ology 213 (2006) 216–223www.elsevier.com/locate/ytaap

Toxicology and Applied Pharmac

Transplacental arsenic plus postnatal 12-O-teradecanoyl phorbol-13-acetateexposures associated with hepatocarcinogenesis induce similar aberrant gene

expression patterns in male and female mouse liver

Jie Liu a,⁎, Yaxiong Xie a, B. Alex Merrick b, Jun Shen a, Danica M.K. Ducharme b,Jennifer Collins b, Bhalchandra A. Diwan c, Daniel Logsdon c, Michael P. Waalkes a

a Inorganic Carcinogenesis Section, Laboratory of Comparative Carcinogenesis, National Cancer Institute at NIEHS,Mail Drop F0-09, Research Triangle Park, NC 27709, USA

b National Center for Toxicogenomics, NIEHS, Research Triangle Park, NC 27709, USAc Basic Research Program, SAIC, NCI-Frederick, Frederick, MD 21702, USA

Received 26 August 2005; revised 25 October 2005; accepted 26 October 2005Available online 20 December 2005

Abstract

Our prior work shows that in utero arsenic exposure alone is a complete transplacental carcinogen, producing hepatocellular carcinoma in adultmale offspring but not in females. In a follow-up study to potentially promote arsenic-initiated tumors, mice were exposed to arsenic (85 ppm)from gestation day 8 to 18 and then exposed to 12-O-teradecanoyl phorbol-13-acetate (TPA), a well-known tumor promoter after weaning. Thedermal application of TPA (2 μg/0.1 ml acetone, twice/week for 21 weeks) after transplacental arsenic did not further increase arsenic-inducedliver tumor formation in adult males but significantly increased liver tumor formation in adult females. Thus, for comparison, liver tumors andnormal liver samples taken from adult male and female mice at necropsy were analyzed for aberrant gene/protein expression by microarray, real-time RT-PCR and Western blot analysis. Arsenic/TPA treatment resulted in increased expression of α-fetoprotein, k-ras, c-myc, estrogen receptor-α, cyclin D1, cdk2na, plasminogen activator inhibitor-1, cytokeratin-8, cytokeratin-18, glutathione S-transferases and insulin-like growth factorbinding proteins in liver and liver tumors from both male and female mice. Arsenic/TPA also decreased the expression of BRCA1, betaine-homocysteine methyltransferase, CYP7B1, CYP2F2 and insulin-like growth factor-1 in normal and cancerous livers. Alterations in these geneproducts were associated with arsenic/TPA-induced liver tumors, regardless of sex. Thus, transplacental arsenic plus postnatal TPA exposureinduced similar aberrant gene expression patterns in male and female mouse liver, which are persistent and potentially important to the mechanismof arsenic initiation of hepatocarcinogenesis.Published by Elsevier Inc.

Keywords: Arsenic; 12-O-teradecanoyl phorbol-13-acetate; Transplacental carcinogenesis; Gene expression; Microarray

Introduction

Inorganic arsenic is a known human carcinogen. Environ-mental arsenic exposure occurs mainly from consumption ofdrinking water contaminated with inorganic arsenic (NRC,1999), but it can also occur from burning of coal containinghigh levels of inorganic arsenic (Liu et al., 2002). Epidemiologystudies show that chronic arsenic exposure produces tumors ofthe skin, urinary bladder, lung, liver, prostate, kidney andpossibly other sit es ( IARC, 1987; NRC, 1999; Morales et al.,

⁎ Corresponding author. Fax: +1 919 541 3970.E-mail address: Liu6@niehs.nih.gov (J. Liu).

0041-008X/$ - see front matter. Published by Elsevier Inc.doi:10.1016/j.taap.2005.10.010

2000). The carcinogenic effects of inorganic arsenic exposure inrodents, particularly cancers of internal organs, had not beenunequivocally demonstrated until recently, making analysis ofmolecular events associated with arsenic carcinogenesis achallenge (Waalkes et al., 2004c).

In this regard, we have recently shown that a short-termmaternal inorganic arsenic exposure during gestation in miceproduces a variety of internal tumors in the offspring when theybecame adults (Waalkes et al., 2003). This includes aggressiveepithelial malignancies, such as hepatocellular carcinoma inmales. It is noteworthy that liver tumors have been repeatedlyidentified as a tumor type associated with arsenic exposure inhumans (Chen et al., 1997; NRC, 1999; Zhou et al., 2002;

217J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

Centeno et al., 2002; Chen and Ahsan, 2004; Chiu et al., 2004).An additional study used the combination of in utero arsenicexposure plus postnatal dermal application of TPA in mice in anattempt to produce skin tumors (Waalkes et al., 2004a).Although skin tumors were not induced, this study confirmedthe ability of arsenic alone to induce liver tumors in adult malemice (Waalkes et al., 2004a). The inclusion of TPA did notinfluence arsenic-induced liver tumor formation in males, but itsignificantly increased liver tumor incidence in females exposedto arsenic in utero (Waalkes et al., 2004a). Transdermalexposure to TPA in mice can have systemic tumor promotingeffects in the liver and other tissues (Armuth and Berenblum,1972, 1977; Goerttler et al., 1981; Diwan et al., 1993). Thus, itappears that transplacental arsenic acts as a complete carcinogenin the male liver, while it initiates events in the female liver thatcan be subsequently promoted to cause tumor formation.

The spectrum of tumors and/or proliferative lesions inducedby in utero arsenic exposure in the initial study, i.e., the liver,ovary, adrenal, uterus and oviduct, resembles the potentialtargets of carcinogenic estrogens (Waalkes et al., 2003; 2004a).This leads to the hypothesis that arsenic could somehowproduce estrogenic-like effects, possibly through estrogenreceptor-alpha (ER-α), in causing tumor formation (Waalkeset al., 2004b). Aberrant expression of ER-α is associated with avariety of human and rodent tumors (Fishman et al., 1995).Indeed, in livers and liver tumors from male mice exposed toarsenic in utero, the overexpression of ER-α and ER-α linkedgenes such as cyclin D1 and the feminization pattern of hepaticcytochrome P450 enzymes were evident (Waalkes et al., 2004b;Liu et al., 2004). Transplacental arsenic plus postnatal TPA

Table 1Primer Sequences for real-time RT-PCR analysis of selected genes

Gene GenBank# Forward

18S X56974 CGAACGTCTGAlpha-fetoprotein V00743 AGCTCAGCGAAnnexin A2 M14044 GTGGATGAGGBHMT AF033381 CACATCAGGGBRCA1 U31625 CAGATGGGCTcdkn2a NM_009877 CGTTCACGTAc-myc X01023 CGCCGCTGGGCyclin D1 M64403 GGGCACCTGGCYP2A4 J03549 GGAAGACGACYP2B9 M21855 TCTCTGTGGCCYP2F2 M77497 CCTTTGACCCCYP2J5 NM_010007 CAGACATGGACYP3A25 Y11995 TGGAGGCCTGCYP7B1 U36993 CCGATTCTGCEgr-1 M20157 AGGTTCCCATGST-alpha 4 AK008490 CTATGTTGAGGST-theta X98055 CTTGTTGGGCHO-1 M33203 CCTCACTGGCIGF-1 X04480 TTGCTTCCGGIGFBP-1 X81579 TGGACAGCTTIGFBP3 X81581 ATGCTGGGAGIGF-2 M14951 AGAGTTCAGACytokeratin-8 X12789 GAGTCTGGGACytokeratin-18 M11686 GGATGTGGAGPAI-1 M33960 TGCATCGCCTSyndecan-1 Z22532 GCCCCAGCAG

exposure produced liver tumors in females (Waalkes et al.,2004a), which provided an opportunity to examine whethersimilar molecular events occur in arsenic initiated hepatocarci-nogenesis in female livers and to compare and confirm theaberrant hepatic gene expression pattern seen when arsenicalone acts as a complete carcinogen in males (Waalkes et al.,2004b; Liu et al., 2004). This toxicogenomic analysis clearlydemonstrated that transplacental arsenic plus postnatal TPAexposures induced similar, gender-independent aberrant geneexpressions associated with hepatocarcinogenesis.

Materials and methods

Chemicals. Sodium arsenite (NaAsO2) was obtained from Sigma ChemicalCo. (St. Louis, MO) and dissolved in sterile distilled water to the desiredconcentrations in the drinking water at 85 mg arsenic/l (85 ppm). The MouseCustom Atlas Arrays (600 genes of our interest) were prepared by Clontech(Palo Alto, CA). [α-32P]dATP was obtained from PerkinElmer Life Sciences(Boston, MA). Monoclonal antibodies against alpha-fetoprotein (sc-8399), K-ras (sc-30), c-myc (sc-42), ER-α (sc-8002), fibronectin (sc-18827), β-actin (sc-1616) and polyclonal antibodies against cdk4 (sc-601) were obtained from SantaCruz Biotechnology (Santa Cruz, CA); monoclonal antibodies against PCNA(610664), cytokeratin-5/8 (550505) and PAI-1 (612024) were purchased fromBD Biosciences (San Jose, CA). All other chemicals were commerciallyavailable and of reagent grade.

Animal treatment and sample collection. The current study was performedusing liver tumor and non-tumorous normal liver samples collected at necropsyfrom our second transplacental arsenic carcinogenesis study (Waalkes et al.,2004a). Briefly, pregnant C3H mice were given drinking water containing 85ppm arsenic as sodium arsenite or unaltered water ad libitum from day 8 to day18 of gestation, and offspring were weaned at 4 weeks then randomly put intoseparate groups according to gender. TPA (2 μg/0.1 ml acetone, twice/week)was applied to a shaved area of dorsal skin for 21 weeks after weaning. The level

Reverse

CCCTATCAACTT CCGGAATCGAACCCTGATTGGAGAAATGGT GTTCACAGGGCTTGCTTCATTCTCACCATTGTCA CTCTGATAGGCGAAGGCAATGTCGATTGCA TCCCCAGCTGCCATGTTTGCAAGTAAAGG GAGTCAGCGTTTGGACCTACCTGCAGCTCTTCTG CGGGCGGGAGAAGGTAGTAAACTTT TCCTGGCTCGCAGATTGTAAATTGTTCT CACCGGAGACTCAGAGCAACGGTGCTTTC CCCGAAGACGATTGAGCTAATGAAGCCCTGTT GGTGTGCTGGAGGTATTTTTCCCGTGTTTATCC TCGAAGCGACTTCCGAAGACAGGAGCAAAGG GAATGCGCTCCTCCAAGCTAACTGCTAAAG TAACCAGCAGCACCCAGGTTCGTCTCCTT GCAGCCTTACTCTGCAAAGCTTGATCCCTGACT GGTACGGTTCTCCAGACCCTGGTGGTCAGGACTGT CTGTGGTGACACTGCAATTGGCCCACATCT CTGGGATGCCCTTCAAAGACTAGGAAATCATC CCTCGTGGAGACGCTTTACATAAGCTGTGATC AGAGCGGGCTGCTTTTGTAGCCACCTGATG TGATGGCGTTCCACAGGATTGTGGAAAGC GCATGGAGTGGATGGAACTTGGAGGCCAAACGT TTGCTGGACATCTCCGAAGAGTGCAGAACATGA TCCCCCATAGGATGAACTCAGTGCCCGATAC CGAGTTTGTGCCAGCTCTGAGCCATTG GGACATTTCCACAGTGGACCTTACCTTATTACTG CCCGATTCGGTCTCCTGAA

218 J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

of TPA exposure was based on a prior carcinogenesis study where it was used topromote the skin and liver tumors initiated by transplacental cisplatin exposure(Diwan et al., 1993). All samples in the present study are from TPA-treatedanimals, either without prior arsenic exposure (control) or after transplacentalarsenic exposure.

Microarray analysis. The custom-designed mouse cancer arrays (588 genes,Clontech) were used for cDNA microarray analysis as previously described (Liuet al., 2004). Total RNA was isolated from liver samples with TRIzol agent(Invitrogen, Carlsbad, CA), followed by purification and DNase-I digestion withRNeasy columns (Qiagen, Valencia, CA). Approximately 5 mg of total RNAwas converted to [a-32P]-dATP-labeled cDNA probe using MMLV reversetranscriptase and the Atlas customer array specific cDNA synthesis primer mixand then purified with a NucleoSpin column (Clontech, Palo Alto, CA). The

Fig. 1. Clustering analysis of altered liver gene expression in arsenic/TPA-exposed mclustered for comparison. Age-matched male (M–C) and female (F–C) received TPAinduced liver tumors (M-AsT, F-AsT) were from animals that received prenatal arsedecreased genes are shown in green.

membranes were prehybridized with Expresshyb from Clontech for 2 h at 68 °C,followed by hybridization with the cDNA probe overnight at 68 °C. Themembranes were then washed four times in 2× SSC/1% SDS, 30 min each, andtwo times in 0.1× SSC/0.5% SDS for 30 min. The membranes were then sealedwith plastic wrap and exposed to a Molecular Dynamics Phosphoimage Screen.The images were analyzed densitometrically using Atlas Image software(version 2.01). The gene expression intensities were first corrected with theexternal background and then globally normalized.

Real-time RT-PCR analysis. The levels of expression of the selected genes werequantified using real-timeRT-PCR analysis (Liu et al., 2004). Briefly, total RNAwasreverse transcribed with MuLV reverse transcriptase and oligo-dT primers. Theforward and reverse primer sequences for selected geneswere designedwith theABIPrimer Express software (Foster City, CA) and are listed inTable 1. The SYBRgreen

ice. The significantly altered genes under criteria of N2-fold and P b 0.05 werealone. Arsenic-exposed non-tumor liver samples (M-AsN, F-AsN) and arsenic-nic followed by postnatal TPA. The increased genes are shown in red, and the

219J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

PCR master mix (Applied Biosystems, Cheshire, UK) was used for real-time PCRanalysis. The relative differences in expression between groupswere expressed usingcycle time (Ct) values as follows: the Ct values of the interested genes were firstnormalized with β-actin of the same sample, and then the relative differencesbetween control and treatment groups were calculated and expressed as relativeincreases, setting control as 100%. Assuming that the Ct value is reflective of theinitial starting copy and that there is 100% efficiency, a difference of one cycle isequivalent to a two-fold difference in starting copy.

Western blot analysis. Tissues were homogenized (1:20, w:v) in PER-TissueProtein Extraction buffer (Pierce, Rockford, IL) containing freshly addedprotease inhibitor cocktail (CalBiochem, La Jolla, CA) and 100 mMphenylmethylsulfonyl fluoride. Cytosols were prepared by centrifugation at12,000 g for 10 min at 4 °C. Protein concentrations were determined using thedye-binding assay (Bio-Rad, Hercules, CA). Total protein (30 mg) wassubjected to electrophoresis on NuPAGEÒ Bis-Tris gels (4–12%) (Invitrogen,San Diego, CA), followed by electrophoretic transfer to nitrocellulosemembranes at 30 V for 1 h. Membranes were blocked in 5% dried milk inTBST (15 mM Tris–HCl, pH 7.4, 150 mM NaCl, and 0.08% Tween 20) for 2 h,followed by incubation with the primary antibody (1:200 to 1:1000) in Blotto(Pierce, Rockford, IL) overnight at 4 °C. After washes with TBST, themembranes were incubated in HRP-conjugated secondary antibody (1:4000 to1:10,000) for 1 h and washed with TBST 3 times. Immunoblots were visualizedusing SuperSignal chemiluminescent substrate.

Table 2Real-time RT-PCR analysis of selected genes in transplacental arsenic plus postnata

Gene categories Male

Control As-normal As-tumor

Oncogenes and HCC-relatedAFP 1.0 ± 0.1 0.8 ± 0.5 239 ± 43⁎

c-myc 1.0 ± 0.2 2.6 ± 0.5 1.8 ± 0.5PAI-1 1.0 ± 0.4 0.6 ± 0.3 15.9 ± 5.8⁎

Cytokeratin-8 1.0 ± 0.2 2.1 ± 0.3 3.2 ± 0.4⁎

Cytokeratin-18 1.0 ± 0.2 2.0 ± 0.3 3.7 ± 0.8⁎

BRCA1 1.0 ± 0.3 0.9 ± 0.3 0.6 ± 0.1Cyclin D1 1.0 ± 0.2 5.3 ± 1.0⁎ 20.3 ± 4.9⁎

Cdk2na 1.0 ± 0.3 1.8 ± 0.6 29.8 ± 8.0⁎

Syndecan-1 1.0 ± 0.2 0.6 ± 0.3 0.4 ± 0.1⁎

Growth factors and cell communicationsIGF-1 1.0 ± 0.1 1.2 ± 0.3 0.5 ± 0.1⁎

IGF-2 1.0 ± 0.4 1.2 ± 0.3 4.3 ± 1.9⁎

IGFBP1 1.0 ± 0.3 0.8 ± 0.3 26.2 ± 6.8⁎

IGFBP3 1.0 ± 0.1 1.6 ± 0.6 4.0 ± 1.0⁎

Genes for Metabolic enzymesCYP2A4 1.0 ± 0.1 2.5 ± 0.7 60.5 ± 17.3⁎

CYP2F2 1.0 ± 0.1 1.0 ± 0.2 0.4 ± 0.2⁎

CYP2B9 1.0 ± 0.4 2.1 ± 0.7 8.1 ± 2.5⁎

CYP2J5 1.0 ± 0.4 0.3 ± 0.1 0.3 ± 0.0⁎

CYP3A25 1.0 ± 0.4 0.4 ± 0.2 0.3 ± 0.1⁎

CYP7B1 1.0 ± 0.3 0.7 ± 0.1 0.5 ± 0.1⁎

BHMT 1.0 ± 0.1 0.4 ± 0.1⁎ 0.2 ± 0.1⁎

Stress-related genesGST-alpha4 1.0 ± 0.4 1.3 ± 0.2 4.6 ± 1.6⁎

GST-theta 1.0 ± 0.2 1.8 ± 0.2 3.3 ± 0.9⁎

EGR1 1.0 ± 0.3 1.1 ± 0.3 7.2 ± 1.3⁎

HO-1 1.0 ± 0.3 0.7 ± 0.1 1.3 ± 0.4SOD1 1.0 ± 0.1 1.0 ± 0.2 1.3 ± 0.3

All animals received TPA exposure (see Materials and methods). Data are mean ± SEMmale controls.⁎ Significantly different from controls P b 0.05.⁎⁎ Significantly different from male controls P b 0.05.

Statistics. For microarray analysis, pooled liver samples were performed intriplicate and individual samples (n = 3 to 5) were used for real time RT-PCRanalysis. Data are expressed as mean ± SEM. For comparisons of geneexpression between two groups, Students' t test was performed. Forcomparisons among three or more groups, data were analyzed of variance(ANOVA), followed by Duncan's multiple range test.

Results

Microarray analysis of aberrant expressed genes

Transplacental arsenic exposure alone induces a highincidence of hepatocellular tumors in male C3H mouseoffspring, while postnatal TPA exposure is required for livertumor formation in female offspring exposed to arsenic in utero(Waalkes et al., 2003, 2004a). Thus, total RNAs from control(TPA alone) mouse liver samples, arsenic/TPA-exposed non-tumorous liver samples and arsenic/TPA-induced liver tumorsfrom males and females were subjected to microarray analysis.Using the combined criteria of a N2-fold difference and P b 0.05for significant, the expression of approximately 70 genes among

l TPA hepatocarcinogenesis in male and female C3H mice

Female

Control % Male controls As-normal As-tumor

1.0 ± 0.2 (84) 1.8 ± 0.7 355 ± 124⁎

1.0 ± 0.3 (150) 1.3 ± 0.1 2.3 ± 0.41.0 ± 0.4 (320)⁎⁎ 2.4 ± 0.7 14.2 ± 3.7⁎

1.0 ± 0.3 (125) 2.3 ± 0.4 3.2 ± 0.9⁎

1.0 ± 0.2 (125) 2.7 ± 0.6 3.6 ± 0.8⁎

1.0 ± 0.3 (150) 1.0 ± 0.3 0.3 ± 0.1⁎

1.0 ± 0.3 (1140)⁎⁎ 1.2 ± 0.3 3.5 ± 1.0⁎

1.0 ± 0.4 (290) 1.2 ± 0.3 29.1 ± 0.8⁎

1.0 ± 0.5 (110) 1.1 ± 0.1 0.1 ± 0.1⁎

1.0 ± 0.4 (150) 1.4 ± 0.3 0.2 ± 0.1⁎

1.4 ± 0.4 (140) 1.0 ± 0.4 4.8 ± 1.7⁎

1.0 ± 0.5 (2100)⁎⁎ 0.8 ± 0.5 3.6 ± 1.1⁎

1.0 ± 0.2 (250)⁎⁎ 2.6 ± 0.6 5.3 ± 1.5⁎

1.0 ± 0.3 (5400)⁎⁎ 2.0 ± 0.3 1.4 ± 0.31.0 ± 0.3 (23)⁎⁎ 1.3 ± 0.3 0.2 ± 0.1⁎

1.0 ± 0.2 (5000)⁎⁎ 0.6 ± 0.2 0.2 ± 0.1⁎

1.0 ± 0.4 (160) 0.4 ± 0.2 0.1 ± 0.1⁎

1.0 ± 0.4 (230) 0.3 ± 0.1 0.1 ± 0.1⁎

1.0 ± 0.3 (10)⁎⁎ 1.4 ± 0.4 0.7 ± 0.11.0 ± 0.4 (120) 0.8 ± 0.3 0.2 ± 0.1⁎

1.0 ± 0.4 (130) 1.0 ± 0.3 2.1 ± 0.41.0 ± 0.3 (95) 2.5 ± 0.5 2.9 ± 0.5⁎

1.0 ± 0.2 (150) 0.7 ± 0.2 4.0 ± 1.2⁎

1.0 ± 0.3 (150) 1.0 ± 0.3 0.5 ± 0.21.0 ± 0.3 (95) 1.5 ± 0.3 0.7 ± 0.2

of 3–5 animals. For females, control expression is also given as a percentage of

Fig. 2. Western blot analysis of selected proteins in control mouse livers (TPAalone; Cont, lanes 1–2 and 7–8), arsenic-exposed non-tumorous livers (arsenicplus TPA; AsN, lanes 3–4 and 9–10) and arsenic-induced liver tumors (arsenicplus TPA; AsT, lanes 5–6 and 11–12) in adult male and female mice. The kDasize of the each protein is described in the text.

220 J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

588 genes on the array was significantly altered by arsenic/TPAexposure. Clustering analysis is shown in Fig. 1, using anexample cluster showing increased genes (in red) and a clusterfor decreased genes (shown in green). In arsenic/TPA-exposednon-tumorous livers and in arsenic/TPA-induced tumors,largely similar gene alteration patterns are evident in bothmale and female livers. Liver tumors generally had morepronounced alterations in gene expression than normal, tumor-surrounding tissue after in utero arsenic and postnatal TPAexposures. In general, arsenic/TPA induced gene alterations areconsistent with the gene expression changes from liver samplesof male mice exposed to arsenic alone in utero (Liu et al., 2004).Expression of selected genes was further analyzed by real-timeRT-PCR or Western blot.

Real-time RT-PCR analysis of aberrant gene expression

To verify microarray analysis, real-time RT-PCR analysis ofselected genes was performed. Real-time RT-PCR showed 95%concordance and appeared more sensitive than microarrayanalysis (Table 2). Among oncogenes and biomarkers of livertumors, dramatic increases in α-fetoprotein (AFP, 200-fold),plasminogen activator inhibitor-1 (PAI-1, 15-fold), cyclin D1(20-fold in male and 3.5-fold in female) and cdk2na (29-fold)were noted in arsenic/TPA-induced liver tumors. Arsenic/TPA-associated liver tumors also showed an increase (3-fold) incytokeratin-8 and cytokeratin-18 in both male and female livers.Basal expression of PAI-1 and cyclin D1 in female liver wasmuch higher than in males, but arsenic/TPA exposurenonetheless caused further increases in this expression.Expression of c-myc tended to increase but was not statisticallysignificant. On the other hand, the expression of breast cancersusceptibility locus 1 (BRCA-1, 30–60% of control) andsyndecan-1 (10–40% of control) was markedly decreased afterarsenic/TPA exposure in both male and female livers.

The expression of insulin-like growth factor-1 (IGF-I, 20–50% of control) was decreased, while the expression of IGF-II was increased 4-fold in arsenic/TPA-induced hepatocellulartumors in both male and female mice. Basal expression ofIGF-binding protein 1 (IGFBP1) and IGFBP3 was muchhigher in female liver. Arsenic/TPA exposure increased theexpression of IGFBP1 (26-fold in male and 3-fold in female)and IGFBP3 (4-fold in males and 5-fold in females).

A feminization pattern of metabolic enzymes was noted inarsenic-exposed male livers. The basal expression of femalepredominant CYP2A4 and CYP2B9 was much higher incontrol female livers. Arsenic/TPA exposure did not furtherincrease CYP2A4 and CYP2B9 expression in females.However, in arsenic/TPA-induced liver tumors in males, bothCYP2A4 (60-fold) and CYP2B9 (8-fold) were markedlyincreased, consistent with prior observations (Waalkes et al.,2004b). In comparison, the basal expression of male predom-inant CYP2F2 and CYP7B1 was significantly lower in femalelivers, and the levels were further decreased in arsenic/TPA-induced liver tumors (∼50%) regardless of sex. In addition, theexpressions of CYP2J5 (10–30% of control), CYP3A25 (10–30% of control), and betaine homocysteine methyltransferase

(BHMT, 20% of control) were similarly decreased in arsenic/TPA-exposed male and female livers.

For genes encoding for stress responses, arsenic/TPAexposure increased the expression of glutathione S-trans-ferases (GST-α4 and GST-θ) by 2–4-fold in both male andfemale liver. Early growth regulated protein 1 (EGR1) wasalso increased (4-fold in males and 7-fold in females) inarsenic/TPA-induced liver tumors, while the expression ofheme oxygenase-1 (HO-1) and extracellular superoxidedismutase-1 (SOD1) was not significantly altered.

Western blot analysis of aberrant expressed proteins

To further confirm the gene expression results at the proteinlevel, Western blot analysis was performed on selected proteins(Fig. 2). In general, Western blot analysis confirmed the geneexpression results and showed similar increases in theexpression of oncogenes AFP (≈75 kDa), K-ras (≈28 kDa)and c-Myc (≈70 kDa) in both male and female livers followingarsenic/TPA exposure, with higher protein levels seen in livertumors. The liver tumor biomarkers cytokeratin-8 (≈54 kDa),PAI-1 (≈47 kDa) and fibronectin (≈200 kDa) were allsignificantly increased in arsenic/TPA-induced liver tumors inboth male and female mice. The cell cycle regulators, such asestrogen receptor-α (ER-α, ≈70 kDa), proliferating cellularantigen (PCNA, ≈36 kDa) and cyclin-dependent kinase 4(cdk4, ≈33 kDa) were all significantly higher in liver tumorsthan peri-tumor normal tissue regardless of gender. Theexpression of β-actin (≈43 kDa) was consistent among lanes.

221J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

Discussion

Transplacental arsenic exposure plus dermal TPA applicationafter weaning produced hepatocellular tumors in both male andfemale C3H mice (Waalkes et al., 2004a) and allowed for thisstudy to examine gender-related and gender-independentaberrant gene expression in liver tumors and non-tumorousliver tissues. In general, the major alterations in gene expressionassociated with hepatocarcinogenesis formed by in utero arsenicexposure and postnatal TPA application are quite similarregardless of gender. These toxicogenomic alterations are alsoconsistent with our prior observations in male mice wheretransplacental arsenic alone acts as a complete hepatocarcino-gen (Waalkes et al., 2004b; Liu et al., 2004). Liver tumors havebeen associated with arsenic exposure in humans (Chen et al.,1997; NRC, 1999; Lu et al., 2001; Zhou et al., 2002; Centeno etal., 2002; Chen and Ahsan, 2004; Chiu et al., 2004), and thus,these genomic results with arsenic-induced liver tumors inexperimental animals are of particular relevance. Overall, thepresent results strongly support the concept that multiplegenetic events have occurred in transplacental arsenic hepato-carcinogenesis in mice. It is noteworthy that all these geneexpression changes were measured in adulthood long afterarsenic treatment had ended, indicating exposure to themetalloid in utero results in persistent aberrant gene expression.This is consistent with the emerging concept that early lifeexposures may induce aberrant genetic “reprogramming thatleads to cancer development later in life (Cook et al., 2005).

Combined TPA and arsenic produced skin tumors in Tg.ACmice, which overexpress the v-Ha-ras gene (Germolec et al.,1998). However, in utero arsenic followed by postnatal TPAfailed to produced any skin tumors in C3H mice (Waalkes et al.,2004a), suggesting that genetic background could be adetermining factor in arsenic-induced dermal carcinogenesis.In addition, it appears that the mechanism for arsenichepatocarcinogenesis may be distinct from arsenic-inducedskin cancer. Dermal TPA application after in utero arsenic notonly promotes arsenic-initiated liver tumor formation in femalesbut also increases arsenic-initiated lung tumor formation in bothmale and female mice (Waalkes et al., 2004a). Previous workshows postnatal dermal application of TPA will promote liverand/or lung tumors in mice transplacentally exposed todimethylnitrosame (Armuth and Berenblum, 1972), 7,12-dimethylbenz[a]-anthracene (Goerttler et al., 1981), 2-acetyla-minofluorene (Armuth and Berenblum, 1977) or cisplatin(Diwan et al., 1993). So TPA can promote liver cancer initiatedby a variety of chemicals, including arsenic. Indeed, in the TPA-promoted liver tumors from female mice exposed to arsenic inutero, assessed in the current study, a similar spectrum ofoncogene and oncoprotein expression alterations was observedwhen compared to males where arsenic alone is an effectivehepatocarcinogen (Liu et al., 2004). This included markedoverexpression of AFP, PAI-1, k-ras and c-myc at bothtranscript and protein levels. On the other hand, a decreasedexpression of tumor suppressor gene syndecan-1 and breastcancer susceptibility locus 1 (BRCA1) was observed in arsenic-induced liver tumors, regardless of sex. Thus, it appears the

process initiated by arsenic in utero is similar regardless of theneed for promoter exposure for eventual tumor formation.

Cell cycle dysregulation, as evidenced by marked increasesin cyclin D1, cdk4, cdkn2a, and PCNA, was also evident inliver and liver tumors from arsenic/TPA-treated male andfemale mice. Arsenic/TPA exposure markedly increased cyclinD1 expression in both sexes, despite much higher basalexpression of cyclin D1 in female livers. Overexpression ofcyclin D1 has been strongly implicated in the development ofliver cancer, and it is considered a hepatic oncogene (Deane etal., 2001). Overexpression of cyclin D1 appears to be a majorfactor in the hepatocarcinogenic effect of in utero arsenicexposure where arsenic alone acts as a complete livercarcinogen (Waalkes et al., 2004b). Cyclin D1 overexpressionhas also been reported after chronic arsenate exposure in ratliver (Cui et al., 2004) and in mouse skin during arsenic and UVirradiation co-carcinogenesis (Rossman et al., 2002). Cyclin D1is upregulated in arsenic transformed cells (Trouba et al., 2000;Chen et al., 2001) and appears to be involved in the co-mutagenicity of arsenic in vitro (Vogt and Rossman, 2001). Inurinary bladder hyperplastic and neoplastic lesions induced bythe dimethylated arsenical DMA, cyclin D1 is also over-expressed (Wei et al., 2002). Thus, the increases in cyclin D1and perhaps other positive cell cycle regulators appear to be aconsistent molecular event associated with arsenic exposureand could be important in the mechanism of arsenic-inducedtumor formation in several tissues, potentially including theliver, in a gender-independent fashion.

Liver feminization has been observed with arsenic-inducedtransplacental hepatocarcinogenesis, possibly through upregu-lation of the steroid receptor ER-α and activation of ER-αlinked genes (Waalkes et al., 2004b; Liu et al., 2004). In thepresent work in female mice, hepatic basal expressions of ER-αlinked genes, potentially including cyclin D1, CYP2A4 andCYP2B9 were much higher than in male mice, while the male-predominant CYP2F2 and CYP7B1 were much lower. In livertumors from male mice, the female-dominant CYP2A4 andCYP2B9 were dramatically increased, while the male-dominantCYP2F2 and CYP7B1 were significantly decreased. Thesefindings are consistent with a hepatic estrogenization inadulthood resulting from in utero arsenic exposure (Waalkeset al., 2004b). Arsenic/TPA exposure did not further increaseCYP2A4 and CYP2B9 expressions in females but did decreasemale-dominant CYP2F2 and CYP7B1 in female liver, againconsistent with estrogenization. The association betweenarsenic exposure and liver cancer has been observed in bothfemales and males (Chiu et al., 2004), although perhaps morefrequently in males (NRC, 1999; Zhou et al., 2002). The role ofliver feminization as a component in the hepatocarcinogeniceffect of arsenic is a consistent phenomenon in mice and isworthy of further investigation.

IGF axis disruption has been proposed as a critical event inhepatocarcinogenesis (Scharf and Braulke, 2003). Similar to ourinitial observations with arsenic alone as a hepatocarcinogen inmale mice (Liu et al., 2004), dysregulation of the IGF axis,including altered expression of IGF-I and IGF-II and IGFbinding proteins, was also evident in the present study. In many

222 J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

instance, the expression of IGF-I mRNA was lower in livertumors as compared with adjacent non-tumor tissues (Scharfand Braulke, 2003; Su et al., 1989) and circulating IGF-I oftenlower in human liver cancer patients (Stuver et al., 2000). Incontrast, increased expression of IGF-II is common in differentanimal models of hepatocarcinogenesis and in human hepato-cellular carcinoma (Scharf and Braulke, 2003). In the presentstudy, the expression of IGF-I in arsenic/TPA-induced livertumors was decreased ∼30%, while the expression of IGF-IIwas increased∼4-fold in both sexes. The overexpression of IGFbinding proteins such as IGFBP-I and IGFBP3 was also evidentin the present study. Despite the higher basal levels of IGFBP1and IGFBP3 in female livers, arsenic exposure further increasedtheir expressions (∼4-fold). Overexpression of IGFBP1 andIGFBP3 has been also observed in human liver tumors (Kondohet al., 2001). It should be noted that the consistent pattern ofdysregulation of IGF axis (decrease in IGF-I and increase inIGFBP1) seen in the present study is in accord with that seenduring mouse liver carcinogenesis induced by the non-genotoxic carcinogens such as oxazepam and Wyeth-14,643(Iida et al., 2003), which may point towards non-genotoxicmechanisms for inorganic arsenic.

The expression of stress-related genes such as GSTs (GST-alpha, mu and theta) was observed after arsenic/TPA exposure,consistent with the findings from chronic arsenic-exposedmouselivers (Xie et al., 2004a, 2004b). In comparison to acute arsenic-induced stress (Liu et al., 2001a), the expressions of solublesuperoxide dismutase and heme oxygenase-1 were largelyunchanged. Taken together, the altered expression of GSTsmight suggest the involvement of glutathione system in inorganicarsenic adaptation, although these events are occurring long afterarsenic exposure has ended in the transplacental model.Increased GSTs could help conjugate lipid peroxides producedduring lipid peroxidation and may also play an important role inarsenic conjugation for cellular efflux (Liu et al., 2001b).

In summary, this study demonstrated that in utero exposure toinorganic arsenic plus postnatal TPA causes remarkable andlong-lasting alterations in gene expression associated with livertumor formation that are largely consistent in both male andfemale mice. These genetic events were also largely consistentwith data from male mice developing liver cancers after in uteroexposure to arsenic alone (Waalkes et al., 2003, 2004a). Multiplegenetic events, including the activation of oncogenes, dysregula-tion of cell cycle, disruption of the IGF axis and liverfeminization, may contribute to arsenic hepatocarcinogenesis.Finally, the multitude of persistent expression changes thatoccurred in the offspring as adults after prenatal arsenic exposureand the consequent development of liver tumors emphasize theimportance of protecting pregnant women from arsenic exposure.

Acknowledgments

The authors thank critical review by Drs. LamiaBenbrahim-Talla, Wei Qu and Larry Keefer for their criticalreview on this manuscript. Research was funded in part bythe Intramural Research Program of the NIH, National Cancer

Institute, Center for Cancer Research, National Center forToxicogenomics, and contract NO1-CO-12400. The contentof this publication does not necessarily reflect the views orpolicies of the Department of Health and Human Services.

References

Armuth, V., Berenblum, I., 1972. Systemic promoting action of phorbol in liverand lung carcinogenesis in AKR mice. Cancer Res. 32, 2259–2262.

Armuth, V., Berenblum, I., 1977. Possible two-stage transplacental livercarcinogenesis in C57BL/6 mice. Int. J. Cancer 20, 292–295.

Centeno, J.A., Mullick, F.G., Martinez, L., Page, N.P., Gibb, H., Longfellow, D.,Thompson, C., Ladich, E.R., 2002. Pathology related to chronic arsenicexposure. Environ. Health Perspect. 110 (Suppl. 5), 883–886.

Chen, Y., Ahsan, H., 2004. Cancer burden from arsenic in drinking water inBangladesh. Am. J. Public Health 94, 741–744.

Chen, C.J., Yu, M.W., Liaw, Y.F., 1997. Epidemiological characteristics and riskfactors of hepatocellular carcinoma. J. Gastroenterol. Hepatol. 12,S294–S308.

Chen, H., Liu, J., Merrick, B.A., Waalkes, M.P., 2001. Genetic events associatedwith arsenic-induced malignant transformation: applications of cDNAmicroarray technology. Mol. Carcinog. 30, 79–87.

Chiu, H.F., Ho, S.C., Wang, L.Y., Wu, T.N., Yang, C.Y., 2004. Does arsenicexposure increase the risk for liver cancer? J. Toxicol. Environ. Health, PartA 67, 1491–1500.

Cook, J.D., Davis, B.J., Cai, S.L., Barrett, J.C., Conti, C.J., Walker, C.L., 2005.Interaction between genetic susceptibility and early life environmentalexposure determines tumor suppressor gene penetrance. Proc. Natl. Acad.Sci. U.S.A. 102, 8644–8649.

Cui, X., Li, S., Shraim, A., Kobayashi, Y., Hayakawa, T., Kanno, S., Yamamoto,M., Hirano, S., 2004. Subchronic exposure to arsenic through drinking wateralters expression of cancer-related genes in rat liver. Toxicol. Pathol. 32,64–72.

Deane, N.G., Parker, M.A., Aramandla, R., Diehl, L., Lee, W.J.,Washington, M.K., Nanney, L.B., Shyr, Y., Beauchamp, R.D., 2001.Hepatocellular carcinoma results from chronic cyclin D1 overexpressionin transgenic mice. Cancer Res. 61, 5389–5395.

Diwan, B.A., Anderson, L.M., Rehm, S., Rice, J.M., 1993. Transplacentalcarcinogenicity of cisplatin: initiation of skin tumors and induction of otherpreneoplastic and neoplastic lesions in SENCAR mice. Cancer Res. 53,3874–3876.

Fishman, J., Osborne, M.P., Telang, N.T., 1995. The role of estrogen inmammary carcinogenesis. Ann. N. Y. Acad. Sci. 768, 91–100.

Germolec, D.R., Spalding, J., Yu, H.S., Chen, G.S., Simeonova, P.P., Humble,M.C., Bruccoleri, A., Boorman, G.A., Foley, J.F., Yoshida, T., Luster, M.I.,1998. Arsenic enhancement of skin neoplasia by chronic stimulation ofgrowth factors. Am. J. Pathol. 153, 1775–1785.

Goerttler, K., Loehrke, H., Hesse, B., Milz, A., Schweizer, J., 1981. Diaplacentalinitiation of NMRI mice with 7,12-dimethylbenz[a]anthracene duringgestation days 6–20 and postnatal treatment of the F1-generation with thephorbol ester 12-O-tetradecanoylphorbol-13-acetate: tumor incidence inorgans other than the skin. Carcinogenesis 2, 1087–1094.

IARC (International Agency for Research on Cancer), 1987. IARC Monogr.,Suppl. 7. World Health Organization, Lyon, pp. 100–106.

Iida, M., Anna, C.H., Hartis, J., Bruno, M., Wetmore, B., Dubin, J.R., Sieber, S.,Bennett, L., Cunningham, M.L., Paules, R.S., Tomer, K.B., Houle, C.D.,Merrick, A.B., Sills, R.C., Devereux, T.R., 2003. Changes in global geneand protein expression during early mouse liver carcinogenesis induced bynon-genotoxic model carcinogens oxazepam and Wyeth-14,643. Carcino-genesis 24, 757–770.

Kondoh, N., Wakatsuki, T., Hada, A., Shuda, M., Tanaka, K., Arai, M.,Yamamoto, M., 2001. Genetic and epigenetic events in human hepatocarci-nogenesis. Int. J. Oncol. 18, 1271–1278.

Liu, J., Kadiiska, M.B., Liu, Y., Lu, T., Qu, W., Waalkes, M.P., 2001a. Stress-related gene expression in mice treated with inorganic arsenicals. Toxicol.Sci. 61, 314–320.

223J. Liu et al. / Toxicology and Applied Pharmacology 213 (2006) 216–223

Liu, J., Chen, H., Miller, D.S., Saavedra, J.E., Keefer, L.K., Johnson, D.R.,Klaassen, C.D., Waalkes, M.P., 2001b. Overexpression of glutathione S-transferase II and multidrug resistance transport proteins is associated withacquired tolerance to inorganic arsenic. Mol. Pharmacol. 60, 302–309.

Liu, J., Zheng, B., Aposhian, H.V., Zhou, Y., Chen, M.L., Zhang, A., Waalkes,M.P., 2002. Chronic arsenic poisoning from burning high-arsenic-containingcoal in Guizhou, China. Environ. Health Perspect. 110, 119–122.

Liu, J., Xie, Y., Ward, J.M., Diwan, B.A., Waalkes, M.P., 2004. Toxicogenomicanalysis of aberrant gene expression in liver tumors and nontumorous liversof adult mice exposed in utero to inorganic arsenic. Toxicol. Sci. 77,249–257.

Lu, T., Liu, J., LeCluyse, E.L., Zhou, Y.S., Cheng, M.L., Waalkes, M.P., 2001.Application of cDNA microarray to the study of arsenic-induced liverdiseases in the population of Guizhou, China. Toxicol. Sci. 59, 185–192.

Morales, K.H., Ryan, L., Kuo, T.-L., Wu, M.-M., Chen, C.-J., 2000. Risk ofinternal cancers from arsenic in the drinking water. Environ. HealthPerspect. 108, 655–661.

NRC (National Research Council), 1999. Arsenic in the Drinking Water.National Academy Press, Washington, pp. 1–310.

Rossman, T.G., Uddin, A.N., Burns, F.J., Bosland, M.C., 2002. Arsenitecocarcinogenesis: an animal model derived from genetic toxicology studies.Environ. Health Perspect. 110, 749–752 (Suppl.).

Scharf, J.G., Braulke, T., 2003. The role of the IGF axis in hepatocarcinogenesis.Horm. Metab. Res. 35, 685–693.

Stuver, S.O., Kuper, H., Tzonou, A., Lagiou, P., Spanos, E., Hsieh, C.C.,Mantzoros, C., Trichopoulos, D., 2000. Insulin-like growth factor 1 inhepatocellular carcinoma and metastatic liver cancer in men. Int. J. Cancer87, 118–121.

Su, T.S., Liu, W.Y., Han, S.H., Jansen, M., Yang-Fen, T.L., P'eng, F.K., Chou,C.K., 1989. Transcripts of the insulin-like growth factors I and II in humanhepatoma. Cancer Res. 49, 1773–1777.

Trouba, K.J., Wauson, E.M., Vorce, R.L., 2000. Sodium arsenite-induceddysregulation of proteins involved in proliferative signaling. Toxicol. Appl.Pharmacol. 164, 161–170.

Vogt, B.L., Rossman, T.G., 2001. Effects of arsenite on p53, p21 and cyclin Dexpression in normal human fibroblasts–A possible mechanism forarsenite's comutagenicity. Mutat. Res. 478, 159–168.

Waalkes, M.P., Ward, J.M., Liu, J., Diwan, B.A., 2003. Transplacentalcarcinogenicity of inorganic arsenic in the drinking water: induction ofhepatic, ovarian, pulmonary, and adrenal tumors in mice. Toxicol. Appl.Pharmacol. 186, 7–17.

Waalkes, M.P., Ward, J.M., Diwan, B.A., 2004a. Induction of tumors of theliver, lung, ovary and adrenal in adult mice after brief maternal gestationalexposure to inorganic arsenic: promotional effects of postnatal phorbol esterexposure on hepatic and pulmonary, but not dermal cancers. Carcinogenesis25, 133–141.

Waalkes, M.P., Liu, J., Chen, H., Xie, Y., Achanzar, W.E., Zhou, Y.S., Cheng, M.L., Diwan, B.A., 2004b. Estrogen signaling in livers of male mice withhepatocellular carcinoma induced by exposure to arsenic in utero. J. Natl.Cancer Inst. 96, 466–474.

Waalkes, M.P., Ward, J.M., Liu, J., Diwan, B.A., 2004c. Animal models forarsenic carcinogenesis: inorganic arsenic is a transplacental carcinogen inmice. Toxicol. Appl. Pharmacol. 198, 377–384.

Wei, M., Wanibuchi, H., Morimura, K., Iwai, S., Yoshida, K., Endo, G., Nakae,D., Fukushima, S., 2002. Carcinogenicity of dimethylarsinic acid in maleF344 rats and genetic alterations in induced urinary bladder tumors.Carcinogenesis 23, 1387–1397.

Xie, Y., Liu, J., Liu, Y., Klaassen, C.D., Waalkes, M.P., 2004a.Toxicokinetic and genomic analysis of chronic arsenic exposure inmultidrug-resistance mdr1a/1b(−/−) double knockout mice. Mol. Cell.Biochem. 255, 11–18.

Xie, Y., Trouba, K.J., Liu, J., Waalkes, M.P., Germolec, D.R., 2004b.Biokinetics and subchronic toxic effects of oral arsenite, arsenate,monomethylarsonic acid, and dimethylarsinic acid in v-Ha-ras transgenic(Tg,AC) mice. Environ. Health Perspect. 112, 1255–1263.

Zhou, Y.S., Du, H., Cheng, M.-L., Liu, J., Zhang, X.J., Xu, L., 2002. TheInvestigation of death from diseases caused by coal-burning type of arsenicpoisoning. Chin. J. Endemiol. 21, 448–484.