiltrating CD8þ cytotoxic T cells to immunosuppressive cellshas been shown to predict patient outcomes for cancer immu-notherapies using ICB (1).

Recent advances in cancer immunotherapies including ICBhave been dramatic; however, they still provide limited benefitsfor the majority of patients. For example, according to an early-phase I trial in patients with breast cancer, the effectiveness of ICBhas been recognized particularly in triple-negative breast cancer(TNBC) due to its lack of targetable molecules such as estrogenreceptor (ER) andhumanEGFR-2 (HER2), with an approximately20% overall response rate (3). In addition to the expression ofimmune checkpoint molecules or the frequencies of tumor-infiltrating CD8þ cytotoxic T cells in tumor tissues, several groupsrecently demonstrated that genetic aberrations in cancer cells suchas loss-of-function mutations in JAK1/2, APLNR, PTPN2, andPBRM1 are significantly correlated with the efficacy of cancerimmunotherapies (4–9). In spite of such extensive efforts, it

1Division of Oncology and Molecular Biology, Cancer Research Institute, Kana-zawaUniversity, Kanazawa, Ishikawa, Japan. 2Department of Medical Oncology,Dana-Farber Cancer Institute, Boston, Massachusetts. 3Keiju Medical Center,Nanao, Ishikawa, Japan. 4Department of Medical Genome Sciences, ResearchInstitute for Frontier Medicine, Sapporo Medical University, Sapporo, Japan.5Division of Molecular Bioregulation, Cancer Research Institute, KanazawaUniversity, Kanazawa, Ishikawa, Japan. 6Department of Nano-Biotechnology,Graduate School of Interdisciplinary Science & Engineering in Health Systems,Okayama University, Okayama, Okayama, Japan. 7Department of PediatricOncology, Dana-Farber Cancer Institute, Boston, Massachusetts. 8Division ofFunctional Genomics, Advanced ScienceResearch Center, KanazawaUniversity,Kanazawa, Ishikawa, Japan. 9Department of Molecular Diagnosis, Chiba Uni-versity Graduate School of Medicine, Chiba, Japan.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

F. Li and S. Kitajima contributed equally to this article.

CorrespondingAuthors:Chiaki Takahashi, Cancer Research Institute, KanazawaUniversity, Kakuma-cho, Kanazawa, Ishikawa920-1192, Japan. Phone: 817-6264-6750; Fax: 817-6234-4521; E-mail: [email protected]; andShunsuke Kitajima, Dana-Farber Cancer Institute, Boston, MA02215. Phone: 617-632-6347; Fax: 617-632-5786; E-mail: [email protected]

Cancer Res 2019;79:3903–15

doi: 10.1158/0008-5472.CAN-18-3604

�2019 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 3903

on January 10, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst June 12, 2019; DOI: 10.1158/0008-5472.CAN-18-3604

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-18-3604&domain=pdf&date_stamp=2019-7-17

http://cancerres.aacrjournals.org/

remains highly challenging to effectively determine which patientwill respond to current immunotherapies because of the com-plexity of tumor heterogeneity in terms of genetic, epigenetic,and/or microenvironment levels in aggressive tumors.

Although cancer cell–intrinsic properties resulting from onco-genic mutations have been well characterized, it is becomingincreasingly clear that oncogenic mutations impact angiogenesisand/or the recruitment and phenotype of immune cells in theTME via increasing secretion of cytokines and chemokines bytumor cells (10). The BRAFV600E mutation in melanoma cellspromotes the secretion of multiple cytokines including IL6 andVEGFa, contributing to the establishment of a protumoral micro-environment (11). The oncogenic KRAS mutation in pancreaticductal adenocarcinoma induced GM-CSF secretion, whichenhanced the recruitment of Gr1þCD11bþ MDSCs and subse-quent suppression of CD8þ cytotoxic T-cell infiltration in theTME(12, 13). In addition, the loss of tumor suppressor genes suchas STK11/LKB1 and PTEN affects T-cell infiltration into the TMEbymodulating thesecretionofcytokinesandchemokines (14,15).We previously reported that retinoblastoma (RB) loss in Trp53-null sarcoma cells and ARF-deficient breast cancer cells increasedthe secretion of cytokines such as IL6 via enhancedmitochondrialsuperoxide (MS) production, which stimulates their self-renewalactivity in a cell-autonomous manner (16, 17). However, the roleof enhanced cytokine production following RB inactivation in theTME remains unclear.

In this study, to elucidate the significance of non–cell-autonomous RB function in tumor tissue, we employed a synge-neic and orthotopic murine soft-tissue sarcoma model and amammary carcinogenesis model to analyze the TME of RB-deficient tumors. We found that enhanced CCL2 secretion fol-lowing RB inactivation contributes to the establishment of atumor-promoting microenvironment due to the recruitment ofimmunosuppressive cells such as Gr1þCD11bþ MDSCs and F4/80þ tumor-associated macrophages (TAM) into the TME.

Materials and MethodsMice

Trp53 knockout mice (18) were obtained from RIKEN BioR-esourceCenter (#CDB0001K).Ccr2 knockoutmicewere obtainedfrom Dr. W.A. Kuziel (PDL Bio Pharma Inc., Incline Village, NV;ref. 19). Ccl2 knockout mice (#004434) and MMTV-Cre mice(#003553)werepurchased from the Jackson Laboratory.Rbflox/flox

mice were gifted from Dr. A. Berns (Netherlands Cancer Institute,Amsterdam). Wild-type C57BL/6 mice were purchased fromJapan SLC. Female of MMTV-Cre; Rbflox/flox mice for mammarycarcinogenesis were never mated to male mice during analysis.Mouse experiments were conducted in accordance with a Kana-zawa University Institutional Animal Care and Use Committee-approved protocol (AP-153426).

Cell line and primary cell cultureMinced pieces of soft-tissue sarcoma samples derived from p53-

knockout mice were digested with 300 U/mL collagenase (#C-5138, Sigma-Aldrich), 100 U/mL hyaluronidase (#H3506-1G,Sigma-Aldrich) and 100 mg/mL DNase I (#DN25-100MG, Sig-ma-Aldrich) in a-modified Eagle's medium (aMEM) supplemen-ted with 10% FBS (17). Primary cells from surgically removedhuman breast carcinomas were established in the laboratory ofDr.NorikoGotoh (KanazawaUniversity; ref. 20), andmaintained

in HuMEC (#12752-010, Life Technologies). The institutionalreview boards of Kanazawa University (Ishikawa, Japan; #335)and the Institute of Medical Science, The University of Tokyo(Tokyo, Japan), approved this study. RAW 264.7 (RIKEN BRC,RCB0535), THP-1 (RIKEN BRC, RCB1189), MCF7 (RIKEN BRC,RCB1904), andMDA-MB-231 [ATCC (HTB-26)] were cultured inDMEM containing 10% FBS. Hs578t [ATCC (HTB-126)] weremaintained inDMEMsupplementedwith 10%FBS and10mg/mLrecombinant insulin. HCC1187 [ATCC (CRL-2322)] were main-tained in RPMI1640 supplementedwith 10%FBS. These cell lineswere authenticated by RIKENBRC and ATCC, and all experimentswere performed before reaching 10 passages. Mycoplasma infec-tion was regularly checked by PCR using the conditioned mediaderived from each cell line (#G238, abm).

Generation of lentivirusMISSION TRC validated shRNA target sets for mouse Rb

(TRCN0000042543 and TRCN0000042544), human RB(TRCN0000040163 and TRCN0000010419), and negative con-trol (Scramble; SHC002) were purchased from Sigma-Aldrich.pQCXIH-PSM-RB7LP was purchased from Addgene (#37106),and RB7LP-lacking stop codon was amplified by PCR (16). PCRproducts were then cloned into pDONR223, and subcloned intopLX304. pCL20c-CMV-EGFP and pCL20c-CMV-EGFP-DN-c-Junwere obtained from Dr. Katsuji Yoshioka (Kanazawa University;ref. 21). Generation and infection of lentivirus were performedaccording to the manufacturer's instructions.

In vivo tumor formation assayCells suspended in50mLaMEMwith10%FBSweremixedwith

50 mL Matrigel (#354234; Corning) and injected subcutaneouslyinto wild-type or Ccr2 KO C57BL/6 male mice. Tumors wereassessed 14–28 days after injection.

qRT-PCRtRNA was isolated from cultured cells or tumor tissues

by using TRIzol (#15596018, Life Technologies) accordingto the manufacturer's instructions. qPCR of tRNA wasperformed as described previously (17) using Taqman probes.Taqman probes: mouse Actb (Mm00607939_s1), mouse Rb(Mm00485586_m1), mouse Vegfa (Mm01281449_m1), mousePerforin1 (Mm00812512_m1),mouseCcl2 (Mm00441242_m1),mouse Ccr2 (Mm99999051_gH), mouse Il6 (Mm00446190_m1), mouse Il1a (Mm00439620_m1), mouse Cxcl1(Mm04207460_ m1), mouse Cxcl5 (Mm00436451_g1), mousePtgs2 (Mm00478374_m1), human ACTB (Hs99999903_m1),human RB (Hs01078066_m1), human CCL2 (Hs00234140_m1), and human CCL5 (Hs00982282_m1). The relative level ofgene expression was normalized using the level of Actb or ACTB.

IHCIHC was performed on paraffin-embedded subcutaneous

tumor sections. After deparaffinizing tissue blocks, antigenretrieval was performed by 0.01% trypsin at 37�C for 10 minutes(CD31, Gr-1, and F4/80), 10mmol/L Tris-1mmol/L EDTA buffer(pH 9.0) at 90�C for 10minutes (CD3, CD4, CD8, and Foxp3), or10mmol/L citrate at 100�C for 10minutes (PCNA and CCL2). Toblock nonspecific signal, tissue sections were incubated for 10minutes at room temperature using PBS containing 5% goatserum, 1%BSA, and 0.1% TritonX-100. Serial tissue sections werestainedwith following antibodies: CD31 (#557355, BDPharmin-gen), Gr-1 (#550291, BD Pharmingen), F4/80 (#MCA497G,

Li et al.

Cancer Res; 79(15) August 1, 2019 Cancer Research3904




Bio-Rad), CD3 (#MCA1477, Bio-Rad), CD4 (ab183685, Abcam),CD8a (#14-0195, Thermo Fisher Scientific), Foxp3 (#623801,BioLegend), PCNA (#13110, Cell Signaling Technology), andCCL2 (#ab25124, Abcam). Sections were visualized with ZEISSmicroscope equipped with ZEISS AxioCamHRc camera and AxioVision 4.1. Obtained digital images were analyzed by Photoshopto determine the proportion of immune-positive cells.

Flow cytometryTumors were surgically removed from transplanted mice. The

tumors were cut into smaller fragments, and digested in 5-mLDMEM medium containing 3,045 units collagenase, 1,050 unitshyaluronidase, and 200–400 units deoxyribonuclease at 37�C for1 hour. Then 1� 106 cells were stained byCD11b-APC (#553312,BD Pharmingen), Gr-1-FITC (#11-5931, eBioscience), F4/80-PE(#12-4801, eBioscience), CD45-PerCP-Cy5.5 (#45-0451,eBioscience), and CCR2-PE (#150609, BioLegend) antibodies.MS level was determined by MitoSOX Red (#M36008, Life Tech-nologies). A total of 1 � 106 cells suspended in 500 mL PBScontaining 3% FBS were analyzed by FACSCanto ll (BDBiosciences).

RNA sequenceThe tRNA was extracted using the TRIzol reagent (#15596018,

Life Technologies). From 15 mg of tRNA, a RNA-sequence librarywas constructed using the mRNA-sequence Sample PreparationKit, according to the manufacturer's instructions (Illumina). Atotal of 36 base-pair single-end-read RNA-sequence tags weregenerated using a HiSeq 2000 sequencer, according to the stan-dard protocol. The RNA-sequence tagsweremapped to themousegenomic sequence (mm9 from theUCSCGenomeBrowser) usingthe ELAND program (Illumina). Unmapped or redundantlymapped sequences were removed from the dataset, and onlyuniquely mapped sequences without any mismatches were usedfor the analyses (22). The raw data of RNA sequence are availablein DNA Data Bank of Japan (DDBJ; DRA002911).

ELISA assayBlood samples were collected directly from the heart of anes-

thetized Ccl2 KO mice 17 days after subcutaneous tumor injec-tion, incubated for 24 hours at 4�C, and then centrifuged at 1,200rcf for 30 minutes at 4�C to separate the serum. Conditionedmediumwas collected from 53KOSTS andMCF7 cells transducedwith shRNA. Mouse Ccl2 ELISA (#88-7391, eBioscience) andhuman CCL2 (#DCP00, R&D Systems) and human CCL5 ELISA(#DRN00B, R&D Systems) were performed according to themanufacturer's instructions.

ReagentsThe following reagents were used: anti-mouse Ccl2 antibody

(#554440, BD Biosciences), Armenian Hamster-IgG (#400916,BioLegend), carmine alum (#07070, STEMCELL Technologies),N-acetylcysteine (#A7250, Sigma-Aldrich), Trolox (#202-17891, Wako), mitoquinone (#10-1363, Focus Biomolecures),carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone(FCCP; #C2920, Sigma-Aldrich), and SP600125 (#8177, CellSignaling Technology).

CRISPR/Cas9 systemTarget sequences for CRISPR interference were designed

using the sgRNA designer (http://portals.broadinstitute.org/

gpp/public/analysis-tools/sgrna-design), and then cloned intopCRISPRv2. A nontargeting sgRNA from the Gecko library v2was used as a scramble sgRNA.

Scramble sgRNA: ACGTGTAAGGCGAACGCCTTMouse Ccl2 sgRNA: TGTCACCAAGCTCAAGAGAG

Microarray analysistRNA was extracted using the RNeasy Mini Kit (#74106, Qia-

gen) according to the manufacturer's instructions. The quality ofthe tRNA samples was assessed using the RNA 6000 Nano LabChip Kit (Bio analyzer 2100, Agilent Technologies). The micro-array analysis was performed with a Human Gene Expression 4�44K v2 Microarray (#26652, Agilent Technologies). The fluores-cence intensity was measured by the G2505CMicroarray Scanner(Agilent Technologies). Three samples were analyzed per group.Data were analyzed by Gene Spring 12.6.1 - GX - PA (AgilentTechnologies) and R version 3.1.1. The raw data of microarrayanalysis are available in Gene Expression Omnibus database(GSE64525).

ImmunoblottingWhole-cell lysates were prepared as described previously (23).

Immunoblotting was performed as described previously (23)using following antibodies: Phospho-Rb (#9308, Cell SignalingTechnology), total RB (#554136, BD Biosciences), Phospho-ACC(#3661, Cell Signaling Technology), total ACC (#3676, CellSignaling Technology), Phospho-AMPK (#2535, Cell SignalingTechnology), total AMPK (#5832, Cell Signaling Technology),a-tubulin (#CP06-100UG,EMD Millipore), and b-Actin (#3700,Cell Signaling Technology).

Chemotaxis assayConditioned medium was collected from MCF7 transduced

with shRNA cultured in serum-free RPMI1640 for 48 hours. Atotal of 1 � 105 THP-1 cells suspended in serum-free RPMI1640(WAKO)were loaded into the upper chamber of the 24-well–typeMicrochemotaxis Chamber (#CLS3421, Sigma-Aldrich), and 600mL conditioned medium derived from MCF7 cells was added tothe lower chamber. After 24-hour incubation at 37�C, the numberof THP-1 cells migrated into the lower chamber was analyzed byBZ analysis software on BZ-9000 (Keyence) and Photoshop.

ImmunofluorescenceImmunofluorescence was performed on paraffin-embedded

subcutaneous tumor sections. After deparaffinizing tissue blocks,antigen retrieval was performed by boiling the sections in pH610 mmol/L citrate buffer for 10 minutes. To block nonspecificsignal, tissue sections were incubated for 10 minutes at roomtemperature using PBS containing 5% goat serum, 1% BSA, and0.1% TritonX-100. Serial tissue sections were stained with fol-lowing antibodies: F4/80 (#MCA497G, Bio-Rad), and CK18(#GTX105624, GeneTex). Put the sections in 4 �C overnight. Thenext day, we labeled the F4/80 antibodywithAlexa Fluor 633 (#A-21094, Thermo Fisher Scientific), labeled the CK18 antibodywithAlexa Fluor 488 (#A-11034, Thermo Fisher Scientific), and thenwe mount the sections with Antifade Mounting Medium withDAPI (#H-1200, VECTOR). Sections were visualized with LeicaTCS SP8microscope and LAS X 1.8. Obtained digital images wereanalyzed by photoshop to determine the proportion of immune-positive cells.

RB Impacts the Tumor Microenvironment via Regulation of CCL2

www.aacrjournals.org Cancer Res; 79(15) August 1, 2019 3905



http://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design

http://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design


Statistical analysisStatistical significance was assessed using unpaired two-tailed

Student t test, or one-way ANOVA followed by Tukey post hoc test.P values less than 0.05 were considered significant. Asterisks usedto indicate significance correspond with: �, P < 0.05; ��, P < 0.01.Columns represent means� SD. In one-way ANOVA followed bypost hoc tests, we showed asterisks only in pairs of our interest.GraphPad Prism7 was used for all statistical analysis, data proces-sing, and presentation.

ResultsRb loss alters the TME

To assess whether RB status affects tumor progression in a non–cell-autonomous manner, we established a syngeneic and ortho-tropic murine soft-tissue sarcoma model to analyze the TME ofRB-deficient tumors (Fig. 1A). First, we depleted Rb in a Trp53knockout (KO)C57BL/6mouse–derived sarcoma cell line named53KOSTS (Trp53 knockout soft-tissue sarcoma) cells (Supple-mentary Fig. S1A), which we established previously (16, 17). As

Figure 1.

Rb inactivation induces a protumoral microenvironment in the syngeneic and orthotopic murine soft-tissue sarcomamodel. A, A schematic drawing of syngeneicand orthotopic murine soft-tissue sarcomamodel. SC, subcutaneous. B, Representative pictures of tumors derived from 53KOSTS cells transduced with theindicated shRNA. A total of 1� 105 cells were injected subcutaneously into syngeneic C57BL/6 mice (day 24). Scale bar, 10 mm. Tumors were weighed (right;n¼ 9). C, IHC analysis of the indicated protein in tumors derived from 53KOSTS cells transduced with the indicated shRNA. Scale bar, 100 mm. CD31 cells werequantified (right; n¼ 8). D, qRT-PCR of the indicated gene in 53KOSTS cells transduced with the indicated shRNA (n¼ 3). E, qRT-PCR of the indicated gene intumor nodules derived from 53KOSTS cells transduced with the indicated shRNA (n¼ 5). F, qRT-PCR of the indicated gene in RAW264.7 cells treated with theCM derived from 53KOSTS cells transduced with the indicated shRNA (n¼ 3). Growth mediumwas used as a negative control. G, J, and K, IHC analysis of theindicated protein in tumors derived from 53KOSTS cells transduced with the indicated shRNA. Scale bar, 100 mm. Gr-1þ, CD3þ, CD4þ, Foxp3þ, or CD8þ cells werequantified (n > 8). H and I, The profiles (% in CD45þ cells) of Gr-1/CD11b (H) or F4/80þ (I) cells in tumors derived from 53KOSTS cells transduced with theindicated shRNA (n > 4). The insets show Gr1/CD11b double-positive cells (H). L, qRT-PCR of the indicated gene in tumor nodules derived from 53KOSTS cellstransduced with the indicated shRNA (n¼ 8). � , P < 0.05; �� , P < 0.01.

Li et al.





we expected, Rb depletion in 53KOSTS cells caused an accel-eration of cell growth in vitro (Supplementary Fig. S1B) and anincrease in tumor size following orthotopic engraftment inwild-type C57BL/6 mice. Interestingly, tumor tissues derivedfrom Rb-depleted 53KOSTS cells appeared to be more vascu-larized than the control tissues (Fig. 1B). To validate thisobservation, we performed endothelial cell marker CD31 stain-ing to confirm higher angiogenesis in Rb-depleted tumors(Fig. 1C). Consistent with higher CD31 expression in Rb-depleted tumors and a previous report describing inductionof Vegfa expression following Rb-inactivation (24), Vegfaexpression was 3-fold higher in tumor tissues derived fromRb-depleted 53KOSTS cells, even though Rb depletion onlyweakly induced Vegfa expression in 53KOSTS cells themselvesin vitro (Fig. 1D and E). On the basis of these findings, weexpected that stromal cells that formed the TME might also bestimulated to express Vegfa upon Rb depletion in 53KOSTScells due to cell–cell interactions including humoral factors.Indeed, we observed that treatment with conditioned medium(CM) derived from Rb-depleted 53KOSTS cells significantlyincreased expression of Vegfa, as well as that of two otheractivation markers, IL6 and Il1a, in an RAW264.7 mousemacrophage cell line (Fig. 1F), implying that Rb depletion intumor cells might affect the TME via secreted factors.

Given these changes in the TME, we next characterizedinfiltration of immune cells into tumor tissues derived from

Rb-depleted 53KOSTS cells. Interestingly, Rb depletion signif-icantly promoted the infiltration of Gr1þCD11bþ MDSCs,which are known to be very potent suppressors of cytotoxicT-cell immunity (Fig. 1G and H). In addition, Rb depletionslightly enhanced the infiltration of F4/80þ TAMs in the TME(Fig. 1I). Moreover, consistent with a higher number of CD3þ

pan-T cells in the TME (Fig. 1J), we observed a significantlyhigher number of CD4þ effector or Foxp3þ Tregs in the TME ofRb-depleted tumors, although the infiltration of CD8þ cyto-toxic T cells was slightly lower in Rb-depleted tumors (Fig. 1K;Supplementary Fig. S1C). We confirmed lower expression ofperforin, the cytolytic granule effector molecule of CD8þ Tcells, in Rb-depleted tumors by qRT-PCR (Fig. 1L). Takentogether, Rb depletion not only enhances angiogenesis, butalso contributes to the establishment of a protumoral micro-environment by recruiting immunosuppressive cells such asMDSCs into the TME.

Rb depletion elevates Ccl2 expressionWe next systematically assessed RB-regulated factors that could

induce these changes in the TME by performing RNA sequencingof Rb-depleted 53KOSTS cells. This uncovered multiple chemo-kine genes including Ccl2 that were upregulated followingRb depletion in these cells (Fig. 2A). Furthermore, pathwayanalysis using Kyoto Encyclopedia of Genes and Genomes(KEGG) revealed that cytokine–cytokine receptor interactions

Figure 2.

Ccl2 is upregulated following Rb depletion inmouse sarcoma cells. A, Heatmap indicating foldchange of the top 50 genes upregulated by Rbdepletion in 53KOSTS cells based on RNA-sequence analysis. Fifty genes were reranked byaverage RPKM value. B, qRT-PCR of the indicatedgene in 53KOSTS cells transduced with theindicated shRNA (n¼ 3). #1 and #2, independentshRNA. C, ELISA of mouse Ccl2 levels in 53KOSTScells transduced with the indicated shRNAfollowing 10-hour culture (n¼ 3). D, qRT-PCR ofthe indicated gene in RAW264.7 and 53KOSTScells (n¼ 3). E, qRT-PCR of the indicated gene intumor nodules derived from 53KOSTS cellstransduced with the indicated shRNA (n¼ 3).� , P < 0.05; �� , P < 0.01.






and chemokine signaling pathwayswere significantly upregulatedin Rb-depleted 53KOSTS cells (Table 1). We then validated theupregulation of Ccl2 and other chemokines such as Cxcl1 andCxcl5 by qRT-PCR ((Fig. 2B; Supplementary Fig. S1D). In addi-tion, we detected enhancedCcl2 secretion following Rb depletionin 53KOSTS cells using ELISA (Fig. 2C). Despite higher secretionlevels of Ccl2 from Rb-depleted 53KOSTS cells, they themselvesseemed not to receive Ccl2 because of the lack of Ccr2 expression,which encodes the main receptor for Ccl2 (Fig. 2D). These datasuggested that enhanced Ccl2 secretion from Rb-depleted53KOSTS cells mainly involved stromal cells, but not tumor cellsin vivo, and might contribute to the remodeling of the TME in anon–cell-autonomous manner. Consistent with this idea, inaddition to Ccl2 expression, tumor tissues derived from Rb-depleted 53KOSTS cells showed significantly high Il1a expression(Fig. 2E), which was induced in the macrophage cell line bytreatment with CM derived from Rb-depleted 53KOSTS cells(Fig. 1F).

Rb depletion induces tumor progression, depending on Ccl2–Ccr2 axis

To determine the specific contribution of enhanced Ccl2secretion to tumor progression in vivo, we next subcutaneouslyinjected 53KOSTS cells into Ccl2 KO C57BL/6 mice to deter-mine the concentration of tumor-derived Ccl2 in serum(Fig. 3A). Consistent with the results in vitro, Rb depletionelevated the concentration of tumor-derived Ccl2 in serum invivo (Fig. 3B). Next, to elucidate the role of Ccl2 in vivo in tumorprogression promoted by Rb depletion, we employed Ccr2 KOC57BL/6 mice to abolish the Ccl2–Ccr2 axis in the TME(Fig. 3C). Interestingly, Rb-depleted cells generated significant-ly smaller tumors in Ccr2 KO C57BL/6 mice than in wild-typeC57BL/6 mice (Fig. 3D). To further study how the Ccl2–Ccr2axis promoted tumor development, we then assessed angio-genesis and infiltration of immune cells such as MDSCs and Tcells into the TME. Angiogenesis induced by Rb depletion in theTME was markedly suppressed in Ccr2 KO C57BL/6 mice.(Fig. 3E). In addition, infiltration of TAMs and MDSCs inducedupon Rb depletion was clearly suppressed in Ccr2 KO C57BL/6mice (Fig. 3E–G). Previously, several groups have shown thatTAMs and MDSCs are recruited into the TME by CCL2 secretedfrom tumor cells and contribute to tumor angiogenesis byproducing angiogenic factors such as VEGF (25, 26). Consistentwith these reports, we observed that approximately 95% ofGr1þCD11bþ MDSCs in the TME express Ccr2 (Fig. 3H). How-ever, the infiltration of T cells including Tregs did not decrease,suggesting that this was independent of the activation of theCcl2–Ccr2 pathway (Supplementary Fig. S1E and S1F). More-over, we demonstrated that CRISPR/Cas9–mediated depletionof Ccl2 significantly attenuated tumor growth, angiogenesis,and the infiltration of TAMs and MDSCs in Rb-depleted53KOSTS cells in C57BL/6 mice (Fig. 3I–K; Supplementary Fig.S1G–S1I). Taken together, these findings suggest that tumor

progression induced by Rb depletion, at least in part, dependson the elevated Ccl2 secretion and the subsequent activation ofCcr2-dependent angiogenesis or the recruitment of immuno-suppressive cells into the TME.

RB depletion upregulates CCL2 expression in human breastcancer cells

To validate the role of the CCL2–CCR2 axis and confirm itsrelevance to human cancer, we focused on human breast cancerbecause the RB gene shows genetic alterations in approximately10% of patients with breast cancer (27). Furthermore, we previ-ously reported enhanced cytokine secretion following RB inacti-vation in breast cancer cells (16, 17). According to gene expressionprofiling usingDNAmicroarray and subsequent pathway analysisin RB-depleted MCF7 cells (RB intact and ARF deficient),we confirmed that cytokine signaling is highly upregulated fol-lowing RB depletion in MCF7 cells as observed in 53KOSTS cells(Fig. 4A; Supplementary Fig. S2A). Furthermore, among CCchemokine family members, the expression levels of CCL2 andCCL5 were specifically upregulated, although we did not observeCcl5 upregulation in Rb-depleted 53KOSTS cells (SupplementaryTable S1). We next examined CCL2 and CCL5 expressionacross a panel of RB-positive breast cancer cell lines. In mostcell lines, CCL2 and CCL5 expression was significantly higherfollowing RB depletion (Fig. 4B; Supplementary Fig. S2B). Wefurther examined patient-derived primary breast cancer cells, inwhich RB depletion also upregulated both CCL2 and CCL5(Fig. 4C). Moreover, we confirmed enhanced CCL2 and CCL5secretion following RB depletion by ELISA (Fig. 4D). In con-trast to RB depletion, overexpression of the constitutivelyactive (nonphosphorylatable) form of RB (RB7LP; ref. 28)clearly decreased both CCL2 and CCL5 expression (Fig. 4E).Consistent with these findings, CCL2 and CCL5 expressionshowed a weak inverse correlation with RB expression accord-ing to gene expression profiling data from breast cancer celllines found in the Cancer Cell Line Encyclopedia (CCLE)database (Fig. 4F; Supplementary Table S2). To functionallyvalidate the role of the RB–CCL2 axis, we next examined CCL2-dependent migration of THP-1 cells using a transwell migra-tion assay. Importantly, compared with the CM derived fromcontrol MCF7 cells, CM derived from RB-depleted MCF7 cellsexhibited stronger chemoattractant activity for THP-1 cells,which was significantly antagonized by treatment with ananti–CCL2-neutralizing antibody (Fig. 4G). Taken together,these data suggest that RB inactivation might influence theTME of breast cancer through enhanced chemokine secretionincluding CCL2.

Enhanced FAO and MS production induces CCL2Previously, we found that RB inactivation induced the

enhanced secretion of several cytokines such as IL6 in breastcancer cell lines through enhanced MS production (17). In brief,the transcription of mitochondria-related genes especially relatedto fatty acid oxidation (FAO) such as CPT1 is upregulated due toderegulation of E2F activity following RB inactivation. CPT1provides a rate-limiting step in long-chain fatty acid oxidation.CPT1 controls transportation of long-chain fatty acids into mito-chondria. Long-chain fatty acids transported into mitochondriaare used for b-oxidation. Consistent with higher expression ofFAO-related genes, RB-depleted cells showed an elevated oxygenconsumption rate upon palmitate stimulation and also an

Table 1. Pathway analysis using KEGG of genes upregulated by Rb depletion in53KOSTS cells

KEGG pathway term P Bonferroni Benjamini

Steroid biosynthesis 2.32E-05 1.60E-03 1.60E-03Cytokine–cytokine receptor interaction 8.67E-04 5.81E-02 2.95E-02NOD-like receptor signaling pathway 3.84E-03 2.33E-01 8.46E-02Chemokine signaling pathway 4.07E-02 9.43E-01 5.12E-01

Li et al.





Figure 3.

Tumor progression induced by Rb depletion depends on Ccl2–Ccr2 axis. A, A schematic drawing of ELISA for serum derived from Ccl2 KO C57BL/6mouse. B,ELISA of mouse Ccl2 levels in serum derived from tumor-bearing Ccl2 KO C57BL/6 mouse. Ccl2 concentration in serumwas normalized by tumor weight (n¼ 7).C,A schematic drawing of subcutaneous tumor implantation of 53KOSTS cells in Ccr2WT or KO C57BL/6mice. D, Representative pictures of tumors derivedfrom 53KOSTS cells transduced with the indicated shRNA. A total of 3� 105 cells were injected subcutaneously into Ccr2WT or KO C57BL/6mice (day 17). Scalebar, 10 mm. Tumors were weighed (right; n¼ 7). E, IHC analysis of the indicated protein in tumors derived from 53KOSTS cells transduced with the indicatedshRNA. Scale bar, 100 mm. CD31 or Gr-1þ cells were quantified (right; n¼ 3). F and G, The profiles (% in CD45þ cells) of F4/80þ cells (F) or Gr-1þ/CD11bþ cells (G)in tumors derived from 53KOSTS cells transduced with the indicated shRNA (n > 4). The insets show Gr1/CD11b double-positive cells (G).H, The 4� 105 cellswere injected subcutaneously into C57BL/6 mice. Tumors were analyzed at day 14. Ccr2 expression in CD45� or CD45þ/Gr1þ/CD11bþ cells in the TME. I,Representative pictures of tumors derived from 53KOSTS cells transduced with the indicated shRNA or sgRNA. Scale bar, 10 mm. Tumors were weighed (right;n¼ 5). J, IHC analysis of the indicated protein in tumors derived from 53KOSTS cells transduced with the indicated shRNA or sgRNA. Gr-1þ cells were quantified(right; n¼ 5). K, The proportion of Gr-1þ/CD11bþ cells in tumors derived from 53KOSTS cells transduced with the indicated shRNA or sgRNA (n¼ 10). n.s., notsignificant; � , P < 0.05; �� , P < 0.01.






elevatedMS production (17). In the same previous work (17), wedemonstrated that RB inactivation significantly decreasemalonyl-CoA level. This finding was highly consistent with elevated FAObecause malonyl-CoA strongly suppresses FAO through inhibi-tion of CPT1. However, why malonyl-CoA level drops followingRB inactivation was not fully cleared in the previous study. In thiswork, we discovered that RB loss increases the phosphorylation ofAMP-activated protein kinase (AMPK) and one of its substrates

acetyl-CoA carboxylase (ACC; Fig. 5A). ACC plays a crucial rolein regulating FAO. The malonyl-CoA, which is generated byACC, specifically inhibits the CPT1 activation. The phosphor-ylated AMPK phosphorylates and thus inactivates ACC. There-fore, upon AMPK phosphorylation, the level of malonyl-CoAdrops, leading to increased activity of CPT1. The RB–AMPK–ACC axis may provide a possible pathway whereby RB lossincreases FAO.

Figure 4.

CCL2 is upregulated following Rb depletion in human breast cancer cells. A, Heatmap indicating fold change of CC chemokines following Rb depletion in MCF7cells based on DNAmicroarray analysis. B, qRT-PCR of the indicated gene in RB-positive breast cancer cell lines transduced with the indicated shRNA (n > 3).#1 and #2, independent shRNA. C, qRT-PCR of the indicated gene in patient-derived primary breast cancer cells transduced with the indicated shRNA (n¼ 3). D,ELISA of human CCL2 and CCL5 levels in MCF7 cells transduced with the indicated shRNA following 48-hour culture (n¼ 3). N.D., not detected. E, qRT-PCR ofthe indicated gene in MCF7 cells transduced with the indicated vector (n¼ 3). Lac, LacZ. 7LP: RB7LP. F, Correlation between RB and CCL2 or CCL5 expressionaccording to CCLE database. r and P values based on Pearson correlation. G, The number of THP1 cells migrated into the lower compartment of themicrochemotaxis chamber containing conditioned medium derived fromMCF7 cells transduced with the indicated shRNAwith or without 20 mg/mL anti–CCL2-neutralizing antibody. n.s., not significant; � , P < 0.05; ��, P < 0.01.

Li et al.





To further understand whether the induction of CCL2 andCCL5 following RB depletion depends on MS, we first analyzedthe association between CCL2 or CCL5 expression and MSproduction in a variety of breast cancer cell lines, noting thatCCL2, but not CCL5, showed a significant positive correlationwith MS production (Fig. 5B). Moreover, consistent with ourprevious study (17), MS production was significantly upregu-lated following RB depletion in multiple breast cancer cell linesexcept MDA-MB-231 (Fig. 5C) in which CCL2 was not upre-gulated by RB depletion (Fig. 4B). To examine whether higherMS production in RB-depleted cells directly contributes tohigher CCL2 production, we treated MCF7 cells with severalantioxidants such as N-acetyl cysteine (NAC), Trolox, andmitochondria-targeted antioxidant MitoQ, and found thatCCL2 production was, at least in part, dependent on MS(Fig. 5D). However, CCL5 induction following RB depletionwas not antagonized upon treatment with antioxidants (Sup-plementary Fig. S2C). In addition, treatment with trifluoro-methoxy carbonylcyanide phenylhydrazone (FCCP), a potentuncoupler of oxidative phosphorylation in mitochondriaknown to induce MS production, strongly induced CCL2, butnot CCL5 expression, to the same degree as RB depletion inMCF7 cells (Fig. 5E; Supplementary Fig. S2D). Collectively,these data suggest that enhanced MS production following RBinactivation induces CCL2 expression. Finally, as we previously

reported that enhanced cytokine secretion following RB inac-tivation was mediated by JNK activation, we verified the JNKdependency of CCL2 induction by treatment with JNK inhib-itor SP600125 (Fig. 5F) or introduction of a dominant negativeform of c-JUN (Fig. 5G and H).

Ccr2�/� background antagonizes in vivo mammarycarcinogenesis induced by Rb deficiency

To examine whether the RB–CCL2 axis is involved in carci-nogenesis induced by RB deficiency, we analyzed mouse mam-mary carcinogenesis in vivo using MMTV-Cre;Rbflox/flox micewith various Ccr2 genetic backgrounds, including Ccr2þ/þ,Ccr2þ/�, and Ccr2�/�. Previously, several groups have reportedthat MMTV-Cre;Rbflox/flox female mice develop focal hyper-plastic lesions in the mammary glands. (29, 30). As expected,the percentage of PCNA-positive cells in the mammary glandsof MMTV-Cre;Rbflox/flox; Ccr2þ/þ nulliparous mice (45.3 �13.3%) at an average age of examination of 429 � 13.2 dayswas dramatically higher than that of wild-type C57BL/6 mice ata similar age (6.5 � 3.0%). Importantly, the percentage ofPCNA-positive cells in mammary glands was lower in Ccr2�

(17.8 � 2.0%) and Ccr2�/� (4.5 � 5.0%) backgrounds at asimilar age (Fig. 6A; Supplementary Fig. S2E). Overall survivaldid not show statistically significant differences amongCcr2þ/þ, Ccr2�, and Ccr2�/� backgrounds (Supplementary

Figure 5.

Enhanced MS production following RB depletion induces CCL2 but not CCL5. A, Immunoblot of the indicated proteins in MCF7 cells transduced with theindicated shRNA. B, Correlation between MS levels and CCL2 or CCL5 expression in breast cancer cell lines (MCF7, HCC1187, Hs578t, MDA-MB-231, MDA-MB-436,MDA-MB-468, and HCC70). r and P values based on Pearson correlations. C,MS levels in RB-positive breast cancer cell lines transduced with the indicated shRNA(n¼ 4). D, qRT-PCR of the indicated gene in MCF7 cells transduced with the indicated shRNA, treated with 5 mmol/L NAC, 100 mmol/L trolox, or 5 nmol/Lmitoquinone for 24 hours (n¼ 3). E, qRT-PCR of the indicated gene in MCF7 cells transduced with the indicated shRNA, and treated with 1 mmol/L DMSO (DM) or1 mmol/L FCCP (FC) for 4 hours (n¼ 3). F, qRT-PCR of the indicated gene in MCF7 transduced with the indicated shRNA and treated with or without 20 mmol/LSP600125 (SP) for 4 hours (n¼ 3). G,MCF7 cells transduced with the indicated lentiviral vectors observed under phase contrast or fluorescence microscope.Scale bar, 100 mm. H, qRT-PCR of the indicated gene in MCF7 cells transduced with the indicated shRNA and the indicated lentiviral expression vector (n¼ 3).DN, dominant negative c-Jun.






Figure 6.

Activation of Ccl2–Ccr2 pathway is required for mammary carcinogenesis induced by Rb deficiency. A, IHC analysis of the indicated protein in MMTV-Cre; Rbf/f;Ccr2WT or KO, or C57BL/6 (WT) mammary glands (>400 days). Scale bar, 50 mm. PCNA-positive cells in mammary glands were quantified (n > 3). Insets showhigher magnification of mammary gland. B, Representative pictures of whole-mount carmine alum staining of MMTV-Cre; Rbf/f; Ccr2WT or KO, or C57BL/6 (WT)mammary glands (> 400 days). Scale bar, 5 mm (left), 500 mm (middle), and 100 mm (right). LN, lymph node. C, IHC analysis of the indicated protein in MMTV-Cre; Rbf/f; Ccr2WT or KO, or C57BL/6 (WT) mammary glands (>400 days). Scale bar, 50 mm. CCL2-positive area in mammary glands was quantified (n > 7).Insets show higher magnification of mammary gland. D, Immunofluorescence analysis of the indicated protein in MMTV-Cre; Rbf/f; Ccr2WT or KO, or C57BL/6(WT) mammary glands (>400 days). Scale bar, 50 mm. F4/80þ cells in mammary glands were quantified (n > 3). Insets show higher magnification of mammarygland. n.s., not significant; �� , P < 0.01.

Li et al.





Fig. S2F). We did not observe palpable mammary tumors inmice with any background. Upon autopsy, we frequentlyobserved lymphoma (Supplementary Fig. S2G), which mayexplain relatively shorter survival of MMTV-Cre;Rbflox/flox mice(around 16 months). Although not frequently, we observedhepatic and thyroid tumors (Supplementary Fig. S2H and SI).These findings are consistent with nonmammary tissue-specificactivation of the MMTV promoter (31).

Consistent with higher PCNA signal, MMTV-Cre;Rbflox/flox;Ccr2þ/þ nulliparous mice mammary glands examined at 436 �40.2 days frequently exhibited hyperplastic features uponwhole-mount carmine alum staining and hematoxylin andeosin staining, whereasMMTV-Cre;Rbflox/flox;Ccr2�/� mammaryglands at a similar age exhibited morphologies reminiscent ofthose of wild-type C57BL/6 mice at a similar age (Fig. 6B;Supplementary Fig. S2J). More accurately, we examined mam-mary gland of 14 MMTV-Cre;Rbflox/flox;Ccr2þ/þ mice, and 11 ofthem (78.6%) showed hyperplastic phenotype. However, in 22MMTV-Cre;Rbflox/flox;Ccr2�/�mice, we observed no (0%) hyper-plastic phenotype. Furthermore, the infiltration of F4/80þ

macrophages into mammary glands was significantly upregu-lated in MMTV-Cre;Rbflox/flox;Ccr2þ/þ but not in the Ccr2�/�

background, even though CCL2 expression in mammary glandswas upregulated following RB deletion both in Ccr2þ/þ andCcr2�/� backgrounds (Fig. 6C and D). Taken together, thesedata suggest that activation of the Ccl2–Ccr2 pathway inmammary glands via enhanced Ccl2 secretion is required forcarcinogenesis induced by Rb deficiency.

DiscussionHere, we provide novel evidence indicating that RB inacti-

vation in tumor cells results in the formation of a protumoralmicroenvironment by promoting angiogenesis and recruitmentof TAMs or immunosuppressive cells such as MDSCs intothe TME. By using a syngeneic and orthotropic murine soft-tissue sarcoma model, and confirming these findings in asecond murine mammary carcinogenesis model, we demon-strated that CCL2 induction following RB inactivation in tumorcells and subsequent activation of the CCL2–CCR2 axis in theTME accelerates tumor progression. CCL2 has been shown toplay a critical role in tumor progression in various cancertypes including breast cancer via macrophage recruitment intothe TME (32, 33). Macrophages in the TME support tumorgrowth via multiple mechanisms, including the secretion ofgrowth factors and the promotion of angiogenesis (34). Inaddition to the proliferative advantage imparted to tumors,elevated CCL2 secretion contributes to the formation of animmunosuppressive TME via MDSCs and Tregs recruitment,and results in the evasion of cytotoxic T cells (35). Despitemany studies that identify CCL2 as a protumorigenic chemo-kine, the therapeutic effect of blocking the CCL2–CCR2 axis viatreatment with a neutralizing antibody, for example, has beendisappointing in clinical trials (36–38). Thus, to achieve thetherapeutic benefits of CCL2-CCR2 blockade, we must under-stand the regulatory mechanisms of CCL2 and determine whichpatient subtypes respond to this therapy (i.e., which tumormutations and gene expression signatures are susceptible toCCL2 blockade).

According to our findings that demonstrate the functionalrelevance between the RB and CCL2–CCR2 axis, aberrant RB

expression in certain tumor types might act as a possible markerfor the development of an effective therapy by CCL2-CCR2blockade. Currently, it is thought that the CCL2-CCR2 blockadeexhibits tumor-suppressive function, at least in part, by enhancingthe antitumoral function of the TME via inhibition of the infil-tration of immunosuppressive cells (1). TNBC is a highly hetero-geneous subtype compared with others such as ER-positive orHER2-positive breast cancer (39). RB inactivation by genetic andepigenetic factors and significantly higher CCL2 levels is frequent-ly found in this aggressive subtype (40, 41). Although TNBC issensitive to chemotherapy, the overall outcomes of TNBC areworse in patients with breast cancer because of the lack oftargetable molecules such as ER and HER2 (39). Thus, immuno-therapy including ICB treatment is emerging as a promising newoption for patients with TNBC, but there are no establishedprognosis markers to estimate its efficacy. Our current studyrevealed that RB inactivation via genetic mutation or transcrip-tional suppression via DNA hypermethylation in the RB genepromoter in patients with TNBC could be a potential marker forboth CCL2-CCR2 blockade efficacy and poor immunogenicity inTNBC, and anti-CCL2 treatment might enhance therapeutic effectof ICB treatment. However, it is now becoming clear that theaccumulation of DNA damage in tumors resulting from defects inthe DNA repair pathway, DNA-damaging chemotherapy, and/orradiotherapy is associated with immunogenic cell death andneoantigen production, promoting an antitumor immuneresponse (42–44). It is possible that increased genomic instabilityand subsequent responses to DNA damage in RB-inactivatedcancer cells might potentiate the efficacy of immunotherapy, butfurther research is needed to uncover how RB inactivation alterstumor immunogenicity in both cell-autonomous and non–cell-autonomous manners.

Tumor angiogenesis in the TME is crucial for tumor progres-sion (26). By using a syngeneic and orthotropicmurine soft-tissuesarcoma model with a Ccr2-null background, we demonstratedthat Rb inactivation in cancer cells promotes aberrant angiogen-esis through the activation of the Ccl2–Ccr2 axis in the TME. Inparticular, RB inactivation–dependent infiltration of TAMs intothe TME is clearly suppressed in Ccr2 KOmice. TAMs secrete highlevels of angiogenic factors including Vegfa, leading to neovas-cularization in the TME. Because Rb inactivation also inducesVegfa secretion from tumor cells themselves (24), RB mightregulate tumor angiogenesis via both cell-intrinsic and cell-extrinsic mechanisms.

In our previous study (17), we partially clarified the mech-anism whereby RB inactivation leads to increased production ofIL6 via increased FAO activity and MS production. We disclosedthat RB inactivation increased the expression of a number ofgenes involved in FAO in an E2F-dependent manner, thereforeincreased oxidative metabolism leads to increased MS produc-tion and JNK activation. JNK activation is critical for IL6secretion. In addition, we demonstrated that malonyl-CoAlevel drops following RB inactivation. This finding is the mostconsistent with increased FAO, because malonyl-CoA is thestrongest suppressor of FAO (17). However, in the previouswork, we did not clarify why malonyl-CoA level drops follow-ing RB inactivation. In this work, we provided evidence thatincreased CCL2 secretion following RB inactivation is due toelevated FAO activity and MS production similar to in the caseof IL6. Moreover, we linked RB inactivation to downregulationof malonyl-CoA by AMPK and ACC. RB inactivation






dramatically increased AMPK phosphorylation (Fig. 5A). Phos-phorylated AMPK phosphorylates ACC. Phosphorylated ACCloses its activity to synthesize malonyl-CoA from acetyl-CoA.Decrease in malonyl-CoA allows CPT1 to transport long-chainfatty acids into mitochondria for FAO. Why RB loss increasesAMPK phosphorylation is currently under investigation. We aredetermining ATP/AMP and NADþ/NADH ratio in cells beforeand after RB depletion (45). In addition, RB has been suggestedto be involved in various facets of cellular metabolism (46).Further study would be necessary to thoroughly determine themechanism of RB–AMPK axis.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: F. Li, S. Kitajima, C. TakahashiDevelopment of methodology: F. Li, S. Kohno, N. Okada, C. TakahashiAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): F. Li, S. Kitajima, S. Kohno, A. Yoshida, S. Tange,S. Sasaki, Y. Nishimoto, H. Muranaka, N. Nagatani, M. Suzuki, T. Nishiuchi,T. Tanaka, N. MukaidaAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): F. Li, S. Kitajima, S. Kohno, S. Tange, T. Tanaka,C. Takahashi

Writing, review, and/or revision of the manuscript: F. Li, S. Kitajima,H. Muranaka, T. Tanaka, D.A. Barbie, N. Mukaida, C. TakahashiAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S. Kitajima, N. Okada, H.Muranaka, S. Masuda,T.C. Thai, C. TakahashiStudy supervision: S. Kitajima, C. Takahashi

AcknowledgmentsWe thank Dr. T. Baba for technical instruction and useful discussion,

Dr. N. Mahadevan for pathologic diagnosis, and Mr. S. Sundararaman forcritical reading of the manuscript. This work was supported by FundingProgram for Next Generation World-Leading Researchers LS049 (toC. Takahashi), Grant-in-Aid for Scientific Research on Innovative Areas15H01487 and 17H05615 (to C. Takahashi), Grant-in-Aid for ScientificResearch 17H03576 (to C. Takahashi) and 25830077 (to S. Kitajima),Hokuriku Bank Research Grant for Young Scientist (to S Kitajima), theUehara Memorial Foundation Post-Doctoral Fellowship (to S. Kitajima), theStrategic Young Researcher Overseas Visit Program for Accelerating BrainCirculation (to S. Kitajima), and JSPS Postdoctoral Fellowship for ResearchAbroad (to S. Kitajima).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received November 19, 2018; revised April 27, 2019; accepted June 7, 2019;published first June 12, 2019.

References1. Binnewies M, Roberts EW, Kersten K, Chan V, Fearon DF, Merad M, et al.

Understanding the tumor immunemicroenvironment (TIME) for effectivetherapy. Nat Med 2018;24:541–50.

2. Wei SC, Duffy CR, Allison JP. Fundamental mechanisms of immunecheckpoint blockade therapy. Cancer Discov 2018;8:1069–86.

3. Li Z, Qiu Y, Lu W, Jiang Y, Wang J. Immunotherapeutic interventions oftriple negative breast cancer. J Transl Med 2018;16:147.

4. Manguso RT, Pope HW, Zimmer MD, Brown FD, Yates KB, Miller BC, et al.In vivo CRISPR screening identifies Ptpn2 as a cancer immunotherapytarget. Nature 2017;547:413–8.

5. PanD, Kobayashi A, Jiang P, Ferrari de Andrade L, Tay RE, Luoma AM, et al.A major chromatin regulator determines resistance of tumor cells to T cell-mediated killing. Science 2018;359:770–5.

6. Miao D, Margolis CA, Gao W, Voss MH, Li W, Martini DJ, et al. Genomiccorrelates of response to immune checkpoint therapies in clear cell renalcell carcinoma. Science 2018;359:801–6.

7. Shin DS, Zaretsky JM, Escuin-Ordinas H, Garcia-Diaz A, Hu-Lieskovan S,Kalbasi A, et al. Primary resistance to PD-1 blockade mediated by JAK1/2mutations. Cancer Discov 2017;7:188–201.

8. Zaretsky JM, Garcia-Diaz A, Shin DS, Escuin-Ordinas H, Hugo W, Hu-Lieskovan S, et al. Mutations associated with acquired resistance to PD-1blockade in melanoma. N Engl J Med 2016;375:819–29.

9. Patel SJ, Sanjana NE, Kishton RJ, Eidizadeh A, Vodnala SK, Cam M, et al.Identification of essential genes for cancer immunotherapy. Nature 2017;548:537–42.

10. Spranger S, Gajewski TF.Impact of oncogenic pathways on evasion ofantitumour immune responses. Nat Rev Cancer 2018;18:139–47.

11. Sumimoto H, Imabayashi F, Iwata T, Kawakami Y. The BRAF-MAPKsignaling pathway is essential for cancer-immune evasion in humanmelanoma cells. J Exp Med 2006;203:1651–6.

12. Pylayeva-Gupta Y, LeeKE,HajduCH,MillerG, Bar-SagiD.Oncogenic Kras-induced GM-CSF production promotes the development of pancreaticneoplasia. Cancer Cell 2012;21:836–47.

13. Bayne LJ, Beatty GL, Jhala N, Clark CE, Rhim AD, Stanger BZ, et al. Tumor-derived granulocyte-macrophage colony-stimulating factor regulates mye-loid inflammation and T cell immunity in pancreatic cancer. Cancer Cell2012;21:822–35.

14. Koyama S, Akbay EA, Li YY, Aref AR, Skoulidis F, Herter-Sprie GS, et al.STK11/LKB1 deficiency promotes neutrophil recruitment and proinflam-

matory cytokine production to suppress T-cell activity in the lung tumormicroenvironment. Cancer Res 2016;76:999–1008.

15. Peng W, Chen JQ, Liu C, Malu S, Creasy C, Tetzlaff MT, et al. Loss of PTENpromotes resistance to T cell-mediated immunotherapy. Cancer Discov2016;6:202–16.

16. Yoshida A, Kitajima S, Li F, Cheng C, Takegami Y, Kohno S, et al. Micro-RNA-140 mediates RB tumor suppressor function to control stem cell-likeactivity through interleukin-6. Oncotarget 2017;8:13872–85.

17. Kitajima S, Yoshida A, Kohno S, Li F, Suzuki S, Nagatani N, et al. The RB-IL-6 axis controls self-renewal and endocrine therapy resistance byfine-tuningmitochondrial activity. Oncogene 2017;36:5145–57.

18. Tsukada T, Tomooka Y, Takai S, Ueda Y, Nishikawa S, Yagi T, et al.Enhanced proliferative potential in culture of cells from p53-deficientmice. Oncogene 1993;8:3313–22.

19. KuzielWA,Morgan SJ, Dawson TC,Griffin S, SmithiesO, LeyK, et al. Severereduction in leukocyte adhesion and monocyte extravasation in micedeficient in CC chemokine receptor 2. Proc Natl Acad Sci U S A 1997;94:12053–8.

20. Hinohara K, Kobayashi S, KanauchiH, Shimizu S, Nishioka K, Tsuji E, et al.ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammo-sphere formation in human breast cancer. Proc Natl Acad Sci U S A2012;109:6584–9.

21. Sato T, IshikawaM,MochizukiM,OhtaM,OhkuraM,Nakai J, et al. JSAP1/JIP3 and JLP regulate kinesin-1-dependent axonal transport to preventneuronal degeneration. Cell Death Differ 2015;22:1260–74.

22. Kanai A, Suzuki K, Tanimoto K, Mizushima-Sugano J, Suzuki Y, Sugano S.Characterization of STAT6 target genes in humanB cells and lung epithelialcells. DNA Res 2011;18:379–92.

23. Kitajima S, Miki T, Takegami Y, Kido Y, Noda M, Hara E, et al. Reversion-inducing cysteine-rich protein with Kazal motifs interferes with epidermalgrowth factor receptor signaling. Oncogene 2011;30:737–50.

24. Lasorella A, Rothschild G, Yokota Y, Russell RG, Iavarone A. Id2 mediatestumor initiation, proliferation, and angiogenesis in Rb mutant mice.Mol Cell Biol 2005;25:3563–74.

25. Kumar V, Patel S, Tcyganov E, Gabrilovich DI. The nature of myeloid-derived suppressor cells in the tumormicroenvironment. Trends Immunol2016;37:208–20.

26. De Palma M, Biziato D, Petrova TV. Microenvironmental regulation oftumour angiogenesis. Nat Rev Cancer 2017;17:457–74.

Li et al.





27. Ciriello G, Gatza ML, Beck AH, Wilkerson MD, Rhie SK, Pastore A, et al.Comprehensive molecular portraits of invasive lobular breast cancer. Cell2015;163:506–19.

28. Knudsen ES, Wang JY.Dual mechanisms for the inhibition of E2F bindingto RB by cyclin-dependent kinase-mediated RB phosphorylation. Mol CellBiol 1997;17:5771–83.

29. Jiang Z, Deng T, Jones R, Li H, Herschkowitz JI, Liu JC, et al. Rb deletionin mouse mammary progenitors induces luminal-B or basal-like/EMTtumor subtypes depending on p53 status. J Clin Invest 2010;120:3296–309.

30. Cheng L, ZhouZ, Flesken-Nikitin A, Toshkov IA,WangW,Camps J, et al. Rbinactivation accelerates neoplastic growth and substitutes for recurrentamplification of cIAP1, cIAP2 and Yap1 in sporadic mammary carcinomaassociated with p53 deficiency. Oncogene 2010;29:5700–11.

31. Wagner KU, McAllister K, Ward T, Davis B, Wiseman R, Hennighausen L.Spatial and temporal expression of the Cre gene under the control of theMMTV-LTR in different lines of transgenic mice. Transgenic Res 2001;10:545–53.

32. Qian BZ, Li J, Zhang H, Kitamura T, Zhang J, Campion LR, et al. CCL2recruits inflammatory monocytes to facilitate breast-tumour metastasis.Nature 2011;475:222–5.

33. Lu X, Kang Y. Chemokine (C-C motif) ligand 2 engages CCR2þ stromalcells of monocytic origin to promote breast cancer metastasis to lung andbone. J Biol Chem 2009;284:29087–96.

34. Mantovani A, Marchesi F, Malesci A, Laghi L, Allavena P. Tumour-associated macrophages as treatment targets in oncology. Nat Rev ClinOncol 2017;14:399–416.

35. Chang AL, Miska J, Wainwright DA, Dey M, Rivetta CV, Yu D, et al. CCL2produced by the gliomamicroenvironment is essential for the recruitmentof regulatory T cells and myeloid-derived suppressor cells. Cancer Res2016;76:5671–82.

36. Sandhu SK, Papadopoulos K, Fong PC, Patnaik A, Messiou C, Olmos D,et al. A first-in-human, first-in-class, phase I study of carlumab (CNTO

888), a human monoclonal antibody against CC-chemokine ligand 2 inpatients with solid tumors. Cancer Chemother Pharmacol 2013;71:1041–50.

37. VelaM, ArisM, LlorenteM, Garcia-Sanz JA, Kremer L. Chemokine receptor-specific antibodies in cancer immunotherapy: achievements and chal-lenges. Front Immunol 2015;6:12.

38. Brana I, Calles A, LoRusso PM, Yee LK, Puchalski TA, Seetharam S, et al.Carlumab, an anti-C-C chemokine ligand 2 monoclonal antibody, incombination with four chemotherapy regimens for the treatment ofpatients with solid tumors: an open-label, multicenter phase 1b study.Target Oncol 2015;10:111–23.

39. Bianchini G, Balko JM, Mayer IA, Sanders ME, Gianni L. Triple-negativebreast cancer: challenges and opportunities of a heterogeneous disease.Nat Rev Clin Oncol 2016;13:674–90.

40. Cancer Genome Atlas Network. Comprehensive molecular portraits ofhuman breast tumours. Nature 2012;490:61–70.

41. Dutta P, SarkissyanM, Paico K,Wu Y, Vadgama JV.MCP-1 is overexpressedin triple-negative breast cancers and drives cancer invasiveness and metas-tasis. Breast Cancer Res Treat 2018;170:477–86.

42. Brown JS, Sundar R, Lopez J. Combining DNA damaging therapeutics withimmunotherapy: more haste, less speed. Br J Cancer 2018;118:312–24.

43. Patel SA, Minn AJ. Combination cancer therapy with immune checkpointblockade: mechanisms and strategies. Immunity 2018;48:417–33.

44. Gotwals P, Cameron S, Cipolletta D, Cremasco V, Crystal A, Hewes B, et al.Prospects for combining targeted and conventional cancer therapy withimmunotherapy. Nat Rev Cancer 2017;17:286–301.

45. Lan F, Cacicedo JM, Ruderman N, Ido Y. SIRT1 modulation of theacetylation status, cytosolic localization, and activity of LKB1. Possiblerole in AMP-activated protein kinase activation. J Biol Chem 2008;283:27628–35.

46. Kitajima S, Takahashi C. Intersection of retinoblastoma tumor suppressorfunction, stem cells, metabolism, and inflammation. Cancer Sci 2017;108:1726–31.






2019;79:3903-3915. Published OnlineFirst June 12, 2019.Cancer Res Fengkai Li, Shunsuke Kitajima, Susumu Kohno, et al. Microenvironment via Enhanced CCL2 SecretionRetinoblastoma Inactivation Induces a Protumoral

Updated version

10.1158/0008-5472.CAN-18-3604doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2019/06/12/0008-5472.CAN-18-3604.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/79/15/3903.full#ref-list-1

This article cites 46 articles, 14 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/79/15/3903To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-18-3604

http://cancerres.aacrjournals.org/content/suppl/2019/06/12/0008-5472.CAN-18-3604.DC1

http://cancerres.aacrjournals.org/content/79/15/3903.full#ref-list-1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/79/15/3903


Documents

RetinoblastomaInactivationInducesaProtumoral ... · in the tumor microenvironment, linking retinoblastoma loss to immunosuppression. Introduction The tumor microenvironment (TME)