1
Supplementary Figure 2. Supplementary Figure 2. Subcellular localization of OsCAF1–GUS fusion proteins in onion epidermal cells. GUS activity in onion epidermal cells that expressed a GUS cDNA fused to downstream of OsCAF1 genes, respectively. GUS activity was observed by a confocal microscope. Nuclei are indicated by white arrows. Scale bar = 50 μm. OsCAF1A– GUS OsCAF1B (L)–GUS OsCAF1G– GUS OsCAF1H– GUS GUS

Supplementary Figure 2

  • Upload
    dorjan

  • View
    24

  • Download
    3

Embed Size (px)

DESCRIPTION

Supplementary Figure 2. GUS. OsCAF1A – GUS. OsCAF1B (L) – GUS. OsCAF1G – GUS. OsCAF1H – GUS. - PowerPoint PPT Presentation

Citation preview

Page 1: Supplementary Figure 2

Supplementary Figure 2.

Supplementary Figure 2. Subcellular localization of OsCAF1–GUS fusion proteins in onion epidermal cells. GUS activity in onion epidermal cells that expressed a GUS cDNA fused to downstream of OsCAF1 genes, respectively. GUS activity was observed by a confocal microscope. Nuclei are indicated by white arrows. Scale bar = 50 μm.

OsCAF1A–GUS

OsCAF1B (L)–GUS

OsCAF1G–GUS

OsCAF1H–GUS

GUS

Figure S1 : Toya et al. - images.nature.com · SUPPLEMENTARY INFORMATION. 2 . Figure S2. Control experiments. (a) Control experiments for the phspho-specific AIR-1 antibody

Figure S1 : Toya et al. - images.nature.com · SUPPLEMENTARY INFORMATION. 2 . Figure S2. Control experiments. (a) Control experiments for the phspho-specific AIR-1 antibody

Documents
Supplementary Figure S2

Supplementary Figure S2

Documents
Supplementary Materials - Cancer Research...2011/02/07  · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Supplementary Materials - Cancer Research...2011/02/07  · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Documents
Supplementary Figure 1. Confirmation of knockdown ... · Supplementary Figure 11. Basal MyoII oscillation is inhibited by the light-induced Talin-GFP clustering. a, c. Time-lapse

Supplementary Figure 1. Confirmation of knockdown ... · Supplementary Figure 11. Basal MyoII oscillation is inhibited by the light-induced Talin-GFP clustering. a, c. Time-lapse

Documents
Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Documents
Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization

Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization

Documents
Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Documents
Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Documents
Supplementary Figure 1

Supplementary Figure 1

Documents
Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Documents
Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db

Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db

Documents
0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

Documents
Supplementary Figure S1: Dictyosteliumyusukeman.org/Supplement_Tractionforce.pdf · Supplementary Figure S2: (a)-(d) Changes in the distribution of the forces exerted by a vegetative

Supplementary Figure S1: Dictyosteliumyusukeman.org/Supplement_Tractionforce.pdf · Supplementary Figure S2: (a)-(d) Changes in the distribution of the forces exerted by a vegetative

Documents
Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Documents
Supplementary Figure 1: NOON State Device Con guration ......Supplementary Figure 1: NOON State Device Con guration. This microscope image of the NOON state device shows how the Mach-Zehnder

Supplementary Figure 1: NOON State Device Con guration ......Supplementary Figure 1: NOON State Device Con guration. This microscope image of the NOON state device shows how the Mach-Zehnder

Documents
Supplementary Figure 1 - Purdue University · Supplementary Figure 1 Supplementary Figure 1. Dose-response curves of the binding of AMFs and AM 1β to soybean PYLs (GmPYL) and Arabidopsis

Supplementary Figure 1 - Purdue University · Supplementary Figure 1 Supplementary Figure 1. Dose-response curves of the binding of AMFs and AM 1β to soybean PYLs (GmPYL) and Arabidopsis

Documents
Supplementary Figure 2: PBX1 induces morphological and cytoskeletal changes consistent with differentiation in NB. A) Morphology of SHSY5Y cells. Cells

Supplementary Figure 2: PBX1 induces morphological and cytoskeletal changes consistent with differentiation in NB. A) Morphology of SHSY5Y cells. Cells

Documents
Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to

Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to

Documents
Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Documents
Figure S1 · 2020. 12. 15. · 1 1 Supplementary Figures 2 3 Figure S1. PPARg expression attenuated the production of cleaved IL-1b in NLRP3 in- 4 flammasome reconstituted HEK293T

Figure S1 · 2020. 12. 15. · 1 1 Supplementary Figures 2 3 Figure S1. PPARg expression attenuated the production of cleaved IL-1b in NLRP3 in- 4 flammasome reconstituted HEK293T

Documents
Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

Documents
Supplementary Information Spiking Neurons with ...10.1038... · Duan et al. 2 . Supplementary Figure 1. Structure of the NbO x threshold switching device. (a) SEM image. Scale bar,

Supplementary Information Spiking Neurons with ...10.1038... · Duan et al. 2 . Supplementary Figure 1. Structure of the NbO x threshold switching device. (a) SEM image. Scale bar,

Documents
Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Documents
Supplementary Figure S3

Supplementary Figure S3

Documents
-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

Documents
Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Documents
Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Documents
SUPPLEMENTARY INFORMATION Supplemental Figure Legend · 2011-09-12 · SUPPLEMENTARY INFORMATION Supplemental Figure Legend Fig. S1 miR-200c expression is induced by oxidative stress

SUPPLEMENTARY INFORMATION Supplemental Figure Legend · 2011-09-12 · SUPPLEMENTARY INFORMATION Supplemental Figure Legend Fig. S1 miR-200c expression is induced by oxidative stress

Documents
Supplementary Data · Supplementary Figure S2. Cobimetinib/ponatinib co-treatment increases death of pancreatic cancer cells (A) CTG assay measuring the effect of Dox-inducible STAT3

Supplementary Data · Supplementary Figure S2. Cobimetinib/ponatinib co-treatment increases death of pancreatic cancer cells (A) CTG assay measuring the effect of Dox-inducible STAT3

Documents
MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

Documents