The Association between ACE I/D Polymorphism and the Risk of Alzheimer’s Disease in Lebanon

Rajaa Fakhoury

Professor of Medical Biochemistry

Alzheimer’s disease (AD)

• AD is a progressive neurodegenerative disease and the most common cause of dementia.• Characterized by β-amyloid deposition, huperphosphorylation of tau

protein and formation of fibrillary tangles.• AD patients are characterized by impaired memory and cognitive

functions.

Epidemiological studies on dementia (Alzheimer’s and Vascular dementia) have been rarely reported in the Middle East

1.5 million Alzheimer’s cases were estimated in the Arab World

Lebanon contributes about 30,000 Alzheimer’s cases

Only Lebanon and Egypt have Alzheimer's associations that are established members of

global organizations

Studies about dementia occurrence, risk and protective factors are few.

Alzheimer's in LebanonIn 2005, Alzheimer's Association Lebanon organization hosted the “Arab Conference on Alzheimer's disease”

In 2007, 27.9% had mild dementia, 22.9% had moderate dementia, and 49.2% had severe dementia in nursing home residents.

A recent study with 162 participant showed that dementia prevalence was 10.5% in Lebanon.

Alzheimer’s disease

Pathological hallmark of AD

Major degeneration in the brain cortex

Presence of amyloid as large extracellular

plaques

Perivascular deposits

Intraneuronal fibrillary tangles

Alzheimer’s disease

• The two main pathological hallmarks of AD are the beta amyloid plaques and neurofibrillary tangles.

• Amyloid-β peptides, physiological peptide, are proteolytically derived from a type 1 integral protein termed amyloid precursor protein (APP)• They are constantly anabolized and catabolized in the brain. (4)

Amyloid Precursor Protein

APP processing pathways

AD Pathophysiology

• Aβ peptides are the main component of amyloid plaques in AD• Aβ peptides are able to aggregate and form Aβ

oligomers• Aβ monomers at high concentrations undergo

conformational change forming a tertiary beta sheet-rich structure that aggregates forming amyloid fibrils. • The Aβ aggregation is followed by neurofibrillary

tangles formation, oxidation, inflammation, demyelination, synaptic and mitochondrial dysfunction and cell death.

©2015 Alzheimer's Association. www.alz.org. All rights reserved. Illustrations by Stacy Jannis.

• Cell biology of Aβ production and degradation

AD Pathophysiology

• The second main hallmark for AD is the neurofibrillary

tangles.• In the nerve cell, there are microtubules that transport

nutrients and other important substances from one part

of the nerve cell to another.• These microtubules are stabilized by a protein called tau that is

regulated by phosphorylation.(2)

AD Pathophysiology

Tau is hyperphosphorylated

Self-assemblies into straight filaments (SF)

and paired helical filaments (PHF)

Aggregate to form neurofibrillary tangles

Collapse and disintegration of the

microtubulesCell death

• The second main hallmark for AD is the neurofibrillary tangles.

©2015 Alzheimer's Association. www.alz.org. All rights reserved. Illustrations by Stacy Jannis.

Inflammatory response Neuritic injury

Hyperphosphorylation of tau protein

Formation of fibrillary tangles

Neuronal dysfunction Cell death (4)

Accumulation and aggregation of Aβ:

Biomarkers For AD

• Global brain atrophy with early disproportionate symmetrical involvement of medial temporal lobe structures as hippocampus.• Bilateral hypometabolism and hypoperfusion in the temporal and

parietal cortices.• Aβ42 CSF level reduction in CSF.• Total tau (t-tau) and phosphorylated tau level increase in CSF.

Risk Factors For AD

Genetic Non- Genetic

• APP• PSEN• ApoE• ECE• NEP• ACE

• Age• Sex• Smoking• Hypertension• Type 2

Diabetes • Traumatic brain

injury • Inactivity

Angiotensin Converting Enzyme

• Angiotensin converting enzyme (ACE) is a dipeptidyl carboxy peptidase enzyme.• It has two isoforms:

A germinal form (gACE) that is only found in male testis. A somatic form (sACE) found mainly in the lungs, vascular

endothelia and kidneys and

• It has been demonstrated to inhibit Aβ peptides aggregation and plaque formation in vitro.

The kinin– kallikrein, and renin–angiotensin systems (Sayed-Tabatabaei et al. 2006)

ACE Gene

A candidate gene for Alzheimer’s disease (AD).

Located on chromosome 17 (17q23).

21 kb long and comprises 26 exons and 25 introns

A 287-base-pair fragment of an Alu element insertion in intron 16 of the ACE gene (9)

The association between circulating ACE levels and ACE gene polymorphisms• Rigat et al showed a marked difference in ACE activity in blood

among the three genotypes:

II genotype

lowest enzyme activity

ACE Polymorphism and AD

Population Association between ACE and AD

Reference

Egyptian Positive Hassanin et al.

Chinese Positive Jian Dong Yang et al

Italian Negative Monastero et al.

Taiwanese Negative Yuan-Han et al.

Lebanese (Unknown)

ACE I/D polymorphism in Lebanon

• Few studies were done concerning ACE I/D polymorphism in Lebanon.• Sabbagh et al. assessed the prevalence in healthy population(6):

ID > DD > II D allele > I allele.

• Saab et al. studied hypertensive population(7)

No significant association between the ACE I/D polymorphism and hypertension

• Chmaisse H et al. studied diabetic population(8): No significant association between the D-allele and T2DM in the Lebanese

population

Aim of The Study

• Determine the frequency of ACE genotypes in Alzheimer’s patients and age-matched controls.• Assess the possible risk factors for Alzheimer’s disease from the

available patients data. • Investigate a possible association between ACE I/D polymorphism

and Alzheimer’s disease

Materials and Methods

45 Alzheimer’s Patients

48 age-matched controls

Sample

Genomic DNA Extraction from Whole Blood

• Using GenElute Blood Genomic DNA kit from SIGMA-ALDRICH.

Principle: leukocytes are lysed to release DNA that is then isolated by a specific binding DNA column.

Polymerase Chain Reaction

• Primers: • Forward primer: 5' CTGGAGACCACTCCCATCCTTTCT 3' • Reverse primer: 5'GATGTGGCCATCACATTCGTCAGAT 3' • PCR conditions: •- Initial denaturation at 95°C for 2 minutes. •-Denaturation at 94°C for 45 seconds•- Annealing at 60°C for 45 seconds•- Extension at 72°C for 45 seconds•- Final extension at 72°C for 9 minutes

40 cycles

Polymerase Chain Reaction (Cont’d) Insertion specific Reaction is used to prevent mistyping of ID heterozygotes as

DD due to suppressed amplification of I-fragment.• Primers: • Forward primer: 5' TGG GAC CAC AGC GCC CGC CAC TAC 3' • Reverse primer: 5' TCG CCA GCC CTC CCA TGC CCA TAA 3' • PCR conditions: •- Same PCR conditions were implicated except the annealing temperature was raised to 67°C to allow the amplification of the I allele.

Gel Electrophoresis:

ACE I/D polymorphism

II genotyp

e

One 490 bp band

DD gentype

One 190 bp band

ID genotyp

eOne

490 bp band & one 190 bp band

Insertion reaction

I allele

335 bp band

D allele

No band

Variables CategoriesSubjects

Chi-value P-valueControl AlzheimerN % N %

Gender Female 20 41.7 35 79.513.7 < 0.001

Male 28 58.3 9 20.5Education None 21 46.7 18 41.9

0.48 0.788School 21 46.7 23 53.5University 3 6.7 2 4.7

Marital statusDivorced\Widowed 12 25.0 23 52.3

9.38 0.009Married 10 20.8 10 22.7Single 26 54.2 11 25.0

Smoker No 33 71.7 34 79.10.64 0.423

Yes 13 28.3 9 20.9BMI group Underweight 1 2.2 1 2.6

6.16 0.104Normal weight 24 52.2 28 71.8Overweight 16 34.8 10 25.6Obese 5 10.9 0 0.0

Depression No 32 78.0 30 81.10.11 0.741

Yes 9 22.0 7 18.9

Basic Characteristics of |AD patients and controls

Control CaseP-value

N Mean SD N Mean SD

Age 48 75.0 10.0 44 79.4 8.3 0.025

Weight 48 65.8 10.7 44 58.1 8.7 < 0.001

Height 46 163.6 8.7 39 157.9 6.3 0.001

BMI 46 24.6 3.5 39 23.2 2.8 0.042

FBS 42 123.1 70.5 39 113.9 55.5 0.521

HbA1C 29 6.3 1.5 35 5.9 1.3 0.256

SBP 42 121 11 39 120 9.2 0.608

DBP 42 70 7.1 39 68 5.4 0.106

Chl 42 138.8 31.0 39 157.5 30.7 0.008

HDL 42 44.7 13.7 39 52.3 13.6 0.015

LDL 42 75.1 26.6 39 80.1 33.1 0.453

Trig 42 115.8 39.3 39 114.1 41.8 0.846

VitD 8 63.5 40.7 11 63.1 38.3 0.983

Characteristics of participant patients

Control Alzheimer

N(%) N(%) OR (95% CI) P-value

Allele

D 65 (67.7%) 49(55.7%)

1.67(0.92, 3.04) 0.093I31 (32.3%) 39 (44.3%)

Genotype

DD 17(35.4%) 13(29.5%)

= 9.56 0.008ID 31(64.6%) 23(52.3%)

II 0(0.0% 8(18.2%)

Distribution of ACE genotypes and Alleles in Alzheimer’s patients and controls.

Discussion

Significant difference between ACE genotype between Alzheimer’s patients and controls.

the II genotype is significantly higher in AD compared to controls. No significant difference in allele distribution between the two groups Female patients had higher prevalence than male AD patients Total cholesterol was significantly higher in AD patients.Being a female and having II genotype are risk factors for

Alzheimer’s disease

Conclusion

• There is an association between ACE I/D polymorphism and Alzheimer’s disease, having II genotype as a risk factor. • There was no other study investigating this association in Lebanon before,

however, several studies in other populations (Egyptian, German, Italian, Japanese and Chinese) were consistent with our findings. • ACE enzyme activity was proven to depend on the ACE I/D genotype, where DD

has the highest activity and II has the lowest activity, and ACE was shown to degrade Aβ peptides, thus having II genotype with low ACE activity means less Aβ degradation which probably participate in AD pathogenesis.