Transcriptional Regulation of Mouse αB- and γF-Crystallin Genes in Lens: Opposite Promoter-specific Interactions Between Pax6 and Large Maf Transcription Factors

doi:10.1016/j.jmb.2004.07.102 J. Mol. Biol. (2004) 344, 351–368

Transcriptional Regulation of Mouse aB- andgF-Crystallin Genes in Lens: Opposite Promoter-specific Interactions Between Pax6 and Large MafTranscription Factors

Ying Yang, Bharesh K. Chauhan, Kveta Cveklova and Ales Cvekl*

The Departments ofOphthalmology and VisualSciences and MolecularGenetics, Albert EinsteinCollege of Medicine, 909Ullmann, 1300 Morris ParkAvenue, Bronx, NY 10461USA

0022-2836/$ - see front matter q 2004 E

† Y.Y. and B.K.C. contributed equAbbreviations used: MARE, Maf

RARE, retinoic acid responsive elemspecific region 1; LSR2, lens-specificE-mail address of the correspond

[email protected]

Mammalian aB-crystallin is highly expressed both in lens epithelium andlens fibers. In contrast, gF-crystallin is highly expressed in the lens fibercells. Crystallin gene expression in lens is regulated at the level oftranscription by a sparse number of specific DNA-binding transcriptionfactors. Here, we report studies on transcriptional regulation of mouse aB-and gF-crystallin promoters by specific combinations of Pax6/Pax6(5a),large Mafs (MafA, MafB, c-Maf, and NRL), Sox1, Sox2, Six3, andRARb/RXRb. Two sets of these factors, co-expressed both in lensepithelium and in lens fibers, were tested in co-transfection assays usingcultured lens and non-lens cells. Regulation of aB-crystallin was studied inthe presence of lens epithelial-factors Pax6, MafB, and RARb/RXRb, andlens fiber-factors Pax6, MafA, c-Maf, and NRL. Pax6 proteins activated theaB-crystallin promoter (K162 to C45) with any combination of Mafs.Addition of RARb/RXRb further increased its promoter activity. Gel shiftassays using lens nuclear extracts demonstrated interactions of Pax6, Maf,and retinoic acid nuclear receptor proteins with two lens-specific regions,the distal LSR1 (K147/K118) and proximal LSR2 (K78/K40), of theaB-crystallin promoter. In contrast, Pax6 proteins acted as repressors ofgF-crystallin promoter activity elicited by a combination of large Mafs,Sox, and RARb/RXRb proteins in transiently transfected lens and non-lenscells. The results show that Pax6 conversely regulates these two lenscrystallin promoters. We propose that the opposite roles of Pax6 incrystallin gene regulation are results of different promoter architectures ofthe aB- and gF-crystallin genes, developmentally regulated association oftranscription factors with the corresponding cis-regulatory sites, andspecific recruitment of transcriptional co-activators and co-repressors byPax6.

q 2004 Elsevier Ltd. All rights reserved.

Keywords: lens; crystallins; Pax6; Maf; Six3, Sox1, Sox2
*Corresponding author
Introduction

The lens is a polarized tissue with the anteriorhemisphere covered by a single cuboidal epi-thelium, and with the lens fiber cells occupyingthe posterior surface and the interior. Lens epi-thelial and lens fiber cells represent a single cell-

lsevier Ltd. All rights reserve

ally to this work.responsive element;ent; LSR1, lens-region 2.

ing author:

lineage; epithelial cells are the precursor popu-lation, and fiber cells are the terminally differen-tiated population. During lens growth, the mostperipheral epithelial cells differentiate into fibercells near the lens equator. Fiber cell differentiationis characterized by cell elongation, and the syn-thesis and accumulation of a diverse group ofwater-soluble proteins, the crystallins. The trans-parent and refractive properties of lens depend onhigh concentrations of crystallins coupled withtheir uneven spatial distribution in lens fibers.In mammals, crystallin genes are divided into

structurally distinct a- and bg-families. Thea-family of crystallins is comprised of two

d.

352 Transcriptional Control of aB- and gF-Crystallin Genes

members, aA and aB.1,2 a-Crystallins are structur-ally and functionally related to small heat shockproteins possessing molecular chaperone-likeactivities. The bg-family is comprised of six b andseven g-crystallins3 sharing a “greek-key” struc-tural motif4 also found in microbial stressproteins including Protein S and spherulin 3a.5

The g-crystallins, via their compact globularstructure, generate the high refractive index ofthe lens nucleus. The different functions of a andbg-crystallins require different temporal and spatialcontrols of their expression.

In situ hybridizations detected expression of aB-crystallin in the lens progenitor cells of the E9.5mouse embryo forming the thickening of the sur-face ectoderm, the lens placode as the first crystallinexpressed here.6 Next, equal expression of aB-crystallin was detected in the anterior and posteriorportions of the embryonic lens vesicle in E11-11.5 ofmouse embryo.6 In the embryonic lens, formedbetween E11.5 and E13.5, aB-transcripts wereabundant in lens epithelium. Furthermore,expression of aB-crystallin was increased indifferentiating primary lens fibers, as well as insecondary fibers, compared to the lens epithelium.

Six g-crystallins (gA to F) are organized in a genecluster that occupies about 25 kb of genomic DNA.7

In contrast to the aB-crystallin, g-crystallins arehighly expressed only in differentiated lens fibers.7

In rodents, gA to gF-crystallins are expressed inlens, and share similar but not identical promoterregions.8 The majority of transcriptional studiesfocused on the regulation of the mouse gF-crystallingene.9,10 Two specific features of g-crystallinexpression are their high level of expression inprimary lens fiber cells forming the lens nucleus,and selective discontinuation of their expression inpostnatal lens.7,8 Elucidation of molecular mechan-isms that account for specific expression patterns ofeach different crystallin gene in lens is important inunderstanding lens fiber cell differentiation.

Studies using transgenic mouse models haveshown that the temporally and spatially regulatedexpression of crystallin genes is controlled at thelevel of transcription.11 Furthermore, molecularstudies of lens-preferred expression of crystallinsresulted in the identification of a group of tissue-restricted DNA-binding transcription factors,including Pax6, Pax6(5a), large Mafs (MafA/L-Maf, MafB, c-Maf andNRL), HSF2, Prox1, RARb/RXRb, Six3, Sox1, and Sox2. These transcriptionfactors act in combination with ubiquitouslyexpressed factors, including AP-1, CREB, USF, andTFIID, to regulate lens-preferred expression ofcrystallin genes.9–11

Mapping of the mouse aB-crystallin promoterresulted in the identification of two lens-specificregions, proximal LSR2 and distal LSR1, residing ina fragment ofK162 toC44.12,13 A shorter promoter,K115 to C44, containing only LSR2, was alsocapable to direct lens-specific expression in trans-genic mice.13 Each LSR has been shown to bindPax6 proteins, and retinoic acid nuclear receptors

RARb/RXRb.13,14 Most recently, we have shownthat the mouse aB-crystallin promoter via its distalLSR1 could be activated by two members of the Maffamily, MafA and c-Maf.15 Both Pax6 hetero-zygous16 and c-Maf homozygous17–19 lenses werefound to express reduced amounts of the aB-crystallin providing additional evidence that Pax6and c-Maf regulate in vivo expression of thiscrystallin. Treatment of cultured lens cells withretinoic acid resulted in a threefold increase intranscription of endogenous aB-crystallin tran-scripts.14 However, it is not known how thedynamic expression patterns of Pax6, large Mafs,and retinoic acid nuclear receptors influence theexpression of aB-crystallin gene in different com-partments of the lens—the lens epithelium and lensfibers.

The “minimal” lens-specific promoter of mousegF-crystallin gene was identified as a K67 to C45fragment capable to direct reporter gene expressionto the lens nucleus in transgenic mouse.20 Thecritical cis-acting elements residing within thisfragment are a Sox-binding site, a MARE, and aTATA-box.21 An extended promoter fragment fromK226 to C44 was capable to express the linkedreporter gene in a broader area of lens fiber cellscompared to the fragment of K67 to C44.20

Molecular studies have shown presence of aRARE,22,23 Pax6- and Pax6(5a)-binding sites,24 andSix3-binding site25 more upstream, i.e. betweenpositions K226 to K67. A series of studies employ-ing various gF-crystallin promoter fragmentshave shown that individual c-Maf, Sox1, Sox2,and RARb/RXRb acted as transcriptional activa-tors.22,23,26,27 Reduced expression of gF-crystallinwas found in c-Maf and Sox1 null lenses.17–19,28 Incontrast, similar studies using individual Pax6,Pax6(5a), and Six3 revealed repression of basalK226 toC44 gF-crystallin promoter activity both inlens and non-lens cells.24,25

The different temporal and spatial expression ofaB- and gF-crystallin genes raises the followingquestion. What is the molecular mechanism togenerate this diversity if aB and gF-crystallinpromoters share at least four cis-regulatoryelements, including Pax6-binding sites, MAREs,RAREs, and TATA boxes?13,14,22–24,26,27 A number ofpossible mechanisms can be involved. First of all,different arrangement of these cis-acting sitespromoting different protein–protein interactionsresulting either in transcriptional activation orrepression can play an important role. As Pax6-binding sites and MAREs have been found in themajority of crystallin regulatory regions,1,3,9–11 it islikely that these sites play prominent roles in theestablishment of this diversity. Studies of transcrip-tional regulation of the glucagon promoter by Pax6,MafA and Cdx2/3 revealed transcriptionalsynergism mediated by specific protein–proteininteractions between Pax6 and MafA that resultedin the recruitment of co-activator p300.29,30 Inaddition, expression of c-Maf,31 MafA/L-Maf,32

and Six3,32 is dependent on Pax6, suggesting

Transcriptional Control of aB- and gF-Crystallin Genes 353

multiple regulatory circuits and molecular mech-anisms involved in crystallin gene regulation inlens.9–11 In contrast to the continued presence ofPax6 and large Maf proteins throughout lensdevelopment, the regulation of both aB and gF-crystallins by RARb/RXRb is possible only duringearly lens embryonic development, between E9.5and E12.5, as retinoic acid/retinoid signaling is lostin lens by E12.5.33,34 When Pax6 and Pax6(5a) weretested together with RARb/RXRb, potentialtranscriptional synergism between these factors ingF-crystallin transcription was revealed,15 althoughPax6 alone could repress this promoter.15,24

Here, we performed a series of cell culture studiesto determine the promoter activities of the aB andgF-crystallin genes using those transcription factorsthat are co-expressed both in lens epithelial cells,and in differentiating lens fibers. The results

Figure 1. Schematic representation of mouse aB-crystallin pfragment of K162 to C44. Two lens-specific regions, distal Llength is based on lens-specific DNase I footprinting data.13

regions. Pax6-binding site (open box), RARE (filled arrows),T-MARE sequence, TGMTGANYNNGCA.35 (C) Nucleotidebinding sites, T-MAREs and RAREs are denoted as in (B). DNare labeled by solid brackets. Oligonucleotides LSR1a, LSR1b

revealed that Pax6 is required for Maf-mediatedactivation of the aB-crystallin promoter, and thatthis activation did not depend on the presence ofRARb/RXRb. Conversely, Pax6 and Six3, predomi-nantly expressed in lens epithelium, acted asrepressors of Maf/Sox/RARb/RXRb-drivenactivation of the gF-crystallin promoter.

Results

The mouse aB-crystallin gene contains two lens-specific regions in its 5 0-flanking promoter region,distal LSR1 and proximal LSR2,13 which areseparated by three a-helical turns encompassing32 base-pairs (see Figure 1). Each LSR contains aPax6-binding site and a RARE.13–15 A MARE sitehas been shown in the middle section of LSR1.12

romoter. (A) A diagram of mouse aB-crystallin promoterSR1 and proximal LSR2, are shown (not in scale). Their(B) Nucleotide sequence of LSR1 including the flankingand two T-MAREs are shown aligned with the consensussequence of LSR2 including its flanking regions. Pax6-ase I protected areas generated by lens nuclear extracts13

and LSR2, used in EMSAs, are shown in brackets.


Using a consensus binding sequence 5 0-TGMTGANYNNGCA-3 0 for T-MARE,35 we found twoadditional candidate Maf binding sites (see Figure1(B) and (C)). Thus, it appears that the distal LSR1may contain two MAREs, and the proximal LSR2harbors a new T-MARE next to the Pax6-bindingsite.

To examine regulation of the mouse aB-crystallinpromoter by combinations of Pax6, large Mafproteins, and retinoic acid nuclear receptors, weperformed a series of co-transfection experimentswith cDNAs encoding those transcription factorsthat are co-expressed both in the lens epithelium

Figure 2. Regulation of mouse aB-crystallin promoter by tpromoter fragment K162 to C44 was co-transfected with cDindicated. Experiments with RARb/RXRbwere performed inMethods. (A) Results of co-transfections in 293T non-lens celTwo hundred nanograms of Pax6, 25 ng of Pax6(5a), 80 ng ofThe results were normalized to the activations obtained in th

and lens fibers. Both lens epithelium and lens fibersare characterized by high levels of aB-crystallinexpression.6 In lens epithelium, high levels ofexpression of Pax6 and MafB have beenfound.36,37 However, the nuclear receptors RARb/RXRb14 function in embryonic lens only betweenE9.5 and E12.5.33,34 Thus, to recapitulate thecomposition of transcription factors prevailing inlens epithelial cells, we tested combinations ofPax6/Pax6(5a), RARb/RXRb, and MafB in transi-ently co-transfected lens and non-lens cells. A ratioof 8 : 1 of Pax6 to Pax6(5a) was used since our recentstudies revealed functional synergism between

ranscription factors expressed in lens epithelial cells. TheNAs encoding Pax6/Pax6(5a), MafB and RARb/RXRb asthe presence of retinoic acid as described in Materials andls. (B) Results of co-transfections in N/N1003A lens cells.MafB, RARb and RXRb expression plasmids were used.e presence of 400 ng of the empty vector, pKW10.


these Pax6 variants.15 The results (see Figure 2(A))demonstrated that individual factors Pax6/Pax6(5a), MafB, or RARb/RXRb activated thepromoter 1.7, 2.7, and 9.3-fold, respectively; how-ever, their simultaneous presence resulted in 113.2-fold activation in transfected non-lens 293T cells.Co-transfection of Pax6 with MafB, addressing theregulation of aB-crystallin expression in post-

Figure 3. Regulation of mouse aB-crystallin promoter by tcells. The promoter fragment K162 to C44 was co-transfectedNRL as indicated. (A) Results of co-transfections in 293T non-lcells. The amounts of individual plasmids are described in th

embryonic lens epithelium with inactive retinoicsignaling,33,34 resulted in fivefold transcriptionalactivation. The activation mediated by RARb/RXRb was dependent on the presence of retinoicacid as described earlier (data not shown).15,22,24

Next, aB-crystallin promoter activity was testedin cultured rabbit lens N/N1003A cells. Basalpromoter activity in lens cells was about 20 times

ranscription factors expressed in differentiating lens fiberwith cDNAs encoding Pax6/Pax6(5a), MafA, c-Maf and

ens cells. (B) Results of co-transfections in N/N1003A lense legend to Figure 2.


higher compared to that in non-lens cells.15,38

Experiments in rabbit N/N1003A lens cells, expres-sing endogenous Pax6 and MafB (see below),39

revealed that each factor tested alone (Pax6/Pax6(5a), RARb/RXRb or MafB) was not sufficientfor significant activation (see Figure 2(B)). Incontrast, a synergism between Pax6/Pax6(5a) andRARb/RXRb was found (Figure 2(B)). In addition,activations by Pax6/Pax6(5a) with MafB, and byMafB with RARb/RXRb were always higher com-pared to those of individual factors. Addition ofPax6/Pax6(5a) to the MafB/RARb/RXRb complexincreased promoter activity of the aB-crystallinfrom 3.4 to 15.6-fold. From these results, weconclude that Pax6 proteins increased the aB-crystallin promoter activity mediated by MafB/RARb/RXRb by 4.6-fold in lens and 2.7-fold in non-lens cells. Moreover, the highest promoter activitywas detected in the presence of Pax6, MafB andactivated retinoic acid nuclear receptors.

Next, to examine aB-crystallin gene regulation bytranscription factors present in differentiating lensfibers, we tested Pax6 together with MafA, c-Mafand NRL, all co-expressed in lens fiber cells.36–39

Individual large Mafs activated the aB-crystallinpromoter in both 293T non-lens, and N/N1003Alens cell lines (see Figure 3). However, co-expression of their combinations, i.e. MafA/c-Maf,

Figure 4. Analysis of expression of proteins in normal and cof expression of Pax6, MafA, MafB, c-Maf, NRL, Six3, Sox1cultured cells. (B) Western blot analysis of transcription factoCHO-K1. The proteins were expressed with N-terminal 3xFLAcell lysates (10 ml and 20 ml) (indicated by triangles) were loa

c-Maf/NRL, NRL/MafA, or MafA/c-Maf/NRLresulted in low activations, between 2.2 and 4.6-fold. In contrast, addition of Pax6/Pax6(5a) to largeMafs stimulated aB-crystallin promoter activity. Forexample, the MafA/c-Maf/NRL complex activatedthe promoter only by 4.6-fold, but addition of thePax6/Pax6(5a) increased the activation to 92.6-fold,i.e. 20-fold, in non-lens cells (see Figure 3(A)).

Similar co-transfections in cultured lens cellsrevealed that individual c-Maf, MafA, and NRLalso activated the promoter, possessing already asignificant basal activity compared to non-lens cellsdescribed above, by a factor of 18.0, 10.1, and 26.7-fold, respectively. In addition, double and triplecombinations of large Mafs resulted in loweractivations (between 4.3 and 9.6-fold) compared toactivations by individual Mafs. Addition of Pax6/Pax6(5a) to various combinations of large Mafsresulted in moderate increases of activation, e.g.Pax6/Pax6(5a) with c-Maf/MafA/NRL elicitednearly a twofold activation of the aB-crystallinpromoter.

Expression of the endogenous transcription fac-tors in three cultured cell lines used here wasassessed using specific antibodies recognizing Pax6,MafA, MafB, c-Maf, NRL, Six3, Sox1 and Sox2. Anantibody recognizing the TATA-box binding pro-tein, TBP, was used as a loading control. The results

o-transfected cultured cell lines. (A) Western blot analysis, Sox2 and TBP in N/N1003A (lens), 293T and CHO-K1rs in transiently transfected non-lens cell lines, 293T andG tags and detected usingM2 anti-FLAG antibody.Wholeded.


indicated no expression of Pax6 and weakexpression of Sox2 in non-lens cells, 293T andCHO-K1 (see Figure 4(A)). In contrast, both Pax6and Sox2 proteins were found in N/N1003A lensepithelial cells. No expression of Sox1 was found inN/N1003A, 293T and CHO-K1 cells. In addition,neither Sox1 protein nor transcripts were found inother lens epithelial cell lines, although they wereexpressed in the neonatal mouse lens (data not

shown). Large Maf proteins were found in all celllines studied here (see Figure 4(A)). We have shownthe expression of RARb and RXRb in N/N1003Alens epithelial cells elsewhere.14 Ectopic expressionof transcription factors Pax6, MafA, MafB, c-Maf,NRL, Six3, Sox1 and Sox2 in transiently transfectedcultured cells was detected using Flag epitope tagsand Western immunobloting. The results haveshown comparable levels of expression in the cell

Figure 5. EMSAs of lens nuclearproteins interacting with mouseaB-crystallin LSR1a and LSR1b.(A) An oligonucleotide containingLSR1a (see Figure 1(B)) was incu-bated with lens nuclear extractsand in the presence of 50-foldexcess of oligonucleotide com-petitors described in Materials andMethods. Specific complexes aredenoted 1a-1, 1a-2 and 1a-3.(B) An oligonucleotide containingLSR1b (see Figure 1(B)) was incu-bated with lens nuclear extracts asdescribed above. Specific com-plexes are denoted 1b-1 and 1b-2.Complexes containing Maf pro-teins, M; retinoic and retinoidnuclear receptors, R; and Pax6proteins, P.


lines used (see Figure 4(B)). In summary, the resultsof the present experiments (see Figures 2 and 3)showed that Pax6 proteins were activators of theaB-crystallin promoter in the presence of otherregulatory proteins co-expressed with Pax6 (seeFigure 4) in lens epithelium and lens fibers. More-over, the highest activation of 113.2-fold (seeFigure 2(A)) was achieved in the presence of Pax6,MafB, and RARb/RXRb, suggesting that the onsetof aB-crystallin expression in lens placode requiresall these diverse transcription factors.

To examine specific protein–DNA interactionsformed with LSR1 and LSR2, we performed a seriesof EMSAs employing oligonucleotides correspond-ing to LSR1a (5 0-half of LSR1), LSR1b (3 0-half ofLSR1), and LSR2 (see Figure 1) incubated with lensnuclear extracts. The results with LSR1a are shownin Figure 5(A). Three major specific complexes,labeled 1a-1, 1a-2, and 1a-3 were detected (Figure 5,compare lane 2 and 3). An oligonucleotide repre-senting proximal LSR2 (lane 5) reduced all of thesespecific complexes providing evidence that LSR2and LSR1 contain similar transcription factor bind-ing sites, although they are differently arrayed(compare Figure 1(B) to (C)). Next, we usedoligonucleotide competitors containing consensusbinding sites for retinoic acid responsive elements(RARE, lane 6) and its mutant (lane 7), retinoidresponsive element (RXRE, lane 8) and its mutant(lane 9), Maf responsive element (T-MARE, lane 10)and its mutant (lane 11), Pax6-binding site (P6CON,lane 12), and Pax6(5a)-binding site (lane 13). Fromthe effects of T-MARE and RXRE and their mutants,we deduced that proteins forming the complexes1a-1 and 1a-2 are related to Mafs and that 1a-1 mayalso contain RXR receptors. In addition, specificcomplex 1a-3 was reduced by both P6CON (lane

12), and 5aCON (lane 13) oligonucleotides,suggesting the presence of Pax6 proteins in agree-ment with previous studies demonstrating bindingof recombinant Pax6 and RARb/RXRb to LSR1.13,14

Similar experiments using LSR1b (seeFigure 1(B)) incubated with lens nuclear extractsyielded two major specific complexes: 1b-1 and 1b-2(see Figure 5(B), compare lanes 2 and 3). Anoligonucleotide corresponding to LSR2 reducedthe formation of complex 1b-1 (lane 5). Formationof this complex was reduced by an oligonucleotideT-MARE (lane 8), but it was not reduced bymutatedT-MARE (lane 9). Thus, distal LSR1 appears tocontain at least two MAREs, one in subregionLSR1a (complexes 1a-1 and 1a-2) and another insubregion LSR1b (complex 1b-1) in agreement withalignments shown in Figure 1.

Next, the promoter-proximal region LSR2 wasalso studied by EMSAs (Figure 6). Five specificcomplexes (Figure 6, compare lanes 1 and 2) wereformed between the LSR2 probe and lens nuclearextracts. Complex 2-1 was abolished in the presenceof T-MARE (lane 7) but not in the presence ofmutated T-MARE (lane 8). Two Pax6-containingoligonucleotides, P6CON and 5aCON, also reducedbut not abolished the formation of the complex 2-2(lanes 9 and 10). Formation of this complex was alsoinhibited in the presence of RARE (lane 5). Inaddition, complexes 2-3, 2-4, and 2-5 were abolishedin the presence of RARE (lane 5) and complexes 2-3,and 2-4 were reduced by RXRE (lane 6). Collec-tively, the specific oligonucleotide competitionexperiments suggested that both distal LSR1and proximal LSR2, in addition to RAREs andPax6-binding sites identified earlier,9,10 also containMaf binding sites, the T-MAREs.

To provide functional evidence that distal LSR1

Figure 6. EMSAs of lens nuclearproteins interacting with mouseaB-crystallin proximal LSR2. Anoligonucleotide containing LSR2(see Figure 1(C)) was incubatedwith lens nuclear extracts and inthe presence of 50-fold excess ofoligonucleotide competitorsdescribed in Materials andMethods. Specific complexes aredenoted 2-1, 2-2, 2-3, 2-4, and 2-5.Complexes containing Maf pro-teins, M; retinoic and retinoidnuclear receptors, R; and Pax6proteins, P.

Table 1. Relative transcriptional activation of LSR1-, LSR1a-, LSR1b- and LSR2-driven reporters by large Mafs and Pax6proteins in 293T cells

Distal Proximal

LSR1 LSR1a LSR1b LSR2

Vector 1.0 1.0 1.0 1.0Mafa (A) 4.7 7.7 0.8 5.1MafB (B) 5.9 19.7 ND 3.3c-Maf (C) 6.2 6.7 0.4 8.5NRL (N) 61.3 28.5 4.0 9.9A/C/N 5.7 26.7 ND 12.8A/C/N/P6/5a 41.5 681.9 ND 2.3Pax6/Pax6(5a) (P6/5a) 6.0 4.7 ND 2.5

ND, not determined.


indeed contains at least two distinct MAREs, andthat proximal LSR2 contains a functional MARE aswell, we prepared a series of reporters containingmultiple copies of each LSR1, LSR1a, LSR1b, andLSR2 (see Figure 1) cloned 5 0 from the E4 TATA-boxfused to the luciferase reporter.15,40 The reportersare described in Materials and Methods. Theplasmids were co-transfected with cDNAs encod-ing individual Mafs (MafA, MafB, c-Maf and NRL),and with a lens fiber cell-specific combination ofMafA/c-Maf/NRL in the absence and presence ofcDNAs encoding Pax6 and Pax6(5a) proteins in293T cells. The results, summarized in Table 1,showed that both distal LSR1 and proximal LSR2were activated by individual Mafs. Dissection ofLSR1 into LSR1a and LSR1b revealed that LSR1awas activated by all four large Mafs. In contrast,LSR1b-driven reporter was only activated by NRL,and this activity was substantially lower comparedto the ability of NRL to activate LSR1- and LSR1a-

driven reporters. Furthermore, cotransfectionstudies using MafA/c-Maf/NRL, co-expressed inlens fiber cells, also resulted in activations of LSR-driven reporters. Addition of Pax6 proteins resultedin 7.3-fold and 25.5-fold increases of LSR1- andLSR1a-driven reporters, respectively (see Table 1).In contrast, the 12.8-fold activity of the proximalLSR2-driven promoter mediated by MafA/c-Maf/NRL was reduced by a factor of 5.6-fold in thepresence of Pax6 proteins.Taken together, functional studies of the aB-

crystallin promoter combined with analysis ofspecific protein–DNA binding complexes provideevidence that both distal LSR1 and proximal LSR2bind large Maf proteins, that functionally interactwith Pax6/Pax6(5a) and RARb/RXRb to activatethe aB-crystallin promoter. Pax6 proteins activatedthe K162 to C44 aB-crystallin promoter with anycombination of Mafs, and retinoic acid activatednuclear receptors (see Figures 2 and 3). However,

Figure 7. Schematic represen-tation of mouse gF-crystallinpromoter. (A) A diagram ofmouse gF-crystallin promoterfragment of K226 to C45. gF-crystallin enhancer region 1,gFE1; Six3-binding site, Six3; andgF-lens specific region, gLSR.(B) Nucleotide sequence encom-passing gFE1. Pax6-binding site,P6CON (horizontal bracket);Pax6(5a) binding sites, 5aCON(arrows); RARE is comprised bythree elements (solid arrows). (C)Nucleotide sequence encompass-ing gLSR. SOX-binding site andT-MARE are shown.


when LSR1, LSR1a, and LSR2 were tested separ-ately using a heterologous “minimal” promoter,Pax6 proteins highly activated the LSR1- andLSR1a-driven promoters, but repressed the LSR2-driven promoter (see Table 1).

Figure 8. The regulation of mouse gF-crystallin promoter bypromoter fragment K226 to C45 was co-transfected withRARb/RXRb as indicated. The amounts of individual pRARb/RXRb were performed in the presence of retinoic acidusing the individual factors. (B) Results of co-transfection(C) Results of co-transfections in CHO-K1 non-lens cells usingN/N1003A lens cells using combinations of factors.

The molecular mechanism by which Pax6 pro-teins repress transcription is poorly understood.24,41,42 To address this question, we turned theattention to the mouse gF-crystallin gene. Theorganization of its proximal and distal regulatory

transcription factors expressed in lens epithelial cells. ThecDNAs encoding Pax6/Pax6(5a), MafB, Sox2, Six3, andlasmids are described in Figure 2. Experiments with. (A) Results of co-transfections in CHO-K1 non-lens cellss in N/N1003A lens cells using the individual factors.combinations of factors. (D) Results of co-transfections in


sites is shown in Figure 7. RARb/RXRb hetero-dimers,22,33,34 Pax6 and Pax6(5a),36 Six3,25,43 Sox2,26

and MafB,37 are transcription factors highlyexpressed in lens epithelium, where, however, themouse gF-crystallin promoter is repressed in vivo.In contrast, this promoter is highly active indifferentiating primary lens fiber cells, whereSox1, MafA, c-Maf, and NRL are highlyexpressed28,37,44,45 concomitant with reducedexpression of Pax6,36,41,46 and elimination of Six3expression.43 To study mouse gF-crystallinpromoter regulation in the presence of transcriptionfactors present in lens epithelium, we performed

Figure 9. The regulation of mouse gF-crystallin promoter bycells. The promoter fragmentK226 toC45 was co-transfectedand Sox1 as indicated. The amounts of individual plasmids atransfections in CHO-K1 non-lens cells using the individual fcells using combinations of factors. (C) Results of co-transfect(D) Results of co-transfections in N/N1003A lens cells using

co-transfections with Pax6/Pax6(5a), RARb/RXRb,MafB, Six3, and Sox 2 in cultured lens and non-lenscells. The results (see Figure 8) showed that acombination of Pax6/Pax6(5a) with RARb/RXRbactivated the gF-crystallin promoter, although thisactivation was lower compared to that of MafB orSox2 (compare Figure 8(C) with (A)). However, inthe remaining assays of Pax6 proteins together withRARb/RXRb and Sox 2, MafB and Sox2, andRARb/RXRb, Sox2 and MafB, the presence ofPax6 proteins resulted in the repression of the gF-crystallin promoter activities. The highest relativegF-crystallin promoter activities of 190.2-fold

transcription factors expressed in differentiating lens fiberwith cDNAs encoding Pax6/Pax6(5a), MafA, c-Maf, NRL,re described in the legend to Figure 2. (A) Results of co-actors. (B) Results of co-transfections in CHO-K1 non-lensions in N/N1003A lens cells using the individual factors.combinations of factors.


(CHO-K1 non-lens cells, Figure 8(C)) and 170.5-fold(N/N1003A lens cells, Figure 8(D)) were foundwith co-transfected RARb/RXRb/Sox2/MafB. Incontrast, presence of Pax6 reduced its promoteractivity by a factor of sixfold (see Figure 8(C)),which was further reduced 2.5-fold by Six3 in non-lens cells. Similarly, Pax6 proteins repressed 5.4-foldgF-crystallin promoter activity elicited by RARb/RXRb/Sox2/MafB in lens cells, which wasfurther reduced 5.8-fold by Six3 (see Figure 8(D)).These results suggest that Pax6 proteins incombination with MafB and Sox 2 switch torepression. We conclude that the gF-crystallinpromoter is kept in a repressed state in vivo inlens epithelial cells due to the repressor activities ofPax6 depending on the presence of MafB and Sox2,and due to independent repression by Six3proteins.25

Next, to examine a set of transcription factorspresent in differentiating lens fibers, we co-trans-fected individual Pax6/Pax6(5a), Six3, Sox1, MafA,c-Maf, and NRL genes and their combinationstogether with the mouse gF-crystallin promoter(see Figure 9) into lens and non-lens cultured cells.The effects of individual factors are shown inFigure 9(A) and (B). Large Mafs activated the gF-crystallin promoter in the order of MafAOc-MafONRL in CHO-K1 non-lens, and in the order ofc-MafONRLOMafA in lens N/N1003A cells. Thehighest relative activations of gF-crystallinpromoter, 181.7 and 132.3-fold (see Figure 9(C)),were found for combinations Sox1/MafA/c-Mafand Sox1/MafA/c-Maf/NRL in non-lens cells,respectively. The presence of Pax6/Pax6(5a) elicitedstrong repression (10.2 and 16.5-fold) of gF-promoter activities mediated by Sox1/MafA/c-Maf and Sox1/MafA/c-Maf/NRL in non-lenscells, respectively. In lens cells, the activation of13.4- by Sox1/MafA/c-Maf and 16.5- by Sox1/MafA/c-Maf/NRL (see Figure 9(D)) were reducedby Pax6/Pax6(5a) by factors of 2.2 and 2.6-fold,respectively.

Discussion

The aim of this study was to determine the role ofPax6 in its transcriptional regulation of two crystal-lin promoters, aB and gF, by studying its mechan-ism in the context of other transcription factors withdifferent spatial expression in lens epithelial andfiber cells. These factors have tissue-restrictedpatterns of expression, and their combinations arerequired to drive lens-preferred expression of thesecrystallin genes.9–11 The expression pattern of aB-crystallin positively correlates with expression ofPax6 as it is expressed in the lens placode, lens pit,and lens vesicle, followed by its high level ofexpression in lens epithelium.6,36,41 However, it isalso highly expressed in lens fibers, wherein Pax6expression is attenuated but not abolished.6,36,41,46

The expression pattern of the gF-crystallin shares aninverse relationship with Pax6, as it is highly

expressed in lens primary fiber cells.7,36

To accomplish this goal, we identified threeMAREs in the mouse aB-crystallin promoter, andconducted functional studies of lens epithelial-and fiber-cell-specific sets of transcription factorsshown to regulate the aB- and gF-crystallinpromoters.

Earlier studies predicted a MARE in LSR212

based on its sequence homology with the elementaCE2 from the chicken aA-crystallin gene.47 Site-directed mutagenesis of this site resulted in asignificant loss of aB-crystallin promoter activityin cultured lens cells.12 Subsequent studies haveshown that the aCE2 element of the chicken aA-crystallin promoter was recognized by a novelmember of the Maf family, chicken L-Maf.48 Morerecent identification of human, mouse, and quailMafA genes suggest that they are homologues ofthe chicken L-Maf.45,49–51 Our data show that eachaB-crystallin LSR1 and LSR2 contains at least onefunctional MARE. Both LSR2 and LSR1 arehighly evolutionary conserved in mammalian aB-crystallin genes suggesting their functional roles.52

Transgenic mouse experiments demonstrated that apromoter fragment K115 to C45 harboringproximal LSR2 is sufficient to elicit lens-specificexpression.13 Here, we show that LSR2 was acti-vated by individual MafA, MafB, c-Maf, and NRLin non-lens cells (see Table 1) consistent with theformation of Maf-containing complexes usingthe LSR2 region as a probe in EMSAs (see Figure 6).The present EMSAs showed formation of specificprotein–DNA complexes that were sensitive to thepresence of oligonucleotides harboring consensusT-MARE but not mutated T-MARE (see Figures 5and 6). Next, we attempted to biochemicallyidentify these complexes using a panel of specificantibodies against large Mafs. However, addition ofantibodies did not result in unequivocal reductionof specific complexes and/or formation of “super-supershifts”, indicating the presence of ternarycomplexes DNA/protein/IgG (data not shown). Anumber of factors could contribute to these findingsincluding but not limited to the limited availabilityof epitopes when proteins interact with DNA aseither homodimers or heterodimers. In addition,formation of multiple species with similarmobilities in EMSAs, and independent associationof AP-1 and CREB proteins with T-MARE sites35,53

may obscure identification of lens nuclear proteinsthat associate in vitro with LSR1 and LSR2 probes.Indeed, large Maf proteins have been shown toform heterodimers with AP-1 family members Fosand Jun, and formation of Maf/NRL and similarheterodimers between large Mafs is possible53

Further studies using recombinant proteins andnuclear extracts enriched with tagged Mafs inEMSAs in vitro combined with chromatin immuno-precipitations (ChIPs) in vivo will provide moredefinitive answers to the identification of lensnuclear proteins associating with the mouse aB-crystallin lens specific regulatory regions. Never-theless, the earlier genetic16–19 and present


functional studies (see Figures 2 and 3, and Table 1)establish aB-crystallin as a direct target for tran-scriptional regulation by MafA, MafB, c-Maf andNRL in the embryonic lens. Postnatal regulation ofthe aB-crystallin in lens can involve additionalfactors including HSF4, which is capable to interactwithin LSR2.3,54

The current data also further extend the under-standing of the regulation of mouse gF-crystallin.Previous studies of this promoter mostly focused onthe action of gF-crystallin-associated transcriptionfactors individually but not in combination witheach other.13,22–26 Here, we found that epithelialfactors, Sox2/MafB/RARb/RXRb, could activatethe mouse gF-crystallin promoter in both lens andnon-lens cells. However, this activation was signifi-cantly reduced by Pax6/Pax6(5a) and Six3 (seeFigure 8), both proteins highly expressed in lensepithelium and serving here as both transcriptionalactivators and repressors. A similar experimentrecapitulating the composition of transcriptionfactors present in differentiating lens fiber cellsrevealed that Sox1 in combination with fiber-enriched large Mafs, i.e. MafA, c-Maf and NRL,strongly activated this promoter (see Figure 9).Although Pax6/Pax6(5a) also reduced gF-crystallinpromoter activity, the amount of Pax6 proteinsappears reduced in lens fiber cells compared to thatin lens epithelium.36,41,46 Hence, Pax6/Pax6(5a)-mediated repression of the gF-crystallin promoter isweakened due to the reduced amounts of thisprotein compared to levels found in lens epitheliumand concomitant with a robust expression of Sox1,MafA, and c-Maf in primary lens fibers.28,45 FromE14.5, these factors are joined by NRL, which isexpressed both in primary and secondary lensfibers.44 Similar repression of the chicken bB1- andbA3/A1-crystallin promoters by Pax6 wasestablished earlier.41,42 However, Pax6/Pax6(5a)-mediated repression of the gF-crystallin promoterunlikely involves competition between Mafs andPax6 proteins for the same cis-acting elements likefor PL1 and PL2 sites in the chicken bB1-crystallinpromoter,41,42 since Pax6/Pax6(5a)-binding site24

and MARE27 are 130 bp apart in the gF-crystallinpromoter (see Figure 7). Further studies of the gF-,bB1- and bA3/A1-crystallin promoters will provideexcellent opportunity to study Pax6-mediatedtranscriptional repression.

Here, we assessed the function of specific DNA-binding transcription factors in crystallin generegulation in transient transfections in both lensand non-lens cultured cells. These cell lines wereused in similar co-transfection studies of crystallinpromoters and our results are consistent withearlier studies.13–15,25,42,55 Since our main questionwas to determine the role of Pax6 in aB- and gF-crystallin regulation, we used two non-lens celllines, 293T and CHO-K1, that do not express theendogenous Pax6 proteins (see Figure 4(B)). Inaddition, we did not find expression of other Paxgenes in these cell lines using Pax2/5/8- and Pax3/7-panspecific antibodies (data not shown).

Expression of Pax6, MafB, c-Maf, NRL, Six3 andSox2 in rabbit lens epithelial cells, N/N1003A,agrees with the in vivo expression of these genes inlens epithelium.17–19,26,32,36,37,44,45,43 Furthermore,lack of expression of Sox1 is consistent with itsexpression in vivo in differentiating lens fibers.28

The results of transcriptional studies of aB- andgF-crystallins combined with expression patterns ofPax6/Pax6(5a), c-Maf, MafA, MafB, NRL, Sox2,Sox1, RARb/RXRb, and Six3 in the embryonic lensare summarized in “promoter occupancy” modelsshown in Figure 10. The model of the aB-crystallinpromoter emphasizes that at least three, andmost ofthe time four or more, tissue-restricted transcriptionfactors have to be employed to confer the lens-preferred activity of the aB-crystallin in lensprecursor cells and in lens epithelium until E12.5(controlled by Pax6/Pax6(5a), MafB and RARb/RXRb), embryonic and adult lens epithelium(regulated by Pax6/Pax6(5a) and MafB) andembryonic and postnatal lens fibers (mediated byPax6/Pax6(5a), MafA, c-Maf and NRL). We alsopropose that the gF-crystallin promoter is occupiedin the lens precursor cells and lens epithelium byPax6/Pax6(5a) and Six3, serving as repressors,counteracting transcriptional activators includingMafB and Sox2 bound to the proximal promoterregion, and RARb/RXRb bound more distally nextto Pax6 proteins. We speculate that such promoteroccupancy allows rapid gene activation triggeredby the departures of the Six3 and Pax6 proteinsfrom the promoter concomitant with the recruit-ment of an abundance of MafA, c-Maf, NRL andSox1 in differentiating primary lens fiber cells (seeFigure 10). The “residual” Pax6 proteins are morelikely to be required for the maintenance of c-Mafand MafA expression in the lens31,56 and less likelyto inhibit b- and g-crystallin gene expression.24,41,42

It is also possible that early binding of Pax6 to thegF-crystallin promoter in lens precursor and pro-genitor cells is required for the epigenetic regulationof this promoter.To elucidate the opposite roles of Pax6/Pax6(5a)

in the regulation of two crystallin genes, both highlyexpressed in lens fiber cells, and regulated by atleast four common regulatory elements includingPax6-binding sites, MAREs, RAREs, and TATA-elements, requires further experimentation. Under-standing why and when Pax6 proteins act astranscriptional activators or repressors is an import-ant biological question critical for understandingkey roles of Pax6 in embryonic development.57,58

We hypothesize that both specific crystallinpromoter architecture combined with its occupancydetermine whether Pax6 proteins act as transcrip-tional activators or repressors. Indeed, the presentdata show that functional interactions betweenPax6 and Maf proteins have opposite outcomes,i.e. activation of the aB-crystallin, or repression ofthe gF-crystallin promoter. A number of possi-bilities may exist for the arrangements of Pax6-binding sites and MAREs. Pax6-binding sites and aMARE are about 130 bp apart in the gF-crystallin

Figure 10. Diagrammatic representation of transcription factors interacting with mouse aB- and gF-crystallinpromoters in lens epithelial and differentiating lens fiber cells. Upper panel, aB-crystallin is expressed in the lensplacode, embryonic and adult lens fibers. Pax6 proteins synergistically interact with Mafs expressed in lens epithelium.Lower panel, expression of the gF-crystallin is repressed in lens epithelium by Pax6 and Six3. In adult lens fiber cells,where Pax6 but not Six3 is expressed, full activation is achieved as the amount of Pax6 proteins decreases (KPax6), andpartial activation is shown in the presence of Pax6 proteins (CPax6). Lens placode cells, LPC; largeMafs expressed in thelens epithelium (MafB and to lesser extent c-Maf), epMafs; large Mafs expressed in the lens fiber cells (MafA, c-Maf andNRL), fMafs.


gene. A direct physical interaction between Pax6and large Maf proteins in the gF-crystallin genemay be mediated by a DNA loop55,59 which couldimpair the recruitment of co-activators includingCBP/p300 by Mafs.60,61 In contrast, if these sites arenext to each other, as in LSR1a and LSR2 of the aB-crystallin gene, the resulting physical interaction

may include different parts of their molecules andfacilitate transcriptional synergism (see Figures 2and 3). Both direct interaction between Pax6 andMafA and transcriptional synergism between thesefactors have been shown for the G1 and G3regulatory elements of the rat glucagonpromoter.51 As there are other mammalian


crystallins genes including the mouse aA-andguinea pig z-crystallins possessing both Pax6 andlarge Maf binding sites,19,39,62,63 the number of theirarrangements available for mechanistic studies iseven increased.

Transcriptional repression of the gF-crystallingene via Six3 is likely due to the recruitment oftranscriptional co-repressors Grg4 and Grg5 bySix3.61 A similar possibility for Pax6 proteinsseems to be unlikely as no evidence was obtainedfor the recruitment of Grg4 by Pax6 proteins.24 Pax6contains a lysine residue (K90) in its paireddomain that may be sumoylated. Sumoylation is apostranslational mechanism that converts a numberof transcriptional activators including Elk1, c-Myb,Sp3, and AP-2 into repressors.64

In summary, the present data provide furtherevidence that temporally and spatially regulatedexpression of transcription factors including Pax6,large Mafs, Six3, Sox1 and Sox2, and retinoic acidnuclear receptors, during different stages of lensformation and development regulate temporal andspatial expression of crystallins in differentcompartments of the lens. Continuous studies ofthe aB- and gF-crystallin promoters in vivo and incell cultures offer a unique opportunity to addressthe molecular mechanism of Pax6-mediatedtranscriptional activation and repression.

Materials and Methods

Materials

The following oligonucleotides were used as probes inEMSAs: LSR1, 5 0-GCTGGGATAATAAAACCCCTGACCTCACCATTCCA; LSR2a, 5 0-TGTTTCTCTTTTCTTAGCTCAGTGAGTACCGGGTAT; and LSR2b, GAGTACCGGGTATGTGTCACCCTGCCAAATCCCTGATCACAAGT. The following oligonucleotides were used asspecific competitors in EMSAs: M1 LSR2a,TGTTTCTCTTTTCTTAcagCAGTGctgACCGGGTAT, M1mutant of LSR2a; M2LSR2b, GAGTACCGGGTATGTcaCACCCTGatggATCCCTGATCACAAGT, mutant M2 ofLSR2b; M3 LSR1, GCTGGGATAATAAAtgCCCTGtgCTCACCATTCCA, mutant M3 of LSR1; RARE, AGGGTAGGGTTCACCGAAAGTTCACTC, mutated RARE, AGGGTAGGGaaCACCGAAAGaaCACTC; RXRE, AGCTTCAGGTCAGAGGTCAGAGAGCT; mutated RXRE,AGCTTCAGcaCAGAGcaTCAGAGAGCT; T-MARE,TCTGTGGGCATTTGCTGACTCAGCATTTGGTGTCG;mutated T-MARE, TCTGTGGGCATTTcagGACTCctgATTTGGTGTCG. Mutated nucleotides are indicated bylower case letters, and consensus binding sites for RAREand T-MARE are underlined. P6CON and 5aCONoligonucleotides have been described.40

Plasmids

Mouse aB- (K162 to C45) and gF- (K226 to C44)crystallin promoter fragments luciferase containingreporter, pGL3, were described earlier.15,40 Four copiesof LSR1 were cloned into E4TATA-pGL315,40 using asynthetic double stranded oligonucleotide 5 0-ctagCTGGGATAATAAAACCCCTGACCTCACCATTCCAGCGGTGAGCTGGGATAATAAAACCCCTGACCTCACCATTC

CAG-3 0). Similarly, two copies of LSR2 (5 0-ctagTGTTTCTCTTTTCTTAGCTCAGTGAGTACCGGGTATGTGTCACCCTGCCAAATCCCTGATCACAAGTCCATG-3 0), four copies of LSR2a (5 0-ctagTGTTTCTCTTTTCTTAGCTCAGTGAGTACCGGGTATGTGTCGTGTTTCTCTTTTCTTAGCTCAGTGAGTACCGGGTATGTGTC-3 0),and four copies of LSR2b (5 0-ctagTACCGGGTATGTGTCACCCTGCCAAATCCCTGATCACAAGTCGAGTACCGGGTATGTGTCACCCTGCCAAATCCCTGATCACAAGTC-3 0) were used. Nucleotides used for subcloning areindicated by lower case letters. The oligonucleotides(Invitrogen, Gaithersburg, MD) were gel purified beforethe phosphorylation and annealing. The final constructswere verified by sequencing.

Transfections and reporter assays

Expression vectors encoding c-Maf, MafA, Pax6,Pax6(5a), Sox2 and Six3a in CMV-driven vector pKW10were described earlier.15 Expression vector encoding ratMafB in pKW10 was generated from a plasmid providedby Dr K. Yoshida. Expression vector pCMV-Sox2 waskindly obtained from Dr C. Basilico. Expression vectorspSV40RARb and pRSVRXRb were obtained from Dr K.Ozato and were described earlier.14 Expression vectorencoding mouse Sox1 was assembled from three sub-fragments generated by PCR using the genomic DNA(Novagen, Madison, WI) and cDNAs generated from E11mouse embryo (Clontech, Palo Alto, CA). Tranfections of293T, CHO-K1 and N/N1003A cells, and treatment withthe all-trans retinoic acid (Sigma, St. Louis, MO) wereperformed as described earlier.15,40 The amounts ofexpression plasmids were 200 ng of Pax6, 25 ng ofPax6(5a), and 80 ng of each MafA, MafB, c-Maf, NRL,RARb, RXRb, Six3a, Sox1, and Sox2.15

Western blot analysis

Expression vectors containing 3xFlag tagged Pax6,Pax6(5a), MafA, MafB, c-Maf, NRL, Six3, Sox1 and Sox2were generated in p3xFLAG-CMV-10 (Sigma, St. Louis,MO). The whole cell lysates were denaturated underreducing conditions, loaded onto SDS-12% PAGE precastgels (Bio-Rad, Richmond, CA), and transferred tonitrocellulose membranes. The following antibodieswere used: anti-Pax6 (dilution 1 : 500, DevelopmentalHybridoma Bank, Iowa City, IW), anti-MafA (dilution1 : 2000, provided by Dr M. P. Felder), anti-MafB (sc-10022), anti c-Maf (sc-7866), anti-NRL (provided by Dr A.Swaroop, dilution 1 : 2000), anti-Six3 (sc-9126), anti-Sox1(sc-17317), anti Sox2 (sc-20088), and anti-TBP (sc-273). Theantibodies from St. Cruz Biotechnology (St. Cruz, CA)were used at dilution 1 : 1000. Anti-Flag M2 monoclonalantibody was obtained from Sigma (St. Louis, MO) andused at dilution 1 : 2500. Secondary antibodies were anti-mouse HRP (dilution 1 : 2000, Amersham, Piscataway,NJ), anti-rabbit and anti-goat HRP (dilution 1 : 5000,Vector Laboratories, Burlingame, CA).

Electrophoretic mobility shift assay (EMSA)

Three oligonucleotides LSR1a, LSR1b, and LSR2 wereradioactively end-labeled and incubated with lensnuclear extracts prepared from mouse lens epithelialcell line aTN4-1 as described earlier.39 The EMSA wereperformed as described elsewhere.39,40 Specific oligo-nucleotide competitors (20 ng) were used in approxi-mately 50-fold excess over the labeled probe (w0.4 ng).


Acknowledgements

This work was supported by grants fromNational Institutes of Health, EY12200 and 12427,and a Career Development Award from Research toPrevent Blindness, Inc. (to A.C.). We thank DrMariePaule Felder for critical reading of the manuscript.We are grateful to Drs M. Busslinger, C. Basilico,M. P. Felder, Z. Kozmik, R. Maas, K. Ozato, A.Sharma, A. Swaroop, and K. Yoshida for antibodies,expression plasmids or individual cDNAs. Wethank Ales Cvekl, Jr for his help to revise and editthe manuscript.

References

1. Sax, C. M. & Piatigorsky, J. (1994). Expression of thea-crystallin/small heat shock protein/molecularchaperone genes in the lens and other tissues.Advan. Enzymol. Relat. Areas Mol. Biol. 69, 155–201.

2. Horwitz, J. (2003). Alpha-crystallin. Exp. Eye Res. 76,145–153.

3. Bhat, S. P. (2003). Crystallins, genes and cataract. Prog.Drug Res. 60, 205–262.

4. Wistow, G., Turnell, B. & Summers, L. (1983). X-rayanalysis of the eye lens protein g-II crystallin at 1.9 Aresolution. J. Mol. Biol. 170, 175–202.

5. Jaenicke, R. & Slingsby, C. (2001). Lens crystallins andtheir microbial homologs: structure, stability, andfunction. Crit. Rev. Biochem. Mol. Biol. 36, 435–499.

6. Robinson, M. L. & Overbeek, P. A. (1996). Differentialexpression of aA- and aB-crystallin during murineocular development. Invest. Ophthal. Vis. Sci. 37,2276–2284.

7. Moormann, R. J., den Dunnen, J. T., Heuyerjans, J.,Jongbloed, R. J., van Leen, R. W., Lubsen, N. H. &Schoenmakers, J. G. (1985). Characterization of the ratgamma-crystallin gene family and its expression inthe eye lens. J. Mol. Biol. 182, 419–430.

8. Den Dunnen, J. T., Moormann, R. J. M., Lubsen, N. H.& Schoenmakers, J. G. G. (1986). Concerted anddivergent evolution within the rat g-crystallin family.J. Mol. Biol. 189, 37–46.

9. Cvekl, A., Yang, Y., Chauhan, B. K. & Cveklova, K.(2004). Regulation of gene expression by Pax6 inocular cells: a case of tissue-preferred expression ofcrystallins in lens. Int. J. Dev. Biol. 48. In the press.

10. Duncan, M. K., Cvekl, A., Kantorow, M. &Piatigorsky, J. (2004). Lens crystallins. In Developmentof the Ocular Lens (Robinson, M. J. & Lovicu, M., eds),pp. 119–150, Oxford University Press, Cambridge.

11. Cvekl, A. & Piatigorsky, J. (1996). Lens developmentand crystallin gene expression: many roles for Pax-6.BioEssays, 18, 621–630.

12. Gopal-Srivastava, R. & Piatigorsky, J. (1994). Identifi-cation of a lens-specific regulatory region (LSR) of themurine aB-crystallin gene. Nucl. Acids Res. 22, 1281–1286.

13. Gopal-Srivastava, R., Cvekl, A. & Piatigorsky, J.(1996). Pax-6 and aB-crystallin/small heat shockprotein gene regulation in the murine lens. Interactionwith the lens-specific regions, LSR1 and LSR2. J. Biol.Chem. 271, 23029–23036.

14. Gopal-Srivastava, R., Cvekl, A. & Piatigorsky, J.(1998). Involvement of retinoic acid/retinoid

receptors in the regulation of murine aB-crystal-lin/small heat shock protein gene expression in thelens. J. Biol. Chem. 273, 17954–17961.

15. Chauhan, B. K., Yang, Y., Cveklova, K. & Cvekl, A.(2004). Functional interactions between alternativelyspliced forms of Pax6 in crystallin gene regulationand in haploinsufficiency. Nucl. Acids Res. 32,1696–1709.

16. Chauhan, B. K., Zhang, W., Cveklova, K., Kantorow,M. & Cvekl, A. (2002). Identification of differentiallyexpressed genes in mouse Pax6 heterozygous lenses.Invest. Ophthalmol. Vis. Sci. 43, 1884–1890.

17. Kawauchi, S., Takahashi, S., Nakajima, O., Ogino, H.,Morita, M., Nishizawa, M. et al. (1999). Regulation oflens fiber cell differentiation by transcription factorc-Maf. J. Biol. Chem. 274, 19254–19260.

18. Kim, J. I., Li, T., Ho, I.-C., Grusby, M. J. & Glimcher,L. H. (1999). Requirement for the c-Maf transcriptionfactor in crystallin gene regulation and lens develop-ment. Proc. Natl Acad. Sci. USA, 96, 3781–3785.

19. Ring, B. Z., Cordes, S. P., Overbeek, P. A. & Barsh, G. S.(2000). Regulation of mouse lens fiber celldevelopment and differentiation by the Maf gene.Development, 127, 307–317.

20. Goring, D. R., Bryce, D. M., Tsui, L.-C., Breitman,M. L. & Liu, Q. (1993). Developmental regulation andcell type-specific expression of the murine gF-crystal-lin gene is mediated through a lens-specific elementcontaining the gF-1 binding site. Dev. Dynam. 196,143–152.

21. Liu, Q., Tini, M., Tsui, L.-C. & Breitman, M. L. (1991).Interaction of a lens cell transcription factor with theproximal domain of the mouse gF-crystallinpromoter. Mol. Cell. Biol. 11, 1531–1537.

22. Tini, M., Otulatowski, G., Breitman, M. L., Tsui, L.-C.& Giguere, V. (1993). An everted repeat mediatesretinoic acid induction of the gF-crystallin gene:evidence of a direct role for retinoids in lensdevelopment. Genes Dev. 7, 295–307.

23. Tini, M., Fraser, R. A. & Giguere, V. (1995). Functionalinteractions between retinoic acid receptor-regulatedorphan nuclear receptor (RORa) and the retinoic acidreceptors in the regulation of the gF-crystallinpromoter. J. Biol. Chem. 270, 20156–20161.

24. Kralova, J., Czerny, T., Spanielova, H., Ratajova, V. &Kozmik, Z. (2002). Complex regulatory elementwithin the gE- and gF-crystallin enhancers mediatesPax6 regulation and is required for induction byretinoic acid. Gene, 286, 271–282.

25. Lengler, J., Krausz, E., Tomarev, S., Prescott, A.,Quinlan, R. A. & Graw, J. (2001). Antagonistic actionof Six3 and Prox1 at the g-crystallin promoter. Nucl.Acids Res. 29, 515–526.

26. Kamachi, Y., Soskanathan, S., Liu, Q., Breitman, M. L.,Lovell-Badge, R. & Kondoh, H. (1995). Involvement ofSOX proteins in lens-specific activation of crystallingenes. EMBO J. 14, 3510–3519.

27. Civil, A., van Genesen, S. T. & Lubsen, N. H. (2002).c-Maf, the gD-crystallin maf-responsive elementand growth factor regulation. Nucl. Acids Res. 30,975–982.

28. Nishiguchi, S., Wood, H., Kondoh, H., Lovel-Badge,R. & Episkopou, V. (1998). Sox1 directly regulates theg-crystallin genes and is essential for lens develop-ment in mice. Genes Dev. 12, 776–781.

29. Hussain, M. A. & Habener, J. F. (1999). Glucagon genetranscription activation mediated by synergistic inter-actions of pax-6 and cdx-2 with the p300 co-activator.J. Biol. Chem. 274, 28950–28957.


30. Planque, N., Leconte, L., Coquelle, F. M., Benkhelifa,S., Martin, P., Felder-Schmittbuhl, M. P. & Saule, S.(2001). Interaction of Maf transcription factors withPax-6 results in synergistic activation of the glucagonpromoter. J. Biol. Chem. 276, 35751–35760.

31. Sakai, M., Serria, M. S., Ikeda, H., Yoshida, K., Imaki, J.& Nishi, S. (2001). Regulation of c-maf geneexpression by Pax6 in cultured cells. Nucl. Acids Res.29, 1228–1237.

32. Ashery-Padan, R., Marquardt, T., Zhou, X. & Gruss, P.(2000). Pax6 activity in the lens primordium isrequired for lens formation and for correct placementof a single retina in the eye. Genes Dev. 14, 2701–2711.

33. Enwright, J. F., III & Grainger, R. M. (2000). Alteredretinoid signaling in the heads of Small eye mouseembryos. Dev. Biol. 221, 10–22.

34. Mori, M., Ghyselinck, N. B., Chambon, P. & Mark, M.(2001). Systematic immunolocalization of retinoidreceptors in developing and adult mouse eyes. Invest.Ophthalmol. Vis. Sci. 42, 1312–1318.

35. Blank, V. & Andrews, N. C. (1997). The Maftranscription factors: regulators of differentiation.Trends Biochem. Sci. 22, 437–441.

36. Walther, C. & Gruss, P. (1991). Pax-6, a murine pairedbox gene, is expressed in the developing CNS.Development, 113, 1435–1456.

37. Sakai, M., Imaki, J., Yoshida, K., Ogata, A.,Matsushima-Hibiya, Y., Kuboki, Y. et al. (1997). Ratmaf genes: specific expression on chondrocytes, lensand spinal cord. Oncogene, 14, 745–750.

38. Dubin, R. A., Gopal-Srivastava, R., Wawrousek, E. F.& Piatigorsky, J. (1991). Expression of the murine aB-crystallin gene in lens and skeletal muscle: identifi-cation of a muscle-preferred enhancer. Mol. Cell. Biol.11, 4340–4349.

39. Cvekl, A., Kashanchi, F., Sax, C. M., Brady, J. N. &Piatigorsky, J. (1995). Transcriptional regulation of themouse aA-crystallin gene: activation dependent on acyclic AMP-responsive element (DE1/CRE) and aPax-6-binding site. Mol. Cell. Biol. 15, 653–660.

40. Chauhan, B. K., Yang, Y., Cveklova, K. & Cvekl, A.(2004). Functional properties of natural human PAX6and PAX6(5a) mutants. Invest. Ophthalmol. Vis. Sci. 45,385–392.

41. Duncan, M. K., Haynes, J., Cvekl, A. & Piatigorsky, J.(1998). Dual roles for Pax-6: a transcriptional repres-sor of lens fiber cell-specific b-crystallin genes. Mol.Cell. Biol. 18, 5579–5586.

42. Cui, W., Tomarev, S. I., Piatigorsky, J., Chepelinsky,A. B. & Duncan, M. K. (2004). Mafs, Prox1 and Pax6can regulate chicken bB1-crystallin gene expression.J. Biol. Chem. 279, 11088–11095.

43. Oliver, G., Mailhos, A., Wehr, R., Copeland, N. G.,Jenkins, N. A. & Gruss, P. (1995). Six3, a murinehomologue of the sine oculis gene, demarcates themost anterior border of the developing neural plateand is expressed during eye development.Development, 121, 4045–4055.

44. Liu, Q., Breitman, M. L., Hitchcock, P. F. & Swaroop,A. (1996). Expression of the bZIP transcription factorgene Nrl in the developing nervous system.Oncogene,12, 207–211.

45. Lecoin, L., Sii-Felice, K., Pouponnot, C., Eychene, A. &Felder-Schmittbuhl, M. P. (2004). Comparison of mafgene expression patterns during chick embryodevelopment. Gene Expr. Patterns, 4, 35–46.

46. Zhang, W., Cveklova, K., Oppermann, B., Kantorow,

M. & Cvekl, A. (2001). Quantitation of PAX6 andPAX6(5a) transcript levels in adult human lens,cornea, and monkey retina. Mol. Vis. 7, 1–5.

47. Matsuo, I. & Yasuda, K. (1992). The cooperativeinteraction between two motifs of an enhancerelement of the chicken aA-crystallin gene, aCE1 andaCE2, confers lens-specific expression. Nucl. AcidsRes. 20, 3701–3712.

48. Ogino, H. & Yasuda, K. (1998). Induction of lensdifferentiation by activation of a bZIP transcriptionfactor, L-Maf. Science, 280, 115–118.

49. Benkhelifa, S., Provot, S., Nabais, E., Eychene, A.,Calothy, G. & Felder-Schmittbuhl, M. P. (2001).Phosphorylation of MafA is essential for its transcrip-tional and biological properties. Mol. Cell. Biol. 21,4441–4452.

50. Kataoka, K., Han, S., Shoda, S., Hirai, M., Nishizawa,M. & Handa, H. (2002). MafA is a glucose-regulatedand pancreatic b-cell-specific transcriptional activatorfor the insulin gene. J. Biol. Chem. 277, 49903–49910.

51. Olbrot, M., Rud, J., Moss, L. G. & Sharma, A. (2002).Identification of b-cell-specific insulin gene transcrip-tion factor RIPE3b1 as mammalian MafA. Proc. NatlAcad. Sci. USA, 99, 6737–6742.

52. Frederikse, P. H., Dubin, R. A., Haynes, J. I., II &Piatigorsky, J. (1994). Structure and alternate tissue-preferred transcription initiation of the mouse aB-crystallin/small heat shock protein gene. Nucl. AcidsRes. 22, 5686–5694.

53. Kerppola, T. K. & Curran, T. (1994). A conservedregion adjacent to the basic domain is required forrecognition of an extended DNA binding site byMaf/NRL family of proteins. Oncogene, 9, 3149–3158.

54. Somasundaram, T. & Bhat, S. P. (2000). Canonical heatshock element in the aB-crystallin gene shows tissue-specific and developmentally controlled interactionswith heat shock factor. J. Biol. Chem. 275, 17154–17159.

55. Su, W., Jackson, S., Tjian, R. & Echols, H. (1991). DNAlooping between sites for transcriptional activation:self-association of DNA-bound Sp1. Genes Dev. 5,820–826.

56. Reza, H. M., Ogino, H. & Yasuda, K. (2002). L-maf, adownstream target of Pax6, is essential for chick lensdevelopment. Mech. Dev. 116, 61–73.

57. Simpson, T. I. & Price, D. J. (2002). Pax6: a pleiotropicplayer in development. BioEssays, 24, 1041–1051.

58. Cvekl, A. & Tamm, E. R. (2004). Anterior eyedevelopment and ocular mesenchyme: new insightsfrom mouse models and human diseases. BioEssays,26, 374–386.

59. Mastrangelo, I. A., Courey, A. J., Wall, J. S., Jackson,S. P. & Hough, P. V. (1991). DNA looping and Sp1multimer links: a mechanism for transcriptionalsynergism and enhancement. Proc. Natl Acad. Sci.USA, 88, 5670–5674.

60. Chen, Q., Dowhan, D. H., Liang, D., Noore, D. D. &Overbeek, P. A. (2002). CREB-binding protein/p300co-activation of crystallin gene expression. J. Biol.Chem. 277, 24081–24089.

61. Zhu, C. C., Dyer, M. A., Uchikawa, M., Kondoh, H.,Lagutin, O. & Oliver, G. (2002). Six3-mediated autorepression and eye development requires its inter-action with members of the Groucho-related family ofco-repressors. Development, 129, 2835–2849.

62. Richardson, J., Cvekl, A. & Wistow, G. (1995). Pax-6 isessential for lens-specific expression of z-crystallin.Proc. Natl Acad. Sci. USA, 92, 4676–4680.

63. Sharon-Friling, R., Richardson, J., Sperbeck, S., Lee,D., Rauchman, M., Maas, R. et al. (1998). Lens-specific


gene recruitment of z-crystallin through Pax6, NRL-Maf, and brain suppressor sites. Mol. Cell. Biol. 18,2067–2076.

64. Freiman, R. & Tjian, R. (2003). Regulating theregulators: lysine modifications make their mark.Cell, 112, 11–17.

Edited by M. Yaniv

(Received 16 April 2004; received in revised form 23 July 2004; accepted 29 July 2004)

Documents

Transcriptional Regulation of Mouse αB- and γF-Crystallin Genes in Lens: Opposite Promoter-specific Interactions Between Pax6 and Large Maf Transcription Factors