1

A B Supplementary Figure 2 CAF 4 37.6% 90.8% PDPN + cells 0.44% PDPN - cells CAF1 CAF 2 CAF 3 + CAF 3 - CAF 4 + CAF4 - 0 0.1 0.2 0.3 PDPN/18S PDPN high low

Supplementary Figure 2

Download PPTX Report

Upload
moriah
View
21
Download
0

Embed Size (px)

DESCRIPTION

Supplementary Figure 2. PDPN + cells. A. 90.8%. CAF 4. 37.6%. PDPN - cells. 0.44%. low. PDPN. high. B. - PowerPoint PPT Presentation

Citation preview

Page 1: Supplementary Figure 2

A

B

Supplementary Figure 2

CAF 4

37.6%

90.8%

PDPN + cells

0.44%

PDPN - cells

CAF1 CAF2 CAF3 +

CAF3 -

CAF4 +

CAF4 -

0

0.1

0.2

0.3

PDPN/18S

PDPN high low

Figure S1 : Toya et al. - images.nature.com · SUPPLEMENTARY INFORMATION. 2 . Figure S2. Control experiments. (a) Control experiments for the phspho-specific AIR-1 antibody

Figure S1 : Toya et al. - images.nature.com · SUPPLEMENTARY INFORMATION. 2 . Figure S2. Control experiments. (a) Control experiments for the phspho-specific AIR-1 antibody

Documents

Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Documents

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Documents

Supplementary Information Spiking Neurons with ...10.1038... · Duan et al. 2 . Supplementary Figure 1. Structure of the NbO x threshold switching device. (a) SEM image. Scale bar,

Supplementary Information Spiking Neurons with ...10.1038... · Duan et al. 2 . Supplementary Figure 1. Structure of the NbO x threshold switching device. (a) SEM image. Scale bar,

Documents

Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

Documents

Supplementary Materials - Cancer Research...2011/02/07 · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Supplementary Materials - Cancer Research...2011/02/07 · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Documents

Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Documents

Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7

Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7

Documents

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

Documents

Supplementary Figure 1

Supplementary Figure 1

Documents

Supplementary Figures - Beijing Normal Universitysss.bnu.edu.cn/~wenxuw/publications/NC_Reconstruct_SI.pdf · Supplementary Figure 10 | Difference between ln(1 − P01 i ) and ln(1

Supplementary Figures - Beijing Normal Universitysss.bnu.edu.cn/~wenxuw/publications/NC_Reconstruct_SI.pdf · Supplementary Figure 10 | Difference between ln(1 − P01 i ) and ln(1

Documents

5 15 25 20 10 Ct value Log concentration miR-375 miR-221 Supplementary Figure S1

5 15 25 20 10 Ct value Log concentration miR-375 miR-221 Supplementary Figure S1

Documents

Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Documents

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Documents

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Documents

0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

Documents

Supplementary Figure 2: PBX1 induces morphological and cytoskeletal changes consistent with differentiation in NB. A) Morphology of SHSY5Y cells. Cells

Supplementary Figure 2: PBX1 induces morphological and cytoskeletal changes consistent with differentiation in NB. A) Morphology of SHSY5Y cells. Cells

Documents

A B C 3500x8900x 5600x14 000x 1500x5000x Supplementary Figure 1 TiO 2 Carbon black SWCNT

A B C 3500x8900x 5600x14 000x 1500x5000x Supplementary Figure 1 TiO 2 Carbon black SWCNT

Documents

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Documents

Supplementary Information (Aoki, K. et al., Chromosomal ...10.1038...Supplementary Figure 1 Karyotype analysis of the wild-type and Wnt signal-activated (β-cateninΔex3 and Apc–/–)

Supplementary Information (Aoki, K. et al., Chromosomal ...10.1038...Supplementary Figure 1 Karyotype analysis of the wild-type and Wnt signal-activated (β-cateninΔex3 and Apc–/–)

Documents

Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to

Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to

Documents

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Documents

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Documents

-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

Documents

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Documents

Supplementary Figure 1: NOON State Device Con guration ......Supplementary Figure 1: NOON State Device Con guration. This microscope image of the NOON state device shows how the Mach-Zehnder

Supplementary Figure 1: NOON State Device Con guration ......Supplementary Figure 1: NOON State Device Con guration. This microscope image of the NOON state device shows how the Mach-Zehnder

Documents

Supplementary Figure S2

Supplementary Figure S2

Documents

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Documents

Figure S1 · 2020. 12. 15. · 1 1 Supplementary Figures 2 3 Figure S1. PPARg expression attenuated the production of cleaved IL-1b in NLRP3 in- 4 flammasome reconstituted HEK293T

Figure S1 · 2020. 12. 15. · 1 1 Supplementary Figures 2 3 Figure S1. PPARg expression attenuated the production of cleaved IL-1b in NLRP3 in- 4 flammasome reconstituted HEK293T

Documents

Supplementary Figure 2

Supplementary Figure 2

Documents