UNIVERSIDAD DE EXTREMADURA

DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR Y GENÉTICA

RUTAS DE SEÑAREGULAN LA APOPT

EN NEUROB

TesisMARÍA ISABEL

Grado de Doctor

LIZACIÓN INTRACELULAR QUE OSIS INDUCIDA POR LOVASTATINA LASTOS FETALES DE RATA

Doctoral presentada por CEREZO GUISADO para optar al

por la Universidad de Extremadura.

Cáceres, 2006

Edita: Universidad de Extremadura Servicio de Publicaciones Caldereros 2. Planta 3ª Cáceres 10071 Correo e.: publicac@unex.es http://www.unex.es/publicaciones

FACULTAD DE VETERINARIA DEPARTAMENTO DE BIOQUÍMICA, BIOLOGÍA MOLECULAR Y GENÉTICA Avda de la Universidad s/n 10071 CÁCERES Tlfno: 927257100 ext. 1332

Dña. MARÍA JULIA BRAGADO GONZÁLEZ, Profesora Contratada Doctora del Departamento de Bioquímica, Biología Molecular y Genética de la Universidad de Extremadura, y Dña. MARÍA JESÚS LORENZO BENAYAS, Profesora Titular de Universidad del Departamento de Bioquímica, Biología Molecular y Genética de la Universidad de Extremadura INFORMAN: Que el presente trabajo, titulado “Rutas de señalización intracelular que regulan la apoptosis inducida por lovastatina en neuroblastos fetales de rata”, ha sido realizado bajo nuestra dirección por María Isabel Cerezo Guisado en el Departamento de Bioquímica, Biología Molecular y Genética de la Universidad de Extremadura, y reúne todos los requisitos para obtener el grado de Doctor. Y para que así conste, firmamos el presente documento en Cáceres, a 21 de Junio de 2006. Dra. María Julia Bragado González Dra. María Jesús Lorenzo Benayas

GRACIAS….

Es tanto lo que tengo que agradecer y a tanta gente que no se si seré capaz de plasmarlo

en estas líneas; en cualquier caso ahí queda mi intento de agradecimientos de esta etapa de

mi vida:

En primer lugar a las doctoras Mª Julia Bragado González y Mª Jesús Lorenzo Benayas,

directoras de esta Tesis. A Chus, por todo lo que me has enseñado en todos estos años

tanto profesional como personalmente. Serás un referente para mí en futuros trabajos y en

la vida. Y sobre todo, por lo que me has ayudado, alentado y aconsejado en este largo, y a

veces difícil camino. Siempre has estado a mi lado y no sé si sabrás lo que eso ha

significado para mi pero gracias a ti, he podido disfrutar de esta Tesis. Espero que muchos

más tengan la suerte que he tenido yo de contar contigo en una aventura como ésta. A Julia,

por todo lo que me has enseñado y por prestarme tu apoyo, tu confianza y tu ayuda.

A Ricardo, el segundo autor de esta Tesis. No te haces a la idea de lo que ha significado

para mí contar contigo y con tu amistad estos años. Siempre has estado ahí para mí

apoyándome y soportando mis continuos lloros y quejas. Por eso, mi más sincero

agradecimiento querido marqués.

A Paco, el “director espiritual” de esta Tesis. Porque la empecé “por tu culpa” y porque

siempre que te he necesitado has estado ahí, para resolver mis dudas científicas y no tan

científicas, por tus consejos y también, cómo no, por aguantar “el monotema” que te soltado

sin parar. Echaré de menos nuestras paradas en el Km. 40.

A Pablo, no sé como agradecerte el que siempre haya podido contar contigo, que siempre

hayas estado ahí, que me hayas dado ese punto de vista coherente que tantas veces he

necesitado, que me hayas prestado tu ayuda sin dudarlo y dejando lo tuyo a un lado y sobre

todo por enseñarme cómo deben ser los amigos de verdad. A Loli, porque tú también has

aguantado mucho el mismo rollo una y otra vez y me has apoyado en los momentos más

críticos, suerte con “lo tuyo” amiga.

A mis compañeros, Inés, Lauro, Julián, Fernando, Rosa, por todo el aprecio y el cariño que

siempre me habéis demostrado. Al resto de compañeros de la Unidad de Bioquímica de la

Facultad de Veterinaria, por vuestra ayuda.

Al Dr. Alberto Álvarez Barrientos por la realización de los experimentos de Citometría de

Flujo y de Microscopía Confocal incluidos en este trabajo. Al Dr. Antonio Chiloeches Gálvez,

por su ayuda con los experimentos de actividad quinasa de Raf y por acogerme en su casa.

A Silvia, Vanessa, Belén, Carmen, Cristina, José Luís, Mar, porque cada uno en su

momento y en su lugar me habéis ayudado mucho, seguramente sin daros cuenta,

simplemente quitándole importancia a las cosas o “llevándome al teatro”. En especial a Ana,

porque no dudo que el último tramo de esta Tesis, sin tu ayuda, hubiera sido mucho más

duro de llevar.

A mis niñas “London” Belén, Eva y Pilar porque me hicisteis pasar los tres mejores meses

de mi vida, porque sin conocerme me ayudasteis y apoyasteis en todo en mi experiencia en

la city. Mi cortijo es vuestro cortijo. Al Dr. Eric Lam por aceptarme tres meses en su

laboratorio. Y a la EMBO, por hacer posible esa experiencia.

A mi madre y a mi hermana, con las que siempre he podido contar. A mi abuela y a mi tía

por escucharme pacientemente sin entender ni “papa”. A Irene, por ser mi sonrisa.

A José Ramón, porque como dice Paco, “lo tuyo tiene mérito”. Aguantar a Maribel no es

fácil, pero aguantar a Maribel haciendo una tesis es ganarse el cielo. En estos casi 5 años

me has demostrado mucho, sobre todo tu paciencia y tu cariño. Me has dicho la verdad aún

cuando yo no quería oírla y durante esos tres meses me demostraste que no podía haber

elegido un compañero mejor. Por todo y más, muchas gracias niño.

A todos, muchas gracias

MARIBEL

Esta Tesis ha sido realizada con una beca de Formación del Personal Investigador

de la Junta de Extremadura y financiada con proyectos del Ministerio de Ciencia y

Tecnología (SAF2001-0154) y de la Consejería de Educación, Ciencia y Tecnología

de la Junta de Extremadura (2PR01B007 y 2PR04A014).

A mis padres

A José Ramón

Índice

ÍNDICE I. INTRODUCCION 1

1. La ruta de biosíntesis del colesterol. 1

1.1. Inhibición de la ruta de biosíntesis del colesterol. 3 1.2. Efectos de la inhibición de la ruta de biosíntesis del colesterol y del mevalonato.

Efectos sobre el sistema nervioso. 4

2. La apoptosis y el sistema nervioso. 6

2.1. Componentes moleculares implicados en la apoptosis neuronal. 7

2.2. El papel de la familia Bcl-2 en la apoptosis neuronal. 8

2.3. El papel de Apaf-1 y las caspasas en la apoptosis neuronal. 9 3. Rutas de señalización intracelular que regulan la supervivencia y la muerte

celular. 12

4. Señalización intracelular a través de las proteínas quinasas activadas por mitógenos (MAPK). 13

4.1. La superfamilia de proteínas G monoméricas. 14

4.1.1. Las proteínas Ras. 16

4.1.1.1. Prenilación de las proteínas Ras. 17

4.1.1.2. Efectores de las proteínas Ras. 18

4.2. Las MAPKs reguladas por factores extracelulares (ERKs). 18

4.3. Las MAPKs activadas por estrés y citoquinas (JNKs). 20

4.4. Las MAPKs activadas por estrés y citoquinas (p38 MAPKs). 23

5. Señalización celular a través de la fosfatidilinositol 3-quinasa (PI3-K). 25

II. OBJETIVOS. 33

III. MATERIALES Y MÉTODOS. 35

1. Materiales. 35

1.1. Productos y reactivos generales 35

1.2. Materiales, reactivos y productos utilizados en los cultivos celulares. 36

2. Metodos. 37

2.1. Línea celular y método de cultivo. Procedimiento experimental. 37

2.2. Estudio de los niveles de proteínas por Western Blot. 38

2.2.1. Obtención de extractos celulares totales. 38

2.2.2. Obtención de extractos de proteínas nucleares. 38

2.2.3. Cuantificación de las proteínas. 38

2.2.4. Electroforesis de proteínas. 38

2.2.5. Electrotransferencia de proteínas a membrana. 39

2.2.6. Detección de las proteínas. 39

2.3. Ensayo de detección de Ras-GTP. 41

I

Índice 2.3.1. Establecimiento de bacterias competentes. 41

2.3.2. Transformación de bacterias competentes. 41

2.3.3. Expresión de la proteína GST-RBD-Raf-1 42

2.3.4. Purificación de la proteína de fusión GST-RBD-Raf-1 42

2.3.5. Ensayo de detección de Ras-GTP. 42

2.4. Ensayos de actividad de proteínas quinasas in vitro. 43

2.4.1. Ensayo in vitro de la actividad quinasa de la PI3-K. 43

2.4.1.1. Ensayos de inmunoprecipitación. 43

2.4.1.2. Ensayo in vitro de la actividad quinasa. 43

2.4.2. Ensayo in vitro de la actividad quinasa de la JNK. 44

2.5. Ensayo de retardo de la movilidad electroforética (EMSA). 44

2.5.1. Marcaje de los oligonucleótidos. 44

2.5.2. Análisis del retardo electroforético (EMSA). 45 2.6. Estudio de la expresión génica mediante la utilización de genes marcadores

(“Reporter Gene Assays”). 45

2.6.1. Vectores utilizados. 45

2.6.2. Transfección transitoria mediada por lípidos. 46

2.6.3. Detección de la actividad β-Galactosidasa in situ. 46

2.6.4. Ensayos de actividad luciferasa. 47

2.6.5. Ensayos de actividad .β-Galactosidasa. 47

2.7. Técnicas de estudio de la viabilidad y la muerte celular. 48

2.7.1. Ensayos de viabilidad celular. 48

2.7.1.1. Ensayo colorimétrico del MTT. 48

2.7.1.2. Tinción con cristal violeta. 48

2.7.2. Análisis de la fragmentación internucleosomal del ADN. 49

2.7.3. Análisis del contenido de ADN por Citometría de flujo. 49

2.8. Análisis estadístico. 50

IV. RESULTADOS 51 1. Capítulo 1: Lovastatin inhibits the growth and survival pathway of

phosphoinositide 3-kinase/Protein kinase B in immortalized rat brain neuroblasts. 51

2. Capítulo 2: Lovastatin inhibits the extracellular signal regulated kinases pathway in immortalized rat brain neuroblasts. 69

3. Capítulo 3: C-Jun N-terminal protein kinase signalling pathway mediates lovastatin-induced rat brain neuroblasts. 87

V. DISCUSIÓN 109

1. Efecto de la lovastatina en la actividad de Ras. 109

2. Efecto de la lovastatina en la ruta de la PI3-K/PKB. 109

3. Efecto de la lovastatina en la ruta de Ras/ERKs. 112

II

Índice

4. Efecto de la inhibición de las rutas de la PI3-K y de las ERKs en la supervivencia de los neuroblastos. 115

5. Efecto de la lovastatina en las rutas de las JNKs y de la p38 MAPK. 115

6. Las estatinas y las rutas de señalización intracelular. 118

VI. CONCLUSIONES. 121

VII. BIBLIOGRAFÍA. 123

III

Lista de abreviaturas ABREVIATURAS ADN Ácido desoxirribonucléico.

AMPc Monofosfato cíclico de Adenosina.

AP1 Proteína activadora 1.

ARN Ácido ribonucléico.

ARNm Acido ribonucléico mensajero.

ASK Quinasa regulada por señales de apoptosis.

ATF-2 Factor activador de la transcripción 2

ATP Adenosina Trifosfato.

BSA Albumina de suero bovino.

Cas Caspasa.

c.p.m. Cuentas por minuto.

Ci Curio. Unidad de radioactividad correspondiente a 2.2.x105 c.p.m.

Cit. c Citocromo c.

cm Centímetros.

c-Myc Homologo del oncogen viral de la mielocitomatosis aviar.

cols Colaboradores.

CRE Elemento de respuesta a AMPc

CREB Proteína que se une al elemento de respuesta CRE

dCTP Desoxinucleótidos de citosina.

DTT Ditiotreitol.

dTTP Desoxinucleótido de timidina.

EDTA Ácido etilendiaminotetraacético.

eIF4E Factor de iniciación de la traducción en eucariotas.

4E-BPs Proteínas de unión al factor de iniciación de la traducción en eucariotas.

EGF Factor de crecimiento epidérmico.

EGTA Ácido etilendiamina tetracético.

EMSA Ensayo de la movilidad electroforética.

ERK Proteína quinasa activada por señales extracelulares.

ES Error estándar.

FAK Quinasa de adhesión focal.

FBS Suero fetal bovino.

FT Factor de transcripción.

FTasa Farnesil transferasa.

GAPs Proteínas activadoras de la actividad GTPasa.

V

Lista de abreviaturas GAPDH Gliceraldehido 3-fosfato deshidrogenasa.

GDIs Inhibidores de la disociación de nucleótidos de guanina.

GDP Guanosín difosfato.

GEFs Factores intercambiadores de nucleótidos de guanina.

GGTAsa Geranil-geranil-transferasa.

GST Glutation-S-transferasa.

Grb2 Proteína unida a receptor de factores de crecimiento2.

GTP Guanosín trifosfato.

h Horas.

HEPES Ácido-4-(2-hidroxietil)-1-piperazin-etano-sulfónico.

HMG-CoA Hidroximetilglutaril-Coenzima A.

IPTG Isopropil-1-tio-β-D-galactopiranosido.

JNK Quinasa del extremo amino terminal de c-Jun.

Kb Kilobases.

KDa Kilodalton.

LB Medio Luria Bertani.

Lov Lovastatina.

LTP Potenciación a largo plazo.

MAPK Proteína quinasa activada por mitógenos.

MAPKAPK Proteína quinasa activada por MAPK.

MAPKK Proteína quinasa de MAPK.

MAPKKK Proteína quinasa quinasa de MAPK.

Mev Mevalonato.

min Minutos.

ml Mililitros.

mm Milímetros.

mM Milimolar.

mmol Milimol.

MNK Proteína quinasa integradora de la señal MAPK.

MTT Bromuro de 3-(4,5-dimetil-2-tiazolil)-2,5-difenil-2H Tetrazolio.

NADPH Nicotinamida-adenina dinucleótido fosfato.

NFκΒ Factor nuclear κΒ.

ng Nanogramos.

NGF Factor de crecimiento nervioso.

nm Nanómetros.

VI

Lista de abreviaturas p70-S6K Proteína quinasa que fosforila a la proteína ribosomal S6.

PAGE Electroforesis en gel de poliacrilamida.

PBS Tampón fosfato salino.

PDK Quinasa dependiente de 3´-fosfoinositol.

PH Dominio con homología a pleckstrina.

PI Fosfoinositoles.

PI3K Fosfatidil inositol-3-quinasa.

PIP2 Fosfatidilinositol-4,5-trifosfato.

PIP3 Fosfatidilinositol-3,4,5-trifosfato.

PKB (AKT) Proteína quinasa B.

PKC Proteína quinasa C.

PMSF Fluoruro de fenilmetanosulfonilo.

Pro Prolina.

PtdIns Fosfatidilinositol.

PVDF Difluoruro de polivinilo.

RBD Dominio de unión a Ras.

RNasa Ribonucleasa A.

RTK Receptores con actividad tirosina quinasa.

SAPK Quinasa activada por el estrés.

SDS Dodecil sulfato sódico.

Ser Serina.

sg Segundos

SH2 Dominios de homología 2 de Src

SNC Sistema Nervioso Central.

SOS “Son of sevenless”.

SRE Elemento de respuesta a suero.

T.A. Temperatura ambiente.

Thr Treonina.

TNF Factor de necrosis tumoral

TRE Elemento de respuesta a ésteres de forbol.

Tris Hidroximetil-aminometano.

Tyr Tirosina.

V Voltios.

µg Microgramo

µl Microlitro

VII

Lista de abreviaturas

VIII

µM Micromolar.

Introducción

1. LA RUTA DE BIOSÍNTESIS DEL COLESTEROL.

La ruta de biosíntesis del colesterol es multienzimática y su precursor es la acetil-

CoA, en la que, además de colesterol, se sintetizan otros compuestos no esteroideos

indispensables para la célula. El proceso de biosíntesis del colesterol se puede resumir en

las siguientes etapas principales (Omoigui, 2005):

1. La síntesis comienza cuando la acetil-CoA, derivada de una reacción de

oxidación en la mitocondria, es transportada al citoplasma.

2. Se condensan dos moléculas de acetil-CoA para dar lugar a acetoacetil-CoA.

Éste y una tercera molécula de acetil-CoA son convertidos en 3-hidroxi-3-

metilglutaril-CoA (HMG-CoA) por acción de la HMG-CoA sintasa.

3. El HMG-CoA es convertido en mevalonato en la reacción limitante de esta

ruta. La enzima que cataliza esta reacción es la HMG-CoA reductasa.

4. El mevalonato es entonces activado por tres fosforilaciones sucesivas dando

lugar al 5-pirofosfomevalonato.

5. Una reacción de descarboxilación dependiente de ATP va a dar lugar al

isopentenil pirofosfato, que es la molécula básica con la que se construirán

los isoprenoides.

6. Una molécula de isopentenil pirofosfato se condensa con una molécula de

dimetilalilpirofosfato para generar geranil pirofosfato. Este paso es catalizado

por la enzima geranil pirofosfato sintasa.

7. La enzima farnesil pirofosfato sintasa cataliza la condensación de una

molécula de geranil pirofosfato y otra molécula de isopentenil pirofosfato para

dar lugar al farnesil pirofosfato. El farnesil pirofosfato es el precursor de varios

productos tales como el colesterol, el grupo hemo A (componente de la

hemoglobina), el dolicol (requerido para la glicosilación de proteínas) y la

ubiquinona (implicada en la cadena transportadora de electrones

mitocondrial) (Graff y cols., 2004).

8. El farnesil pirofosfato se condensa con otra molécula de isopentenil

pirofosfato para generar geranil geranil pirofosfato. Esta reacción es

catalizada por la geranil geranil pirofosfato sintasa.

1

Introducción

9. La condensación de dos moléculas de farnesil pirofosfato dará lugar al

escualeno en una reacción catalizada por la escualeno sintasa.

10. En dos reacciones sucesivas de ciclación, el escualeno generará lanosterol.

11. El lanosterol, por último, es convertido en colesterol en una serie de 19

reacciones adicionales.

Como hemos visto, en la ruta de biosíntesis del colesterol se sintetizan, entre otros

compuestos, farnesil pirofosfato y geranil geranil pirofosfato (Figura 1). Ambos productos

son esenciales para la función de una gran variedad de proteínas. Los grupos farnesilos o

geranil geranilos se incorporan a las proteínas dando de esta forma lugar a proteínas

farnesiladas o geranil geraniladas. Estas reacciones están catalizadas por la farnesil

transferasa y por la geranil geranil transferasa, respectivamente. A este tipo de modificación

post-transduccional de las proteínas se le conoce con el nombre de (iso)prenilación (Graff y

cols., 2004). La importancia de los procesos de isoprenilación de proteínas radica en el

hecho de que existen varias proteínas implicadas en procesos de señalización que

dependen de la prenilación para ejercer sus funciones. Entre ellas se encuentran Ras,

lamininas nucleares A y B, transducina γ, rodopsina quinasa, Rho, proteínas G

heterotriméricas y varias proteínas que unen GTP pequeñas (Casey, 1995; Rando, 1996).

La prenilación de las proteínas permite su anclaje eficaz a las membranas celulares y su

interacción con otras proteínas, participando de este modo en diversos procesos celulares

como son la supervivencia y la proliferación celular (Graff y cols., 2004). Más adelante, se

describirá con más detalle la farnesilación de las proteínas Ras y su importancia en los

procesos de señalización celular.

2

Introducción

Acetil-CoA + Acetoacetil-CoA

HMG-CoA

Farnesil Pirofosfato

Geranil-geranil Pirofosfato

Proteínas Farnesiladas

Proteínas Geranilgeraniladas

Hemo A

Dolicol

Ubiquinona

EscualenoRutas

SeñalizaciónCelular

HMG-CoA reductasa ESTATINAS

FTasa

GGTasaCOLESTEROL

MEVALONATO

Hormonas EsteroideasVitamina DÁcidos BiliaresLipoproteínas

Figura 1. La ruta de biosíntesis del colesterol

Acetil-CoA + Acetoacetil-CoA

HMG-CoA

Farnesil Pirofosfato

Geranil-geranil Pirofosfato

Proteínas Farnesiladas

Proteínas Geranilgeraniladas

Hemo A

Dolicol

Ubiquinona

EscualenoRutas

SeñalizaciónCelular

HMG-CoA reductasaHMG-CoA reductasa ESTATINASESTATINAS

FTasaFTasaFTasa

GGTasaGGTasaGGTasaCOLESTEROLCOLESTEROL

MEVALONATOMEVALONATO

Hormonas EsteroideasVitamina DÁcidos BiliaresLipoproteínas

Figura 1. La ruta de biosíntesis del colesterol

1.1. Inhibición de la ruta de biosíntesis del colesterol.

Como se ha comentado en el apartado anterior, la reacción limitante de la ruta de

biosíntesis del colesterol es la catalizada por la enzima HMG-CoA reductasa. La regulación

de la actividad de la HMG-CoA reductasa debe de hacerse, por tanto, para cumplir con los

requerimientos celulares de, al menos, dos productos diferentes: los isoprenoides y el

colesterol (Brown y Goldstein 1980). Según la disponibilidad del colesterol y de otros

intermediarios de la ruta, la HMG-CoA reductasa se regula de varias formas: en la

transcripción, en la traducción y mediante modificaciones post-traduccionales, como son la

fosforilación y la degradación poteolítica (Friesen y Rodwell, 2004).

Además de por colesterol y otros metabolitos celulares, la enzima HMG-CoA

reductasa se inhibe por un conjunto de fármacos que reciben el nombre genérico de

estatinas. Las estatinas son análogos estructurales de la HMG-CoA, sustrato de la enzima,

que actúan como inhibidores competitivos y reversibles. Alteran la conformación del centro

activo de la enzima, lo cual hace que estos compuestos sean muy efectivos y específicos.

Su afinidad por la enzima está en el rango nanomolar, mientras que el sustrato natural de la

misma tiene afinidad micromolar (Corsini y cols., 1999). Las estatinas son los principales

fármacos que se utilizan para combatir la hipercolesterolemia, de forma que con su uso se

3

Introducción consigue reducir los niveles de colesterol-LDL entre un 15% y un 61% dependiendo de la

dosis y de la pauta del tratamiento. En la actualidad existen cinco estatinas aprobadas para

su uso clínico: estatinas de primera generación obtenidas a partir de hongos (lovastatina y

pravastatina), estatinas de segunda generación o

semisintéticas (sinvastatina) y estatinas de tercera

generación o sintéticas (fluvastatina, atorvastatina)

(Stancu y Sima, 2001).

La lovastatina, el fármaco utilizado en este

trabajo, es una estatina hidrofóbica administrada de

forma inactiva, como lactona, que debe ser

hidrolizada enzimáticamente para generar la forma

activa (Blumenthal, 2000). En la figura 2 se

representa la estructura química de esta estatina.

Figura 2. La lovastatina.

1.2. Efectos de la inhibición de la ruta de biosíntesis del colesterol y

del mevalonato. Efectos sobre el sistema nervioso.

La ruta de biosíntesis del colesterol juega un papel muy importante en el crecimiento

y la supervivencia celular (Goldstein y Brown, 1990). Mantener unos niveles adecuados de

colesterol es muy importante, ya que las células necesitan colesterol para muchas de sus

funciones, entre las que se incluyen construir las membranas celulares, mantenerlas con la

fluidez adecuada, con estructuras más o menos ordenadas o modificar covalentemente a las

proteínas (Smart y cols., 1994; Murata y cols., 1995; Porter y cols., 1996). Su función como

componente de las membranas celulares hace del colesterol una molécula imprescindible

para el crecimiento celular.

Como ya se ha mencionado, los inhibidores competitivos de la HMG-CoA reductasa

se utilizan de forma habitual en el tratamiento de la hipercolesterolemia. Mientras que los

efectos beneficiosos de las estatinas se reflejan en la disminución de la mortalidad por

arterioesclerosis, varios estudios demuestran que no sólo bloquean la biosíntesis del

colesterol sino que, adicionalmente, inhiben el crecimiento y la proliferación tanto de células

normales como tumorales (Jones y cols, 1994; Raiteri y cols., 1997). Además, la inhibición

de la HMG-CoA reductasa induce la muerte celular por apoptosis en diferentes tipos

celulares (Pérez-Sala y Mollinedo, 1994; Jones y cols., 1994; Padayatty y cols., 1997;

Guijarro y cols., 1998). Se ha demostrado que la capacidad de los inhibidores de la HMG-

CoA reductasa para interferir en la progresión del ciclo celular y para inducir apoptosis

4

Introducción

puede ser debida a su capacidad de bloquear la biosíntesis de compuestos isoprenoides

intermediarios de la ruta, más que a la inhibición de la síntesis del colesterol (Tanaka y cols.,

2000).

En el sistema nervioso central, y principalmente durante el desarrollo fetal y

postnatal, tanto la actividad de la HMG-CoA reductasa como la biosíntesis del colesterol son

muy elevadas, lo que hace pensar que esta ruta también resulta crucial en los procesos de

diferenciación, maduración y mantenimiento de los tejidos neuronales (Maltese y Volpe,

1979; Spady y Dietschy, 1983; Cavender y cols., 1995). Además, las células neuronales son

las que requieren mayor cantidad de colesterol para la síntesis de las membranas en

relación a otros tipos celulares (Graaf y cols., 2004). Sin embargo, los efectos de la

inhibición de la ruta del colesterol con estatinas en el sistema nervioso no se conocen en

profundidad y en ocasiones son contradictorios. Determinados estudios atribuyen a las

estatinas efectos beneficiosos en el sistema nervioso, ya que, entre otras acciones, reducen

el riesgo de desarrollar la enfermedad de Alzheimer y resultan esenciales para la formación

de las sinapsis (Wolozin y cols., 2000; Mauch y cols., 2001), mientras que otros autores

asocian el consumo de estatinas a varios efectos perjudiciales en el sistema nervioso

central, ya que producen alteraciones en el sueño, inducen depresión (Vgontzas y cols.,

1991; Duits y Bos, 1993) y pérdida de memoria (Matthies y cols., 1997; Kotti y cols., 2006).

Otros estudios recientes muestran que el consumo de estatinas durante el primer trimestre

de la gestación, provoca graves anomalías en el sistema nervioso central, entre las que

cabe citar la espina bífida, defectos en el tubo neuro-lumbar, etc. (Edison y Muenke, 2004a,

2004b). Por otro lado, estudios realizados in vitro muestran que las estatinas, a

concentraciones µM y mM, tienen efectos neurotóxicos en cultivos primarios de neuronas

procedentes de la corteza cerebral (Michikawa y Yanagisawa, 1999), provocan una pérdida

de neuritas al interferir en la síntesis de geranil geranil pirofosfato (Schulz y cols., 2004),

están asociadas a procesos de neuromiotoxicidad (Baker y Tarnopolsky, 2005) y en la

microglia, afectan a la motilidad celular y a la distribución del citoesqueleto de actina

(Kuipers y cols., 2006). En concordancia con estos estudios, nuestro grupo ha mostrado que

la lovastatina es capaz de inducir apoptosis en neuroblastos fetales de rata, estando este

efecto pro-apoptótico relacionado con una disminución en la prenilación de Ras (García-

Román y cols., 2001). Sin embargo, hasta la fecha, no se ha realizado una investigación

exhaustiva acerca de los mecanismos moleculares que regulan la apoptosis neuronal inducida por lovastatina.

5

Introducción

2. LA APOPTOSIS Y EL SISTEMA NERVIOSO.

La muerte de células individuales en un tejido se observó por primera vez en

vertebrados hace ya más de 40 años en estudios sobre el desarrollo (Glucksman, 1951;

Saunders, 1966). A principios de los años 70, Kerr, Wyllie y Curie observaron que en las

células se podían observar dos tipos diferentes de muerte: una bien caracterizada, la

necrosis, y una nueva forma, morfológicamente distinta, a la que llamaron apoptosis (Kerr y

cols., 1972; Wyllie y cols., 1981). La muerte celular por necrosis es violenta y se caracteriza

por la tumefacción del citoplasma, la ruptura de las membranas celulares y la desintegración

de los componentes subcelulares y nucleares. Por otro lado, la apoptosis viene definida por

una serie ordenada de eventos que tienen lugar en un período de tiempo más largo y que

afecta únicamente a cada célula individual.

Durante el proceso de apoptosis, la célula se vuelve más compacta y aparecen gran

cantidad de invaginaciones en la membrana plasmática. Estas invaginaciones finalmente

acabarán dando lugar a los llamados cuerpos apoptóticos, en los cuales quedarán recluidos

tanto restos del citoplasma como restos de los distintos orgánulos celulares. Por su parte, la

cromatina se empieza a condensar y finalmente el ADN acaba fragmentado. La apoptosis

es, por tanto, un proceso activo que conlleva, por parte de la célula, la síntesis de nuevo

ARNm así como de nuevas proteínas que participan en este proceso. Típicamente, la célula

se observa heteropicnótica, es decir, condensada y con un núcleo fragmentado y de

pequeño tamaño. La célula se fragmenta en los cuerpos apoptóticos. Estos, finalmente,

serán fagocitados por los macrófagos, evitando así cualquier tipo de respuesta inflamatoria

por parte del organismo.

En el caso del sistema nervioso, y en particular de las neuronas, la apoptosis es un

tipo de muerte celular programada responsable de la eliminación fisiológica de poblaciones

celulares que durante el desarrollo embrionario no han establecido las conexiones

adecuadas, o bien no disponen de los suficientes factores tróficos para poder llevar a cabo

sus funciones (Wyllie, 1988). Este proceso va a determinar el tamaño y la forma del sistema

nervioso de los verterbrados (Kuan y cols., 2000). Se estima que más de la mitad de las

neuronas del sistema nervioso central de los vertebrados mueren durante el desarrollo

embrionario, o bien, en la maduración postnatal temprana mediante una muerte celular

programada (Raff y cols., 1993). En el adulto, una activación inapropiada de la apoptosis

contribuye al desarrollo de enfermedades neurodegenerativas como el Parkinson, la

esclerosis múltiple o la lateral amiotrófica, así como a varias formas de degeneración

cerebelar, atrofia muscular espinal y la enfermedad de Alzheimer (Barinaga, 1993), que se

caracterizan por una pérdida gradual de subpoblaciones específicas de neuronas. Por lo

6

Introducción

tanto, no es de extrañar que el proceso apoptótico esté controlado muy rigurosamente por

distintas vías de señalización intracelular.

La apoptosis puede inducirse por multitud de efectores: ausencia de factores de

crecimiento, ligandos peptídicos específicos (factor de necrosis tumoral α, ligando de Fas,

etc.), cambios en la concentración de calcio intra o extracelular, fármacos (estaurosporina,

ésteres de forbol, etc.,) o daños tanto en el ADN como en la mitocondria. Aunque cada uno

de ellos va a actuar en un punto específico de las vías de transducción que conducen a la

apoptosis, todos ellos implican un daño celular que podemos considerar irreparable, y al que

la célula responde con el inicio del proceso apoptótico.

2.1. Componentes moleculares implicados en la apoptosis neuronal.

La identificación de los genes que regulan la muerte celular programada ced-3, ced-4

y ced-9 en el nemátodo Caenorhabditis elegans y sus homólogos en mamíferos, permitió

examinar los mecanismos moleculares por los cuales se produce la muerte neuronal

(Metzstein y cols., 1998). Pronto se descubrió que la muerte neuronal en vertebrados

inducida por la eliminación de factores tróficos requería la participación de cisteína

proteasas, más tarde denominadas caspasas, homólogos en mamíferos del gen ced-3 de C-

elegans (Gagliardini y cols., 1994). Fue la primera evidencia funcional de que la eliminación

de un factor trófico activaba un programa de muerte en las neuronas de vertebrados.

La apoptosis en mamíferos está regulada por la familia de proteínas Bcl-2, la

proteína adaptadora Apaf-1 y la familia de cisteína proteasas o caspasas, las cuales son

homólogas a los productos de los genes de muerte de C. elegans CED-9, CED-4 y CED-3,

respectivamente (Hengartner y Horvitz, 1994). Las neuronas comparten con todos los

demás tipos celulares el programa básico de apoptosis. Sin embargo, diferentes tipos de

neuronas y en diferentes etapas del desarrollo neuronal, expresan distintas combinaciones

de miembros de la familia Bcl-2 y caspasas, lo cual está estrechamente relacionado con la

especificidad de su regulación (De Zio y cols., 2005). Hasta la fecha, han sido

caracterizadas dos rutas principales que desencadenan la apoptosis (Becker y Bonni, 2004):

1. La vía extrínseca activada por estímulos extracelulares cuya acción es

mediada por receptores de membrana que tienen en común dominios

extracelulares ricos en cisteína y una secuencia citoplasmática muy similar en

todos ellos denominada dominio de muerte (DD o “death domain”). Esta vía

7

Introducción

conduce a la activación directa de la cascada de caspasas, siendo la caspasa

8 la primera en activarse.

2. La vía intrínseca activada como respuesta a señales intracelulares o

lesiones como un daño en el ADN. Las rutas que desencadenan la activación

de esta vía convergen en la mitocondria a través de la activación de los

miembros pro-apoptóticos de la familia Bcl-2 que regulan la liberación del

citocromo c. En este caso también se produce la activación de las caspasas.

En esta vía, la primera caspasa que se activa es la caspasa 9. (Figura 3).

2.2. El papel de la familia Bcl-2 en la apoptosis neuronal.

La familia de proteínas Bcl-2 desempeña un papel crucial en la transducción de

señales implicadas en la apoptosis. Esta familia incluye proteínas tanto anti- como pro-

apoptóticas que presentan uno o más dominios de homología con Bcl-2 (BH) (Merry y

Korsmeyer, 1997). Los miembros anti-apoptóticos de la familia Bcl-2, Bcl-2 y Bcl-XL, se

localizan en la membrana externa de la mitocondria, en el retículo endoplásmico y en la

membrana perinuclear. La expresión de Bcl-2 es elevada en el sistema nervioso central

durante el desarrollo y disminuye tras el nacimiento mientras que Bcl-XL se expresa en el

cerebro en desarrollo y a diferencia de Bcl-2 su expresión continúa en el individuo adulto

(González-García y cols., 1995). La proteína Bcl-2 es crítica para el mantenimiento de la

supervivencia neuronal, mientras que Bcl-XL es crucial para la supervivencia de neuronas

inmaduras antes de que éstas estabilicen sus conexiones sinápticas (Yuan y Yankner,

2000).

Bcl-2 y Bcl-XL ejercen su acción anti-apoptótica actuando sobre los miembros pro-

apoptóticos de la familia Bcl-2 (Bax, Bad, Bim, Bid, Bik) inhibiéndolos por procesos de

heterodimerización cuando éstos translocan a la mitocondria desde el citosol redirigidos por

señales pro-apoptóticas (Ferry y Korsmeyer, 1997). Allí compiten por regular la salida del

citocromo c por mecanismos aún en discusión.

La integración de las vías extrínseca e intrínseca de la apoptosis ocurre a través del

miembro pro-apoptótico Bid. La proteolisis de Bid por acción de la caspasa 8 libera su

extremo carboxilo y conduce a la traslocación de Bid a la mitocondria, promoviendo así la

salida del citocromo c al citosol. El citocromo c induce la interacción de la proteína

citoplasmática Apaf-1 con la caspasa 9, formando el complejo proteico denominado

8

Introducción

apoptosoma, que a su vez induce la autoproteolisis y activación de la caspasa 9. Ésta a su

proteoliza a la pro-caspasa 3, generándose la caspasa 3 activa (Gross y cols., 1999).

Entre los miembros pro-apoptóticos de la familia Bcl-2 se encuentra una proteína con

un sólo dominio BH3 denominada Bim que es de particular interés en el estudio de la

apoptosis en el sistema nervioso. Bim se une al dominio BH3 de Bax causando un cambio

conformacional que conduce a su oligomerización e integración en la membrana

mitocondrial externa y a la formación de canales para la liberación del citocromo c y otros

factores mitocondriales apoptóticos (Donovan y cols., 2002). Bim presenta tres isoformas

generadas por procesamiento alternativo: BimS (“Bim short”), BimL (“Bim long”) y BimEL

(“Bim extra long”) (O´Relly y cols., 2000). La actividad pro-apoptótica de Bim está regulada

por varias rutas de señalización que regulan su expresión y su fosforilación. Así, la

activación del factor de transcripción FOXO3a, como consecuencia del bloqueo de la ruta de

la fosfatidilinositol-3 quinasa, incrementa la expresión de Bim (Zhu y cols., 2004). Sin

embargo, las principales proteínas reguladoras de Bim son las quinasas que fosforilan el

extremo N-terminal de c-Jun ó JNKs y las activadas por estímulos extracelulares o ERKs. La

activación de las JNKs promueve la actividad de Bim al aumentar su expresión y su

fosforilación en el residuo serina 65 (Putcha y cols., 2003) mientras que la fosforilación

directa de Bim en el residuo serina 69 por las ERKs resulta en una disminución de los

niveles de Bim a través de un mecanismo dependiente del proteosoma (Weston y cols.,

2003).

2.3. El papel de Apaf-1 y las caspasas en la apoptosis neuronal.

Apaf-1 es el homólogo en mamíferos del gen de muerte celular de C. elegans ced-4.

Transmite la señal apoptótica desde la mitocondria y activa las caspasas. Como se comentó

en el apartado anterior Apaf-1 forma un complejo con el citocromo c, liberado de la

mitocondria, y la caspasa 9 para mediar su activación (Zou y cols., 1997). La caspasa 9

activada hidroliza y activa a la caspasa 3. Los ratones deficientes en Apaf-1 mueren durante

el desarrollo embrionario, mostrando una apoptosis reducida en el cerebro con un marcado

desarrollo de la zona proliferativa periventricular (Cecconi y cols., 1998), lo que sugiere que

Apaf-1 es indispensable para la apoptosis de células progenitoras neuronales.

La capacidad de los inhibidores de las caspasas para bloquear la muerte neuronal

inducida por la eliminación de factores tróficos y otras condiciones citotóxicas, supone una

evidencia indiscutible del papel crucial de las caspasas en la apoptosis neuronal (Cryns y

Yuan, 1998). En mamíferos se han identificado al menos 14 caspasas diferentes y las

9

Introducción neuronas, como el resto de los tipos celulares, pueden expresar varias de ellas de forma

simultánea.

Las caspasas son cisteína proteasas que actúan en secuencias específicas que

contienen residuos de aspártico (cisteína-aspártico proteasas) y que se expresan como pro-

enzimas catalíticamente inactivas compuestas por un pro-dominio en la región amino-

terminal, una subunidad grande y una subunidad pequeña. La activación de las caspasas

implica un procesamiento proteolítico entre los dominios seguido de la asociación de la

subunidad pequeña y la subunidad grande para formar el heterodímero o el tetrámero

activo. Una vez activas, las caspasas hidrolizan a otras caspasas o a otros sustratos. La

especificidad de sustrato de una caspasa la determina una secuencia de cuatro residuos

que se encuentran en la dirección amino terminal del punto de corte. Las caspasas

participan en una cascada de eventos proteolíticos que producen la alteración de la

homeostasis celular y afectan al mecanismo de reparación del ADN, produciendo los

cambios celulares característicos de la apoptosis (Marks y Berg, 1999).

Las caspasas se pueden clasificar en dos grandes grupos: caspasas iniciadoras,

entre las que se encuentran la 2, 8, 9, 10 y 12, y las caspasas efectoras o ejecutoras como

la 3, 6 y 7. Las caspasas también pueden diferenciarse en base a la secuencia de sus pro-

dominios. Así, las caspasas que presentan un dominio largo del tipo DED (“death-effector

domain”), como las caspasas 8 y 10, son activadas por la interacción con los dominios

intracelulares de receptores de muerte como el CD95 (Apo-1/Fas) y los receptores del factor

de necrosis tumoral o TNF. Las caspasas con dominios largos tipo CARD (“caspase-

activating recruitment domains”), entre las que se encuentran las caspasas 1, 2, 4, 5, 9, 11 y

12, son activadas principalmente a través de complejos intracelulares de activación tales

como el ya mencionado complejo citocromo c/Apaf-1 y caspasa 9 (Li y cols., 1997). Por otro

lado, las caspasas con pro-dominios cortos, como la caspasa 3, pueden ser activadas por la

mayoría de las caspasas. La caspasa 3 se activa al proteolizarse su precursor (el zimógeno

pro-caspasa 3) en dos fragmentos de 17 y 12 KDa que se van a unir para formar el

heterodímero activo. La caspasa 3 interviene en lo que se denomina la fase efectora de la

apoptosis. Ésta va a producir la hidrólisis de diferentes sustratos entre ellos PARP (poli-

ADP-ribosa polimerasa) y DFF (factor de fragmentación del ADN) ó CAD (ADNasa activada

por caspasa). La PARP está implicada en los procesos de reparación del ADN y es muy

importante para mantener la viabilidad de la célula. De hecho, su proteolisis facilita la

disrupción de la célula, por lo que se emplea como marcador del proceso apoptótico (Oliver

y cols., 1998). En cuanto a DFF, en células no apoptóticas, se encuentra en el núcleo como

un heterodímero formado por una subunidad inhibidora o ICAD (inhibidor de ADNasa

activada por caspasa) y una subunidad con actividad nucleasa latente o CAD. Ante un

10

Introducción

estímulo apoptótico, la caspasa 3 hidroliza a este complejo y libera y activa a la subunidad

CAD que producirá así la degradación del ADN, una de las características bioquímicas de la

apoptosis como ya se ha mencionado (Widlak y Garrard, 2005).

Las dos principales caspasas implicadas en la apoptosis neuronal son la caspasa 3 y

la caspasa 9. Ratones deficientes en caspasa 3 (Kuida y cols., 1996) y en caspasa 9 (Kuida

y cols., 1998) muestran similares y graves defectos en el desarrollo de la muerte neuronal.

Estímulos apoptóticos

Fas/TNF

Citocromo c

ApoptosomaProcaspasa-9Apaf-1Citocromo c

Bid

Bid

Caspasa 9

Caspasa-8

Caspasa-3

Pro-Cas 8FADD

Apoptosis

Figura 3. Representación esquemática de las dos principales víasque desencadenan la apoptosis.

Estímulos apoptóticos

Fas/TNF

Citocromo c

ApoptosomaProcaspasa-9Apaf-1Citocromo c

BidBid

BidBid

Caspasa 9Caspasa 9

Caspasa-8

Caspasa-3

Pro-Cas 8Pro-Cas 8FADDFADD

Apoptosis

Figura 3. Representación esquemática de las dos principales víasque desencadenan la apoptosis.

11

Introducción

3. RUTAS DE SEÑALIZACIÓN INTRACELULAR QUE REGULAN LA SUPERVIVENCIA Y LA MUERTE CELULAR.

La supervivencia y la muerte neuronal están controladas por diversas rutas de

señalización celular. Bajo el término de “transducción de señales” se agrupan los

mecanismos por los cuales estímulos extracelulares que llegan a la membrana plasmática

de la célula se convierten en respuestas celulares específicas que permiten la adaptación a

cambios en el medio externo, así como el mantenimiento de la homeostasis. La

transducción de una señal desde la membrana plasmática y su propagación en el interior

celular se realiza por la activación secuencial de distintas proteínas, entre las que podemos

encontrar proteínas quinasas y fosfatasas, organizadas en lo que se conocen como

“cascadas de señalización”. Estas cascadas pueden ser activadas por una gran variedad de

estímulos entre los que se incluyen hormonas, factores de crecimiento, citoquinas y agentes

que dañan el ADN. La organización de las proteínas quinasas en cascadas de señalización

es importante porque permite amplificar, diversificar e integrar las distintas señales que

recibe la célula.

En 1956, Krebs y Fischer pusieron de manifiesto la importancia de la fosforilación de

las proteínas en la regulación del metabolismo del glucógeno al descubrir que la fosforilasa

de glucógeno permanece activa sólo cuando un determinado residuo de serina está

fosforilado (Krebs y Fischer, 1956). Hoy se sabe que la fosforilación reversible de proteínas

se produce en casi todos los aspectos de la vida celular y que juega un papel muy

importante en la regulación de muchos procesos como el metabolismo, la expresión de

genes, la proliferación, la diferenciación y la respuesta inmune. La importancia de la

fosforilación y su correcta regulación se ha puesto de manifiesto al conocerse que la

fosforilación anormal de las proteínas puede originar o ser el resultado de diversas

enfermedades como la diabetes, el cáncer, las enfermedades autoinmunes,

neurodegenerativas o cardiovasculares (Cohen, 2002).

La fosforilación de proteínas la llevan a cabo proteínas quinasas que catalizan la

transferencia de un fosfato del ATP a residuos específicos de serina, treonina o tirosina en la

proteína sustrato. La desfosforilación de estos residuos está catalizada por proteínas

fosfatasas.

12

Introducción

4. SEÑALIZACIÓN INTRACELULAR A TRAVÉS DE LAS PROTEÍNAS QUINASAS ACTIVADAS POR MITÓGENOS (MAPK).

Las células son capaces de reconocer y responder a una gran variedad de estímulos

extracelulares a través de programas intracelulares específicos como la cascada de

señalización que conduce a la activación de las proteínas quinasas activadas por mitógenos ó MAPKs. Todas las células eucariotas poseen múltiples rutas MAPKs las

cuales coordinan diversas actividades celulares que van desde la expresión de genes,

mitosis y metabolismo hasta la motilidad, supervivencia, apoptosis y diferenciación celular

(Roux y Blenis, 2004). Hasta la fecha, se han caracterizado cinco grandes grupos de MAPKs

en mamíferos (Chen y cols., 2001; Kyriakis y Avruch, 2001):

1. Las quinasas reguladas por señales extracelulares (ERKs).

2. Las quinasas que fosforilan el extremo N-terminal de c-Jun (JNKs).

3. Las quinasas activadas por mitógenos de 38 KDa o p38 MAPKs.

4. Las ERKs 3 y 4.

5. La ERK 5.

En vertebrados, las subfamilias de MAPKs más ampliamente estudiadas son las de

ERKs, JNKs y p38 quinasas.

Todas las vías de las diferentes MAPKs comparten los siguientes componentes que

constituyen el núcleo de señalización: una MAPK quinasa quinasa (MAPKKK), una MAPK

quinasa (MAPKK) y una MAPK (Kyriakis y Avruch, 2001). Las MAPKKKs, con actividad

serina-treonina quinasa, son generalmente activadas por fosforilación y/o como resultado de

su interacción con una proteína G monomérica de la familia de Ras o Rho (Dan y cols.,

2001; Kolch, 2000). La activación de las MAPKKKs conduce a la fosforilación y activación de

una MAPKK, la cual estimulará la actividad de una MAPK a través de una fosforilación doble

en residuos de treonina y tirosina localizados en el lazo de activación del dominio VIII de la

quinasa. Una vez activadas, las MAPKs fosforilan a sus sustratos en residuos de serina o

treonina seguidos de una prolina. La selectividad del sustrato es a menudo conferida por la

existencia de dominios de interacción específica en los sustratos fisiológicos. Además, la

especificidad de la cascada de las MAPKs está también mediada por la interacción con

proteínas “scaffolding” que organizan las rutas en módulos específicos a través de la unión

simultánea de varios componentes (Roux y Blenis, 2004).

13

Introducción

Las MAPKs pueden ser activadas por una gran variedad de estímulos diferentes,

pero en general, las ERKs se activan preferentemente en respuesta a factores de

crecimiento y esteres de forbol, mientras que las JNKs y las p38 MAPKs responden a

estímulos de estrés que van desde el choque osmótico y la radiación ionizante a la

estimulación por citoquinas (Pearson y cols., 2001). (Figura 4).

Ruta ERK JNK p38-MAPK

MAPKKK(MKKK)

MAPKK(MKK)

MAPK

Sustratos

Papel enApoptosis

RafMEKK2

Raf MEKKs, ASK, MLK, TAK1

MEK1/2 MEK5 MKK4/7 MKK3/6

ERK1/2 ERK5 JNK1/2/3 p38-αβγδ

p90RSKElk

c-mycMEF2

JunATF-2ELK-1

MNK1MAPKAPK2/5

CDC25MEF2

AntiApoptosis

AntiApoptosis

Anti y proApoptosis

Anti y proApoptosis

Estímulos Mitógenos Estrés/Citoquinas

Ruta ERK JNK p38-MAPK

MAPKKK(MKKK)

MAPKK(MKK)

MAPK

Sustratos

Papel enApoptosis

RafMEKK2

Raf MEKKs, ASK, MLK, TAK1

MEK1/2 MEK5 MKK4/7 MKK3/6

ERK1/2 ERK5 JNK1/2/3 p38-αβγδ

p90RSKElk

c-mycMEF2

JunATF-2ELK-1

MNK1MAPKAPK2/5

CDC25MEF2

AntiApoptosis

AntiApoptosis

Anti y proApoptosis

Anti y proApoptosis

Estímulos Mitógenos Estrés/CitoquinasEstímulos Mitógenos Estrés/Citoquinas

Figura 4. Las proteínas quinasas activadas por mitógenos o MAPKs.

4.1. LA SUPERFAMILIA DE PROTEÍNAS G MONOMÉRICAS.

Las proteínas G monoméricas forman una superfamilia con más de cien miembros

identificados, hasta la fecha, en eucariotas. Desde un punto de vista estructural, los

miembros de esta superfamilia se clasifican en cinco grandes familias denominadas Ras,

Rho/Rac/Cdc42, Rab, Sar1/Arf y Ran, implicadas en múltiples mecanismos de señalización

intracelular. Estas proteínas sufren modificaciones post-traduccionales, en su extremo

carboxilo terminal concretamente modificaciones lipídicas, que son necesarias para que se

unan a las membranas celulares donde interaccionan con sus moléculas reguladoras y

efectoras.

14

Introducción

Las proteínas G monoméricas, con una masa molecular que varía entre los 20 y los

40 KDa, son GTPasas, es decir, enzimas capaces de unir e hidrolizar nucleótidos trifosfato

de guanina o GTP. Estas proteínas se encuentran siempre unidas a nucleótidos de guanina

y en función de la naturaleza de éste, las proteínas G se encontrarán en estado inactivo,

cuando tienen unido GDP, o en estado activo cuando tienen unido GTP (Takai y cols.,

1992). El cambio de GDP a GTP se produce tras la recepción de una señal estimuladora, la

cual provoca cambios estructurales que hacen accesible la región efectora a los

denominados efectores. La forma activa de estas proteínas es capaz de hidrolizar GTP

gracias a su actividad GTPasa intrínseca, volviendo de nuevo a su estado inactivo y

cerrándose de este modo el ciclo.

El paso limitante en el proceso de

activación es el intercambio de GDP por

GTP. Esta reacción es extremadamente

lenta por lo que se hace necesaria la

acción de un grupo de proteínas

denominadas factores intercambiadores

de nucleótidos de guanina o GEFs. Estos

GEFs interaccionan con la forma inactiva

de las proteínas G y facilitan la salida del

GDP, el cual es rápidamente sustituido por

el GTP. (Figura 5).

GTPasaGDP

GTPasa

GDI

GDI

GDP

GTPasaGTP

GAP

GEF

SeñalesReguladoras

GTP GDP

Pi

Efectores

Figura 5. Ciclo de activación de las proteínas G monoméricas

GTPasaGDP

GTPasa

GDI

GDI

GDP

GTPasaGTP

GAP

GEF

SeñalesReguladoras

GTP GDP

Pi

Efectores

Figura 5. Ciclo de activación de las proteínas G monoméricas

GTPasaGTPasaGDPGDP

GTPasaGTPasa

GDIGDI

GDIGDI

GDPGDP

GTPasaGTPasaGTPGTP

GAP

GEF

SeñalesReguladoras

GTP GDP

Pi

Efectores

Figura 5. Ciclo de activación de las proteínas G monoméricas

La actividad GTPasa de las proteínas G es bastante lenta, por lo que se hace

necesaria la participación de otro grupo de proteínas denominadas factores activadores de

la actividad GTPasa o GAPs, cuya función es acelerar la hidrólisis del GTP. Además, existe

una clase de proteínas reguladoras conocidas con el nombre de inhibidores de la

disociación de nucleótidos de guanina (GDIs), que parecen funcionar como inhibidores de la

actividad GTPasa al prevenir la disociación del GDP. Sin embargo, el papel preciso de las

GDIs en este ciclo no está muy claro (Bernards y Settleman, 2004).

La mayoría de las proteínas G monoméricas se encuentran ampliamente distribuidas

en células de mamíferos aunque los niveles de expresión de los miembros de cada familia

varían según el tipo celular. La localización subcelular de estas proteínas es variada. Así, las

podemos encontrar en la membrana plasmática, en el citosol o en el núcleo, pero siempre

unidas a un tipo específico de membranas.

Las proteínas G monoméricas intervienen en la regulación de funciones celulares

muy diversas, entre las que destacan el crecimiento y la supervivencia celular, la

15

Introducción organización del citoesqueleto, el tráfico intracelular de vesículas y el transporte nuclear

(Macara y cols., 1996). Las proteínas de la subfamilia de Rho, como Rho, Rac1 y Cdc42,

regulan la transducción de señales en una gran variedad de funciones celulares

relacionadas con la morfología, la adhesión, la motilidad y el crecimiento celular y la

metástasis de células cancerosas (Hall, 1998). Entre los efectores de estas proteínas se

encuentran las proteínas quinasas JNKs y las p38 MAPKs (Coso y cols., 1995). RhoA y

RhoC sufren una modificación post-transduccional por geranil geranilación mientras que

RhoB puede ser farnesilado y geranil geranilado (Adamson y cols., 1992). Las proteínas Ras

farnesiladas están asociadas a la transducción de señales mitogénicas en respuesta a

factores de crecimiento; entre sus principales efectores se encuentran la ruta de Raf-MEK-

ERK y la ruta de la fosfatidilinositol 3-quinasa o PI3-K, ambas implicadas principalmente en

la supervivencia celular (Pronk y Bos, 1994).

4.1.1. LAS PROTEÍNAS RAS.

Las proteínas Ras son los miembros mejor caracterizados de la superfamilia de

proteínas G monoméricas (Cox y Der, 2003). En humanos, la familia de proteínas Ras

incluye tres proto-oncogenes denominados H-ras, K-ras y N-ras y un gen muy similar

denominado TC21. Las proteínas Ras tienen un peso molecular de 21 KDa y en su

estructura primaria se pueden distinguir cuatro regiones diferentes denominadas región

constante, región variable, región hipervariable y caja CAAX. Esta última región es esencial

para la actividad de estas proteínas, ya que en ella se encuentran las secuencias señal de

prenilación que van a localizar a las proteínas Ras en la membrana plasmática. Las

proteínas Ras son sintetizadas como precursores inactivos que se localizan en el citoplasma

y, tras ser preniladas, son transportadas y localizadas en la membrana plasmática donde

realizan su función. Las proteínas Ras, tal y como se ha descrito anteriormente, se

encuentran oscilando entre un estado activo e inactivo.

Las proteínas Ras modulan muchos aspectos funcionales de la célula, incluyendo la

proliferación, la diferenciación, la motilidad y la muerte celular (Shields y cols., 2000). La

única función enzimática conocida de Ras es su actividad GTPasa, por lo demás no es

capaz de modificar directamente a ningún posible sustrato. Ras, una vez activado, sufre

cambios conformacionales que hacen accesible su región efectora a otras proteínas.

16

Introducción

4.1.1.1. Prenilación de las Proteínas Ras.

La modificación post-traduccional de algunas proteínas por la incorporación de

isoprenoides a su molécula o prenilación se demostró por primera vez en fibroblastos Swiss

3T3 (Schmidt y cols., 1984). Generalmente, la prenilación (farnesilación o geranil

geranilación) de una proteína conduce a la translocación de la misma desde el citosol a la

membrana. La importancia de la localización celular para la función de Ras se determinó al

demostrarse que las formas oncogénicas de Ras eran inactivas cuando se prevenía su

asociación a la membrana debido a una mutación en un residuo de cisteína (Willumsen y

cols., 1984). Posteriormente, se demostró que este residuo era el aceptor de un grupo

farnesilo (Hancock y cols., 1989). El sitio de prenilación de las proteínas Ras consiste en

una secuencia formada por cuatro aminoácidos situada en el extremo carboxilo terminal,

CAAX, donde C representa la cisteína, A representa los residuos alifáticos de leucina,

isoleucina o valina y X los de metionina, alanina o serina. Las proteínas Ras son sustratos

de una reacción de farnesilación catalizada por la enzima farnesil transferasa que incorpora

grupos farnesilos al sulfuro de la cadena lateral de la cisteína. Tras la prenilación, los tres

aminoácidos del extremo C-terminal son hidrolizados por proteolisis y la cisteína prenilada

es metilada (Waddick y Uckun, 1998) (Figura 6).

Ras

P P P P

Ras

F

Ras

F

FPP

PP

Ras

F

GDP

Ras

F

GTP

Rutas deSeñalización

Celular

Receptor Ligando

Figura 6. Farnesilación de Ras

Ras

P P P P

Ras

F

Ras

F

Ras

F

FPP

PP

Ras

F

GDPGDPGDP

Ras

F

GTPGTPGTP

Rutas deSeñalización

Celular

Receptor Ligando

Figura 6. Farnesilación de Ras

17

Introducción

4.1.1.2. Efectores de las proteínas Ras.

En la actualidad se conocen varios efectores de Ras que desempeñan funciones

diversas regulando tanto acciones anti-apoptóticas (Raf, la fosfatidilinositol 3-quinasa y Tiam

1) como pro-apoptóticas (Nore1 y RASSF1) (Repasky y cols., 2004). Otros efectores de Ras

son los factores intercambiadores de nucleótidos de guanina (Ral-GDS, RGL), factores

activadores de la actividad GTPasa (120 GAP, NF1), proteínas adaptadoras (AF-6), lipasas

(PLCε) y la serina-treonina quinasa PKCξ (Repasky y cols., 2004).

Los distintos efectores de Ras se caracterizan por presentar un dominio de unión a

Ras ó “Ras-binding Domain” (RBD). Los RBDs están formados por unos 100 aminoácidos y

hasta la fecha se han descrito tres: el dominio de unión a Ras de Raf 1 o Tiam 1; el dominio

de unión a Ras de la subunidad catalítica de la fosfatidilinositol 3-quinasa de la clase I y los

dominios de asociación a Ras (RA) encontrados en los demás efectores de Ras (Ponting y

cols., 1996).

4.2. LAS MAPKs REGULADAS POR FACTORES EXTRACELULARES (ERKs).

Las ERKs fueron las primeras MAPKs identificadas, por lo que se han utilizado como

modelo para el estudio de las otras vías de señalización homólogas descubiertas con

posterioridad. En mamíferos, el esquema principal de la cascada de las ERKs es el

siguiente: las MAPKKKs A-Raf, B-Raf y Raf-1, las MAPKKs MEK1 y MEK2, y las MAPKs

ERK1 y ERK2. ERK1 y ERK2 comparten un 83% de homología y se expresan en todos los

tejidos (Chen y cols., 2001). Tienen pesos moleculares de 44 KDa y 42 KDa

respectivamente, por lo que también se las conoce con el nombre de p44/p42 MAPK.

Además de por los estímulos arriba mencionados, las ERKs se activan por ligandos de los

receptores acoplados a proteínas G heterotriméricas, estrés osmótico y eventos como la

desorganización de los microtúbulos (Lewis y cols., 1998).

Como se describió en un apartado anterior, los receptores con actividad tirosina

quinasa transmiten las señales mitogénicas a la cascada Raf/MEK/ERK a través de las

diferentes isoformas de las proteínas Ras (Wood y cols., 1992; Campbell y cols, 1998). Ras

es activado tras la dimerización, activación y asociación del receptor con actividad tirosina

quinasa a una serie de proteínas adaptadoras, como Grb2, que interaccionan con los GEFs,

como SOS. SOS interacciona con Ras produciendo el intercambio de GDP por GTP. Ras-

GTP interacciona y activa a un gran número de proteínas efectoras entre las que se incluye

18

Introducción

la serina/treonina quinasa Raf (Geyer y Wittinghofer, 1997). El mecanismo exacto por el cual

se produce la activación de Raf no se conoce todavía pero se sabe que es un proceso

complejo constituido por múltiples pasos que implicarían la traslocación de Raf a la

membrana de la célula. Una vez localizada en la membrana, la actividad de Raf se regula

por fosforilación (Chong y cols., 2003). Entre las proteínas que pueden fosforilar a las

distintas isoformas de Raf se encuentran la proteína quinasa C o PKC (Kolch y cols., 1993),

la proteína quinasa A o PKA (Quilliam y cols., 1991) y la proteína quinasa B o PKB que

fosforila e inhibe a Raf (Guan y cols., 2000). Raf activo se une y fosforila a las quinasas de

especificidad dual MEK1 y MEK2 las cuales, a su vez, fosforilan en residuos de treonina y

tirosina a ERK1 y ERK2. Estos residuos se encuentran en un motivo Thr-Glu-Tyr localizado

entre los dominios VII y VIII del lazo de activación de la quinasa. La amplificación de la señal

a través de esta cascada es tal que se estima que un incremento en la activación de Ras del

5% es suficiente para inducir la activación de ERK1 y ERK2 (Hallberg y cols., 1994).

Los sustratos de las ERKs se encuentran en diferentes compartimentos celulares,

incluyendo a proteínas integrales de membrana como el receptor de TNFα CD120a, la

tirosina quinasa Syk, el receptor del factor de crecimiento epidérmico o EGFR y la proteína

calnexina (Roux y Blennis, 2004); sustratos nucleares como los factores de transcripción

Elk-1, MEF-2, c-Fos, c-Myc y STAT3 (Frodin y Gammeltoft, 1999); proteínas del

citoesqueleto como MAP-2 y paxilina (Sturgill y cols., 1998; Ku y Meier, 2000) y algunas

proteínas quinasas como la proteína p90 ribosomal S6 quinasa (RSK), las quinasa activadas

por estrés y mitógenos (MSKs) y las quinasas de interacción con MAPK o MNKs (Roux y

Blennis, 2004).

Las ERKs están implicadas en procesos de proliferación y diferenciación celular,

reorganización del citoesqueleto de actina y migración celular. Además, estas proteínas

también participan en la respuesta al estrés y la muerte celular (Johnson y Lapadat, 2002;

Werlen y cols, 2003).

En el sistema nervioso, la ruta de señalización de las ERKs juega un papel

fundamental en procesos de diferenciación, plasticidad y supervivencia neuronal (Hetman y

Gozdz, 2004). Además, esta ruta participa en la regulación de funciones cognitivas como el

aprendizaje y la memoria (Valjent y cols., 2001). Experimentos realizados en células PC12

demostraron que las ERKs podían tener un papel anti-apoptótico en neuronas ya que en

este modelo la sobre-expresión de mutantes activos de MEK-1 prevenía la apoptosis

inducida por la ausencia del factor de crecimiento nervioso ó NGF (Xia y cols., 1995).

Estudios posteriores han confirmado esta función anti-apoptótica de las ERKs en el sistema

nervioso. Por ejemplo, en células del ganglio de la retina de rata, la activación de las ERKs

19

Introducción puede bloquear la muerte celular inducida por la ausencia del factor neurotrófico derivado

del cerebro, el BDNF (Nakazawa y cols., 2002); en neuronas corticales, las ERKs son

necesarias para la neuroprotección ejercida por estrógenos contra la excitotoxicidad

inducida por glutamato (Singer y cols., 1999) y en neuronas granulares de cerebelo, la

activación del factor de transcripción CREB (“cAMP response element binding protein”) y/o

la inhibición de Bad, puede mediar la función antiápoptótica de las ERKs (Bonni y cols.,

1999).

Sin embargo, aunque las ERKs desempeñan un papel anti-apoptótico en muchos

sistemas como ya hemos visto, cada vez más estudios implican a estas quinasas en

procesos de muerte celular tanto en neuronas como en otros tipos celulares. Varios estudios

demuestran que la inhibición de las ERKs tiene un efecto anti-apoptótico en procesos de

isquemia, epilepsia o toxicidad oxidativa inducida por glutamato (Chu y cols., 2004). En

pacientes con la enfermedad de Alzheimer, se ha observado un incremento en los niveles

de la forma fosforilada de las ERKs en neuronas (Zhu y cols., 2002b) y en pacientes con la

enfermedad de Parkinson, se han detectado en la sustancia negra cantidades anormales de

fosfo-ERK1/2 (Zhu y cols., 2002a).

4.3. LAS MAPKs ACTIVADAS POR ESTRÉS Y CITOQUINAS (JNKs).

En el año 1990 se purificó una proteína de 54 KDa que se activaba por fosforilación

en tirosina y en treonina y que fosforilaba a residuos de treonina y serina seguidos de prolina

(Kyriakis y Avruch, 1990). Esta proteína quinasa se denominó proteína quinasa activada por

estrés (SAPK) ya que se activaba por estímulos nocivos como el calor, la radiación, el estrés

oxidativo, las citoquinas, agentes que dañan al ADN e inhibidores de la síntesis de

proteínas, como la anisomicina y la cicloheximida (Kyriakis y Avruch, 2001). Además,

también se la conoce como JNK porque fosforila el dominio N-terminal de trans-activación

del factor de transcripción c-Jun (Hibi y cols., 1993).

Las JNKs están codificadas por tres genes diferentes denominados jnk1, jnk2 y jnk3.

El procesamiento alternativo de estos tres genes produce 10 o más isoformas distintas de

las JNKs. Las isoformas caracterizadas son la JNK1, JNK2 y JNK3, que comparten una

homología de aminoácidos de hasta el 85 % en mamíferos (Pearson y cols., 2001). Estas

proteínas tienen pesos moleculares de 46 KDa (JNK1α, JNK2α) y 54 KDa (JNK1β, JNK2β),

mientras que las isoformas de JNK3 tienen pesos moleculares de 48 KDa la JNK3α y 57

KDa la JNK3β. Las JNK1 y JNK2 se expresan de forma ubicua mientras que la expresión de

la JNK3 tiene lugar principalmente en el cerebro (Davis, 2000).

20

Introducción

Como ya se ha comentado, las JNKs son activadas principalmente en respuesta a

citoquinas, radiación UV, ausencia de factores de crecimiento, agentes que dañan al ADN y,

en menor medida, por algunos receptores acoplados a proteínas G heterotriméricas, suero y

factores de crecimiento (Kyriakis y Avruch, 2001). Al igual que en el caso de las ERKs, las

JNKs siguen el esquema típico de activación en cascada de las MAPKs. En el caso de las

JNKs, parece ser que las MAPKKKs son activadas por proteínas adaptadoras del tipo Nck,

Crk, Shc o TRAFs y/ó proteínas G monoméricas principalmente de la familia de Rho (Rac,

Rho, Cdc42) (Kyriakis,1999). Entre las MAPKKKs de la ruta de señalización de las JNKs se

encuentran las MEKKs, MLKs, ASK-1, TAK-1 o PAKs (Kyriakis y Avruch, 2001). Estas

MAPKKKs activan y fosforilan a las MAPKKs, MKK4 y MKK7. La MKK4 fosforila

principalmente en residuos de tirosina, mientras que la MKK7 tiene preferencia por residuos

de treonina (Fleming y cols., 2000). Se requiere la actuación de ambas proteínas de forma

sinérgica para la completa activación de las JNKs. Por tanto, la MKK4 y la MKK7 fosforilan y

activan a las JNKs en un residuo de tirosina y en otro de treonina en el motivo conservado

Thr-Pro-Tyr. La ruta de las JNKs también está regulada por proteínas “scaffold” tales como

JIP, β-arrestina y JSAP1 (McDonald y cols., 2000).

Una vez activas, las JNKs pueden fosforilar a diferentes proteínas nucleares y

citoplasmáticas. El principal sustrato de las JNKs es el factor de transcripción inducible c-

Jun, que es fosforilado en los residuos serina 63 y serina 73 (Barr y Bogoyevitch, 2001). c-

Jun es el componente mayoritario del factor de transcripción AP-1 (proteína activadora 1). El

factor AP-1 puede estar compuesto por homodímeros formados por dos moléculas de la

familia de c-Jun (JunB y JunD) o heterodímeros entre una proteína de la familia de Jun y

otra de la familia de Fos (c-Fos, FosB, Fra1 y Fra2) o de la familia de ATF (Karin y cols.,

1997).

Además de c-Jun, las JNKs pueden fosforilar a otros factores de transcripción como

son ATF2 (“Activating Transcription Factor”), NFATc1 (“Nuclear Factor Activated T cells”),

STAT3 (“Signal Transduction and Activator of Transcription 3”) y Elk1. La fosforilación de

estos factores de transcripción por las JNKs afecta a su actividad transcripcional y a la

expresión de aquellas proteínas cuyo nivel de transcripción regulan (Roux y Blennis, 2004).

Las JNKs, además de factores de transcripción, también pueden fosforilar diferentes

sustratos citoplasmáticos como a proteínas del citoesqueleto, a Bim, a Bcl-2 y al receptor de

glucocorticoides.

La ruta de señalización de las JNKs participa en muchos y diferentes procesos

celulares. Así, las JNKs regulan la proliferación celular (Zhang y Liu, 2002) y la apoptosis

(Wada y Penninger, 2004); participan en la organogénesis durante el desarrollo embrionario

21

Introducción (Sabapathy y cols., 1999); controlan la respuesta inmune al regular la expresión de

citoquinas (Sabapathy y cols., 1999), la migración celular (Nishina y cols., 2003) y la

integridad del citoesqueleto (Huang y cols., 2004).

En el sistema nervioso, las JNKs han sido consideradas principalmente como

activadoras de la apoptosis. Esta conclusión se basa en los efectos neuroprotectores que

conlleva la inhibición de las JNKs en varios modelos experimentales, por ejemplo en los

procesos de apoptosis inducida por excitotoxicidad en ratones knockout para JNK3 (Yang y

cols., 1997), en la neurotoxicidad inducida por MPTP (Hunnot y cols., 2004) o en procesos

de isquemia cerebral (Borsello y cols., 2003). Además, las JNKs pueden incrementar la

fosforilación de la proteína asociada a los microtúbulos Tau, lo cual parece ser uno de los

fenómenos típicos en enfermedades neurodegenerativas como la enfermedad de Alzheimer

(Reynolds y cols., 1997). Por otro lado, las JNKs fosforilan las cadenas pesadas de los

neurofilamentos con el consiguiente incremento de la vulnerabilidad al estrés de las

neuronas (Giasson y Mushynski, 1997).

Los mecanismos concretos por los cuales las JNKs activan la apoptosis neuronal no

se conocen con exactitud. Por un lado, regulan la liberación del citocromo c en la

mitocondria (Schroeter y cols., 2003) ya que la fosforilación por las JNKs activa los

miembros pro-apoptóticos de la familia Bcl-2 (Bid, Bim, Bad), mientras que inactiva los anti-

apoptóticos (Bcl-2, Bcl-XL) (Tournier y cols., 2000; Putcha y cols., 2003). Por otro lado, las

JNKs están implicadas en la regulación de la transcripción de genes pro-apoptóticos que

codifican por ejemplo para el ligando de Fas, TNFα o Bim (Putcha y cols., 2003).

Aunque la activación de la ruta de las JNKs es importante para regular la apoptosis

neuronal, se ha demostrado que en condiciones fisiológicas existen altos niveles de JNKs

activadas en neuronas, lo cual indica que la señalización a través de las JNKs puede ser

también importante para otros procesos celulares (Harris y cols., 2002; Besirli y Johnson,

2003). En este sentido, algunos autores atribuyen a las JNKs un papel anti-apoptótico en el

sistema nervioso. Por ejemplo, en cerebros embrionarios de ratones knockout de JNK1 y

JNK2 se observa una activación de caspasa 3 (Kuan y cols., 1999); por otro lado, la

activación de las JNKs protege contra la toxicidad inducida por la radiación UV (Widsom y

cols., 1999).

22

Introducción

4.4. LAS MAPKs ACTIVADAS POR ESTRÉS Y CITOQUINAS (p38 MAPKs).

La p38 MAPK fue descrita inicialmente como un polipéptido de 38 KDa que se

fosforilaba en tirosina en respuesta al choque osmótico o al tratamiento con endotoxinas

(Han y cols., 1994), como una proteína diana de drogas con actividad antiinflamatoria

(CSAIDs) (Lee y cols., 1994) y como una quinasa que se activaba por procesos de estrés

celular o por la citoquina IL-1α (Rouse y cols., 1994; Freshney y cols., 1994).

Hasta la fecha se han descrito cuatro isoformas de p38 MAPKs todas implicadas en

procesos celulares de respuesta a estrés y citoquinas pro-inflamatorias: la isoforma original

p38α, también llamada proteína de unión a CSAIDs (CSBP) o SAPK2a; la p38β o SAPK2b

(Jiang y cols., 1996); la p38γ también llamada SAPK3 o ERK6 (Goedert y cols., 1997b) y la

p38δ o SAPK4 (Goedert y cols., 1997a). Estas cuatro isoformas de las p38 MAPKs

presentan un 60 % de homología en su secuencia. Los transcritos de los genes de p38α y

p38β se expresan de forma ubicua en todos los tejidos, mientras que los de los genes de

p38γ se expresan mayoritariamente en el músculo y los de p38δ en el pulmón y en el riñón

(Jiang y cols., 1997; Wang y cols., 1997).

La cascada principal de activación de las p38 MAPKs lo formarían las siguientes

quinasas: las MAPKKKs que incluyen a la familia de las MEK quinasas, principalmente la

MEKK4, la TGF-β quinasa 1 (TAK 1) y la quinasa reguladora de apoptosis (ASK1); las

MAPKKs MKK3 y MKK6 (también llamadas MEK3 y MEK6 respectivamente) y las MAPKs

que incluyen a las cuatro isoformas de la p38 (α, β, γ y δ) (Roux y Blenis, 2004).

Entre los candidatos para la activación y regulación de las MAPKKKs se encuentran

las proteínas de la familia de Rho, Rac y CDC42 (Ono y Han, 2000). Una vez que las

MAPKKKs están activas fosforilan en residuos de serina y treonina a la MEK3 y a la MEK6.

La MEK3 y la MEK6 activas fosforilan a las distintas isoformas de p38 pero mientras que la

MEK6 activa a todas las isoformas de p38, la MEK3 es más selectiva y fosforila

principalmente a las isoformas p38α y p38β . De esta forma, las cuatro isoformas de la p38

MAPK son activadas por doble fosforilación en residuos de treonina y tirosina localizados en

el motivo Thr-Gly-Tyr del lazo de activación situado entre los subdominos VII y VIII de la

quinasa, siendo necesaria la fosforilación conjunta de ambos residuos para su activación

(Roux y Blenis, 2004).

Las p38 MAPKs activas fosforilan a un gran número de sustratos celulares, entre

ellos factores de transcripción como ATF2 que es un componente del factor de transcripción

23

Introducción AP-1, CREB, Elk-1 y MEF2, participando de esta forma en la regulación transcripcional

necesaria para llevar a cabo la respuesta celular a estímulos de estrés (Takeda y Ichijo,

2002). Además, fosforilan proteínas quinasas como las MAPKAP-K2/5, las MSK172 y la

MNK (Takeda y Ichijo, 2002) y a proteínas como la fosfolipasa citosólica A2, Tau y p53

(Roux y Blenis, 2004).

La ruta de señalización de las p38 MAPKs está implicada en un gran número de

procesos celulares diferentes. Así, tiene un papel central en el control de la respuesta

inmune promoviendo la producción de citoquinas (Ono y Han, 2000); también participa en el

control del ciclo celular; regula la organización del citoesqueleto de actina (Schafer y cols.,

1998) y la migración celular y estimula el crecimiento y la diferenciación celular (Juretic y

cols., 2001; Yosimichi y cols., 2001). Por otro lado, dependiendo del tipo celular y del

estímulo, estas quinasas pueden llegar a ejercer efectos opuestos, induciendo o inhibiendo

la apoptosis (Porras y cols., 2004; Liu y cols., 2001). Además, se han visto implicadas en la

formación de tumores (Yee y cols., 2004).

Mientras que las JNKs parecen desempeñar un papel principal en la regulación de la

apoptosis neuronal, la función de las p38 MAPKs en el sistema nervioso aún está en

discusión. Varios estudios sugieren un papel pro-apoptótico en el sistema nervioso de las

p38 MAPKs (Xia y cols., 1995; Kawasaki y cols., 1997; Mielke y Herdegen, 2000; Harper y

LoGrasso, 2001), sin embargo, otros estudios han implicado a las p38 MAPKs en procesos

de diferenciación neuronal. Así, se ha demostrado que la señalización a través de las p38

MAPKs es necesaria para la diferenciación inducida por el factor de crecimiento nervioso

(NGF) de las células PC12 (Morooka y Nishida, 1998); la MAPKKK TAK1 es una candidata

para actuar como mediadora en la diferenciación neuronal de las células PC12 inducida por

la proteína morfogenética de hueso (BMP) (Yanagisawa y cols., 2001), mientras que la

expresión de la ASK1 constitutivamente activa induce el crecimiento de las neuritas en

células PC12 (Takeda y cols., 2000). Sin embargo, no todas las MAPKKKs que pueden

activar la ruta de las p38 MAPKs inducen necesariamente la diferenciación neuronal en

células PC12, ya que la expresión de MEKK1 induce apoptosis en lugar de diferenciación

(Le-Niculescu y cols., 1999). Una posible explicación de esta discrepancia sería que, en

situaciones fisiológicas de actividad neuronal, la ruta de las p38 MAPKs podría actuar como

un mediador de la supervivencia celular. Por el contrario, una vez que las células sufren un

fuerte estrés, la ruta de las p38 MAPKs actuaría entonces como un mediador de la apoptosis

neuronal (Takeda y Ichijo, 2002). En este sentido, la quinasa ASK1 sería un posible

candidato para actuar como regulador de estos efectos opuestos de las p38 MAPKs, ya que

parece funcionar como un intermediario tanto pro- como anti-apoptótico, dependiendo del

24

Introducción

tipo y el contexto celular (Kanamoto y cols., 2000; Matsuzawa y Ichijo 2001; Takeda y cols.,

2000).

5. SEÑALIZACIÓN CELULAR A TRAVÉS DE LA FOSFATIDILINOSITOL-3 QUINASA (PI3-K).

La fosfatidilinositol-3 quinasa, PI3-K, es una proteína quinasa que cataliza la adición

de una molécula de fosfato específicamente en la posición 3 del anillo de inositol de los

fosfoinositoles (PI) dando lugar a la formación de fosfatidilinositoles (PtdIns), precursores de

todos los fosfoinositoles, y que constituyen al menos el 10% de los lípidos totales en las

membranas de las células eucariotas (Rameh y Cantley, 1999). Además, los

fosfatidilinositoles juegan un papel muy importante en la transducción de las señales, ya que

son los precursores de muchas moléculas que actúan como segundos mensajeros en el

interior celular (Golden y Insogna, 2004). Los miembros de la familia de la PI3-K comparten

el dominio catalítico con otras proteínas quinasas entre ellas las PI4-Ks, la proteína quinasa

mTOR, ATM y la proteína quinasa dependiente de ADN (ADN-PK) (Wymann y cols., 2003).

Estructuralmente, la PI3-K presenta dos subunidades de diferente peso molecular,

denominadas subunidades p85 y p110 ó subunidades reguladora y catalítica,

respectivamente. En células de mamíferos se han caracterizado múltiples isoformas de PI3-

K que se dividen a su vez en tres clases en función de la especificidad de su sustrato, de su

estructura o de su regulación:

a) Las PI3-Ks de la clase I son heterodímeros de aproximadamente 200 KDa,

compuestos por una subunidad catalítica de 110-120 KDa y una subunidad

reguladora de 50-101 KDa. Son capaces de fosforilar in vitro PtdIns, PtdIns 4-P y

PtdIns (4,5)P2. Sin embargo, el principal sustrato in vivo de la clase I de PI3-K parece

ser PtdIns (4,5)P2 (Wymann y Pirola, 1998; Wymann y cols., 2003). Todas las PI3-Ks

de la clase I unen Ras de manera dependiente de GTP a través de un dominio de

unión específico (RBD). Como ya se ha mencionado anteriormente, la clase I de la

PI3-K puede subdividirse en dos subclases (A y B) en función del tipo de subunidad

reguladora a la que se unan (Vanhaesebroeck y cols., 1997): la clase IA de PI3-K

presenta tres isoformas de la subunidad catalítica denominadas p110α, p110β y

p110δ que pueden asociarse con las distintas subunidades reguladoras presentes en

mamíferos (p85α, p85β y p55γ). Dichas subunidades reguladoras interaccionan, a

través de sus dominios de homología 2 de Src, SH2, con residuos fosforilados en

tirosina de otras proteínas; la clase IB presenta la subunidad catalítica p110γ y se

25

Introducción

asocia a la subunidad reguladora p101. La clase IB de la PI3-K es estimulada

directamente por subunidades βγ de proteínas G heterotriméricas. La subunidad

p110γ de esta clase también presenta un dominio amino-terminal de unión a Ras

(Golden y Insogna, 2004).

b) Las PI3-Ks de la clase II son enzimas de gran tamaño (170-210 KDa) que fosforilan

in vitro PtdIns y PtdIns 4-P pero no PtdIns (4,5)P2. Los miembros de esta clase se

caracterizan por presentar dominios C2 en su región C-terminal que median la unión

de calcio y lípidos descritos en las isoformas clásicas de PKC (Cantrell, 2001). No se

conoce su mecanismo de activación ni se han identificado sus proteínas

adaptadoras.

c) Las PI3-Ks de la clase III presentan una subunidad catalítica p110 que comparte

homología con la PI3-K de levaduras, Vps34p. El homólogo humano de Vps34p,

PtdIns3K se encuentra formando un complejo con p150, el homólogo de la

subunidad reguladora de levaduras Vps15p (Panaretou y cols., 1997). Fosforilan

exclusivamente PtdIns. Regulan el transporte intracelular de vesículas.

La clase I de la PI3-K es activada por una gran variedad de estímulos estando

implicada en numerosos procesos celulares tales como el crecimiento, la motilidad, la

adhesión y la supervivencia celular (Coelho y Leevers, 2000). El principal sustrato de la

clase I de la PI3-K es el PtdIns(4,5)P2 y el primer producto de la reacción es el

PtdIns(3,4,5)P3 (Hawkins y cols., 1992). Este lípido es rápidamente metabolizado por inositol

fosfatasas para producir PtdIns(3,4)P2. Los PtdIns(3,4,5)P3 y PtdIns(3,4)P2 se unen a

proteínas con dominios de homología a pleckstrina (PH) (Rameh y cols., 1997), pudiendo de

esta forma modificar alostéricamente su actividad o inducir la relocalización de la proteína y

así definir áreas de la membrana plasmática donde puede ocurrir su activación. Además de

su capacidad para fosforilar lípidos, se ha demostrado posteriormente que las PI3-Ks de la

clase I también pueden fosforilar proteínas. Son serina treonina quinasas que pueden

fosforilar residuos localizados tanto en la subunidad reguladora como en la subunidad

catalítica (Vanhaesebroeck y cols., 1997).

En condiciones normales, la PI3-K de la clase I se encuentra en el citosol y su

activación está regulada por una serie de mecanismos que pueden actuar de una manera

cooperativa:

1. Mediante la unión, a través de dominios SH2 de su subunidad reguladora p85, a un

receptor tirosina quinasa activado o a otras proteínas fosforiladas en tirosina. Se ha

demostrado in vitro que la interacción de p85 con secuencias YMXM fosforiladas en

26

Introducción

tirosina aumenta la actividad catalítica de la subunidad p110 (Golden y Insogna,

2004). Este proceso recluta a la subunidad catalítica p110 de PI3-K hacia la

membrana plasmática, donde puede fosforilar a su principal sustrato PtdIns(4,5)P2 y

generar de esta forma PtdIns(3,4,5) P3 (Kazlauskas, 1994).

2. A través de Ras. Como ya se comentó en un apartado anterior uno de los principales

efectores de las proteínas Ras es la subunidad catalítica de la PI3-K. Así, la

subunidad catalítica p110 de la PI3-K puede unirse a la conformación activa de Ras

a través de los dominios RBD, lo cual podría estabilizar la asociación de p110 con la

membrana plasmática y favorecer su activación (Rodríguez-Viciana y cols., 1996).

3. A través de dominios SH3 de su subunidad reguladora, que se unen a secuencias

ricas en prolina, como las que presentan las proteínas adaptadoras del tipo Shc, Cbl,

Grb2, IRS-1 y Gab. Las moléculas adaptadoras tienen un papel central en la

activación y localización de la clase I de la PI3-K (Wymann y Pirola, 1998).

4. En el caso de la clase IB de las PI3-Ks, mediante la interacción con las subunidades

βγ de las proteínas G heterotriméricas (Vanhaesebroeck y cols., 1997).

5. Por un mecanismo de autofosforilación de la subunidad catalítica p110. En el caso

de la subunidad p110δ esta fosforilación tiene lugar en el residuo Ser 1039 y conlleva

una disminución en su actividad quinasa (Golden y Insogna, 2004).

6. Por la fosforilación de p85 mediante la actividad serina-treonina quinasa intrínseca

de la subunidad catalítica p110. El residuo Ser 608 ha sido identificado como el

principal sitio de fosforilación de la subunidad p85 de forma que su fosforilación

resulta en una disminución de la actividad quinasa de la PI3-K de aproximadamente

el 80% (Golden y Insogna, 2004).

La clase I de la PI3-K está también regulada por la desfosforilación de sus productos

lipídicos por parte de las fosfatasas de fosfoinositoles, PTEN, el producto del gen supresor

de tumores PTEN (“Phosphatase and tensin homolog deleted from chromosome 10”) y SHIP

(“Src homology 2-containing inositol-5-phosphatase”). Estas fosfatasas actúan limitando la

señalización a través de la PI3-K (Golden y Insogna, 2004).

Las clases I y II de la PI3-K son inhibidas de una forma irreversible por el inhibidor

wortmanina, el cual se une covalentemente a la lisina 802 de la subunidad p110 que es un

residuo necesario para su actividad catalítica y de forma reversible con el inhibidor

LY294002 que bloquea el sitio de unión al ATP (Golden y Insogna, 2004).

27

Introducción

Aunque no todas las funciones biológicas de la PI3-K están completamente

clarificadas, la elevación en los niveles de los productos de la PI3-K ha sido implicada en la

regulación de la síntesis del ADN, en la supervivencia y la apoptosis celular, en procesos de

diferenciación, en la quimiotaxis y migración, en el transporte a membranas y en la adhesión

celular y en la formación de fibras de estrés (Wymann y cols., 2003).

Los productos lipídicos de la PI3-K pueden interaccionar con determinadas proteínas

y modular su localización y/ó su actividad a través de dominios de homología a pleckstrina y

dominios C2 (Vanhaesebroeck y cols., 1997). Entre estos efectores de la PI3-K se

encuentran la quinasa dependiente de fosfoinosítidos, PDK1, los factores intercambiadores

de nucleótidos (GEFs) específicos de Rho, Rac y Arf, las tirosinas quinasas de la familia

BTK (“Bruton´s tyrosine kinase”) y la fosfolipasa C, PLCγ (Duronio y cols., 1998; Leevers y

cols., 1999). Además, la PI3-K modula, a través de las proteínas descritas, la actividad de

otros efectores celulares como PKA, PKC, Rac y Arf (Leevers y cols., 1999). Sin embargo, el

principal efector de la PI3-K es una serina-treonina quinasa de 60 KDa denominada

Proteína Quinasa B ó PKB/Akt. Esta proteína fue identificada en 1991 con tres nombres

diferentes PKB, RACPK y Akt (Marte y Downward, 1997). Pertenece a la familia de

proteínas quinasas AGC, las cuales generalmente actúan como efectores de segundos

mensajeros tales como cAMP, cGMP, fosfolípidos o Ca2+ (Devarenne y cols., 2006).

En mamíferos, existen tres isoformas de PKB (α, β, γ ; Akt 1, 2, 3) compuestas por

tres regiones funcionalmente distintas: un dominio N-terminal de homología a pleckstrina, un

dominio central catalítico y un motivo C-terminal hidrofóbico. El dominio N-terminal PH

permite a PKB/Akt unirse a los productos generados por la PI3-K, el PtdIns(3,4,5) P3 y

PtdIns(3,4)P2 mientras que el dominio C-terminal hidrofóbico, HM, parece ser que

proporciona un sitio de unión para la quinasa dependiente de fosfoinosítidos, PDK1 (Sheid y

Woodgett, 2003). El papel específico de este dominio aún no se ha determinado aunque

recientemente se ha sugerido un papel regulador. La tirosina quinasa Src se puede unir

directamente a PKB/Akt a través de la interacción entre su dominio SH3 y un motivo

conservado rico en prolina (PXXP) en este dominio C-terminal de PKB/Akt de tal forma que,

determinadas mutaciones en este motivo de PKB/Akt, disminuyen su interacción con Src, lo

cual puede ser necesario para la fosforilación en tirosina de PKB/Akt y su consecuente

activación por otras quinasas como PDK1 (Jiang y Qiu, 2003).

La unión de la PKB/Akt a los fosfoinositoles-3-fosfato a través de los dominios PH

recluta a esta quinasa a la membrana plasmática donde sufre un cambio conformacional

que permite su fosforilación en dos residuos: en el residuo Thr308 situado en el lazo de

activación del dominio catalítico y en el residuo Ser473 situado en el dominio hidrofóbico HM

28

Introducción

(Vanhaesebroeck y Alessi, 2000). La quinasa responsable de la fosforilación de PKB en la

Thr308 es la PDK1 (Alessi y cols., 1997). Sin embargo, la identidad de la quinasa

responsable de la fosforilación de PKB en la Ser473 ha causado gran controversia.

Recientes estudios atribuyen a la quinasa mTOR este papel de tal forma que cuando se

encuentra formando parte del complejo mTOR-Rictor sería la responsable de fosforilar

directamente a PKB en la Ser473 in vitro lo cual facilitaría la fosforilación del residuo Thr308

por parte de la PDK1 (Sarbassov y cols., 2005; Hresko y Mueckler, 2005). La fosforilación de

PKB en la Ser473 conduce a su activación total y consecuentemente a la regulación de

numerosos procesos celulares, entre los que se incluye la supervivencia celular generada

por estímulos extracelulares (Figura 7).

La PKB/Akt fosforila numerosos efectores que conducen finalmente a cambios

globales en la fisiología celular y promueven la supervivencia. Entre los mecanismos

implicados en esta función celular se encuentra la fosforilación de diversos factores de

transcripción y de proteínas reguladoras de la apoptosis y del ciclo celular. Adicionalmente

se ha descrito que la PKB/Akt puede inhibir la transcripción de genes pro-apoptóticos,

provocar cambios metabólicos o inducir cambios en la traducción de los ARNms que

controlan la muerte celular (Vivanco y Sawyer, 2002). De esta forma, la PKB/Akt promueve

la supervivencia celular al fosforilar e inactivar proteínas que median la apoptosis (Lawlor y

Alessi, 2001), como la glucógeno sintasa quinasa ó GSK-3, (Cross y cols., 1995), el factor

proapoptótico Bad (Datta y cols., 1997) y la caspasa 9 humana (Cardone y cols., 1998).

Entre las dianas moleculares de la PKB se encuentra la serina treonina quinasa mTOR

(Holland y cols., 2004), que a su vez tiene como efectores moleculares directos a proteínas

reguladoras de la traducción de proteínas y consecuentemente del crecimiento y la

supervivencia celular, como son la quinasa p70S6K o S6K (Burnett y cols., 1998; McMahon y

cols., 2002) y la proteína reguladora del factor de iniciación de la traducción en eucariotas

eIF4E, 4E-BP1 (Choi y cols., 2003). Entre otros muchos efectores descritos, PKB también

fosforila directamente factores de transcripción entre los que se incluyen los miembros de la

familia de los forkhead (FKHR, FKHRL y AFX) (Medema y cols., 2000) y los factores de

transcripción NF-κB y CREB (Rodgers y Theibert, 2002).

29

Introducción

Los elevados niveles en la expresión de la PI3-K durante el desarrollo normal del

sistema nervioso y los cambios observados en condiciones neurodegenerativas apoyan la

hipótesis de la contribución de la ruta de la PI3-K a los procesos que regulan el crecimiento

y la diferenciación celular en el sistema nervioso. Activada por factores tróficos, factores de

crecimiento, citoquinas o neurotransmisores, la PI3-K participa por tanto en los procesos de

diferenciación y supervivencia de células neuronales y de la glia.

Una función esencial de la PI3-K es promover la supervivencia neuronal y de las

células de la glia. Varios estudios realizados tanto en cultivos primarios de neuronas como

en líneas celulares neuronales, han puesto de manifiesto que la PI3-K es activada por las

neurotrofinas clásicas (NGF y BDNF), por factores de crecimiento neurotróficos (IGF-1 y

GDNF), a través de proteínas de la matriz extracelular como las lamininas, a través de

quimioquinas y por neurotransmisores (Rodgers y Theibert, 2002). De esta forma, la

activación de la PI3-K es necesaria para promover la supervivencia de neuronas primarias

PI3-K

Adaptador

P

p85p110

P

P

Ras GTP

PKB

PDK1P

PDK2 P

P P

CRECIMIENTO Y SUPERVIVENCIA

F

PIP2 PIP3 PH

PH

Bad

NF-κβCaspasa 9 Raf

FKHR

mTORGSK-3 CREB

Figura 7. La ruta de señalización de la PI3-K

30

Introducción

de cerebelo, simpáticas, sensoriales, motoras, corticales, del hipocampo, de la retina y de

líneas celulares de neuroblastoma. En el caso de células gliales, la activación de la PI3-K

también es crítica para la supervivencia. Así, en astrocitos y células de Schwann, la PI3-K

puede ser activada por neurogulinas, por los miembros de la familia de GDNF, IGF-1,

citoquinas como la IL-1 o neurotransmisores (Rodgers y Theibert, 2002).

La PI3-K está también implicada en procesos de migración de neuronas y de células

de la glia (Segarra y cols., 2006; Wang y cols., 2005) y en procesos de diferenciación

neuronal a través de las proteínas de la familia de Rho (Schmid y cols., 2000; Hall y cols.,

2001).

El principal efector de la PI3-K, la PKB/Akt también está implicada en procesos de

supervivencia neuronal (Brunet y cols., 2001). De las tres isoformas de Akt, Akt3 es la que

se expresa de una forma mayoritaria en neuronas. En presencia de factores tróficos, un

dominante negativo de Akt bloquea la supervivencia neuronal mientras que la expresión de

de la forma activa de Akt es suficiente para promover la supervivencia neuronal en ausencia

de factores tróficos (Toker, 2000; Yuan y Yankner, 2000). Akt además, fosforila a una gran

variedad de proteínas que están implicadas de una forma u otra en la supervivencia

neuronal: cuando GSK-3 es fosforilada por Akt se inhibe su actividad y se ha descrito que

una mayor actividad de GSK-3β aumenta la apoptosis en distintos sistemas neuronales; los

factores de transcripción forkhead, FKHRL1, promueven apoptosis al aumentar la

transcripción de genes implicados en la muerte celular como FasL por lo que Akt puede

promover supervivencia neuronal al fosforilar e inhibir a los miembros de la familia forkhead.

Además, Akt puede ejercer su acción a través de la activación de NF-κB y CREB, dos

factores de transcripción que pueden promover supervivencia neuronal (Toker, 2000; Kaplan

y Miller, 2001; Brunet y cols., 2001; Patapoutian y Reichardt, 2001).

31

Objetivos

Tal y como se ha señalado en el apartado de la Introducción, la ruta de biosíntesis

del colesterol juega un papel muy importante en el crecimiento, supervivencia,

diferenciación, maduración y mantenimiento de las funciones celulares de todos los tejidos,

incluido los tejidos neuronales. Mientras que los efectos beneficiosos de la inhibición de la

biosíntesis del colesterol con estatinas están ampliamente contrastados, los efectos de estos

fármacos en el sistema nervioso no se conocen en profundidad.

Estudios previos realizados por nuestro grupo ponen de manifiesto que la lovastatina

es capaz de inducir la apoptosis de los neuroblastos fetales de rata. Por lo tanto:

El objetivo general del presente trabajo es estudiar las cascadas de señalización intracelular que desencadenan la apoptosis de células neuronales y, en particular, estudiar las rutas de transducción de señales implicadas en la muerte de los neuroblastos fetales de rata inducida por la lovastatina.

Bajo esta perspectiva, los objetivos concretos del presente trabajo son:

1. Estudiar el efecto de la lovastatina en el estado de activación de Ras en neuroblastos

fetales de rata.

2. Estudiar la implicación de la ruta que regula la supervivencia celular PI3-K/PKB en la

apoptosis de los neuroblastos inducida por la lovastatina.

3. Estudiar el papel que desempeña la ruta que controla la supervivencia celular ERK

en la apoptosis inducida por la lovastatina en neuroblastos fetales de rata.

4. Estudiar el efecto de la lovastatina en la ruta reguladora de la muerte celular JNK en

neuroblastos fetales de rata.

5. Estudiar la implicación de la ruta de la p38 MAPK en la apoptosis de neuroblastos

inducida por la lovastatina.

La metodología empleada en este trabajo, así como los resultados obtenidos, serán

expuestos a continuación.

33

Materiales y Métodos

1. MATERIALES.

1.1. PRODUCTOS Y REACTIVOS GENERALES.

La lovastatina (MK-808) o lactona del ácido mevínico [2β, 6α-dimetil-8α-(2-metil-1-

oxobutoxy)], se obtuvo de Calbiochem (La Jolla, CA, USA). La forma lactona de la

lovastatina es inactiva, por lo que antes de utilizarla se activó según el protocolo

descrito por Kita y cols. (1980).

El ácido mevalónico y el sustrato de la PI3-K, el fosfatidilinositol, son de Sigma-

Aldrich (St.Louis, MO, USA).

Los inhibidores PD98059 (2´-amino-3´-metoxyflavona), que inhibe a MEK, LY294002

[2-(4-Morfolinyl)-8-fenil-4H-1-benzopirano-4-uno] y Wortmanina (C23H24O8 ), que

inhiben a la PI3-K, SB 203580 que inhibe a las p38 MAPKs y el Péptido Inhibidor I de

las JNKs fueron suministrados por Calbiochem (La Jolla, CA, USA). Otro inhibidor de

las p38 MAPKs, el BIRB796 fue amablemente cedido por la Dr. Ana Cuenda

(Departamento de Bioquímica y Biología Molecular de la Universidad de

Extremadura).

Los anticuerpos utilizados se obtuvieron de las siguientes casas comerciales: anti

p85 de la PI3-K (06-195), anti fosfo Ser 133-CREB (06-519) y anti fosfo Ser 63-c-jun

(06-828) de Upstate Biotechnology (Lake Placid, NY, USA); anti fosfo Ser

472/473/474-Akt (559029), anti Akt (559028), anti fosfotirosina PY20 (610000), anti

pan Ras (610002) y anti c-jun (610326) en BD Biosciences Pharmigen (San Diego,

CA, USA); anti fosfo Thr 389-p70S6K (9205L), anti p70S6K (9202), anti 4E-BP1 (9452),

anti-SAPK/JNK (9252) y anti fragmento activo de caspasa 3 (9665) de Cell Signaling

Technology; anti fosfo Thr 183/Tyr 185-ERK p44/p42 (M8159), anti ERK p44/p42

(M3807), anti CREB (8977) y anti actina (A2066) de Sigma (St.Louis, MO, USA); anti-

GAPDH (RDI-TRK5G4-6C5) de Fitzgerald Inc. (Concord, MA, USA); anti-Bim

(202000) de Calbiochem (La Jolla, CA, USA); anti-p38 MAPK (sc-535) de Santa Cruz

Biotechnology (Santa Cruz, CA, USA); el anticuerpo anti fosfo Thr 180/Tyr 182-p38

MAPK fue amablemente cedido por la Dr. Ana Cuenda (Departamento de Bioquímica

y Biología Molecular de la Universidad de Extremadura); los anticuerpos secundarios

anti-conejo (31460) y anti-ratón (31430) conjugados a la peroxidasa de rábano

picante se obtuvieron de Pierce (Rockford, IL, USA).

35

Materiales y Métodos

El resto de los reactivos y productos utilizados (sales, ácidos y bases inorgánicos,

solventes orgánicos, detergentes, etc.) fueron de la máxima pureza disponible y se

adquirieron de diferentes casas comerciales.

1.2. MATERIALES, REACTIVOS Y PRODUCTOS UTILIZADOS EN LOS CULTIVOS CELULARES.

El medio de cultivo Ham´s F-12, el suero bovino fetal (FBS), los antibióticos

(penicilina y estreptomicina), la solución de Tripsina-EDTA y la glutamina se

obtuvieron de PANTM Biotech (Aidenbach, Alemania).

El material de plástico estéril utilizado (placas de cultivo de 100, 60 y 35 mm de

diámetro, tubos Falcon de centrífuga, pipetas, etc.) se obtuvo de TPP (Trasadingen,

Suiza).

Las soluciones empleadas se esterilizaron por filtración (filtros MillexR-6S de 0.22µm

de Millipore Ibérica, Madrid), mientras que el material sólido se esterilizó en

autoclave Selecta Presoclave 75 (Barcelona).

36

Materiales y Métodos

2. MÉTODOS.

2.1. LÍNEA CELULAR Y MÉTODOS DE CULTIVO.

Todos los estudios que se muestran en el presente trabajo se realizaron en una línea

celular de neuroblastos fetales de rata, denominada línea celular E18. La línea celular E18

se estableció por inmortalización espontánea de cultivos de corteza cerebral de embriones

de rata de 17 días (Muñoz y cols., 1993) y fue amablemente cedida por el Dr. Alberto Muñoz

(Instituto de Investigaciones Biomédicas, CSIC, Madrid). Estas células son neuroblastos

primitivos que expresan las proteínas NF 68 y nestina pero que no expresan la proteína

ácida fibrilar de la glia (GFAP). Las células E18 se crecieron en presencia de medio Ham´s

F12 suplementado con un 10 % FBS, L-glutamina (2mM), penicilina (100 U/ml) y

estreptomicina (100 µg/ml) en frascos de 75cm2 y se mantuvieron en una atmósfera de 5%

CO2 /95% de aire, saturada de humedad a 37ºC. La división de los cultivos se llevó a cabo

cada dos o tres días, tras alcanzar la confluencia siguiendo el protocolo descrito en el

apartado siguiente.

Procedimiento experimental.

Las células se lavaron con PBS (9,1 mM Na2HPO4, 1,7 mM NaH2PO4, 150 mM NaCl)

y se despegaron de los frascos de mantenimiento mediante la utilización de una solución de

Tripsina-EDTA (0,05% de tripsina y 0,02% de EDTA en PBS). La suspensión celular se

centrifugó durante 5 minutos a 60 g y las células resultantes se resuspendieron en el medio

de cultivo suplementado. A continuación, se contaron las células utilizando una cámara de

Neubauer (Blau Brand, Alemania) y un microscopio de contraste de fases Leica DMIL

(Wetzlar, Alemania). Las células se sembraron en placas de cultivo a una densidad

aproximada de 20.000 células/ cm2. Después de 24 horas de incubación, el medio se eliminó

y se reemplazó por medio completo (grupo control) o conteniendo los diferentes agentes a

estudiar (grupos experimentales), tras lo cual, el periodo de incubación se prolongó durante

6 ó 24 horas más, dependiendo del objetivo del estudio. Para los experimentos de tiempo-

respuesta, las células se incubaron con lovastatina 10 µM durante diferentes periodos de

tiempo. Al final de cada experimento, las células se procesaron de forma diferente,

dependiendo del objetivo final del estudio y de acuerdo con las técnicas que se detallan a

continuación.

37

Materiales y Métodos

2.2. ESTUDIO DE LOS NIVELES DE PROTEÍNAS POR WESTERN BLOT.

2.2.1. Obtención de extractos celulares totales.

Tras los diferentes tratamientos, las células adheridas y/o en suspensión se lavaron

con PBS a 4ºC, se centrifugaron a 20.000 g durante 60 segundos y finalmente se incubaron

con un tampón de lisis [50 mM HEPES pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glicerol,

5 mM MgCl2, 25 mM NaF, 1 mM EGTA, 10 mM de pirofosfato de sodio, 4 µg/ml de la mezcla

de inhibidores de proteasas de Roche (Mannheim, Alemania), 500µM ortovanadato sódico]

durante 10 minutos en hielo. A continuación, los extractos celulares se centrifugaron a

20.000 g durante 15 minutos a 4ºC y el sobrenadante se guardó a –20ºC hasta su

utilización.

2.2.2. Obtención de los extractos de proteínas nucleares.

Los extractos de proteínas nucleares se obtuvieron siguiendo el método descrito en

el Kit “Nuclear/Cytosol Fractionation” de MBLTM (Woburn, MA, USA). Las células se lavaron

con PBS a 4ºC y se recogieron por rascado y posterior centrifugación a 20.000 g durante 60

segundos. El precipitado celular se resuspendió en el tampón CEB A (“Cytosol Extraction

Buffer A”). Tras agitar la muestra en un agitador de tubos durante 15 segundos, se incubó

10 minutos en hielo. A continuación, se añadió a la muestra el tampón CEB B (“Cytosol

Extraction Buffer B”), se agitó durante 15 segundos y se mantuvo en hielo 1 minuto.

Seguidamente se centrifugó a 20.000 g durante 5 minutos a 4ºC. El sobrenadante (extracto

citoplasmático) se guardó a -80ºC hasta su utilización. El precipitado nuclear se resuspendió

en el tampón NEB mix (“Nuclear Extraction Buffer mix”). La muestra se mantuvo en hielo

durante un total de 40 minutos agitándose durante 15 segundos cada 10 minutos. Tras este

periodo, la muestra se centrifugó a 20.000 g durante 10 minutos a 4ºC. El sobrenadante

(extracto nuclear) se recogió y se almacenó a -80ºC hasta su utilización.

2.2.3. Cuantificación de las proteínas.

La concentración de proteínas en cada muestra se determinó utilizando el reactivo de

Bio-Rad (Manchen, Alemania) siguiendo el protocolo descrito por el proveedor y utilizando

albúmina de suero bovino para construir la curva patrón.

2.2.4. Electroforesis de proteínas.

Las proteínas presentes en los extractos celulares (15-20 µg/muestra) o en los

inmunoprecipitados con anticuerpo anti-fosfotirosina PY20 (ver apartado 2.4.1.1.), se

resolvieron mediante electroforesis en geles de poliacrilamida al 10% o al 12% en

38

Materiales y Métodos

condiciones reductoras y desnaturalizantes (SDS-PAGE). La electroforesis se llevó a cabo

en presencia de 25 mM Tris base, pH 8.3, 192 mM glicina y 0,1% SDS.

Las muestras se prepararon para la electroforesis mezclándose con tampón Laemmli

(60 mM Tris pH 6.8, 2% SDS, 10% glicerol, 100 mM ditiotreitol (DTT), 0,001% azul de

bromofenol, 2,5% mercaptoetanol), tras lo cual las muestras se calentaron a 95ºC durante 5

minutos.

2.2.5. Electrotransferencia de proteínas a membrana.

Una vez terminada la electroforesis, las proteínas se transfirieron a una membrana

de PVDF (difluoruro de polivinilo) de PolyScreen NEN Life Science Products Inc. (Boston,

MA, USA) mediante el paso de corriente eléctrica a 20V durante 15 minutos, utilizando un

equipo de transferencia en semiseco Transblot SD de BioRad (Hércules, CA, USA). La

electrotransferencia se realizó en un gradiente de fuerza iónica mediante la utilización de

tres tampones diferentes: SDB-1 (40 mM ácido amino caproico, 25 mM Tris base y 20%

metanol); SDB-2 (25 mM Tris base y 20% metanol) y SDB-3 (300 mM Tris base y 20%

metanol). Una vez realizada la transferencia, las proteínas presentes en la membrana se

tiñeron con una solución de rojo Ponceau (0.5% rojo Ponceau y 5% ácido acético) con

objeto de saber si se habían resuelto y transferido de una forma correcta.

2.2.6. Detección de las proteínas.

La detección de las proteínas se realizó mediante el uso de anticuerpos específicos

(Tabla 1). Para ello, primero se incubó la membrana toda la noche a 4º C o durante 1 hora a

temperatura ambiente con una solución de bloqueo, (5% de leche desnatada ó 3% de BSA,

10 mM Tris-HCl pH 7.5, 100 mM NaCl y 0,5% Tween-20), con el fin de bloquear los sitios de

unión inespecífica de la membrana. Posteriormente la membrana se incubó durante una

hora a temperatura ambiente o toda la noche a 4ºC, con el anticuerpo primario diluido en 10

mM Tris-HCl pH 7.5, 100 mM NaCl y 0,05% Tween-20 y 5% de leche desnatada ó 3% de

BSA. Tras esta incubación se realizaron tres lavados de 10 minutos cada uno en una

solución de lavado, (10 mM Tris-HCl pH 7.5, 100 mM NaCl y 0,05% Tween-20), y a

continuación, se procedió a la incubación de la membrana durante 45 minutos a temperatura

ambiente, con el anticuerpo secundario específico conjugado con peroxidasa de rábano y

diluido en la misma solución que el anticuerpo primario. A continuación, las membranas se

lavaron tres veces durante 10 minutos, tras lo cual se secaron suavemente y se pusieron

sobre un recipiente adecuado para proceder a la detección de proteínas específicas. La

detección de las proteínas se realizó incubando las membranas durante 5 minutos con

luminol y el sustrato de la peroxidasa que se encuentra unida al anticuerpo secundario, de

39

Materiales y Métodos este modo se produce una reacción de quimioluminiscencia y la luz emitida es capaz de

impresionar una película sensible a ella (Hyperfilm, Amersham Biosciencies, UK). Como

sustrato de la reacción de luminiscencia se utilizó el reactivo SuperSignal West Pico

Chemiluminescent de Pierce (Rockford, IL, USA). En algunas ocasiones se utilizaron los

reactivos Supersignal West Dura Extended Duration Substrate y Supersignal West Femto

Maximum Sensitivity Substrate, de Pierce. Después de revelar la película, las bandas

correspondientes a las proteínas específicas se fotografiaron mediante la utilización de un

equipo de documentación y análisis de imágenes Chemi Doc de Bio-Rad (Hércules, CA,

USA).

Tabla 1. Anticuerpos específicos utilizados para la detección de proteínas por Western Blot.

Anticuerpos Primarios

Dilución Tiempo de incubación

Anticuerpo Secundario

p85 de la PI3-K 1/1000 Toda la noche a 4ºC Conejo (1/10000)

P-Akt (Ser 472/473/474) 1/1000 Toda la noche a 4ºC Ratón (1/2000)

Akt 1/1000 Toda la noche a 4ºC Conejo (1/10000)

P-p70S6K (Thr 389) 1/1000 Toda la noche a 4ºC Conejo (1/10000)

p70S6K 1/1000 Toda la noche a 4ºC Conejo (1/10000)

4E-BP1 1/3500 1 hora a T.A. Conejo (1/10000)

Ras 1/1000 1 hora a T.A. Ratón (1/2000)

P-ERK p44/p42 (Thr 183/Tyr 185)

1/5000 1 hora a T.A. Ratón (1/2000)

ERK p44/p42 1/5000 1 hora a T.A. Conejo (1/10000)

P- CREB (Ser 133) 1/1000 Toda la noche a 4ºC Conejo (1/10000)

CREB 1/1000 Toda la noche a 4ºC Conejo (1/10000)

SAPK/JNK 1/500 Toda la noche a 4ºC Conejo (1/10000)

P- c-jun (Ser 63) 1/200 Toda la noche a 4ºC Conejo (1/10000)

c-jun 1/1000 Toda la noche a 4ºC Ratón (1/2000)

P-p38 (Thr180/Tyr182) 1/1000 Toda la noche a 4ºC Conejo (1/10000)

p38 1/1000 Toda la noche a 4ºC Conejo (1/10000)

Bim 1/1000 1 hora a T.A. Conejo (1/10000)

fragmento activo de caspasa 3

1/1000 Toda la noche a 4ºC Conejo (1/10000)

actina 1/5000 1 hora a T.A. Conejo (1/10000)

GAPDH 1/20000 1 hora a T.A. Ratón (1/2000)

40

Materiales y Métodos

2.3. ENSAYO DE DETECCIÓN DE RAS-GTP.

Se trata de un método que permite detectar Ras activo mediante la unión específica

de Ras-GTP al dominio de Raf-1 que reconoce la región efectora de Ras (RBD: “Ras

Binding Domain”). Para ello, es necesario previamente amplificar y expresar la proteína de

fusión GST-RBD-Raf-1, contenida en el vector de expresión pGEX-4T-1-RBD-Raf-1,

siguiendo los protocolos que se describen a continuación.

2.3.1. Establecimiento de bacterias competentes.

El primer paso para amplificar un plásmido consiste en transformar cepas

bacterianas competentes con el plásmido de interés. Para ello se obtuvieron bacterias

competentes siguiendo el método de permeabilización con calcio. Bacterias E.coli DH5α se

crecieron en 50 ml de medio LB estéril (10% triptona, 0,17 M NaCl, 5% extracto de levadura,

pH 7.2) durante toda la noche a 37ºC, con agitación circular. A la mañana siguiente, las

bacterias se pasaron a un matraz que contenía 100 ml de medio LB dejándolas crecer

durante 2 ó 3 horas en las mismas condiciones, hasta obtener una densidad óptica de 0.4-

0.6 a una longitud de onda de 600 nm. A continuación, el contenido del matraz se distribuyó

en tubos de 50 ml y se centrifugaron a 1.800 g durante 5 minutos a 4ºC. El precipitado

bacteriano se resuspendió en 50 ml de 50 mM CaCl2, y se incubó durante 15 minutos en

hielo, centrifugándose de nuevo a 1.800 g durante 5 minutos a 4ºC, tras lo cual, el

precipitado bacteriano se resuspendió nuevamente en 10 ml de 50 mM CaCl2 y se incubó

durante 10 minutos en hielo. Finalmente, se añadió 10% de glicerol y se prepararon

alícuotas que se guardaron a –80ºC hasta su utilización.

2.3.2. Transformación de bacterias competentes.

Una vez obtenidas las células competentes se llevó a cabo una transformación

bacteriana. Las bacterias competentes se incubaron en presencia de ADN plasmídico

(aproximadamente 100 ng), durante 30 minutos en hielo. A continuación, se realizó un

choque de calor durante 1 minuto a 42ºC, e inmediatamente después se pusieron en hielo

durante 5 minutos. Posteriormente se añadió a cada tubo 1 ml de medio LB y se incubó

durante una hora en agitación a 37ºC para que las bacterias se recuperaran y replicaran.

Posteriormente se procedió a la selección de las bacterias que habían introducido el

plásmido mediante la siembra en placas de Petri previamente preparadas con medio LB

suplementado con 1,5% de bactoagar y 100 µg/ml de ampicilina, a la cual sólo son

resistentes las bacterias transformadas. Se dejaron crecer durante toda la noche a 37ºC. Al

día siguiente se seleccionó una colonia y se creció en medio LB con ampicilina,

procediéndose a continuación a expresar la proteína como se describe a continuación.

41

Materiales y Métodos

2.3.3. Expresión de la proteína GST-RBD-Raf-1.

Las bacterias DH5α, transformadas con el plásmido pGEX-4T-1-RBD-Raf-1, se

cultivaron en 50 ml de medio LB con 100 µg/ml de ampicilina durante toda la noche y a 37º

C. Posteriormente se realizó una dilución 1/10 de ese cultivo (volumen final de 500 ml) y las

células se incubaron a 37ºC hasta que alcanzaron una densidad óptica de 0.5-0.6 a 600 nm.

Una vez alcanzada dicha densidad, se indujo la expresión de la proteína de fusión

añadiendo al medio 1 mM de IPTG y prolongándose la incubación durante 3 horas a 37ºC.

Transcurrido este tiempo, las células se centrifugaron a 10.000 g durante 10 minutos a 4º C.

El precipitado bacteriano se resuspendió en 10 ml de PBS que contenía 0,05 mM DTT, 4

µg/ml de la mezcla de inhibidores de proteasas de Roche y 500 µM ortovanadato sódico.

Después de sonicar las células de 6 a 8 veces durante 1 minuto en hielo en un sonicador

modelo Vibra Cell SONICS & MATERIAL Inc. (Danbury, USA), se añadió Triton X-100 al

extracto de bacterias hasta una concentración del 1%. El extracto se incubó durante 30

minutos a 4ºC en un agitador orbital de tubos. Transcurrido este tiempo, el extracto

bacteriano se centrifugó a 3.000 g durante 10 minutos a 4ºC. Se recogió el sobrenadante y

se le añadió glicerol hasta una concentración del 10%. El extracto celular se mantuvo a -

80ºC hasta su utilización.

2.3.4. Purificación de la proteína de fusión GST-RBD-Raf-1.

Para purificar la proteína de fusión, los extractos celulares se incubaron con

Glutation-sefarosa 4B durante 2 horas en un agitador orbital a 4ºC. Transcurrido este

tiempo, las muestras se lavaron 3 veces con tampón de lisis [20 mM Tris pH 7.4, 1 mM

EDTA, 10% glicerol, 100 mM KCl, 1 % Triton X-100, 0,05% β-mercaptoetanol, 5 mM NaF;

500µM ortovanadato sódico; 5 mM MgCl2; 1 mM fenil-metil-sulfonil fluoruro (PMSF), 4 µg/ml

de la mezcla de inhibidores de proteasas de Roche] y se realizaron centrifugaciones

sucesivas de 30 segundos a 10.000 g a 4ºC.

2.3.5. Ensayo de detección de Ras-GTP.

Al final de cada experimento, las células se recogieron en PBS y se centrifugaron

durante 60 segundos a 20.000 g a 4ºC. A continuación las células se lisaron en el tampón de

lisis descrito en el apartado anterior durante 10 minutos en hielo. Transcurrido este tiempo,

los extractos celulares se centrifugaron a 20.000 g durante 5 minutos a 4ºC, se recogió el

sobrenadante y se determinó la concentración de proteínas en cada muestra como se

describió con anterioridad. A continuación, 250 µg de proteína de cada una de las

condiciones experimentales se incubaron en presencia de la proteína de fusión GST-RBD-

Raf-1/Glutation-sefarosa durante 2 horas en agitación y a 4ºC. Seguidamente, las muestras

42

Materiales y Métodos

se lavaron tres veces en tampón de lisis. A continuación, se añadió tampón Laemmli a cada

muestra, se incubaron durante 5 minutos a 95ºC y se procedió a detectar los niveles de la

proteína Ras unida a GST-RBD-Raf-1 mediante Western blot.

2.4. ENSAYOS DE ACTIVIDAD DE PROTEÍNAS QUINASAS IN VITRO.

2.4.1. Ensayo in vitro de la actividad quinasa de la PI3-K.

2.4.1.1. Ensayos de inmunoprecipitación.

Tras los diferentes tratamientos, las células se lisaron con un tampón de lisis cuya

composición era la siguiente: 20 mM Hepes pH 7.4, 10 mM EGTA, 1% NP-40, 40 mM β-D-

glicerofosfato, 10% glicerol, 2,5 mM MgCl2, 1mM DTT, 2 mM ortovanadato sódico, 1 mM

PMSF, 10 µg/ml aprotinina y 10 µg/ml leupeptina. A continuación, los extractos celulares se

centrifugaron a 20.000 g durante 15 minutos a 4ºC y se recogió el sobrenadante. Proteínas

de los lisados (150 µg) se incubaron con 4µg de anticuerpo monoclonal anti-fosfotirosina

PY20 y 30 µl de proteína A unida a sefarosa, durante toda la noche con agitación constante

y a 4°C. Los inmunoprecipitados conteniendo las proteínas fosforiladas en tirosina se

lavaron dos veces con el tampón A (PBS, 1% NP-40, 100 µM ortovanadato sódico), dos

veces en tampón B (100 mM Tris pH 7.5, 0,5 M LiCl, 1 mM EDTA, 100 µM ortovanadato

sódico) y dos veces en tampón C (Tris 25 mM pH 7.5, 100 mM NaCl, 1 mM EDTA) a 4°C.

2.4.1.2. Ensayo in vitro de la actividad quinasa.

El sustrato de la PI3-K, el fosfatidilinositol, se secó en una atmósfera suave de

nitrógeno, se resuspendió en un volumen adecuado de 25 mM HEPES pH 7.5 y 1 mM EDTA

para conseguir una concentración de 1 µg/µl y se sonicó de 3 a 4 veces durante 15

segundos. Los inmunoprecipitados con anti-fosfotirosina se resuspendieron en 25 µl de

fosfatidilinositol. La reacción quinasa in vitro empezó tras la adición del tampón de reacción

[25 mM Hepes pH 7.4, 10 mM MgCl2, 0,5 mM EGTA, 100 nM [γ-32P]ATP (10 µCi), 40 µM

ATP] y su incubación durante 20 minutos a 30 °C con agitación rápida y constante. La

reacción enzimática se paró con la adición a 4°C de 400 µl de CHCl3: metanol (1:2) con 1%

HCl, 125 µl de CHCl3 y 125 µl 10 mM de HCl. Las muestras se centrifugaron durante 2

minutos a temperatura ambiente, tras lo cual, la fase orgánica se recogió y se lavó con 500

µl de metanol: 100 mM HCl y 2 mM EDTA (1:1). La fase orgánica se secó con nitrógeno y se

resuspendió en 25 µl de CHCl3. La separación de los lípidos se realizó por cromatografía de

capa fina. Las muestras se aplicaron en placas de silica gel y la cromatografía se realizó en

CHCl3:MetOH:H2O:NH4OH (120:94:23,2:4). Los fosfolípidos de inositol, productos de la

43

Materiales y Métodos reacción, marcados con 32P se detectaron por autorradiografía utilizando una película

sensible a la radiactividad.

2.4.2. Ensayo in vitro de la actividad quinasa de la JNK.

Como sustrato de la enzima JNK se utilizó una proteína de fusión, GST-c-Jun,

formada por el fragmento N-terminal (aminoácidos 1 a 79) de la proteína c-Jun, que

presenta los sitios de unión y de fosforilación (Ser 63 y Ser 73) específica para JNK, y por la

enzima glutationil-S- transferasa (GST). La proteína de fusión se expresó siguiendo el

protocolo descrito para la proteína de fusión GST-RBD-Raf-1. Después de cada tratamiento,

los extractos celulares totales se prepararon siguiendo el protocolo descrito anteriormente.

Un volumen de extracto celular, que contenía 200 µg de proteínas, se incubó en presencia

de GST-c-Jun unida a Glutation-sefarosa 4B durante una hora a 4 ºC en una plataforma

orbital, con objeto de permitir la unión de JNK a su sustrato c-Jun. A continuación esta

suspensión se centrifugó durante 1 minuto a 20.000 g, se eliminó el sobrenadante y el

precipitado se lavó 4 veces con solución de lavado (20 mM Tris-HCl pH 7.5, 50 mM NaCl,

2,5 mM MgCl2, 0,1 mM EGTA, 0.05% (v/v) Triton X-100, 0.1% (v/v) 2-mercaptoetanol y 1

mM ortovanadato sódico) y una vez con el tampón de reacción (25 mM Tris-HCl pH 7.5, 20

mM ß-glicerofosfato, 10 mM MgCl2, 0,1 mM EGTA, 0,5 mM NaF y 1 mM ortovanadato

sódico). A continuación el precipitado se resuspendió en tampón de reacción iniciándose la

reacción de fosforilación añadiendo a la mezcla 5 µCi de [γ-32P] ATP. Después de 20

minutos de incubación a 30ºC, la reacción de fosforilación se paró añadiendo a la mezcla

tampón Laemmli. Las muestras se incubaron durante 5 minutos a 95ºC y las proteínas se

resolvieron en un gel SDS-PAGE al 10%. Después de la electroforesis, los geles se secaron

y la presencia de 32P c-Jun se visualizó por autorradiografía.

2.5. ENSAYO DE RETARDO DE LA MOVILIDAD ELECTROFORÉTICA (EMSA).

2.5.1. Marcaje de los oligonucleótidos.

El oligonucleótido de doble cadena utilizado como sonda para AP-1 está compuesto

por el sitio de reconocimiento conservado para AP-1 al que se pueden unir tanto

homodímeros de c-Jun como heterodímeros formados por Jun y Fos (Lee y cols., 1987). Su

secuencia es la que se describe a continuación:

5´-tgcaCGCTTGATGACTCAGCCGGAA-3´

5´-tgcaTTCCGGCTGAGTCATCAAGCG-3´

44

Materiales y Métodos

El oligonucleótido de doble cadena (100 ng/µl) se marcó en presencia de 10 mM Tris-

HCl pH 7.5, 10 mM MgCl2, 1 mM DTT y 50 mM NaCl, dNTP (20 µM de cada uno), 400 µg/ml

BSA, 50 µCi α-32P-dCTP (3000 Ci/mmol) y 5 unidades de Klenow. La reacción de

polimerización se llevó a cabo durante 20 minutos a 30ºC. A continuación se realizó una

extracción de proteínas con fenol/cloroformo, tras lo cual, el oligonucleótido aislado se

precipitó con etanol en presencia de acetato sódico durante toda la noche a -80ºC. Después

de centrifugar la muestra, el oligonucleótido marcado se resuspendió en agua y se guardó a

4ºC hasta su utilización.

2.5.2. Análisis del retardo electroforético (EMSA).

El ensayo de retardo de la movilidad electroforética se realizó siguiendo el protocolo

descrito por Wen y Locker (1994). Proteínas nucleares (10 µg) se incubaron en presencia de

20 mM HEPES p.H 8, 1 mM EDTA, 50 mM NaCl, 1 mM DTT, 1% glicerol, 1mM MgCl2, 1 µg

de polidIdc-polidIdc y 200.000 cpm de la secuencia AP-1 marcada durante 15 minutos a

temperatura ambiente. A continuación las muestras se resolvieron en condiciones no

desnaturalizantes en un gel de poliacrilamida al 6% en presencia de TBE. Terminada la

electroforesis, el gel se fijó durante 15 minutos en una solución al 10% de metanol y 10% de

ácido acético. Posteriormente, el gel se secó en un desecador de geles y la interacción del

factor de transcripción AP-1 con su elemento de respuesta se analizó mediante

autorradiografía utilizando películas sensibles a la radiactividad.

2.6. ESTUDIOS DE LA EXPRESIÓN GÉNICA MEDIANTE LA UTILIZACIÓN DE GENES MARCADORES (“REPORTER GENE ASSAYS”)

2.6.1. Vectores utilizados.

Como vector “control” se utilizó el vector de expresión pSV-β-Galactosidasa,

suministrado por Promega (Madison, WI, USA), que como su nombre indica contiene el gen

que codifica a la enzima β-Galactosidasa.

Como vector experimental se utilizó el vector de expresión pGL3-promotor (Promega)

modificado (Lorenzo y cols., 1997). Este vector contiene el gen de la luciferasa como gen

marcador bajo el control del promotor TK HSV mínimo. Los diferentes vectores cis utilizados

se obtuvieron clonando, en este vector básico (pGL3-Control), oligonucleótidos de doble

cadena que contenían las secuencias consenso del elemento que responde al suero ó SRE

(CAGGATGTCCATATTAGGACATC, pGL3-SRE), a ésteres de forbol ó TRE

(GTGACATCAT, pGL3-TRE) y a AMPc ó CRE (AGCCTGACGTCAGAGA, pGL3-CRE).

45

Materiales y Métodos

2.6.2. Transfección transitoria mediada por lípidos.

La introducción de los diferentes vectores al interior de las células E18 (transfección)

se realizó siguiendo el protocolo indicado en el Kit “GenePORTERTM” de Genlantis (San

Diego, CA, USA), adaptado a las condiciones de cultivo de la línea celular utilizada. La

mezcla de lípidos suministrada por la casa comercial favorece la entrada del ADN a través

de la membrana plasmática. Esta mezcla está formada por un lípido neutro, el dioleoil-

fosfatidiletanolamina (DOPE) y un lípido catiónico.

El día anterior a la transfección, se sembraron 10.000 células por pocillo en placas de

24 pocillos en las condiciones habituales de cultivo. Transcurridas 24 horas, la transfección

se llevó a cabo siguiendo el protocolo que se describe a continuación. En primer lugar se

preparó la mezcla de la transfección diluyendo los vectores (1 µg pSV-β-Galactosidasa + 1

µg pGL3-control ó pGL3-SRE/TRE/CRE) en 125 µl de medio libre de suero y de antibióticos.

A continuación, 5 µl de GenePORTER diluido en el mismo volumen de medio libre de suero

y de antibióticos, se mezcló suavemente con la solución de ADN, tras lo cual, se incubó

durante 30 minutos a temperatura ambiente. A continuación se eliminó el medio de las

placas y se añadió gota a gota la mezcla de la transfección. Después de 3 horas de

incubación a 37ºC, se añadió a cada pocillo 250 µl de medio de cultivo suplementado con

suero pero sin antibióticos durante toda la noche. Al día siguiente, se realizaron los distintos

tratamientos a las células y posteriormente se realizaron los ensayos de las actividades

luciferasa y β-Galactosidasa.

2.6.3. Detección de la actividad β-Galactosidasa in situ.

Antes de realizar los ensayos de actividad luciferasa y β-Galactosidasa es

conveniente saber si las células se han transfectado de forma correcta. Para ello, en todos

los experimentos que se llevaron a cabo, se sembraron dos placas controles que se

utilizaron para determinar la eficiencia de la transfección mediante una técnica histoquímica

que permite determinar la actividad de la enzima β-Galactosidasa in situ. Las células

transfectadas con el vector pSV-β-Galactosidasa y que expresan la enzima β-Galactosidasa

se pueden visualizar mediante microscopía óptica ya que las células se tiñen de azul tras

ser incubadas en presencia del sustrato cromógeno de la enzima β-Galactosidasa, 5-bromo-

4-cloro-3-indol-β-Galactosido (X-Gal).

Al final de cada experimento las células se lavaron dos veces con PBS y se fijaron en

presencia de 0,25% glutaraldehído en PBS durante 15 minutos. Tras un nuevo lavado con

PBS, las células se incubaron con una solución de X-Gal [0,2% de X-Gal, 1mM MgCl2, 150

mM NaCl, 3,3 mM K4Fe (CN)6* 3 H2O, 3,3 mM K3Fe (CN)6, 60 mM Na2HPO4, 40mM

46

Materiales y Métodos

NaH2PO4] a 37ºC durante al menos 1 hora. Finalmente, la solución de X-Gal se eliminó, se

sustituyó por PBS y las células se observaron en un microscopio óptico de contraste de

fases.

Los ensayos de actividad luciferasa se realizaron sólo cuando la eficiencia de la

transfección fue superior al 20%.

2.6.4. Ensayos de actividad luciferasa.

El ensayo de actividad luciferasa se realizó siguiendo el protocolo descrito en el

manual de “Luciferase assay system” de Promega (Madison, WI, USA).

Al final de cada experimento, las células se lavaron con PBS y se incubaron en

presencia de un tampón de lisis (Reporter lysis buffer, Promega) durante 10 minutos a

temperatura ambiente y en agitación. Tras centrifugar el lisado celular a 20.000 g durante 5

minutos y a 4ºC, se recogieron los sobrenadantes y se almacenaron a -80ºC hasta su

utilización.

El ensayo de actividad luciferasa se realizó tomando 20 µl de cada muestra y

depositándolos en pocillos de microplacas. A continuación estas microplacas se introdujeron

en el interior de un luminómetro modelo Microbeta TriLux de Perkin Elmer (Wellesley, MA,

USA). El aparato inyectó a cada muestra de forma automática 100 µl de reactivo de ensayo

de luciferasa [20 mM tricita, 1,07 mM (MgCO3)4Mg(OH) 2 5H2O, 2,67 mM MgSO4, 0,1 mM

EDTA, 33,3 mM DTT, 270 µM coenzima A, 470 µM luciferina, 530 µM ATP, pH 7.8), y midió

a continuación el pulso de luz producido en cada muestra durante 10 segundos a 25ºC.

2.6.5. Ensayo de la actividad β-Galactosidasa.

Con objeto de normalizar la eficiencia de la transfección entre los diferentes

experimentos y tratamientos, se valoró, en cada una de las muestras, la actividad β-

Galactosidasa siguiendo el protocolo descrito en el manual técnico de Promega.

Un volumen de muestra de 50 µl se mezcló con 50 µl de tampón de ensayo 2X (200

mM tampón fosfato sódico pH 7.3, 2 mM MgCl2, 100 mM β-mercaptoetanol, 1,33 mg/ml

ONPG) y se incubó aproximadamente 3 horas o hasta que las muestras desarrollaran un

color amarillento a 37ºC. Este cambio de color en la muestra es el resultado de la actividad

de la enzima β-Galactosidasa que hidroliza el sustrato ONPG (o-nitrofenil-β-

Galactopiranósido) convirtiéndolo en o-nitrofenol (que es de color amarillo y absorbe a una

longitud de onda de 450 nm). La reacción se paró con 1 M de carbonato sódico realizándose

a continuación la lectura de la absorbancia a una longitud de onda de 450 nm.

47

Materiales y Métodos

Los resultados obtenidos a partir de estos experimentos se expresaron como el

porcentaje de la actividad luciferasa/actividad β-Galactosidasa con respecto al grupo control,

el cual se estableció como el 100%.

2.7. TÉCNICAS DE ESTUDIO DE LA VIABILIDAD Y LA MUERTE CELULAR.

2.7.1. ENSAYOS DE VIABILIDAD CELULAR.

El crecimiento de la población celular se determinó utilizando los métodos

colorimétricos del MTT [3-(4,5-dimetil-2-tiazol)-2,5-difenil-2H bromuro de tetrazolio] y del

cristal violeta, obteniéndose en ambos casos resultados similares. Tanto el MTT como el

cristal violeta se obtuvieron de Sigma-Aldrich (St.Louis, MO, USA).

2.7.1.1. Ensayo colorimétrico del MTT.

Este método se basa en el hecho de que las células viables expresan la enzima

mitocondrial succinato deshidrogenasa, la cual es capaz de reducir el MTT a formazán, que

es un producto que absorbe la luz a una longitud de onda de 570nm (Mossman T, 1983).

Antes de realizar los experimentos se determinó el tiempo óptimo de incubación con el MTT

en la línea celular utilizada en este trabajo.

Para realizar estos experimentos, se utilizaron placas de cultivo de 35 mm de

diámetro. Al final de cada experimento se añadió a cada placa 0,5 mg/ml de MTT. Después

de 20 minutos de incubación a 37ºC, el medio se retiró y el formazán precipitado se disolvió

en una solución ácida de isopropanol (0.04-0.1N HCl en isopropanol absoluto). La cantidad

de formazán presente en cada muestra se determinó midiendo la absorción a 570 nm. La

medida de la absorbancia se hizo en un espectrofotómetro Varian modelo Cary 300 Bio UV-

Visible (Mulgrave, Australia). Los resultados obtenidos se expresaron como porcentaje de

células viables con respecto al grupo control, el cual se estableció como el 100%.

2.7.1.2. Tinción con Cristal Violeta.

Este método se basa en el hecho de que las células viables se tiñen con el colorante

cristal violeta (Drysdale y cols., 1983). Este método también se optimizó para la línea celular

de estudio.

Para realizar estos experimentos se utilizaron placas de cultivo de 35 mm de

diámetro. Al final de cada experimento, el medio se eliminó y las células viables adheridas a

la placa se tiñeron con una solución de cristal violeta (0,03% en 2% de etanol) durante 5

48

Materiales y Métodos

minutos. Tras este periodo, el exceso de colorante se eliminó con agua y las células teñidas

se solubilizaron con SDS al 1%. La medida de la absorbancia del cristal violeta se realizó a

560 nm. El número de células viables se calculó como el porcentaje de absorbancia con

respecto al grupo control, el cual se estableció como el 100%.

2.7.2. ANÁLISIS DE LA FRAGMENTACIÓN INTERNUCLEOSOMAL DEL ADN.

Las células que mueren por apoptosis presentan cambios bioquímicos muy

característicos. Uno de ellos es la degradación del ADN genómico como consecuencia de la

activación de endonucleasas endógenas dependientes de Ca2+ y Mg2+. Estas enzimas

cortan el ADN por la región internucleosomal, dando lugar a fragmentos múltiplos de 180

pares de bases que pueden salir al citoplasma. Estos fragmentos dan lugar a la

característica escalera de ADN cuando se resuelven por electroforesis en geles de agarosa.

Para la realización de estos experimentos se utilizaron placas de cultivo de 100 mm de

diámetro. Las células adheridas a la placa y en suspensión se recogieron y se lavaron dos

veces con PBS a 4ºC. A continuación las células se incubaron con tampón de lisis (5 mM

Tris pH 7.5, 20 mM EDTA pH 8, 0,5% Triton X-100) durante 1 hora a 4ºC y en agitación

constante. El lisado celular se centrifugó a 20.000 g durante 30 minutos y el sobrenadante

se incubó en presencia de 100 µg/ml de RNAsa A durante 45 minutos a 37ºC, seguida de

otra incubación con 0,5% de SDS y 200 µg/ml de proteinasa K durante 45 minutos a 37ºC.

Después de dos extracciones con fenol-cloroformo-isoamílico, el ADN se precipitó con

etanol en presencia de 0,3 M de acetato sódico a -80ºC. El ADN presente en cada muestra

se analizó mediante electroforesis en geles de agarosa al 2%, preparados en una solución

tampón de TBE (90 mM Tris-ácido bórico; 2mM EDTA) y conteniendo 0.1 µg/ml de bromuro

de etidio. La electroforesis se llevó a cabo a 80 V durante 2 horas, tras lo cual los geles se

observaron bajo una fuente de luz ultravioleta y se fotografiaron mediante la utilización de un

equipo Chemic Doc de Bio Rad.

2.7.3. ANÁLISIS DEL CONTENIDO DE ADN POR CITOMETRÍA DE FLUJO.

Este método de análisis del contenido del ADN, permite identificar y cuantificar las

células apoptóticas, ya que como consecuencia de la fragmentación del ADN aparece un

pico hipodiploide característico (sub-G0), correspondiente a células con un contenido de

ADN inferior a 2n (Darzynckiewicz y cols., 1992). Para la realización de estos experimentos

se utilizaron placas de cultivo de 100 mm de diámetro. Se recogieron tanto las células en

49

Materiales y Métodos

50

suspensión como las adheridas a las placas. Las células se despegaron de la placa

incubándolas con una solución de tripsina/EDTA (0,05% de tripsina y 0,02% de EDTA en

PBS), se lavaron con PBS a 4ºC y se centrifugaron a 3.000 g durante 10 minutos,

posteriormente se lavaron dos veces con PBS a 4ºC y se fijaron durante 5 minutos con 70%

de etanol. Después de eliminar el etanol por centrifugación, las células se resuspendieron en

PBS y se incubaron en presencia de RNAsa A (10 µg/ml) durante 30 minutos a 37ºC. Las

células se tiñeron con 50 µg/ml de yoduro de propidio durante 30 minutos a temperatura

ambiente y en oscuridad. El contenido de ADN por célula se analizó en un citómetro de flujo

modelo CyAn LX (DakoCytomation, Gostrup, Dinamarca), en la Unidad de Citometría de

Flujo del CNIC (Madrid), utilizando un láser de argón con una longitud de onda de emisión

de 488 nm. Para el análisis sólo se consideraron las señales originadas por células únicas

(10.000 células/ensayo). El porcentaje de células que se encontraban en las distintas fases

del ciclo celular se calculó a partir de sus histogramas utilizando el programa Modfit (Verity

Systems, San José, CA, USA), que es capaz de aplicar diferentes modelos matemáticos a

las distribuciones obtenidas.

2.8. ANÁLISIS ESTADÍSTICO.

Todos los tratamientos experimentales se realizaron por triplicado y cada

experimento se repitió al menos tres veces. Los resultados se muestran como la media y su

correspondiente error estándar. La comparación estadística entre los grupos experimentales

se realizó mediante el ANOVA seguido del test de Scheffee o la t- de Student. La diferencia

entre los grupos experimentales se consideró significativa cuando sus medias mostraron

una p<0.05.

CCaappííttuulloo 11

“LOVASTATIN INHIBITS THE GROWTH AND SURVIVAL PATHWAY OF PHOSPHOINOSITIDE 3-KINASE/PROTEIN KINASE B IN IMMORTALIZED

RAT BRAIN NEUROBLASTS”

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts LOVASTATIN INHIBITS THE GROWTH AND SURVIVAL PATHWAY OF

PHOSPHOINOSITIDE 3-KINASE/PROTEIN KINASE B IN IMMORTALIZED RAT BRAIN

NEUROBLASTS.

Maria Isabel Cerezo-Guisado, Luis Jesus Garcia-Marin*; Maria Jesus Lorenzo and Maria Julia

Bragado.

Departamento de Bioquímica, Biología Molecular y Genética and *Departamento de Fisiología, Universidad de

Extremadura, Cáceres, Spain.

Received April 13, 2005; accepted April 27, 2005

ABSTRACT

We previously showed that lovastatin, a

HMG-CoA reductase inhibitor, suppresses cell

growth by inducing apoptosis in rat brain

neuroblasts. Our aim was to study intracellular

signalling induced by lovastatin in neuroblasts.

Lovastatin significantly decreases the

phosphoinositide 3-kinase (PI3-K) activity in a

concentration-dependent manner. Expression

of p85 subunit and its association with

phosphotyrosine containing proteins are

unaffected by lovastatin. Lovastatin decreases

PKB/Akt phosphorylation, and its downstream

effectors, p70S6K and the eIF4E regulatory

protein, 4E-BP1, in a concentration-dependent

manner, and reduces p70S6K expression.

Lovastatin effects are fully prevented with

mevalonate. Only the highest dose of PI3-K

inhibitors which significantly reduce PI3-K

kinase activity, induces apoptosis in

neuroblasts but in a lower degree than

lovastatin. In summary, this work shows that

treatment of brain neuroblasts with lovastatin

leads to an inhibition of the main pathway that

controls cell growth and survival, PI3-K/PKB

and the subsequent blockade of downstream

proteins implicated in the regulation of protein

synthesis. This work suggests that inactivation

of the antiapoptotic PI3-K appears insufficient

to induce the degree of neuroblasts apoptosis

provoked by lovastatin which must necessarily

involve other intracellular pathways. These

findings might contribute to elucidate the

molecular mechanisms of some statins effects

in the central nervous system.

RUNNING TITLE: Lovastatin inhibits PI3-K

in brain neuroblasts

KEYWORDS: neuroblasts, apoptosis,

lovastatin, kinase, phosphorylation, PI3-K,

PKB/Akt.

51

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts INTRODUCTION

It is well established that mevalonate

pathway, which yields different isoprenoid

compounds and cholesterol, plays an important

role in cell growth and survival (Goldstein and

Brown 1990). Mevalonate is intracellularly

synthesized from 3-hydroxy-3-methylglutaryl

coenzyme A (HMG-CoA), and this process is

catalyzed by HMG-CoA reductase, the rate

limiting enzyme in this pathway (Goldstein

and Brown 1990). Several studies show that

competitive inhibitors of HMG-CoA reductase

(statins), such as lovastatin, simvastatin and

pravastatin, not only block the biosynthesis of

mevalonate but, in addition, inhibit the growth

and proliferation of both normal and tumour

cells (Falke et al. 1989; Jones et al. 1994;

Raiteri et al. 1997). Furthermore, inhibition of

HMG-CoA reductase is also known to induce

cell death by apoptosis in different non

neuronal cell types (Guijarro et al. 1998; Jones

et al. 1994; Padayatty et al. 1997; Perez-Sala

and Mollinedo 1994).

This metabolic pathway is essential

during late fetal and early neonatal life to

ensure normal growth and development of the

brain (Cavender et al. 1995; Spady and

Dietschy 1983). Several studies suggest that

HMG-CoA reductase inhibitors could seriously

affect cholesterol homeostasis in the brain, and

therefore alter the normal growth, development

and survival of neurons. Then, although statins

are widely used in the treatment of

hypercholesterolemia (Barth et al. 1990;

Tobert 1987), several epidemiological studies

indicate that long-term administration of these

drugs may have adverse side effects on the

central nervous system (CNS) (Barth et al.

1990; Roth et al. 1992). In spite of its potential

relevance, the effects of statins on CNS have

been poorly studied. In this regard, Michikawa

and Yanagisawa (1999) have shown that

compactin induces cell death in primary

neurons from rat cerebral cortices and we have

recently shown that lovastatin induces

apoptosis of immortalized rat brain

neuroblasts, being its effects associated with a

decreased prenylation of both Rho A and Ras

proteins (Garcia-Roman et al. 2001).

The Ras family operates in diverse

signalling pathways that regulate cell growth,

differentiation and survival. They function as

molecular switches by cycling between the

inactive GDP-bound state and the active GTP-

bound state. Phosphoinositide 3-kinase (PI3-K)

has been identified as a key effector of Ras in

signalling cell survival (reviewed in Anderson

and Jackson 2003). Class IA of PI3-K includes

a heterodimer possessing subunits with

molecular weights of 85 and 110 kDa (p85 and

p110) and catalytic activity that specifically

transfers phosphate to position 3´ of the

phosphoinositide ring, regulating a variety of

cell responses including cell division and

survival (reviewed in Anderson and Jackson

2003). A role for PI3-K in cell survival was

first indicated by experiments showing that

PI3-K was required for nerve growth factor to

prevent apoptosis of PC12 cells induced by

serum deprivation (Yao and Cooper 1995).

One of the molecular targets of PI3-K products

involved in signalling cell survival is the

protein kinase B or Akt (Toker and Cantley

1997), which contains a pleckstrin homology

52

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts domain that recruits PKB to the plasma

membrane where is subsequently

phosphorylated in Thr306 and Ser473

(reviewed in Scheid and Woodgett 2001).

Phosphorylation of PKB leads to its full kinase

activity and subsequently to regulation of

several cellular processes such as extracellular

stimuli-induced cell survival. It is well

accepted that PKB promotes cell survival by

inhibiting the action of proteins that mediate

apoptosis (Lawlor and Alessi 2001).

The aim of the present work was to

study the effects of lovastatin in one of the

most important intracellular pathways that

control cell growth and survival, PI3-K/PKB in

immortalized rat brain neuroblasts. The

elucidation of biochemical pathways affected

by lovastatin will contribute to gain insight in

the growth inhibition and apoptosis induced by

this statin in neuroblasts, and additionally it

will contribute to establish the role of the

mevalonate pathway in the physiological

growth and development of the brain.

EXPERIMENTAL PROCEDURES

Materials

Lovastatin (MK-808, mevinolin) [2β,

6α-dimethyl-8α-(2-methyl-1-oxobutoxy)-

mevinic acid lactone] was purchased from

Calbiochem (La Jolla, CA, USA). The inactive

lactone of lovastatin was converted to the

active form as described by Kita et al.(1980).

Mevalonic acid, MTT [3-(4,5-dimethyl-2-

thiazolyl)-2,5-diphenyl-2H tetrazolium

bromide], propidium iodide (PI), ribonuclease

A, proteinasa K, 123 bp DNA ladder,

phosphatidylinositol (P-8443) and crystal

violet were purchased from Sigma-Aldrich,

(St. Louis, MO). Complete protease inhibitor

cocktail tablets were from Roche Molecular

Biochemicals (Indianapolis, IN, USA).

Wortmannin and LY294002 were from

Calbiochem (La Jolla, CA). Anti p85 antibody

of PI3-K (06-195) was purchased from Upstate

Biotechnology (Lake Placid, NY); anti

phospho Ser472/473/474 Akt (559029) and

anti Akt1 (559028) from BD Pharmingen; anti

phospho Thr389-p70 S6K (9205L), anti p70

S6K (9202) and anti 4E-BP1 (9451) from Cell

Signaling; peroxidase-conjugated secondary

anti mouse and anti rabbit antibodies and the

chemiluminiscence detection system were

from Pierce (Rockford, IL). Protein A/G-

Sepharose (Sc-2003) was from Santa Cruz

Biotechnology (Santa Cruz, CA); [γ-32P]ATP

(3.000 mCi/mmol) was purchased from Perkin

Elmer Life Sciences (Boston, MA). Ham’s F-

12 medium, fetal calf serum, L-glutamine,

streptomycin, penicillin and trypsin/EDTA

solution were from PAN Biotech (Aidenbach,

Germany). Tissue culture flasks and dishes

were from TPP (Trasadingen, Switzerland).

All other reagents were obtained from

commercial sources and were of the highest

purity available.

Cell Line and Culture

Spontaneously immortalized rat brain

neuroblasts, E 18 cells, were used in this study.

The E18 cell line has been obtained by

spontaneous immortalization from cultures of

18-day fetal rat cerebral cortices (Muñoz et al.

1993) and was kindly provided by Dr. Alberto

Muñoz (Instituto de Investigaciones

53

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts Biomédicas, CSIC, Madrid, Spain). Cells were

grown, as described previously (Garcia-Roman

et al. 2001), in Ham’s F-12 supplemented with

10% fetal calf serum, L-glutamine (2 mM),

streptomycin (100 µg/ml) and penicillin (100

U/ml). Cells were seeded at 5 x 105 in 75-cm2

tissue culture flask and incubated at 37ºC

under a 5% CO2/95% air atmosphere.

Cell Treatments

Confluent cells were trypsinized and

seeded in tissue culture dishes at a

concentration of 2 x 104 cells/cm2. After 24 h

the medium was aspirated and replaced for a

further 24 h with fresh media alone or

containing the indicated concentrations of

lovastatin, mevalonic acid or PI3-K inhibitors.

Cell Viability Assay

Cell viability was determined by the

colorimetric MTT assay as previously

described (Garcia-Roman et al. 2001). At the

end of each treatment, cells were incubated for

15 min at 37ºC with MTT (500 µg/ml) and

formazan precipitates were solubilized with

acidic isopropanol (0.04-0.1 N HCl in absolute

isopropanol). The absorbance of converted dye

was measured at a wavelength of 570 nm. In

some experiments, cell viability was evaluated

by the crystal violet method. At the end of each

experiment, media was discarded and cells

were stained with crystal violet (0,03% in 2%

ethanol) for 5 min. Dishes were then rinsed

with tap water, allowed to dry, and 1% sodium

dodecyl sulfate was added to solubilize them.

The absorbance of dye was measured at 560

nm. Viable cells were calculated as percent of

absorbance with respect to untreated cells.

Results using both methods were similar.

DNA Fragmentation Assay

At the end of each experiment, cells

were washed twice in ice-cold phosphate-

buffered saline without Ca2+ and Mg2+ and then

scraped and pelleted at 4ºC. Cells were lysed in

10 mM Tris buffer, pH 7.4, with 5 mM EDTA,

and 0,5% Triton X-100 for 60 min at 4ºC.

After centrifugation at 20 800 g for 30 min at

4ºC, the supernatants were incubated with

RNase A (0.1 mg/ml) at 37ºC for 45 min, and

then with proteinase K (0.2 mg/ml) at 37ºC for

45 min. DNA was then extracted twice with

phenol/chloroform (1:1), precipitated with 0.1

volume of sodium acetate (3 M) and 2.5

volumes of ice-cold ethanol overnight at -80ºC.

The precipitated DNA was collected by

centrifugation at 20 800 g for 20 min and

resuspended in autoclaved water. DNA was

resolved on 2% agarose-0.1 µg/ml ethidium

bromide gels in TBE buffer (80mmol/L Tris-

borate (pH 8), 2 mmol/L EDTA). After

electrophoresis, gels were examined under

ultraviolet light and photographed using a

ChemiDoc System (Documentation and

Analysis System, Bio-Rad, Hercules, CA,

USA).

Analysis of Cell DNA Content by Flow

Cytometry

The ploidy determination of

neuroblasts was estimated by flow cytometry

DNA analysis as previously described (Garcia-

Roman et al. 2001). After treatment, cells were

trypsinized, washed in phosphate-buffered

54

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts

In vitro phosphoinositide 3-kinase activity

assay

saline, fixed at 4 ºC in 70 % ethanol and

treated at 37 ºC with RNase (10 µg/ml) for 30

min. The DNA content per cell was evaluated

in a CyAn LX flow cytometer

(DakoCytomation, Glostrup, Denmark) after

staining the cells with propidium iodide (50

µg/ml) for 30 min at room temperature in the

dark. For cell cycle analysis, only signals from

single cells were considered (10000

cells/sample).

Anti-phosphotyrosine

inmunoprecipitates were resuspended with 25

µl of the PI3-K susbtrate, phosphatidylinositol

for 20 minutes. Substrate was previously dried

under nitrogen atmosphere, resuspended

(1µg/µl) in 25 mM Hepes, pH 7.5, 1mM

EDTA and sonicated 4 times for 15 s. In vitro

kinase reaction started after addition of 15 µl

of kinase reaction buffer [100 nM [γ-32P]ATP

(10 µCi), 40 µM ATP, 25 mM Hepes pH 7.4,

10 mM MgCl2 and 0.5 mM EGTA] and kept

for 30 min at 30°C with shaking. Reaction was

stopped after addition of ice-cold chloroform:

methanol (1:2) with 1% HCl, 125 µl de CHCl3

and 125 µl HCl 10 mM. Samples were briefly

centrifuged and the lower organic phase

extracted and washed with 500 µl methanol:

100mM HCl plus 2mM EDTA (1:1). Lower

organic phase was extracted, dried under

nitrogen and resuspended with 25µl

chloroform. Lipid products were analyzed by

thin layer chromatography using silica gel

plates and developed with

CHCl3:MetOH:H2O:NH4OH

Immunoprecipitation assay.

At the end of neuroblasts treatment, cells

were rinse twice with ice-cold phosphate-

buffered saline and lysed for 10 min at 4°C in

the following buffer: 20 mM Hepes pH 7.4, 10

mM EGTA, 1% NP-40, 40 mM β-D-

glycerophosphate, 10% glycerol, 2.5 mM

MgCl2, 1mM dithiothreitol (DTT), 2mM

sodium ortovanadate (Na3VO4), 1mM phenyl-

methyl-sulphonyl fluoride (PMSF), 10 µg/ml

aprotinin and 10 µg/ml leupeptin. After

centrifugation at 20 800 g for 15 min at 4°C,

resulting supernatants were analyzed for

protein concentration using BioRad protein

assay. Equal amount of protein (150 µg) was

immunoprecipitated overnight at 4°C with 4

µg antiphosphotyrosine antibody PY20 using

30 µl of protein A-Sepharose.

Immunoprecipitates were washed twice with

ice cold buffer A (phosphate-buffered saline,

1% NP-40, 100 µM Na3VO4), twice with

buffer B (100 mM Tris pH 7.5, 0.5M LiCl,

1mM EDTA, 100 µM Na3VO4) and twice with

buffer C (Tris 25mM pH 7.5, 100 mM NaCl,

1mM EDTA).

(120:94:23.2:4). 32P-labelled phospholipids

products were detected by autoradiography

using a radioactivity sensitive film.

Western Blotting Analysis

Briefly, denatured proteins from total

cell extracts (10-20 µg) or immunoprecipitates

were separated by 10 or 12.5% sodium dodecyl

sulfate and electrophoretically transferred to

membranes that were blocked in buffer: 50

mM Tris/HCl pH 8.0, 2 mM CaCl2, 80 mM

55

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts NaCl, 5% non-fat dry milk. After overnight

incubation at 4°C with primary antibodies

(1:1000 dilution and for p70S6K 1:500),

membranes were washed and incubated with

horseradish peroxidase-conjugated secondary

antibody (anti mouse IgG 1:6000 or anti rabbit

IgG 1:10000). After three washes with 50 mM

Tris/HCl pH 8.0, 2 mM CaCl2, 80 mM NaCl,

membranes were incubated with

chemiluminescent substrate for 5 min and

exposed to Hyperfilm ECL (Amersham,

Piscataway, NJ, USA). Results were analyzed

by densitometry using the MacBAS Software,

version 2.2, and expressed as percentage of

control.

0 101 2Lovastatin (µM)

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0

25

50

75

100

Lovastatin (µM)0 1 10

*

20

*

A

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

0

25

50

75

100

125PI

3-K

Act

ivity

(% o

fcon

trol

)

--

+-

++

-+

*

B

0 101 2Lovastatin (µM)

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0

25

50

75

100

Lovastatin (µM)0 1 10

*

20

*

A0 101 2Lovastatin (µM) 0 101 2Lovastatin (µM)

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0

25

50

75

100

Lovastatin (µM)00 11 10

*

10

*

20

*

20

*

A

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

0

25

50

75

100

125PI

3-K

Act

ivity

(% o

fcon

trol

)

--

+-

++

-+

*

B--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

0

25

50

75

100

125PI

3-K

Act

ivity

(% o

fcon

trol

)

--

+-

++

-+

*

--

+-

++

-+

**

B

0000

Statistical analysis

Data are obtained from at least three

independent experiments and expressed as

mean ± standard error of the mean. Statistical

analysis of the data was performed by one way

ANOVA followed by Dunnet test. P-values

lower that 0.05 were considered significant. Figure 1. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the in vitro kinase activity of PI3-K in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0) and various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). In vitro PI3-K kinase assay was performed as described in Material and Methods and lipid products were separated by thin-layer chromatography. A representative autoradiography is shown. Densitometry analysis of results, expressed as mean ± standard error of at least three independent experiments is shown in the graphs.* P<0.05 compared to untreated cells.

RESULTS

Effect of lovastatin in the in vitro kinase

activity and the expression of the

phosphoinositide 3-kinase

We first evaluated the in vitro

enzymatic activity of one of the major kinases

that regulates cell growth and survival, PI3-K,

after treatment of neuroblasts with lovastatin

for 24 hours. We have previously shown that

the intracellular effects of lovastatin in rat

brain neuroblasts are time and concentration

dependent (Garcia-Roman et al. 2001).

As shown in Fig. 1A, treatment of neuroblasts

with lovastatin promotes a clear reduction of

the in vitro kinase activity of PI3-K in a

concentration-dependent manner. Lovastatin

effect is evident with the lower concentration

used, 1µM, which reduces by 30% the kinase

activity, whereas higher lovastatin

concentrations, 10 and 20 µM, significantly

56

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts reduce the PI3-K activity by 56% and 63%,

respectively. 0 101 20Lovastatin (µM)

p85 → 98 kDa

64 kDa

A

0 101 20Lovastatin (µM)98 kDa

64 kDa

50 kDa

p85 →

IP: PY20WB: anti-p85

B

0 101 20Lovastatin (µM)

p85 → 98 kDa

64 kDa

A0 101 20Lovastatin (µM)

p85 → 98 kDa

64 kDa

98 kDa

64 kDa

A

0 101 20Lovastatin (µM)98 kDa

64 kDa

50 kDa

p85 →

IP: PY20WB: anti-p85

B0 101 20Lovastatin (µM)

98 kDa

64 kDa

98 kDa

64 kDa

50 kDa

p85 →

IP: PY20WB: anti-p85

B

In order to know whether this effect on

PI3-K activity is specific of the inhibition of

HMG-CoA reductase, neuroblasts were

incubated with lovastatin in presence or

absence of L-mevalonate, the final product of

the reaction catalyzed by HMG-CoA reductase

(Fig. 1B). Treatment with 10 µM lovastatin

significantly reduces PI3-K activity (51 ± 6%

of control), whereas simultaneous treatment

with 100 µM mevalonate significantly prevents

the decrease of activity induced by lovastatin,

yielding PI3-K levels comparable to control

samples (86 ± 13% of control). Treatment of

neuroblasts with mevalonate alone does not

modify PI3-K activity.

Figure 2. Effect of lovastatin on the expression of p85 regulatory subunit of PI3-K (A) and on the association of p85 subunit with tyrosine-phosphorylated proteins (B) in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0) or lovastatin. A: proteins from neuroblasts lysates (15 µg) were analyzed by Western Blot using an anti-p85 antibody. B: Anti-phosphotyrosine immunoprecipitated proteins were analyzed by Western Blot using the same anti-p85 antibody. IP, inmunoprecipitation; PY20, anti-phosphotyrosine antibody; WB, western blot.

We next investigated whether lovastatin

treatment affects the expression of PI3-K

protein. Therefore we evaluated the expression

level of the regulatory subunit of PI3-K, p85,

in lysates from neuroblasts incubated with

lovastatin for 24 h. As seen in Fig. 2A,

lovastatin treatment does not modify the

expression of p85 regulatory protein.

We immunoprecipitated tyrosine-

phosphorylated proteins from neuroblasts

lysates and analyzed the p85 subunit by

Western Blot. As seen in Fig. 2B, results show

that lovastatin does not modify the amount of

p85 subunit associated with tyrosine-

phosphorylated proteins.

Effect of lovastatin on the phosphorylation

of the protein kinase B or Akt. Lovastatin has not effect on the association

of phosphoinositide 3-kinase with tyrosine-

phosphorylated proteins One of the main targets downstream of

PI3-K is PKB/Akt, key molecule involved in

the regulation of cell growth and survival. We

next study the phosphorylation state of this

protein kinase after lovastatin treatment. It is

important to note that initial phosphorylation

of PKB in Thr308 leads to activation of the

enzyme but its full activation is achieved after

a second phosphorylation on Ser473. Therefore

we evaluated the phosphorylation of PKB on

One of the pathways leading to PI3-K

activation in response to several stimuli is the

interaction of SH2 domains of the regulatory

subunit of PI3-K, p85, with tyrosine-

phosphorylated proteins. Our next aim was to

study the interaction of p85 subunit with

tyrosine-phosphorylated proteins in this

neuronal apoptosis model.

57

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts Ser473 in lysates of neuroblasts treated with

lovastatin. As seen in Fig. 3A (upper film),

incubation of neuroblasts with lovastatin is

associated with a marked decrease in the

phosphorylation on Ser473 of PKB in a

concentration dependent manner.

The effect is evident at 1 µM (decrease of

29%), being significant at higher

concentrations, 10 µM and 20 µM, where the

reduction of phosphorylation is 84% y 87%,

respectively.

In order to know whether effect is

specific of the inhibition of HMG-CoA

reductase, neuroblasts were incubated with

lovastatin in presence or absence of

mevalonate (Fig. 3B). Simultaneous treatment

of neuroblasts with 100 µM L-mevalonate

significantly prevents the decrease of

phosphorylation on Ser473 induced by

lovastatin (Fig. 3B upper film). Treatment of

neuroblasts with mevalonate alone does not

affect Ser473 phosphorylation of PKB.

P-PKB →

PKB →

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

--

++

-+

0

50

100

150

200

PKB

Pho

spho

ryla

tion

(% o

fcon

trol

)

+-

*

B

0 101 2

P-PKB →

PKB →

Lovastatin (µM)

PKB

Pho

spho

ryla

tion

(% o

fcon

trol

)

0 1Lovastatin (µM) 10

*

20

*25

50

75

100

0

A

P-PKB →

PKB →

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

--

++

-+

0

50

100

150

200

PKB

Pho

spho

ryla

tion

(% o

fcon

trol

)

+-

*

B

P-PKB →

PKB →

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

P-PKB →

PKB →

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

--

++

-+

0

50

100

150

200

PKB

Pho

spho

ryla

tion

(% o

fcon

trol

)

+-

*

B

0 101 2

P-PKB →

PKB →

Lovastatin (µM)

PKB

Pho

spho

ryla

tion

(% o

fcon

trol

)

0 1Lovastatin (µM) 10

*

20

*25

50

75

100

0

A0 101 2

P-PKB →

PKB →

Lovastatin (µM)

PKB

Pho

spho

ryla

tion

(% o

fcon

trol

)

0 1Lovastatin (µM) 10

*

10

*

20

*

20

*25

50

75

100

0

A000

In parallel, in the same samples analyzed

for PKB phosphorylation, we investigated the

expression of PKB protein, which is not

affected by treatment with lovastatin or

mevalonate (Fig. 3A and B, lower films).

Effect of lovastatin in the phosphorylation

and expression of protein kinase p70S6K

One of the molecular substrates of PKB

is the mammalian target of rapamycin, mTOR,

a kinase that controls protein translation via

p70S6K and the regulatory protein of eIF4E,

named 4E-BP1 or PHAS-I (reviewed in

Schmelzle and Hall 2000). p70S6K is activated

by mTOR via phosphorylation of several

residues, such as Thr 389 and Thr 229, that

leads to its kinase activation (Holland et al.

2004). Therefore our next aim was to study the

effect of lovastatin in the phosphorylation level

of p70S6K. Treatment of neuroblasts with

lovastatin leads to a reduction in the

Figure 3. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the phosphorylation of PKB (Ser473) in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0), various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). 15 µg proteins from neuroblasts lysates were analyzed by Western Blotting using an anti phospho-Ser473-PKB (upper films) or anti-PKB (lower films) antibody. Representative films are shown. Densitometry analysis of results, expressed as mean ± standard error of six (A) and four (B) independent experiments, is shown at the bottom graphs. * P<0.05 compared to untreated cells.

58

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts phosphorylation of p70S6K in Thr389 that is

concentration dependent, as seen in Fig. 4A

graphic and upper film). This effect is

significant at higher concentrations used, 10

µM y 20 µM, where the decrease on the

phosphorylation state is 76% and 71%,

respectively.

Figure 4. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the phosphorylation and expression of p70S6K (Thr389) in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0), various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). The phosphorylation state was evaluated in proteins (15 µg) from neuroblasts lysates analyzed by Western Blotting using an anti phosphor-Thr389-p70S6K (upper films). As a loading control the membranes were blotted with antibody anti-actin (middle films). The expression of p70S6K was analyzed using an antibody anti p70S6K (lower films). Each experiment was performed several times (three to five times) and representative films are shown.

We next confirmed that this effect was

specifically due to inhibition of the HMG-CoA

reductase. As seen in Fig. 4B, treatment with

mevalonate significantly prevents the decrease

on p70S6K phosphorylation observed in

presence of lovastatin. Treatment of

neuroblasts with mevalonate alone does not

affect Thr389 phosphorylation of p70S6K. As a

loading control in the gels, we have analyzed

the expression levels of actin (Fig. 4, middle

films).

Figure 4 (lower films) shows that

lovastatin treatment leads to a reduction of the

expression of p70S6K protein in a

concentration-dependent manner (A) which

results prevented by mevalonate (B).

Effect of lovastatin in the phosphorylation

and expression of eukaryotic initiation

translation factor 4E-binding protein 1

A direct substrate of the kinase mTOR is

4E-BP1, protein that regulates the eukaryotic

initiation factor eIF4E.

P-p70S6K →

Actin →

BLovastatin (10 µM)

Mevalonate (100 µM) --

+-

++

-+

p70S6K →

ALovastatin (µM) 0 101 2

P-p70S6K →

Actin →

p70S6K →

P-p70S6K →

Actin →

BLovastatin (10 µM)

Mevalonate (100 µM) --

+-

++

-+

p70S6K →

P-p70S6K →P-p70S6K →

Actin →

BLovastatin (10 µM)

Mevalonate (100 µM) --

+-

++

-+

p70S6K →

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

p70S6K →p70S6K →

ALovastatin (µM) 0 101 2

P-p70S6K →

Actin →

p70S6K →

ALovastatin (µM) 0 101 2

P-p70S6K →

Actin →

p70S6K →

000

γ →β →α→

Lovastatin (µM) 0 101 2

4E-BP1→

A

γ →α →β→

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

4E-BP1→

B

γ →β →α→

Lovastatin (µM) 0 101 2

4E-BP1→

A

γ →β →α→

Lovastatin (µM) 0 101 2

4E-BP1→

γ→β→α→

Lovastatin (µM) 0 101 2

γ →β →α→

γ →β→α→

γ →β→α→

Lovastatin (µM) 0 101 2Lovastatin (µM) 0 101 2

4E-BP1→4E-BP1→4E-BP1→

A

γ →α →β→

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

4E-BP1→

B

γ →α →β→

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

4E-BP1→

γ→α→β→

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

γ →α →β→γ →α→β→γ →α→β→

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

Lovastatin (10 µM) Mevalonate (100 µM)

Lovastatin (10 µM) Mevalonate (100 µM)

--

+-

++

-+

--

+-

++

-+

4E-BP1→4E-BP1→4E-BP1→

B

000000

Figure 5. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the phosphorylation and expression of 4E-BP1 in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0), various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). The three phosphorylation states of 4E-BP1 corresponding to α, β, and γ isoforms, are shown at the upper films and were evaluated as changes in its electrophoretic mobility analyzed by a 12% SDS-PAGE followed by Western Blotting using an anti 4E-BP1 antibody. A representative film of five (A) and four (B) independent experiments is shown. In the bottom films (A and B) the expression of 4E-BP1 was analyzed in 10% SDS-PAGE followed by Western Blotting using same antibody. A representative film of three independent experiments is shown.

59

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts

We next investigated whether lovastatin

affects the phosphorylation state of 4E-BP1 in

rat brain neuroblasts. It is well established that

phosphorylation of 4E-BP1 decreases its

electrophoretic mobility in 12% sodium

dodecyl sulphate-polyacrylamide gel

electrophoresis gels, where it appears as three

bands called α, β and γ with decreasing

electrophoretic mobility, which represent

protein 4E-BP1 phosphorylated to different

extents. Treatment of neuroblasts with

lovastatin leads to a marked concentration-

dependent increase in the electrophoretic

mobility of 4E-BP1 (Fig. 5A, upper film). This

increase of the electrophoretic mobility of 4E-

BP1 corresponds with a change of the

phosphorylation state, which is visualized by

an increasing intensity in the less

phosphorylated form, α, at higher lovastatin

concentrations, 10 µM and 20 µM.

We next confirmed that this effect was

specific of the HMG-CoA reductase inhibition,

as treatment with mevalonate significantly

prevents the decrease on 4E-BP1

phosphorylation observed in presence of 10

µM lovastatin (Fig. 5B, upper film). This effect

is more evident with the appearance of the

most phosphorylated form, γ, after mevalonate

treatment. Incubation of neuroblasts with

mevalonate alone leads to a phosphorylation

pattern of 4E-BP1 comparable to neuroblasts

without treatment.

Incubation of neuroblasts with

lovastatin or mevalonate does not modify the

expression levels of protein 4E-BP1 visualized

as a unique band in 10% sodium dodecyl

sulphate-polyacrylamide gel electrophoresis

gel (Fig 5A and B, lower films).

Effect of inhibitors of the phosphoinositide

3-kinase, LY294002 and wortmannin, in the

in vitro kinase activity of phosphoinositide 3-

kinase in neuroblasts

Our results suggest that lovastatin might

exert its effects in neuroblasts by its capacity to

inhibit the pathway of PI3-K.

A

LY 294002 (µM)

0

50

100

150

0 1 10010

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0 101 1LY 294002 (µM)

*

B

0

50

100

150

0 0,10,01 1Wortmannin (µM)

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0 0,10,01 1Wortmannin (µM)

*

A

LY 294002 (µM)

0

50

100

150

0 1 10010

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0 101 1LY 294002 (µM)

*

A

LY 294002 (µM)

0

50

100

150

0 1 100100

50

100

150

0

50

100

150

0 1 1001000 11 1001001010

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0 101 1LY 294002 (µM)

*

B

0

50

100

150

0 0,10,01 1Wortmannin (µM)

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0 0,10,01 1Wortmannin (µM)

*

B

0

50

100

150

0

50

100

150

0 0,10,01 10 0,10,01 1Wortmannin (µM)

PI3-

K A

ctiv

ity(%

ofc

ontr

ol)

0 0,10,01 1Wortmannin (µM) 0 0,10,01 1Wortmannin (µM)

*

000000

Figure 6. Effects of PI3-K inhibitors, LY294002 and wortmannin, on the in vitro kinase activity of PI3-K in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0) or various concentrations of PI3-K inhibitors, LY294002 (1, 10 and 100 µM) and wortmannin (0.01, 0.1 and 1 µM). In vitro PI3-K kinase assay was performed in anti-phosphotyrosine immunoprecipitates as described in Material and Methods. A representative autoradiography is shown. Densitometry analysis of results, expressed as mean ±

60

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts standard error of at least three independent experiments is shown at the bottom graphs.* P<0.05 compared to untreated cells.

Therefore, our next aim was to

investigate whether the pharmacological

inhibition of PI3-K is able to induce apoptosis

in neuroblasts. But previously we first checked

the effect of different concentrations of two

unrelated inhibitors of PI3-K, LY294002 and

wortmannin in its in vitro kinase activity (Fig.

6). As shown in Fig. 6A and B, treatment of

neuroblasts with different concentrations of

LY294002 (1-100µM) and wortmannin

(10nM-1µM) promotes an inhibition of the in

vitro kinase activity of PI3-K in a

concentration-dependent manner. Although

LY294002 and wortmannin effects result

evident at 10 µM and 100nM, respectively,

they significantly inhibit the PI3-K activity at

the higher concentrations used, 100 µM and 1

µM, respectively.

Effect of inhibitors of the phosphoinositide

3-kinase on parameters indicative of

apoptosis.

We therefore incubated neuroblasts with

different concentrations of the two PI3-K

inhibitors and then evaluated direct or indirect

parameters of apoptosis: cell viability, analysis

of internucleosomal fragmentation of DNA

and quantification of neuroblasts in apoptosis

by flow cytometry. We have checked that final

concentration of vehicle, 0.01% and 0.1%

DMSO, does not alter neuroblasts viability.

Neuroblasts were incubated with different

concentrations of wortmannin and LY294002

for 24 h. As seen in Fig. 7A, the percentage of

viable cells observed after exposure to 0.1µM,

1µM and 10 µM of LY294002 remains similar

to control sample (0.1% DMSO). Incubation

with a higher concentration, 100 µM, promotes

a significant decrease of neuroblasts viability

(43%), percentage similar to the obtained after

lovastatin treatment. Treatment of neuroblasts

with different concentrations of wortmannin

(1nM to 1 µM) does not significantly affect

cell viability compared to control samples with

0.01% DMSO.

As a decrease in cell viability is not a

specific indicator of apoptosis, we next

evaluated by flow cytometry the population of

neuroblasts that posses a hypodiploid DNA

content (phase of cell cycle Sub Go–G1), which

is a characteristic feature of cells undergoing

apoptosis (Darzynkiewicz et al. 1992). Results

in Fig. 7B show that 0.1µM of wortmannin and

10 µM of LY294002 do not significantly

modify the percentage of hypodiploid

neuroblasts compared with control neuroblasts.

Interestingly, 1 µM wortmannin and 100 µM

of LY294002 significantly increase, by almost

2 times, the percentage of neuroblasts in

apoptosis. However, the percentage of

apoptotic cells observed after 1 µM

wortmannin or 100 µM LY294002 (9 ± 1 %

and 11.7 ± 3 %, respectively) are significantly

lower than the observed after lovastatin

treatment (27.8±1%). Rest of cell cycle phases

are not affected after PI3-K inhibitors in our

conditions (data not shown).

In parallel experiments we have

analyzed a biochemical hallmark of apoptosis,

the internucleosomal fragmentation of DNA,

consequence of cellular DNA degradation by

endonuclease.

61

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts

C

4MW 5 6 72 31

B

0 10 100 Lov

Apo

ptos

is(%

oft

otal

cel

ls)

LY 294002 (µM)

05

10

15

202530

*

05

101520

2530

Apo

ptos

is(%

oft

otal

cel

ls)

0,1 1 LovWortm (µM)0

*C

ellV

iabi

lity

(% o

fcon

trol

)

0

25

50

75

100

125

0 0,001 0,10,01 1 LovWortm (µM)LY 294002 (µM)

0

25

50

75

100

125

Lov0 0.1 1 10010

Cel

lVia

bilit

y(%

ofc

ontr

ol)

*

A

C

4MW 5 6 72 31

C

4MW 5 6 72 31 4MW 5 6 72 31

B

0 10 100100 LovLov

Apo

ptos

is(%

oft

otal

cel

ls)

LY 294002 (µM)

05

10

15

202530

*

05

101520

2530

Apo

ptos

is(%

oft

otal

cel

ls)

0,1 1 LovWortm (µM)0

*

05

101520

2530

Apo

ptos

is(%

oft

otal

cel

ls)

0,1 1 LovWortm (µM)0

05

101520

2530

Apo

ptos

is(%

oft

otal

cel

ls)

0,1 1 LovLovWortm (µM)0

*C

ellV

iabi

lity

(% o

fcon

trol

)

0

25

50

75

100

125

0 0,001 0,10,01 1 LovWortm (µM)LY 294002 (µM)

0

25

50

75

100

125

LovLov0 0.1 1 10010

Cel

lVia

bilit

y(%

ofc

ontr

ol)

*

A

Figure 7. Effects of PI3-K inhibitors on neuroblasts viability (A), quantification of apoptotic cells (B) and internucleosomal DNA fragmentation (C). Neuroblasts were incubated for 24 h in the presence of medium (0), 10 µM lovastatin (black histograms) or the indicated concentrations of inhibitors LY294002 and wortmannin. Cell viability was determined by the MTT assay (A), the hypodiploid DNA content was evaluated by flow cytometry (B), and isolated DNA was analyzed by using electrophoresis on 2% agarose gel (C). In experiment C, MW, molecular weight ladder; lane 1: 0.01% DMSO; lane 2: wortmannin 0.1 µM; lane 3: wortmannin 1 µM; lane 4: 0.1% DMSO; lane 5: LY294002 10 µM; lane 6: LY294002 100 µM and lane 7: lovastatin 10 µM. Results in A and B are expressed as mean ± standard error of eleven and three independent experiments, respectively. A representative film of three independent experiments is shown in C. Samples in experiments A and B were evaluated in triplicate. * P<0.05 compared to untreated cells.

DISCUSSION Treatment of neuroblasts with 10 µM

LY294002 does not induce internucleosomal

degradation of DNA, whereas a higher

concentration, 100 µM, leads to a typical

apoptotic pattern of DNA laddering (Fig. 7C,

lane 6). Wortmannin treatment does not

promote internucleosomal DNA fragmentation,

as seen in Fig. 7C (lanes 2, 3).

The ability of lovastatin to induce

apoptosis has been well documented in several

non-neuronal cell types (Guijarro et al. 1998;

Jones et al. 1994; Padayatty et al. 1997; Perez-

Sala and Mollinedo 1994). A recent study by

our group shows that lovastatin suppressed cell

growth by inducing apoptosis in rat brain 62

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts neuroblasts (Garcia-Roman et al. 2001). The

aim of this work was to investigate the

intracellular mechanisms induced by lovastatin

in rat brain neuroblasts, focused on one of the

main pathways that regulate cell growth and

survival, PI3-K/PKB. In the present work, we

show that lovastatin treatment leads to a clear

reduction of the kinase activity of PI3-K in

neuroblasts. This result agrees with previous

works on the apoptosis induced by other statins

in non neuronal cell types (Nakagawa et al.

1998; Weiss et al. 1999), which point to PI3-K

as a key regulatory molecule on cell survival.

However, our finding differs from other study

in which a different statin, simvastatin, reduced

myocardial reperfusion injury in vivo by

activating the PI3-K activity in myocardial

tissue (Wolfrum et al. 2004). These

controversial results may be explained by both,

the different cell type used and different

biological actions of statins, apoptosis or

cardioprotective effect. At this moment, we do

not know the mechanisms by which lovastatin

treatment leads to an inactivation of PI3-K in

neuroblasts. However, we may postulate that

the inhibition of PI3-K activity observed after

lovastatin treatment could be due, at least

partially, to a reduction of the prenylation of

Ras (Garcia-Roman et al. 2001), an upstream

regulator of PI3-K as previously reported by

Nakagawa et al. (1998). The suggested

hypothesis that Ras is involved in PI3-K

activation in neuroblasts could not be

confirmed in our experimental conditions due

to technical problems. Therefore, we measured

PI3-K activity in tyrosine phosphorylated

proteins immunoprecipitates. The decrease in

the PI3-K activity observed might be attributed

to an inhibition of the tyrosine phosphorylation

of several proteins after lovastatin treatment, as

it has been described in previous studies but in

other cell types (McGuire et al. 1993; McGuire

et al. 1994; McGuire et al. 1996; Xu et al.

1996). However, our data clearly show that the

amount of p85 regulatory subunit associated

with tyrosine phosphorylated proteins is not

modified by lovastatin treatment. A different

explanation of the reduction of PI3-K activity

could involve the tyrosine phosphorylation of

the p110 subunit of PI3-K, which negatively

reduces its kinase activity, as it has been

shown in L6 myoblasts after simvastatin,

treatment (Nakagawa et al. 2001).Therefore,

the mechanisms underlying the inhibition of

PI3-K activity evoked by lovastatin in

neuroblasts will be an objective of future

studies.

Among the main signal transduction

pathways initiated by PI3-K to promote its

cellular actions is PKB/Akt. In the present

work, we show that lovastatin treatment leads

to a clear reduction on the phosphorylation of

PKB in Ser473 in brain neuroblasts that point

to an inhibition of its kinase activity. By

contrast, previous works show that simvastatin

activated PKB in myocardial tissue (Wolfrum

et al. 2004) and endothelial cells (Kureishi et

al. 2000) in two experimental models unrelated

to apoptosis. As mentioned above, these

controversial findings may be attributed to

different biological actions of statins

depending on the cell type. The decrease in the

phosphorylation/activation of PKB observed in

brain neuroblasts can be explained as a direct

63

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts consequence of the decrease in PI3-K activity

induced by lovastatin. However, we should not

discard the possibility of a dephosphorylation

in Ser 473, as it occurs in the apoptosis

induced by ceramide (Schubert et al. 2000).

It is generally accepted that PKB

promotes cell survival by inhibiting the action

of proteins that mediate apoptosis (Lawlor and

Alessi 2001). Among its multiples effectors is

the kinase mTOR (Holland et al. 2004), which

phosphorylates two substrates involved in the

regulation of protein translation, p70S6K

(Holland et al. 2004; McMahon et al. 2002)

and the regulatory protein of the eukaryotic

translation initiation factor 4E, 4E-BP1 (Choi

et al. 2003). In the present work, we have

shown that the decrease in PKB

phosphorylation/activity caused by lovastatin

is associated with a reduction of both p70S6K

and 4E-BP1 phosphorylation. Although a

decrease in the phosphorylation of 4E-BP1

after lovastatin treatment has been previously

reported in non neuronal cells (Polunovsky et

al. 2000), this is the first study showing a

reduction of 4E-BP1 phosphorylation in brain

neuroblasts. Moreover, we also report for the

first time that the phosphorylation of another

protein involved in the translational process,

p70S6K, is markedly decreased in neuroblasts in

response to lovastatin. The reduction of p70S6K

phosphorylation can be also greatly attributed

to the clear inhibition of p70S6K protein levels

induced by lovastatin in neuroblasts. Our data

support the recent hypothesis that points at

regulatory proteins of the translation initiation

as important modulators involved in the

programmed cell death (Herbert et al. 2000; Li

et al. 2002; Polunovsky et al. 1996). However

further experiments are necessary to elucidate

the mechanism underlying the inhibition of

p70S6K protein expression and to confirm the

plausible relationship between protein

synthesis and apoptosis in rat neuroblasts.

In this work we show that all lovastatin

effects are completely prevented by

simultaneous exposure of neuroblasts to

exogenous mevalonate, which allow us to

conclude that the inhibition of PI3-K/PKB

pathway in these cells is specifically due to a

blockade of HMG-CoA reductase.

Our results might suggest that lovastatin

could suppress rat brain neuroblasts growth

and induce apoptosis (Garcia-Roman et al.

2001) by its capacity to inhibit the growth and

survival pathway of the PI3-K/PKB.

Therefore, and because previous studies

demonstrated that pharmacological inhibition

of PI3-K leads to apoptosis in different cell

types, such as MDCK (Khwaja et al. 1997) and

PC12 cells (Yao and Cooper 1995), we

investigated whether PI3-K inhibition is able to

induce apoptosis in neuroblasts. Our results

show that only the highest doses of both

inhibitors of the PI3-K activity are able to

induce apoptosis in rat neuroblasts.

Additionally, the pharmacological inhibition of

PI3-K activity in neuroblasts was less effective

at triggering apoptosis than lovastatin.

Concentrations of LY294002 and wortmannin

used in this work are within the range widely

described in the literature to potently inhibit

the PI3-K activity in numerous cell types

(Cheatham et al. 1994; Vlahos et al. 1994). We

have further confirmed that inhibitors

64

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts concentrations of 1 µM wortmannin and 100

µM LY294002, which promote neuroblasts

apoptosis, significantly inhibit the in vitro PI3-

K activity in rat neuroblasts. The fact that both

inhibitors are less effective at inducing

neuronal apoptosis than lovastatin allow us to

suggest the idea that, besides the inhibition of

PI3-K alone, the activation/inactivation of

other intracellular pathways should be

necessarily involved in the neuronal apoptosis

induced by lovastatin. We have shown in this

work that incubation of neuroblasts with 1 µM

lovastatin causes a repetitive reduction (about

30%) of PI3-K activity (Fig. 1) but under the

same conditions there was not effect on

neuroblasts apoptosis (Garcia-Roman et al.

2001), confirming the above mentioned idea

that the inhibition of the PI3-K pathway alone

does not mean a relevant mechanism involved

in neuroblasts-induced apoptosis. According to

the hypothesis of the involvement of different

signalling mechanisms, Xia et al. (1995)

propose that cellular fate is determined by a

dynamic balance between pathways that

regulate cell survival and those activated by

cellular stress such as JNK and p38MAPK.

Supporting the idea that other pathways

different from PI3-K are regulating neuronal

apoptosis, Li et al. (2000) demonstrate that

neuronal survival is also promoted by the

cAMP pathway. If neuroblasts death induced

by lovastatin involves other intracellular

pathways is unknown at present but current

work is in progress to test this hypothesis.

In summary, we have shown in this

work that the specific inhibition of HMG-CoA

reductase in rat brain neuroblasts leads to an

inhibition of the main pathway that controls

cell growth and survival, PI3-K/PKB and to

the subsequent blockade of downstream

proteins implicated in the regulation of protein

synthesis. Our results suggest that PI3-K

pathway inactivation appears insufficient to

induce the degree of apoptosis provoked by

lovastatin and that apoptosis of neuroblasts

induced by this statin must necessarily involve

the activation/inactivation of other intracellular

pathways. We propose that the integration

between different intracellular pathways

simultaneously affected in different degree by

lovastatin, including PI3-K/PKB, might lead to

a cell death by apoptosis in neuroblasts.

These findings might contribute to

elucidate the molecular mechanisms of some

statins effects in the central nervous system,

such as induction of neuroblasts apoptosis.

ACKNOWLEDGEMENTS

The authors thank J. Ricardo Argent for

his excellent technical assistance, Dr. Alberto

Alvarez Barrientos for his kind and valuable

help on the flow cytometry experiments and

Dr. Pedro Fernandez for his kind advice in the

in vitro PI3-K assay. This work has been

supported by Grants, SAF 2001-0154 from the

Ministerio de Ciencia y Tecnologia (Spain),

2PR01B007 and 2PR04A014 from the Junta de

Extremadura (Spain). M. I. Cerezo-Guisado is

supported by a doctoral fellowship from Junta

de Extremadura, Spain.

65

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts REFERENCES Goldstein J. L. and Brown M. S. (1990) Regulation

of the mevalonate pathway. Nature 343, 425-430. Anderson K. E. and Jackson S. P. (2003) Class I phosphoinositide 3-kinases. Int J Biochem Cell Biol 35, 1028-1033.

Guijarro C., Blanco-Colio L. M., Ortego M., Alonso C., Ortiz A., Plaza J. J., Diaz C., Hernandez G., and Egido J. (1998) 3-Hydroxy-3-methylglutaryl coenzyme a reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res 83, 490-500.

Barth J. D., Kruisbrink O. A., and Van Dijk A. L. (1990) Inhibitors of hydroxymethylglutaryl coenzyme A reductase for treating hypercholesterolaemia. BMJ 301, 669.

Cavender C. P., Turley S. D., and Dietschy J. M. (1995) Sterol metabolism in fetal, newborn, and suckled lambs and their response to cholesterol after weaning. Am J Physiol 269, E331-E340.

Herbert T. P., Fahraeus R., Prescott A., Lane D. P., and Proud C. G. (2000) Rapid induction of apoptosis mediated by peptides that bind initiation factor eIF4E. Curr Biol 10, 793-796.

Cheatham B., Vlahos C. J., Cheatham L., Wang L., Blenis J., and Kahn C. R. (1994) Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol 14, 4902-4911.

Holland E. C., Sonenberg N., Pandolfi P. P., and Thomas G. (2004) Signaling control of mRNA translation in cancer pathogenesis. Oncogene 23, 3138-3144.

Jones K. D., Couldwell W. T., Hinton D. R., Su Y., He S., Anker L., and Law R. E. (1994) Lovastatin induces growth inhibition and apoptosis in human malignant glioma cells. Biochem Biophys Res Commun 205, 1681-1687.

Choi K. M., McMahon L. P., and Lawrence J. C., Jr. (2003) Two motifs in the translational repressor PHAS-I required for efficient phosphorylation by mammalian target of rapamycin and for recognition by raptor. J Biol Chem 278, 19667-19673. Khwaja A., Rodriguez-Viciana P., Wennstrom S.,

Warne P. H., and Downward J. (1997) Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J 16, 2783-2793.

Darzynkiewicz Z., Bruno S., Del Bino G., Gorczyca W., Hotz M. A., Lassota P., and Traganos F. (1992) Features of apoptotic cells measured by flow cytometry. Cytometry 13, 795-808.

Falke P., Mattiasson I., Stavenow L., and Hood B. (1989) Effects of a competitive inhibitor (mevinolin) of 3-hydroxy-3-methylglutaryl coenzyme A reductase on human and bovine endothelial cells, fibroblasts and smooth muscle cells in vitro. Pharmacol Toxicol 64, 173-176.

Kita T., Brown M. S., and Goldstein J. L. (1980) Feedback regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase in livers of mice treated with mevinolin, a competitive inhibitor of the reductase. J Clin Invest 66, 1094-1100.

Kureishi Y., Luo Z., Shiojima I., Bialik A., Fulton D., Lefer D. J., Sessa W. C., and Walsh K. (2000) The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med 6, 1004-1010.

Garcia-Roman N., Alvarez A. M., Toro M. J., Montes A., and Lorenzo M. J. (2001) Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosynthesis inhibition. Mol Cell Neurosci 17, 329-341.

66

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts Lawlor M. A. and Alessi D. R. (2001) PKB/Akt: a key mediator of cell proliferation, survival and insulin responses? J Cell Sci 114, 2903-2910.

Li M., Wang X., Meintzer M. K., Laessig T., Birnbaum M. J., and Heidenreich K. A. (2000) Cyclic AMP promotes neuronal survival by phosphorylation of glycogen synthase kinase 3beta. Mol Cell Biol 20, 9356-9363.

Li S., Sonenberg N., Gingras A. C., Peterson M., Avdulov S., Polunovsky V. A., and Bitterman P. B. (2002) Translational control of cell fate: availability of phosphorylation sites on translational repressor 4E-BP1 governs its proapoptotic potency. Mol Cell Biol 22, 2853-2861.

McGuire T. F., Corey S. J., and Sebti S. M. (1993) Lovastatin inhibits platelet-derived growth factor (PDGF) stimulation of phosphatidylinositol 3-kinase activity as well as association of p85 subunit to tyrosine-phosphorylated PDGF receptor. J Biol Chem 268, 22227-22230.

McGuire T. F., Qian Y., Vogt A., Hamilton A. D., and Sebti S. M. (1996) Platelet-derived growth factor receptor tyrosine phosphorylation requires protein geranylgeranylation but not farnesylation. J Biol Chem 271, 27402-27407.

McGuire T. F., Xu X. Q., Corey S. J., Romero G. G., and Sebti S. M. (1994) Lovastatin disrupts early events in insulin signaling: a potential mechanism of lovastatin's anti-mitogenic activity. Biochem Biophys Res Commun 204, 399-406.

McMahon L. P., Choi K. M., Lin T. A., Abraham R. T., and Lawrence J. C., Jr. (2002) The rapamycin-binding domain governs substrate selectivity by the mammalian target of rapamycin. Mol Cell Biol 22, 7428-7438.

Michikawa M. and Yanagisawa K. (1999) Inhibition of cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death. J Neurochem 72, 2278-2285.

Muñoz A., Wrighton C., Seliger B., Bernal J., and Beug H. (1993) Thyroid hormone receptor/c-erbA:

control of commitment and differentiation in the neuronal/chromaffin progenitor line PC12. J Cell Biol 121, 423-438.

Nakagawa H., Mutoh T., Kumano T., and Kuriyama M. (1998) HMG-CoA reductase inhibitor-induced L6 myoblast cell death: involvement of the phosphatidylinositol 3-kinase pathway. FEBS Lett 438, 289-292.

Nakagawa H., Mutho T., Kumano T., and Kuriyama M. (2001). Tyrosine phosphorylation of the cartalytic subunit p110 of phosphatidylinositol-3 kinase induced by HMG-CoA reductase inhibitor inhibits its kinase activity in L6 myoblasts. FEBS Lett 508, 53-56.

Padayatty S. J., Marcelli M., Shao T. C., and Cunningham G. R. (1997) Lovastatin-induced apoptosis in prostate stromal cells. J Clin Endocrinol Metab 82, 1434-1439.

Perez-Sala D. and Mollinedo F. (1994) Inhibition of isoprenoid biosynthesis induces apoptosis in human promyelocytic HL-60 cells. Biochem Biophys Res Commun 199, 1209-1215.

Polunovsky V. A., Gingras A. C., Sonenberg N., Peterson M., Tan A., Rubins J. B., Manivel J. C., and Bitterman P. B. (2000) Translational control of the antiapoptotic function of Ras. J Biol Chem 275, 24776-24780.

Polunovsky V. A., Rosenwald I. B., Tan A. T., White J., Chiang L., Sonenberg N., and Bitterman P. B. (1996) Translational control of programmed cell death: eukaryotic translation initiation factor 4E blocks apoptosis in growth-factor-restricted fibroblasts with physiologically expressed or deregulated Myc. Mol Cell Biol 16, 6573-6581.

Raiteri M., Arnaboldi L., McGeady P., Gelb M. H., Verri D., Tagliabue C., Quarato P., Ferraboschi P., Santaniello E., Paoletti R., Fumagalli R., and Corsini A. (1997) Pharmacological control of the mevalonate pathway: effect on arterial smooth muscle cell proliferation. J Pharmacol Exp Ther 281, 1144-1153.

67

Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts

68

Roth T., Richardson G. R., Sullivan J. P., Lee R. M., Merlotti L., and Roehrs T. (1992) Comparative effects of pravastatin and lovastatin on nightime sleep and daytime performance. Clin Cardiol 15, 426-432.

Scheid M. P. and Woodgett J. R. (2001) PKB/AKT: functional insights from genetic models. Nat Rev Mol Cell Biol 2, 760-768.

Schmelzle T. and Hall M. N. (2000) TOR, a central controller of cell growth. Cell 103, 253-262.

Schubert K. M., Scheid M. P., and Duronio V. (2000) Ceramide inhibits protein kinase B/Akt by promoting dephosphorylation of serine 473. J Biol Chem 275, 13330-13335.

Spady D. K. and Dietschy J. M. (1983) Sterol synthesis in vivo in 18 tissues of the squirrel monkey, guinea pig, rabbit, hamster, and rat. J Lipid Res 24, 303-315.

Tobert J. A. (1987) New developments in lipid-lowering therapy: the role of inhibitors of hydroxymethylglutaryl-coenzyme A reductase. Circulation 76, 534-538.

Toker A. and Cantley L. C. (1997) Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature 387, 673-676.

Vlahos C. J., Matter w. F., Hui K. Y., and Brown R. F. (1994) A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem 269, 5241-5248.

Weiss R. H., Ramirez A., and Joo A. (1999) Short-term pravastatin mediates growth inhibition and apoptosis, independently of Ras, via the signaling proteins p27Kip1 and P13 kinase. J Am Soc Nephrol 10, 1880-1890.

Wolfrum S., Dendorfer A., Schutt M., Weidtmann B., Heep A., Tempel K., Klein H. H., Dominiak P., and Richardt G. (2004) Simvastatin acutely reduces myocardial reperfusion injury in vivo by activating

the phosphatidylinositide 3-kinase/Akt pathway. J Cardiovasc Pharmacol 44, 348-355.

Xia Z., Dickens M., Raingeaud J., Davis R. J., and Greenberg M. E. (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326-1331.

Xu X. Q., McGuire T. F., Blaskovich M. A., Sebti S. M., and Romero G. (1996) Lovastatin inhibits the stimulation of mitogen-activated protein kinase by insulin in HIRcB fibroblasts. Arch Biochem Biophys 326, 233-237.

Yao R. and Cooper G. M. (1995) Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science 267, 2003-2006.

CCaappííttuulloo 22

“LOVASTATIN INHIBITS THE EXTRACELLULAR SIGNAL-REGULATED KINASES PATHWAY IN IMMORTALIZED RAT BRAIN NEUROBLASTS”

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis LOVASTATIN INHIBITS THE EXTRACELLULAR SIGNAL-REGULATED KINASES

PATHWAY IN IMMORTALIZED RAT BRAIN NEUROBLASTS

1Maria Isabel Cerezo-Guisado, 2Natalia García-Román, 3Luis Jesús García-Marín, 4Alberto Álvarez-

Barrientos, 1Maria Julia Bragado and 1Maria Jesús Lorenzo

1Departamento de Bioquímica, Biología Molecular y Genética and 3Departamento de Fisiología, Universidad de

Extremadura, Cáceres. 2Departamento de Bioquímica y Biología Molecular, Universidad de Alcalá, 4Unidad de

Citometría, Centro Nacional de Investigaciones Cardiovasculares, Madrid. Spain.

ABSTRACT Furthermore, we showed that

pharmacological inhibition of both MEK and

PI3K activities was able to induce neuroblast

apoptosis with the same efficacy as lovastatin.

Our results suggest that lovastatin triggers

neuroblast apoptosis by regulating several

signalling pathways, including the

Ras/ERK1/2 pathway. These findings might

also contribute to elucidate the intracellular

mechanisms involved in the central nervous

system side effects associated to statin therapy.

We have previously shown that

lovastatin, an HMG-CoA reductase inhibitor,

induces apoptosis in spontaneously

immortalized rat brain neuroblasts. In the

present study, we analyzed the intracellular

signal transduction pathways by which

lovastatin induces neuroblast apoptosis. We

showed that lovastatin efficiently inhibited Ras

activation which was associated with a

significant decrease in ERK1/2

phosphorylation. Lovastatin also decreased

CREB phosphorylation and CREB-mediated

gene expression. The effects of lovastatin on

the Ras/ERK1/2/CREB pathway were time-

and concentration dependent and fully

prevented by mevalonate. In addition, we

showed that the MEK inhibitor, PD98059, was

a poor inducer of apoptosis in serum-treated

neuroblasts. However, PD98059 significantly

increased apoptosis induced by lovastatin

treatment.

RUNNING TITLE: ERKs inhibition in

lovastatin-induced neuronal apoptosis.

KEYWORDS: Lovastatin, apoptosis,

neuroblasts, ERK1/2, PD98059, LY294002

ABBREVIATIONS USED: HMG-CoA, 3-

hydroxy-3-methylglutaryl coenzyme A; ERK,

extracellular signal-regulated kinase; CREB,

cAMP response element binding protein,

PI3K, phosphoinositide 3-kinase; PKB, protein

kinase B.

69

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis INTRODUCTION

3-hydroxy-3-methylglutaryl

coenzyme A reductase inhibitors (HMG-CoA

reductase inhibitors or “statins”) are widely

used in the treatment of lipid disorders,

especially hypercholesterolemia. They

decrease the risk for vascular disease including

vascular death, myocardial infarction and

stroke. The statin family is composed of six

members: lovastatin, simvastatin, atorvastatin,

cerivastatin, pravastatin and fluvastatin. The

last two are hydrophilic, whereas the others are

lipid soluble, and each member differs in its

specificity for HMG-CoA reductase

(Blumenthal et al. 2000; Chong et al. 2001;

Graaf et al. 2004).

HMG-CoA reductase is a rate-limiting

enzyme that catalyses the conversion of HMG-

CoA into mevalonate (Goldstein et al. 1990;

Graaf et al. 2004). It is well established that

the mevalonate pathway plays an important

role in cell growth and survival (Goldstein et

al. 1990). Several studies show that statins not

only block the biosynthesis of mevalonate but,

in addition, inhibit the proliferation and induce

apoptosis of both normal and tumour cells

(Padayatty et al. 1997; Blanco-Colio et al.

2002; Hillyard et al. 2002; Jaster et al. 2003;

Graaf et al. 2004; Koyuturk et al. 2004; Takata

et al. 2004; Wu et al. 2004; Nishida et al.

2005). These pleiotropic effects of statins are

thought to be mediated by their ability to block

the biosynthesis of isoprenoid intermediates of

the cholesterol pathway, such as farnesyl

pyrophosphate and/or geranylgeranyl

pyrophosphate which serve as lipid

attachments for the small GTP-binding

proteins Ras, Rho and Rac (Goldstein et al.

1990; Graaf et al. 2004). This post-

translational prenylation step (either

farnesylation or geranylgeranylation) is

required both for membrane association and

cell signalling, leading to cell survival and

proliferation (Zhang and Casey 1996; Graaf et

al. 2004).

HMG-CoA reductase activity (Maltese

and Volpe 1979) and cholesterol biosynthesis

(Spady and Dietschy 1983; Cavender et al.

1995) are very high in the early phase of the

ontogenetic development of the brain. These

data indicate that the mevalonate pathway is

essential to ensure normal growth,

differentiation and maintenance of neuronal

tissues. In agreement with this, recent reports

show that the inhibition of this biosynthetic

pathway during gestation by statin exposures

are associated with severe central nervous

system (CNS) defects (Edison and Muenke

2004a,b). On the other hand, studies in vitro

show that statins at micro- and millimolar

concentrations have neurotoxic effects on

primary neuronal cultures of cerebral cortex

(Michikawa and Yanagisawa 1999; Tanaka et

al. 2000; Schulz et al. 2004) and we have

shown that lovastatin induces apoptosis of

immortalized rat brain neuroblasts, and that its

effect is associated with a decreased

prenylation of Ras (García-Román et al. 2001).

The Ras family of small GTPases are

key regulators of signal transduction pathways

that control cell proliferation, differentiation,

survival and apoptosis. Ras and its relatives are

activated in response to an extracellular or

intracellular signal that generates the GTP-

bound form and energizes the signal

transducing ability. Hydrolysis of the bound

70

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis GTP by an intrinsic GTPase activity relaxes

the conformation and terminates the signal

(Denhardt 1996; Repasky et al. 2004; Mitin et

al. 2005). Active Ras interacts with and

modulates the activity of several downstream

effectors. The best-characterized Ras effector

pathway is the interaction with, and activation

of, the three Raf serine/threonine kinases (A-

Raf, B-Raf and Raf-1) leading to stimulation of

the MEK1/MEK2 and ERK1/ERK2 (ERK1/2)

mitogen-activated protein kinase (MAPK)

cascade (Denhardt 1996; Repasky et al. 2004).

In the nervous system, ERK1/2 cascade is

critical for neuronal differentiation, plasticity

and neuronal survival (Hetman and Gozdz

2004). A role for ERK1/2 in neuronal survival

was first indicated by experiments showing

that overexpression of constitutively active

mutants of MEK1 prevented the apoptosis

induced by NGF withdrawal in neuronally

differentiated PC12 cells (Xia et al. 1995).

Thereafter, although many studies supported a

prosurvival activity of ERK1/2 in different

neuronal cell types, several other studies

suggested that ERK1/2 were not involved in

the antiapoptotic signalling in neurons. Apart

from those contradictory results, there is

accumulating evidence that ERK1/2 may

mediate the neuroprotective activity of several

factors that neuroprotect against damaging

insults and neuronal injury (Hetman and Gozdz

2004). The mechanism by which the

Ras/ERK1/2 signalling pathway promotes

neuronal survival is under study, although it

has been suggested that activation of a

transcription factor, cAMP response element

binding protein (CREB) and/or a direct

inhibition of Bad, a pro-apoptotic member of

the Bcl-2 family, may mediate the prosurvival

activity of ERK1/2 in trophic-deprived

cerebellar granule neurons (Bonni et al. 1999).

As has been previously mentioned, we

have shown that lovastatin induces apoptosis in

rat brain neuroblasts (García-Román et al.

2001). The aim of the present work was to

investigate the role of the Ras/ERK1/2

signalling pathway in regulating lovastatin-

induced apoptosis in rat brain neuroblasts. The

elucidation of the intracellular mechanisms

affected by lovastatin will contribute to gain

insight in the growth inhibition and apoptosis

induced by lovastatin and other statins in

neuronal cells, and additionally will contribute

in establishing the important role that the

mevalonate pathway plays in the development

of the nervous system.

EXPERIMENTAL PROCEDURES

Reagents and antibodies

Lovastatin (Mevinolin, MK-803) was

from Calbiochem (San Diego, CA, USA). The

inactive lactone of lovastatin was converted to

the active form as previously described (Kita et

al. 1980). Mevalonic acid was purchased from

Sigma-Aldrich (St. Louis, MO, USA). Ham’s

F-12 medium, fetal calf serum, L-glutamine,

streptomycin, penicillin and trypsin/EDTA

solution were from PAN Biotech (Aidenbach,

Germany, Europe). Tissue culture flasks and

dishes were from TPP (Trasadingen,

Switzerland, Europe). MEK1 inhibitor

PD98059 (2´-amino-3´-methoxyflavone) and

PI3K inhibitor LY294002 [2-(4-Morpholinyl)-

8-phenyl-4H-1-benzopyran-4-one] were from

Calbiochem (San Diego, CA, USA). Complete

protease inhibitor cocktail tablets were from

71

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Roche Molecular Biochemicals (Indianapolis,

IN, USA). Glutathione-Sepharose 4B was from

Pharmacia (Freiburg, Germany), Ras antibody

(cat. 610002) was from BD Biosciences

Pharmigen (San Diego, CA, USA). ERK1/2

(cat. M3807) and phospho-ERK1/2 (Thr183

and Tyr185, cat. M8159) antibodies were from

Sigma (St. Louis, MO, USA). CREB antibody

(cat. 8977) was from Sigma, phospho-CREB

(Ser 133, cat. 06-519) antibody was from

Upstate Biotechnology (Lake Placid, NY,

USA). Goat anti-rabbit (cat. 31460) and goat

anti-mouse (cat. 31430) conjugated to

horseradish peroxidase were from Pierce

(Rockford, IL, USA). Other reagents were

obtained from different commercial sources

and were of the highest purity available.

Cell cultures and treatments

Spontaneously immortalized rat brain

neuroblasts were used in this study. This cell

line was obtained by spontaneous

immortalization from cultures of 17-day fetal

rat cerebral cortices (Muñoz et al. 1993) and

was kindly provided by Dr. Alberto Muñoz

(Instituto de Investigaciones Biomédicas,

CSIC, Madrid, Spain). The cells represented

primitive neuroblasts that expressed NF 68 and

the primitive neuronal marker nestin, but

lacked the astrocyte marker, glial fibrillary

acidic protein (GFAP). After partial

differentiation induction with dibutyryl –

cAMP, the cells expressed further neuronal

markers such as NF 145, NF 220, and neuron-

specific enolase (A. Muñoz, personal

communication). Cells were grown in Ham’s

F-12 supplemented with 10% fetal calf serum,

L-glutamine (2 mM), streptomycin (100

µg/ml) and penicillin (100 U/ml). Cells were

seeded at 5 x 105 in 75-cm2 tissue culture flask

and incubated at 37ºC under a 5% CO2/95% air

atmosphere.

Confluent cells were trypsinized and

seeded in tissue culture dishes at a density of 2

x 104 cells/cm2. After 24 h, the medium was

aspirated and replaced with fresh medium

alone or containing the indicated

concentrations of lovastatin, mevalonate,

PD98059 or LY294002 and the incubation was

continued for a further 24 h. When indicated,

cells were incubated with PD98059 for 1h

before lovastatin addition. For the time course

experiments, cells were incubated with 10 µM

lovastatin for different periods of time.

Measurement of Ras activation

The capacity of Ras-GTP to bind to

RBD (Ras-binding domain of Raf-1) was used

to analyze the amount of active Ras as

previously described (Villalonga et al. 2002).

Neuroblasts were seeded in 100 mm tissue

culture dishes and after indicated treatments,

cells were harvested in phosphate-buffered

saline (PBS) and lysed for 15 min in 100 µl

ice-cold lysis buffer containing 20 mM Tris

(pH 7.4), 5 mM MgCl2, 1 mM EDTA, 0.2 mM

sodium orthovanadate, 5 mM NaF, 10 %

glycerol, 100 mM KCl, 1 % Triton X-100, 0.05

% 2-mercaptoethanol and 4 µg/ml complete

protease inhibitor cocktail. Cell lysates were

centrifuged at 20000 g for 10 min at 4ºC and

protein concentrations in the supernatants were

determined by using the Bio-Rad protein

assay, according to the instructions of the

manufacturer. Protein-equalized supernatants

(250 µg) were incubated for 2 h at 4ºC with

72

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis glutathione-Sepharose 4B beads pre-coupled

with GST-RBD (1h at 4ºC). The beads were

washed four times in the lysis buffer. Bound

proteins were solubilized by the addition of 30

µl of Laemmli loading buffer and analyzed in

12 % SDS-PAGE gels. The amount of Ras in

the bound fraction was analyzed by Western

blot as described below.

Western blot analysis

Treated and control cells were

harvested in PBS and lysed for 15 min in ice-

cold lysis buffer containing 50 mM HEPES

(pH 7.5), 150 mM NaCl, 1% Triton X-100,

10% glycerol, 5 mM MgCl2, 25 mM NaF, 10

mM sodium pyrophosphate, 1 mM EGTA, 0,5

mM sodium orthovanadate and 4 µg/ml

complete protease inhibitor cocktail. After

lysis, cell debris was removed by

centrifugation at 20000 g for 10 min at 4 ºC

and protein concentrations determined in the

supernatants as indicated above. Equal

amounts of protein (20 µg) were separated on

10 or 12% SDS-PAGE and blotted onto PVDF

membranes (PolyScreen, NEN life Science

Products, Inc. Boston, MA). The membranes

were then blocked with 5% non-fat dry milk in

Tris-buffered saline (pH 7.5) containing 0.5%

tween 20 and incubated with appropriate

primary and horseradish peroxidase (HRP)-

conjugated secondary antibodies in antibody

buffer [5% non-fat dry milk in Tris-buffered

saline (pH 7.5) containing 0.05% tween 20

(TBS-T)]. After required washes with TBS-T,

proteins were analyzed using an enhanced

chemiluminescence detection system (Signal®

West Pico Chemiluminescent Substrate,

Pierce, Rockford, IL) and exposed to

hyperfilm-ECL (Amersham, Pharmacia

Biotech, Freiburg, Germany). Films were

photographed and the intensity of each band

was analyzed using a ChemiDoc System

(Documentation and Analysis System, Bio-

Rad, Hercules, CA, USA). Results were

expressed as percentage of control.

Luciferase reporter construct and assay

The control ß-galactosidase construct

was pSV- ß-Galactosidase (Promega). To

construct the CRE response element luciferase

reporter, the SV40 promoter in the vector

pGL3-promoter (Promega) was excised with

BglII and Hind III and replaced by a minimal

HSV TK promoter (obtained by PCR

amplification) containing nucleotides – 109 to

+ 17 flanked by BglII and Hind III sites. A

double stranded oligonucleotide containing the

CRE response element from the somatostatin

promoter (AGCCTGACGTCAGAGA) flanked

by Asp718 and BglII sites was then cloned into

this vector (pGL3-CRE). Neuroblasts were co-

transfected with 1 µg of pGL3-CRE and 1 µg

of ß-Galactosidase reporter vector using

GenePORTER transfection reagent (Genlantis,

San Diego, CA, USA), as recommended by the

manufacturer. Following transfection the cells

were incubated for 24 h, the medium was

exchanged, and the cells were incubated for an

additional 24 h with 10 µM lovastatin in the

presence or absence of 100 µM mevalonate.

The cells were then lysed and luciferase and ß-

galactosidase assays performed using Promega

reagents as recommended by the manufacturer.

Luciferase activity was normalized to ß-

galactosidase activity. Results were expressed

as percentage of control.

73

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Cell viability assay

Cell viability was evaluated by the

crystal violet method (Drysdale et al. 1983).

For these experiments 35 mm tissue culture

dishes were used. At the end of each

treatment, the medium was discarded, and the

remaining viable adherent cells were stained

with crystal violet (0.03% in 2% ethanol) for 5

min. Dishes were rinsed with tap water and 1

ml of 1% sodium dodecyl sulfate was added to

each plate to solubilize the stained cells. The

absorbance of each plate was read at 560 nm.

Dishes without cells were processed in parallel

to correct the nonspecific adhesion of crystal

violet to the plastic. Viable cells were

calculated as percentage of absorbance with

respect to untreated cells.

DNA Fragmentation Assay

Neuroblasts were plated on 100 mm

culture dishes. After indicated treatments,

floating cells were harvested by centrifugation

at 20000 g for 1 min and adherent cells were

detached mechanically with a rubber

policeman. Adherent and floating cells were

mixed, washed twice in ice-cold PBS and lysed

in lysis buffer [10 mM Tris (pH 7.4), 5 mM

EDTA and 0.5 % Triton X-100)] for 60 min at

4ºC with agitation. After centrifugation at

20000 g for 30 min at 4ºC, supernatants were

incubated with RNase A (0.1 mg/ml) at 37ºC

for 45 min and then with Proteinase K (0.2

mg/ml) with 0.5% SDS solution at 37ºC for 45

min. Soluble DNA was then isolated by

phenol-chloroform-isoamylalcohol extraction

and ethanol precipitation. DNA was collected

by centrifugation at 20000 g for 20 min,

dissolved in autoclaved water and resolved on

2% agarose-0.1 µg/ml ethidium bromide gels

in TBE buffer [80 mM Tris-borate (pH 8.0), 2

mM EDTA]. DNA fragments were visualized

under ultraviolet light and photographed using

a ChemiDoc System (Documentation and

Analysis System, Bio-Rad, USA).

Analysis of Nuclear DNA Content by Flow

Cytometry

The ploidy determination of

neuroblasts was estimated by flow cytometry

DNA analysis. After culture under the

indicated conditions, adherent cells were

detached from dishes by the addition of a

trypsin-EDTA solution. They were mixed with

non-adherent cells and washed twice in ice-

cold PBS without Ca2+ and Mg2+. Cells were

resuspended in ice-cold 70% ethanol and fixed

for 5 min. After centrifugation at 500 g for 5

min, cells were resuspended in PBS containing

1 mg/ml of RNAsa A and incubated at 37ºC

for 30 min. Cells were stained with 50 µg/ml

propidium iodide for 30 min at room

temperature and then flow cytometry analysis

was done. DNA content per nucleus was

evaluated in a CyAn MLE flow cytometer

(DAKO, Gostrup, Denmark). This analysis

was performed using a doublet discriminator

system, which distinguishes between the

signals coming from a single nucleus and the

ones produced by two or more aggregated

nuclei. For the computer analysis, only signals

from single cells were considered (10000

cells/sample). This method of analysis of DNA

content permits the identification and

quantification of apoptotic cells, as revealed by

peak localized below the G0/G1 peak

(Darzynkiewicz et al. 1992).

74

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Statistical analysis

Each experiment was repeated at least

three times, with good agreement among the

results of individual experiments. All data are

expressed as the mean ± standard error of the

mean. Results were analyzed by one-way

analysis of variance (ANOVA) followed by

Student´s t test. P values of less than 0.05 were

considered significant.

RESULTS

Effect of lovastatin on Ras activation

We have previously shown that

lovastatin induced apoptosis of neuroblasts in a

dose- and time-dependent manner and also that

the lovastatin effect was associated with an

inhibition of Ras prenylation evaluated by the

decrease of the level of Ras in the membrane

compartment (García-Román et al. 2001). This

post-translational prenylation step is required

both for membrane association and Ras

activation. Therefore, in the present work we

first studied whether the inhibition of Ras

prenylation by lovastatin was also associated

with a decrease in its biological activity. To

clarify this issue, time course and

concentration-dependent experiments were

done and Ras activation was analyzed by the

GST-RBD-Raf-1 pull-down method. Time

course experiments showed that in comparison

to the control cells grown in 10% FCS media,

lovastatin (10 µM) inhibited Ras activation in a

time dependent manner (Fig. 1A). The

lovastatin effect started to be significant after 3

hours of treatment and reached its maximum at

24 hours, the last time tested. Inhibition of Ras

activation occurred before induction of

apoptosis that started to be significant after 12

hours of lovastatin treatment (García-Román et

al. 2001). Additionally, neuroblasts were

treated with increasing concentrations of

lovastatin for 24 hours and as shown in Fig.

1B, Ras activation decreased in a

concentration-dependent manner after

lovastatin treatment. The effect of lovastatin

was evident at a concentration as low as 1 µM

reaching the maximum effect at a

concentration of 10 µM. In order to know

whether the lovastatin effect on Ras activation

was specific of HMG-CoA reductase

inhibition, cells were incubated with lovastatin

(10 µM) in presence or absence of mevalonate

(100 µM) for 24 h. Co-treatment with

mevalonate prevented the decrease in Ras

activation induced by lovastatin (Fig. 1C).

Treatment of cells with mevalonate alone did

not modify Ras activation. In all the

experiments, lovastatin decreased Ras

prenylation evaluated by the presence of the

unprocessed form of Ras (unprocessed Ras

migrates more slowly that its processed form

in SDS-PAGE). Taken together, these data

suggest that the decrease of Ras activation

induced by lovastatin may be due to a specific

failure of Ras prenylation.

75

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

Effect of lovastatin on ERK1/2

phosphorylation

C

B

0 10 2010

25

50

75

100

Lovastatin (µM)

ns

******

Ras

-GT

P(%

ofc

ontr

ol)

Ras-GTP →

A

Processed Ras →

Time (h)

Ras-GTP →

Ras

-GT

P(%

ofc

ontr

ol)

0 3 6 12 240

25

50

75

100

**

****

*

0

50

100

150

LovMev

--

++

-+

+-

***

ns ns

Ras

-GT

P(%

ofc

ontr

ol)

Ras-GTP →

Unprocessed Ras →

Processed Ras →Unprocessed Ras →

Processed Ras →Unprocessed Ras →

C

B

0 10 2010

25

50

75

100

Lovastatin (µM)

ns

******

Ras

-GT

P(%

ofc

ontr

ol)

Ras-GTP →

A

Processed Ras →

Time (h)

Ras-GTP →

Ras

-GT

P(%

ofc

ontr

ol)

0 3 6 12 240

25

50

75

100

**

****

*

0

50

100

150

LovMevLovMev

--

++

-+

+-

***

ns ns

Ras

-GT

P(%

ofc

ontr

ol)

Ras-GTP →

Unprocessed Ras →

Processed Ras →Unprocessed Ras →

Processed Ras →Unprocessed Ras →

The best characterized Ras effector is

the serine/threonine kinase Raf, which leads to

the activation of the ERK1/2 pathway

(Denhardt 1996; Repasky et al. 2004).

Therefore, we next studied the phosphorylation

state of these kinases after lovastatin treatment

by immunoblot analysis using phosphospecific

antibodies. As shown in Fig. 2, lovastatin

decreased ERK1/2 phosphorylation in a time-

and concentration-dependent manner (Fig. 2A

and Fig. 2B, respectively). Lovastatin (10 µM)

produced a decrease in ERK1/2

phosphorylation that was significant at 3 hours

and was maximum at 12 hours of treatment

(Fig. 2A). On the other hand, the lovastatin

effect on ERK1/2 phosphorylation was evident

at a concentration of 1 µM, but the decrease in

the phosphorylation of both kinases was only

significant at higher concentrations (10 µM

and 20 µM). Mevalonate (100 µM) prevented

the decrease in ERK1/2 phosphorylation

induced by lovastatin, indicating that the

lovastatin effect was specific (Fig. 2C).

Treatment of neuroblasts with mevalonate

alone did not affect ERK1/2 phosphorylation.

Expression levels of ERK1/2 remained

unchanged throughout the experiment (Fig. 2),

suggesting that ERK1/2 phosphorylation was

specifically affected by exposure to lovastatin.

It is noteworthy that the lovastatin effect on

ERK1/2 phosphorylation was less potent than

the effect on Ras activation. In fact, neuroblast

incubation with lovastatin 10 µM for 24 hours

reduced ERK1/2 phosphorylation by 45 % vs.

control cells while the same treatment inhibited

Ras activation by 90% vs. control.

Figure 1. Effect of lovastatin on Ras activation. A: Time-dependent effect: Neuroblasts initially cultured for 24 hours in Ham´s F12/10% FCS were incubated in culture media alone or with 10 µM lovastatin for different periods of time. B: Concentration-dependent effect: cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated for an additional 24 hours in the presence of media alone (0) or various concentrations of lovastatin. C: Effect of mevalonate treatment: Cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated with lovastatin (Lov 10 µM) in absence or presence of mevalonate (Mev 100 µM) for an additional 24 hours. Control cells were incubated in presence of media or mevalonate alone. At the end of each experiment, Ras activation was measured by GST-RBD pull-down followed by Western blot with anti-(pan)-Ras antibody. An aliquot of each lysate was also loaded in another gel to analyze total Ras protein levels. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.

76

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

Figure 2. Effect of lovastatin on ERK1/2 phosphorylation. A: Time-dependent effect. B: Concentration-dependent effect. C: Effect of mevalonate treatment. Neuroblasts were treated as described in Fig. 1. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using an anti-phospho-ERK1/2 specific antibody. As a control of the amount of protein, total ERK1/2 were also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; **, p<0.01; ***, p<0.001; compared to untreated cells.

Effect of lovastatin on CREB

phosphorylation and CREB-mediated gene

expression

It has been shown that one of the mechanisms

by which the Ras/ERK1/2 signalling pathway

promotes neuronal survival is by activating

p90rsk, which in turn phosphorylates the

transcription factor CREB at serine 133.

Activated CREB promotes cell survival, and

inhibition of CREB phosphorylation triggers

apoptosis. Therefore, we next evaluated the

effect of lovastatin on the phosphorylation

level of CREB. Treatment of neuroblasts with

10 µM lovastatin during different periods of

time led to a reduction in the phosphorylation

at Ser133 of CREB that was significant at 6

hours. The maximum effect was observed after

12 hours of treatment (Fig. 3A). As shown in

Fig. 3B, lovastatin treatment induced a

decrease in the phosphorylation of CREB in a

concentration-dependent manner with respect

to untreated control cells, but in these

experiments the maximum decrease in CREB

phosphorylation was detected at 20 µM

lovastatin. Co-treatment with mevalonate (100

µM) prevented the decrease in CREB

phosphorylation induced by lovastatin.

Treatment of cells with mevalonate alone did

not modify CREB phosphorylation (Fig. 3C).

Lovastatin treatment did not modify CREB

expression in any of the experimental

conditions (Fig. 3). To determinate whether the

decrease in CREB phosphorylation induced by

lovastatin was associated with an inhibition on

CREB-mediated gene expression we next

performed the luciferase reporter gene assay.

As shown in Fig. 4, the incubation of the CRE-

plasmid containing cells with 10 µM lovastatin

for 24 hour resulted in an inhibition in

luciferase expression.

A

P-ERK1P-ERK2

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

020406080

100

120

0 1 3 6 12 24

**

ns

****** ***

P-ERK1 →P-ERK2 →

ERK1 →ERK2 →

Time (h)

Lovastatin (µM)0 10 201

0

25

50

75

100

**

ns

*** ***

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

B

P-ERK1

P-ERK2

P-ERK1 →P-ERK2 →

ERK1 →ERK2 →

LovMev

--

++

-+

+-

0

25

50

75

100**

ns ns

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

CP-ERK1 →P-ERK2 →

ERK1 →ERK2 →

P-ERK1

P-ERK2

A

P-ERK1P-ERK2

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

020406080

100

120

0 1 3 6 12 24

**

ns

****** ***

P-ERK1 →P-ERK2 →

ERK1 →ERK2 →

A

P-ERK1P-ERK2

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

020406080

100

120

0 1 3 6 12 24

**

ns

****** ***

P-ERK1 →P-ERK2 →P-ERK1 →P-ERK2 →

ERK1 →ERK2 →ERK1 →ERK2 →

Time (h)

Lovastatin (µM)0 10 201

0

25

50

75

100

**

ns

*** ***

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

B

P-ERK1

P-ERK2

P-ERK1 →P-ERK2 →

ERK1 →ERK2 →

Time (h)

Lovastatin (µM)0 10 201

0

25

50

75

100

**

ns

*** ***

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

Lovastatin (µM)0 10 201

0

25

50

75

100

**

ns

*** ***

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

B

P-ERK1

P-ERK2

P-ERK1 →P-ERK2 →P-ERK1 →P-ERK2 →

ERK1 →ERK2 →ERK1 →ERK2 →

LovMev

--

++

-+

+-

0

25

50

75

100**

ns ns

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

CP-ERK1 →P-ERK2 →

ERK1 →ERK2 →

P-ERK1

P-ERK2

LovMevLovMev

--

++

-+

+-

0

25

50

75

100**

ns**

ns ns

ER

K P

hosp

hory

latio

n(%

ofc

ontr

ol)

CP-ERK1 →P-ERK2 →P-ERK1 →P-ERK2 →

ERK1 →ERK2 →ERK1 →ERK2 →

P-ERK1

P-ERK2

77

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

Figure 3. Effect of lovastatin on CREB phosphorylation. A: Time-dependent effect. B: Concentration-dependent effect. C: Effect of mevalonate treatment. Neuroblasts were treated as described in Fig. 1. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using an anti-phospho-CREB specific antibody. As a control of the amount of protein, total CREB was also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.

This effect was not observed in the cells

transfected with the plasmid control lacking

CREB binding sites (data not shown). Again,

co-treatment with mevalonate prevented the

effect of lovastatin and completely restored

CREB-mediated gene expression to control

levels. Taken together, these data suggest that

lovastatin not only decreases CREB

phosphorylation in neuroblasts but this action

also correlates with decreased CREB capacity

to activate transcription.

AC

RE

B P

hosp

hory

latio

n(%

ofc

ontr

ol)

0

20

40

60

80100

120

0 1 3 6 12 24Time (h)

**

ns

***

ns

*

P-CREB →

CREB →

B

ns

*

*

0 10 2010

25

50

75

100

Lovastatin (µM)

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

P-CREB →

CREB →

C

LovMev

--

++

-+

+-

ns

0

50

100

150

*

ns

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

P-CREB →

CREB →

AC

RE

B P

hosp

hory

latio

n(%

ofc

ontr

ol)

0

20

40

60

80100

120

0 1 3 6 12 24Time (h)

**

ns

***

ns

*

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

0

20

40

60

80100

120

0 1 3 6 12 24Time (h)

**

ns

***

ns

***

ns

***

ns

*

P-CREB →

CREB →

P-CREB →

CREB →

B

ns

*

*

0 10 2010

25

50

75

100

Lovastatin (µM)

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

P-CREB →

CREB →

ns

*

*

0 10 2010

25

50

75

100

Lovastatin (µM)

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

ns

*

*

0 10 2010

25

50

75

100

Lovastatin (µM)

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

P-CREB →

CREB →

P-CREB →

CREB →

C

LovMevLovMev

--

++

-+

+-

ns

0

50

100

150

*

ns

ns

0

50

100

150

*

ns

*

ns

CR

EB

Pho

spho

ryla

tion

(% o

fcon

trol

)

P-CREB →

CREB →

P-CREB →

CREB →

0

50

100

150

**

ns

ns

Luc

/Gal

(% o

fCon

trol

)

LovMev

--

+-

++

-+

0

50

100

150

**

ns

ns

Luc

/Gal

(% o

fCon

trol

)

LovMev

--

+-

++

-+

Figure 4. Effect of lovastatin on transcription from the CRE-response element. Neuroblasts initially cultured for 24 hours in Ham´s F12/10% FCS were co-transfected with pGL3-CRE-luciferase and pSV-β-Galactosidase reporter constructs. Following transfection, cells were incubated with lovastatin (Lov 10 µM) in absence or presence of mevalonate (Mev 100 µM) for 24 hours. Control cells were incubated in presence of media or mevalonate alone. Luciferase and β-Galactosidase activity were measured in the same extracts and the luciferase activity standardised for transfection efficiency by dividing the luciferase activity by β-Galactosidase activity. Results are expressed as the percentage relative to untreated cells. Each value represents the mean ±SE of four independent experiments performed in triplicate. ns, not significant; **, p<0.01; compared to untreated cells

Effect of MEK inhibitor PD98059 on

neuroblast survival in absence or presence

of lovastatin

Our results suggested that lovastatin

might induce neuroblast apoptosis by its

capacity to inhibit the Ras/ERK1/2 signalling

pathway. Therefore, we next studied whether

the pharmacological inhibition of this pathway

was able to induce neuroblast apoptosis.

Neuroblasts were incubated for 24 hours with

different concentrations of PD98059 that

inhibits MEK1/2, the MAP kinase kinase

responsible for ERK1/2 phosphorylation and

then the ability of this inhibitor to induce

apoptosis was assessed by three independent

78

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis assays, neuroblast viability, internucleosomal

DNA fragmentation and quantification of

neuroblasts undergoing apoptosis by flow

cytometry.

As shown in Fig 5, the treatment of neuroblasts

with PD98059 alone was associated with a

concentration-dependent decrease in cell

viability (Fig. 5A), the appearance of

internucleosomal DNA fragmentation (Fig.

5B) and an increase in the percentage of

apoptotic neuroblasts (Fig. 5C). It is

noteworthy that PD98059 effects were

minimal when compared with control samples

and never reached the parameters seen with

lovastatin treatment (Fig. 5). PD98059 20 µM

and 50 µM partially inhibited ERK1/2

phosphorylation in a concentration-dependent

manner (data not shown). These data suggest

that the inactivation of the Ras/ ERK1/2

pathway may be necessary but not sufficient to

evoke the lovastatin effect on neuroblast

apoptosis.

0

20

40

60

80

100

120

**

***

**

**

a

Lov 10µM

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

+--

-+

+

-

-+

+

--

+

-+PD 20µM

PD 50µM

A

Lov 10µM ---

+--

-+

+

-

-+

+

--

+

-+PD 20µM

PD 50µM

MW

B

0

10

20

30

40

50

Lov 10µM ---

+--

-+

+

-

-+

+

--

+

-+PD 20µM

PD 50µM

*****

***

***

b

b

Apo

ptos

is(%

oft

otal

cel

ls)

C

0

20

40

60

80

100

120

**

***

**

**

a

Lov 10µM

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

+--

-+

+

-

-+

+

--

+

-+PD 20µM

PD 50µM

A

Lov 10µM ---

---

+--

-+

+

-

-+

+

--

+

-+PD 20µM

PD 50µM

MW

B

0

10

20

30

40

50

Lov 10µM ---

---

+--

-+

+

-

-+-

-+

+

--+

--

+

-+PD 20µM

PD 50µM

*****

***

***

b

b

Apo

ptos

is(%

oft

otal

cel

ls)

C

It has been recently shown that the

inhibition of the Raf/ERK pathway sensitizes

cells to statins-induced apoptosis (Takata et al.

2004; Wu et al. 2004). To evaluate whether

direct inhibition of this pathway can increase

the efficacy of lovastatin to trigger neuroblast

apoptosis, cells were treated with lovastatin

(10 µM) alone or in combination with PD

98059 (20 µM and 50 µM) for 24 hours. In

these experiments, MEK inhibitor was added

to the cells 1 hour before lovastatin treatment.

As shown in Fig. 5, lovastatin effects were

enhanced by preteatment with PD98059 in a

concentration-dependent manner. As expected,

the down-regulation of ERK1/2

phosphorylation was also enhanced when

lovastatin and PD98059 were used together

(data not shown).

Figure 5. Effect of MEK inhibitor (PD98059) alone or in combination with lovastatin on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of PD98059 (PD 20 and 50 µM) in absence or presence of 10 µM lovastatin (Lov) for an additional 24 h. At the end of the experiment, cell viability was determined by the crystal violet method (A), internucleosomal DNA degradation was analyzed by using electrophoresis on 2% agarose gel (B) and the percentage of cells with hypodiploid DNA content was evaluated by flow cytometry (C). Each value represents the mean ±standard error of at least three independent experiments made in triplicate. *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells. a, p<0.01; b, p<0.05; compared to lovastatin-treated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.

79

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Effect of the inhibition of Ras/ ERK1/2 and

phosphoinositide 3-kinase/protein kinase B

(PI3K/PKB) pathways on neuroblast

survival

We have shown that Ras/ERK1/2 and

PI3K/PKB signalling pathways are down-

regulated by lovastatin in neuroblasts and that

the pharmacological inhibition of each of these

pathways was not sufficient to induce the

apoptosis degree elicited by lovastatin

(Cerezo-Guisado et al. 2005) and the present

work. Therefore, we next studied the effect of

co-incubation of PD98059 (MEK1/2 inhibitor)

and LY294002 (PI3K inhibitor) on neuroblast

survival and apoptosis. The treatment of

neuroblasts with PD98059 (20 and 50 µM) or

LY294002 (50 µM) alone during 24 h was

associated with a decrease in cell viability (Fig.

6A), the appearance of internucleosomal DNA

fragmentation (Fig. 6B) and a slight increase in

the percentage of cells in the apoptotic sub-G1

population (Fig. 6C) when compared with

control. However, the effects of both inhibitors

were additive on all the parameters studied

(Fig. 6) and only the concomitant use of both

inhibitors resembled the lovastatin efficacy in

inducing neuroblasts apoptosis (Fig. 5A,B,C).

LY294002 at this concentration range

efficiently decreased PI3K activation (Cerezo-

Guisado et al. 2005).

DISCUSSION

It is known that the mevalonate

pathway is essential to ensure normal growth,

differentiation and maintenance of neuronal

tissues (Maltese and Volpe 1979; Spady and

Dietschy 1983; Cavender et al. 1995). We

have recently shown that mevalonate pathway

inhibition by lovastatin induces apoptosis of

spontaneously immortalized rat brain

neuroblasts (García-Román et al. 2001).

A

PD 20µM0

20

40

60

80

100

120

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

*** ***ns a

B

MWPD 20µM ---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

C

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls)

PD 20µM ---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

***

*b

b

A

PD 20µM0

20

40

60

80

100

120

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

*** ***ns a

A

PD 20µM0

20

40

60

80

100

120

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

*** ***ns a

PD 20µM0

20

40

60

80

100

120

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

PD 20µM0

20

40

60

80

100

120

Cel

lVia

bilit

y(%

ofc

ontr

ol)

---

---

+--

+--

+-

-+-

-

+

+-+

+-

+

--+

--

-

++-

++PD 50µM

LY 50µM

*** ***ns a

B

MWPD 20µM ---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

B

MWPD 20µM ---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

MWPD 20µM ---

---

+--

+--

+-

-+-

-

+

+-+

+-

+

--+

--

-

++-

++PD 50µM

LY 50µM

C

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls)

PD 20µM ---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

C

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls)

PD 20µM ---

+--

+-

-

+

+-

+

--

-

++PD 50µM

LY 50µM

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls)

PD 20µM ---

---

+--

+--

+-

-+-

-

+

+-+

+-

+

--+

--

-

++-

++PD 50µM

LY 50µM

***

*b

b

Figure 6. Effect of the coincubation with MEK inhibitor (PD98059) and PI3K inhibitor (LY294002) on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of PD98059 (PD 20 and 50 µM) in absence or presence of 50 µM LY294002 (LY 50 µM) and with LY 50 µM alone for an additional 24 h. At the end of the experiment, cell viability (A), internucleosomal DNA degradation (B) and the percentage of cells with hypodiploid DNA content (C) were determined as described in Materials and Methods. Each value represents the mean ±standard error of at least three independent experiments made in triplicate. *, p<0.05; ***, p<0.001; compared to their respective PD-treated cells. ns, not significant; a, p<0.05; b, p<0.01; compared to LY-treated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.

80

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

In the present study, we investigated

the molecular mechanisms underlying

lovastatin-induced neuroblast apoptosis,

focusing our work on the involvement of the

Ras/ERK1/2/CREB signalling pathway.

In the present work, we have shown

for the first time that lovastatin significantly

decreased the activation of Ras stimulated by

serum in spontaneously immortalized rat brain

neuroblasts. The lovastatin effect on Ras

activation was time- and concentration

dependent and preceded neuroblast apoptosis

(García-Román et al. 2001). Our results are in

agreement with previous studies that show that

statins inhibit Ras prenylation and activation in

different non-neuronal cell types (Nakagawa et

al. 1998; Bassa et al. 1999; Hillyard et al.

2002; Miura et al. 2004) and strongly suggest

that lovastatin may induce neuroblast apoptosis

by its capacity to disrupt Ras-mediated signal

transduction in the cells.

Activation of Ras has been

demonstrated to initiate activation of Raf and

MEK1/2, resulting in ERK activation

(Denhardt 1996; Repasky et al. 2004). Since

the Ras-MEK-ERK signalling pathway plays a

key role in the transmission of cell survival

signals, the phosphorylation of ERK 1/2 after

lovastatin treatment was investigated. Our data

show that lovastatin treatment led to a time-

and concentration dependent decrease in the

phosphorylation of ERK1/2 in neuroblasts that

pointed to an inhibition of its kinase activity.

These results suggest that the decrease in the

phosphorylation of ERK1/2 may play a role in

the apoptotic induction by lovastatin.

Consistent with our findings, several reports

show that statin-induced apoptosis and/or

growth inhibition of various cell types

correlates with down-regulation of ERK

activity (Bassa et al. 1999; Hillyard et al.

2002; Johnson et al. 2002; Miura et al. 2004;

Wu et al. 2004; Nishida et al. 2005). In

contrast, another study reported that statin-

induced growth inhibition of rat RBL-2H3

cells did not involve down-regulation of ERK

activity (Graham et al. 1998). These

controversial findings may be attributed to

different biological actions of statins

depending on the cell type. We have also

shown that although the activation of Ras was

almost completely inhibited by lovastatin, the

serum-induced phosphorylation of the ERK1/2

was only partially inhibited in lovastatin-

treated cells compared with control. The

sustained phosphorylation of ERK1/2 in

lovastatin-treated neuroblasts may be due to

the activation of other upstream intracellular

signalling molecules, such as PKC or Rac

(Skaletz-Rorowski et al. 2001; Negre-Aminou

et al. 2002) which in turn produce the

activation of the MEK/ERK pathway.

It is accepted that ERK1/2 activation

promotes neuronal survival by its capacity to

activate p90rsk, which in turn phosphorylates

and activates CREB as well as increased

CREB-mediated gene expression (Bonni et al.

1999; Riccio et al. 1999). In the present work,

we have shown that the decrease in ERK1/2

phosphorylation/activity caused by lovastatin

is associated with a reduction of both CREB

phosphorylation and CREB-mediated gene

expression. The turn off Ras/ERK/CREB

signalling pathway has been related to

apoptosis induced by other stimuli (Bonni et

al. 1999; Rabelo et al. 2003; Hansen et al.

81

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis 2004) but, to our knowledge, this is the first

report that demonstrates that lovastatin inhibits

the activation of this survival signalling

pathway in neuronal cells. We have previously

shown that lovastatin decreased the expression

of Bcl-2 in neuroblasts undergoing apoptosis

(García-Román et al. 2001). As this pro-

survival gene is a target of CREB in neurons

(Bonni et al. 1999), our present data suggest

that lovastatin may induce neuroblast apoptosis

by decreasing the expression of Bcl-2 through

the inhibition of the Ras/ERK/CREB

signalling pathway. Our findings are in

agreement with several works that indicate that

CREB is essential for neuronal survival

(Walton and Dragunow 2000).

We have also shown that lovastatin

effects were completely prevented by

simultaneous exposure of cells to exogenous

mevalonate, demonstrating that the inhibition

of the Ras/ERK/CREB pathway induced by

lovastatin was specifically due to a blockade of

HMG-CoA reductase activity.

As said above, our results could

suggest that lovastatin may induce neuroblasts

apoptosis by its capacity to inhibit the

Ras/ERK/CREB pathway. Therefore, we

investigated whether the pharmacological

inhibition of this pathway was able to induce

apoptosis in neuroblasts. Our results show that

the MEK inhibitor alone was a poor inducer of

apoptosis in serum-treated neuroblasts.

However, PD98059 significantly increased

apoptosis induced by lovastatin treatment.

Taken together, these results suggest 1) that

lovastatin does not trigger neuroblast apoptosis

by down-regulating the Ras/ERK/CREB

signalling cascade alone, and 2) that the

sustained phosphorylation of ERK1/2 in

lovastatin-treated neuroblasts may play a

protective role (Hetman and Gozdz 2004). Our

findings are in agreement with other reports

where MEK inhibitors enhance the apoptotic

actions of statins and other drugs in different

non-neuronal cell types (Wu et al. 2004;

Rabelo et al. 2003; Brantley-Finley et al.

2003).

Finally, in the present work we have

shown that only the pharmacological inhibition

of both MEK and PI3K activities was able to

induce neuroblast apoptosis with the same

efficacy as lovastatin. These data suggest that

lovastatin may induce neuroblast apoptosis by

inducing the simultaneous inactivation of both

Ras/ERK1/2 and PI3K/PKB signalling

pathways. Whether neuroblast death induced

by lovastatin involves other intracellular

pathways is under study.

In conclusion, we have shown for the

first time that HMG-CoA reductase inhibition

by lovastatin leads to an inhibition of the

Ras/ERK/CREB signalling pathway in

spontaneously immortalized rat brain

neuroblasts which may contribute to

explaining its apoptotic effect. The lovastatin

effects were time- and concentration-

dependent and prevented by adding

mevalonate to the medium, which indicates

that they were due to an inhibition of

mevalonate synthesis. Our results also suggest

that Ras/ERK pathway inactivation appears

insufficient to induce the degree of apoptosis

evoked by lovastatin and that apoptosis of

neuroblasts induced by this statin could require

the simultaneous inhibition of both the

Ras/ERK and PI3K-PKB signalling pathways.

82

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

These findings could contribute to

elucidate the molecular mechanisms by which

statins induce growth suppression and/or

apoptosis in neuronal cells and may also help

to explain the CNS side effects associated with

statin therapy.

Brantley-Finley C., Lyle C.S., Du L., Goodwin M.E., Hall T., Szwedo D., Kaushal G.P. and Cambers T.C. (2003) The JNK, ERK and p53 pathways play distinct roles in apoptosis mediated by the antitumor agents vinblastine, doxorubicin, and etoposide. Biochem. Pharmacol. 66, 459-469. Cavender C.P., Turley S.D. and Dietschy J.M. (1995) Sterol metabolism in fetal, newborn and suckled lambs and their response to cholesterol after weaning. Am. J. Physiol. 269, E331-E340.

ACKNOWLEDGMENTS

The authors thank Ricardo Argent for

his excellent technical assistance. We also

thank Mary Harper for the preparation of the

manuscript. This work has been supported by

Grants, SAF 2001-0154 from the Ministerio de

Ciencia y Tecnologia, and 2PR01B007 from

the Junta de Extremadura. M. I. Cerezo-

Guisado is supported by a Ph D fellowship

from Junta de Extremadura, Spain.

Cerezo-Guisado M.I., García-Marín L.J., Lorenzo M.J. and Bragado M.J. (2005) Lovastatin inhibits the growth and survival pathway of phosphoinositide 3-kinase/protein kinase B in immortalized rat brain neuroblasts. J. Neurochem. 94, 1277-1287. Chong P.H., Seeger J.D. and Franklin C. (2001) Clinically relevant differences between the statins: implications for therapeutic selection. Am. J. Med. 111, 390–400.

REFERENCES Darzynkiewicz Z., Bruno S., Bino G.D., Gorczyca W., Hotz M.A., Lassota P. and Traganos F. (1992) Features of apoptotic cells measured by flow cytometry. Cytometry 13, 795-808.

Bassa B.V., Roh D.D., Vaziri N.D., Kirschenbaum M.A. and Kamanna V.S. (1999) Effect of inhibition of cholesterol synthetic pathway on the activation of Ras and MAP kinase in mesangial cells. Biochim. Biophys. Acta 1449, 137-149.

Denhardt D.T. (1996) Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex signalling. Biochem. J. 318, 729-747.

Blanco-Colio L.M., Villa A., Ortego M., Hernández-Presa M.A., Pascual A., Plaza J.J and Egido J. (2002) 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase inhibitors, atorvastatin and simvastatin, induce apoptosis of vascular smooth muscle cells by downregulation of Bcl-2 expression and Rho A prenylation. Atherosclerosis 161, 17-26.

Drysdale B.E., Zacharchuk C.M. and Shin H.S. (1983) Mechanism of macrophage-mediated cytotoxicity: production of a soluble cytotoxic factor. J. Immunol. 131, 2362-2367. Blumenthal R.S. (2000) Statins: effective

antiatherosclerotic therapy. Am. Heart J. 139, 577–83.

Edison R.J. and Muenke M. (2004a) Central nervous system and limb anomalies in case reports of first-trimester statin exposure. N. Engl. J. Med. 350, 1579-1582.

Bonni A., Brunet A., West A.E., Datta S.R., Takasu M.A. and Greenberg M.E. (1999) Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and independent mechanisms. Science 286, 1358-1362.

Edison R.J. and Muenke M. (2004b) Mechanistic and epidemiologic considerations in the evaluation of adverse birth outcomes following gestational

83

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis exposure to statins. Am. J. Med. Genet. 131A, 287-298. García-Román N., Álvarez A.M., Toro M.J., Montes A. and Lorenzo M.J. (2001) Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosíntesis inhibition. Mol. Cell. Neurosci. 17, 329-341. Goldstein J.L. and Brown M.S. (1990) Regulation of the mevalonate pathway. Nature 343, 425-429. Graaf M.R., Richel D.J., van Noorden C.J.F. and Guchelarr H.J. (2004) Effect of statins and farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat. Rev. 30, 609-641. Graham T.E., Pfeiffer J.R., Lee R.J., Kusewitt D.F., Martinez A.M., Faotz T., Wilson B.S. and Oliver J.M. (1998) MEK and ERK activation in ras-disabled RBL-2H3 mast cells and novel roles for geranylgeranylated and farnesylated proteins in Fc ecpsilonRI-mediated signaling. J. Immunol. 161, 6733-6744. Hansen H.H., Briem T., Dzietko. M., et al. (2004) Mechanisms leading to disseminated apoptosis following NMDA receptor blockade in the developing rat brain. Neurobiology of Disease 16, 440-453. Hetman M. and Gozdz A. (2004) Role of extracellular signal regulated kinases 1 and 2 in neuronal survival. Eur. J. Biochem. 271, 2050-2055. Hillyard D.Z., Cameron A.J., McIntyre A.H., Hadden N.H., Marshall C. E., Johnston N. and Jardine A.G. (2002) Inhibition of proliferation and signalling mechanisms in human lymphocytes by fluvastatin. Clin. Exp. Pharmacol. Physiol. 29, 673-678. Jaster R., Brock P., Sparmann G., Emmrich J. and Liebe S. (2003) Inhibition of pancreatic stellate cell activation by the hydroxymethylglutaryl coenzyme

A reductase inhibitor lovastatin. Biochem. Pharmacol. 65, 1295-1303. Johnson M.D., Woodard A., Okediji E.J., Toms S.A. and Allen G.S. (2002) Lovastatin is a potent inhibitor of meningioma cell proliferation: Evidence for inhibition of a mitogen associated protein kinase. J, Neurooncol, 56, 133-142. Kita T., Brown M.S. and Goldstein J.L. (1980) Feedback regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase in livers of mice treated with mevilonin, a competitive inhibitor of the reductase. J. Clin. Invest. 66, 1094-1100. Koyuturk M., Ersoz M. and Altiok N. (2004) Simvastatin induces proliferation inhibition and apoptosis in C6 glioma cells via c-jun N-terminal kinase. Neurosci. Lett. 370, 212-217. Maltese W.A. and Volpe J.J. (1979) Developmental changes in the distribution of 3-hydroxy-3-methylglutaryl coenzyme A reductase among subcellular fractions of rat brain. J. Neurochem. 33, 107-115. Michikawa M. and Yanagisawa K. (1999) Inhibition of cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death. J. Neurochem. 72, 2278-2285. Mitin N., Rossman K.L. and Der C.J. (2005) Signaling interplay in ras superfamily function. Curr. Biol. 15, R563-R574. Miura S., Matsuo Y. and Saku K. (2004) Simvastatin suppresses coronary artery endotelial tube formation by disrupting Ras/Raf/ERK signaling. Atherosclerosis 175, 235-243. Muñoz A., Wrighton C., Seliger B., Bernal J. and Beug H. (1993) Thyroid hormone receptor/c-erbA: Control of commitment and differentiation in the neuronal/chromaffin progenitor line PC12. J. Cell. Biol. 121, 423-438. Nakagawa H., Mutoh T., Kumano T. and Kuriyama M. (1998) HMG-CoA reductase inhibitor-induced

84

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

Skaletz-Rorowski A., Müller J.G., Kroke A., Waltenberger J., Pulawski E., Pinkernell K. and Breithardt G. (2001) Lovastatin blocks basis fibroblast growth factor-induced mitogen-activated protein kinase signalling in coronary smooth muscle cells via phosphatase inhibition. Eur. J. Cell. Biol. 80, 207-212.

L6 myoblast cell death: involvement of the phosphatidylinositol 3-kinase pathway. FEBS Lett. 438, 289-292. Negre-Aminou P., van Leeuwen R.E., van Thiel G.C., van den IJssel P., de Jong W.W., Quinland R. A. and Cohen L. H. (2002) Differential effect of simvastatin on activation of Rac(1) vs. activation of the heat shock protein 27-mediated pathway upon oxidative stress, in human smooth muscle cells. Biochem. Pharmacol. 64, 1483–1491.

Spady D.K. and Dietschy J.M. (1983) Sterol synthesis in vivo in 18 tissues of the squirrell monkey, guinea pig, rabbit, hamster and rat. J. Lipids Res. 24, 303-315. Nishida S., Matsuoka H., Tsubaki M., Tanimori Y.,

Yanae M., Fujii Y. and Iwaki M. (2005) Mevastatin induces apoptosis in HL60 cells dependently on decrease in phosphorylated ERK. Mol. Cell. Biochem. 269, 109-114.

Takata R., Fukasawa S., Hara T., Nakajima H., Yamashina A., Yanase N. and Nizuguchi J. (2004) Cerivastatin-induced apoptosis of human aortic smooth muscle cells through partial inhibition of basal activation of extracellular signal-regulated kinases. Cardiovasc. Pathol. 13, 41-48.

Padayatty S.J., Marcelli M., Shao T.C. and Cunningham G.R. (1997) Lovastatin-induced apoptosis in prostate stromal cells. J. Clin. Endocrinol. Metabol. 82, 1434-1439.

Tanaka T., Tatsuno I., Uchida D., Moroo I., Morio H., Nakamura S., Noguchi Y., Yasuda T., Kitagawa M., Saito Y. and Hirai A. (2000) Geranylgeranyl-pirophosphate, an isoprenoid of mevalonate cascade, is a critical compound for rat primary cultured cortical neurons to protect the cell death induced by 3-hydroxy-3-methylglutaryl-CoA reductase inhibition. J. Neurosci. 20, 2852-2859.

Rabelo F.L.A., Ropert C., Ramos M.G., Bonjardim C.A., Gazzinelli R.T. and Alvarez-Leite J.I. (2003) Inhibition of ERK1/2 and CREB phosphorylation by caspase-dependent mechanism enhances apoptosis in fibrosarcoma cell line treated with butyrate. Biochem. Biophys. Res. Comm. 303, 968-972.

Villalonga P., Lopez-Alcala C., Chiloeches A., Gil J., Marais R., Bachs O. and Agell N. (2002) Calmodulin prevents activation of Ras by PKC in 3T3 fibroblasts. J. Biol. Chem. 277, 37929-37935.

Repasky G.A., Chenette E.J. and Der C.J. (2004) Renewing the conspiracy theory debate: does Raf function alone to mediate Ras oncogenesis? Trends Cell. Biol. 14, 639-647.

Walton M.R. and Dragunow M. (2000) Is CREB a key to neuronal survival? Trends Neurosci. 23, 48-53.

Riccio A., Ahn S., Davenport C.M., Blendy J.A. and Ginty D.D. (1999) Mediation by CREB family transcription factor of NGF-dependent survival of sympathetic neurons. Science 286, 2358-2361.

Wu J., Wong W.W., Khosravi F., Minden M.D. and Penn L.Z. (2004) Blocking the Raf/MEK/ERK pathway sensitizes acute myelogenous leukaemia cells to lovastatin-induced apoptosis. Cancer Res. 64, 6461-6468.

Schulz J.G., Bosel J., Stoeckel M., Megow D., Dirnagl U. and Endres M. (2004) HMG-CoA reductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate synthesis. J. Neurochem. 89:24-32.

Xia Z., Dickens M., Raingeaud J., Davis R.J. and Greenberg M.E. (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326-1331.

85

Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis

86

Zhang F.L. and Casey P.J. (1996) Protein prenylation: molecular mechanisms and functional

consequences. Ann. Rev. Biochem. 65, 241-269.

CCaappííttuulloo 33

“C-Jun N-terminal protein kinase signalling pathway mediates lovastatin-induced rat brain

neuroblasts apoptosis”

Submitted JNKs activation in lovastatin-induced neuronal apoptosis C-JUN N-TERMINAL PROTEIN KINASE SIGNALLING PATHWAY MEDIATES

LOVASTATIN-INDUCED RAT BRAIN NEUROBLASTS APOPTOSIS

Maria Isabel Cerezo-Guisadoa, Alberto Álvarez-Barrientosb, Ricardo Argenta, Luis Jesús García-

Marínc, Maria Julia Bragadoa, Maria Jesús Lorenzo*a

a Departamento de Bioquímica, Biología Molecular y Genética and c Departamento de Fisiología, Universidad de

Extremadura, Facultad de Veterinaria, E-10071 Cáceres. b Unidad de Citometría, Centro Nacional de

Investigaciones Cardiovasculares, E-28029 Madrid. Spain.

ABSTRACT

We have previously shown that

lovastatin, an HMG-CoA reductase inhibitor,

induces apoptosis in rat brain neuroblasts. C-

Jun N-terminal kinase (JNK) and p38 mitogen-

activated protein kinase (MAPK) are

implicated in regulation of neuronal apoptosis.

In this work, we investigated the role of JNK

and p38 MAPK in neuroblast apoptosis

induced by lovastatin. We showed that

lovastatin induced the activation of JNK, but

not p38 MAPK. It also induced c-Jun

phosphorylation with a subsequent increase in

activator protein-1 (AP-1) binding, AP-1-

mediated gene expression and BimEL protein

levels. The effects of lovastatin were prevented

by mevalonate. Pre-treatment with iJNK-I (a

selective JNK inhibitor) prevented the effect of

lovastatin on both neuroblast apoptosis and the

activation of the JNK cascade. Furthermore,

we found that activation of JNK signalling

pathway triggered by lovastatin is

accompanied by caspase-3 activation which is

also inhibited by iJNK-I pre-treatment. Finally,

a specific inhibitor of p38 MAPK, SB203580,

had no effect on lovastatin-induced neuroblast

apoptosis. Taken together, our data suggest

that the activation of the JNK/c-Jun/BimEL

signalling pathway plays a crucial role in

lovastatin-induced neuroblast apoptosis. Our

findings may also contribute to elucidate the

intracellular mechanisms involved in the

central nervous system side effects associated

to statin therapy.

KEYWORDS: Apoptosis, statins, nervous

system, JNK, p38 MAPK, Bim

87

Submitted JNKs activation in lovastatin-induced neuronal apoptosis INTRODUCTION

A large body of evidence indicates that

the mevalonate pathway plays an important

role in cell growth [1, 2]. Mevalonate is

intracellularly synthesized from 3-hydroxy-3-

methylglutaryl coenzyme A (HMG-CoA), and

this process is catalyzed by HMG-CoA

reductase, the rate-limiting enzyme in this

pathway [2]. Mevalonate metabolism yields a

series of isoprenoid compounds which are

incorporated into cholesterol, isopentenyl

adenine, prenylated proteins, and other end-

products essential for cell growth and survival

[2, 3]. Competitive inhibitors of HMG-CoA

reductase (statins), such as lovastatin,

simvastatin, atorvastatin, cerivastatin,

pravastatin and fluvastatin, not only block the

biosynthesis of mevalonate but, in addition,

inhibit the proliferation and induce apoptosis

of both normal and tumour cells [4-12].

HMG-CoA reductase activity [13] and

cholesterol biosynthesis [14, 15] are very high

in the early phase of the ontogenetic

development of the brain. These data indicate

that the mevalonate pathway is essential to

ensure normal growth, differentiation and

maintenance of neuronal tissues. In agreement

with this, recent reports show that the

inhibition of this biosynthetic pathway during

gestation by statin exposures are associated

with severe central nervous system (CNS)

defects [16, 17]. On the other hand, studies in

vitro show that statins have neurotoxic effects

on primary neuronal cultures of cerebral cortex

[18-20]. Moreover, we have also shown that

lovastatin induces apoptosis of immortalized

rat brain neuroblasts [21].

Apoptosis plays an important role

during neuronal development and in the

homeostasis of the adult nervous system [22,

23]. However, abnormal neuronal apoptosis

contributes to the onset and progression of

several neurodegenerative diseases [24].

Consequently, elucidation of molecular

mechanisms that regulate neuronal apoptosis is

important in order to develop drugs to prevent

and treat these disorders. Several studies have

implicated the stress-activated protein kinase

c-Jun N-terminal protein kinase (JNK) and p38

mitogen activated protein kinase (MAPK)

pathways as key regulators of neuronal

apoptosis [25, 26]. Experiments with cerebellar

granule neurons, pheochromocytoma 12

(PC12) cells and sympathetic neurons cultured

in vitro, have demonstrated that activation of

JNK or p38 MAPK can promote apoptosis

following survival-factor withdrawal [27-30]

and, ceramide [31], glutamate [30],

anandamide [32], cadmium [33] and arsenite

[34] exposure. Nevertheless, other studies fail

to implicate these kinases in neuronal

apoptosis [35-37] and demonstrate that JNK

and p38 MAPK are implicated in promoting

neuronal survival [38] and differentiation [39,

40].

c-Jun, a well-known downstream

target of activated JNK and one of substrates

of p38 MAPK, has been also implicated in

neuronal apoptosis [41]. c-Jun phosphorylation

is necessary for apoptosis induced by survival

signal withdrawal and potassium deprivation in

cerebellar granule neurons, sympathetic

neurons and PC12 cells [42-44]. c-Jun

activation is also implicated in neuronal

apoptosis induced by several insults [9, 28, 30,

88

Submitted JNKs activation in lovastatin-induced neuronal apoptosis 31, 33, 34, 41]. c-Jun is a part of the larger AP-

1 transcription factor family which mediates an

immediate-early gene response following

cellular exposure to external stimuli [41]. AP-1

is also involved in the increased expression of

pro-apoptotic proteins, such as Bax, Fas-L and

Bim [28, 45]. Thus, c-Jun appears to

participate in both internal and external

apoptotic pathways. Bim is a member of the

BH3-only Bcl-2 family that plays an important

role in neuronal apoptosis. Developmentally

regulated neuronal apoptosis is delayed in mice

in which the Bim gene is disrupted, suggesting

a critical role for Bim in neuronal cell death.

Moreover, it has been shown that the apoptotic

stimuli of growth factor and neuronal activity

withdrawal induce Bim transcription in

sympathetic and cerebellar granule neurons, in

part through the JNK-mediated

phosphorylation and activation of c-Jun. The

activation of Bim seems to depend on cell type

neurons [45-46].

Statins are widely used in the treatment

of hypercholesterolemia. As it has been

previously mentioned, antiproliferative and

apoptotic effects of statins have been observed

in several experimental systems [4-12, 18-21].

These pleiotropic effects of statins are thought

to be mediated by their ability to block the

biosynthesis of isoprenoids intermediates of

cholesterol pathway, such as farnesyl

pyrophosphate and/or geranylgeranyl

pyrophosphate which serve as lipid

attachments for the small GTP-binding

proteins Ras, Rho and Rac [2]. This post-

translational prenylation step (either

farnesylation or geranylgeranylation) is

required both for membrane association and

cell signalling, leading to cell survival and

proliferation [2, 47]. Although recent studies

have shown that statins inhibit both small

GTP-binding protein prenylation and

activation in different neuronal cells [19-21],

the molecular mechanisms by which statins

induce neuronal apoptosis are not well

understood. The aim of the present work was

to investigate the role of both the JNK and p38

MAPK signalling pathways in mediating

lovastatin-induced neuronal apoptosis. A

spontaneously immortalized rat brain

neuroblast cell line was used in this study.

Here we report that lovastatin induces

neuroblast apoptosis through activation of the

JNK/c-Jun/Bim signalling pathway.

EXPERIMENTAL PROCEDURES

Reagents and antibodies

Lovastatin (Mevinolin, MK-803) was

from Calbiochem (San Diego, CA, USA). The

inactive lactone of lovastatin was converted to

the active form as previously described [48].

Mevalonic acid was purchased from Sigma-

Aldrich, (St. Louis, MO, USA). Ham’s F-12

medium, fetal calf serum, L-glutamine,

streptomycin, penicillin and trypsin/EDTA

solution were from PAN Biotech (Aidenbach,

Germany, Europe). Tissue culture flasks and

dishes were from TPP (Trasadingen,

Switzerland, Europe). JNK inhibitors

(SP600125 and JNK inhibitor I), and p38

MAPK inhibitor (SB203580), were from

Calbiochem (San Diego, CA, USA). p38

MAPK inhibitor (BIRB796) was kindly

provided by Dr. Ana Cuenda (Departamento

de Bioquimica y Biologia Molecular,

Universidad de Extremadura, Caceres, Spain).

89

Submitted JNKs activation in lovastatin-induced neuronal apoptosis Complete protease inhibitor cocktail tablets

were from Roche Molecular Biochemicals

(Indianapolis, IN, USA). Glutathione-

Sepharose 4B was from Pharmacia (Freiburg,

Germany). p38 MAPK (sc-535) antibody was

from Santa Cruz Biotechnology (Santa Cruz,

CA, USA) and phospho-p38 MAPK (Thr

180/Tyr 182) was kindly provided by Dr. Ana

Cuenda. c-Jun antibody (610326) was from

BD Biosciences Pharmigen (San Diego, CA,

USA) and phospho-c-Jun (Ser 63, 06-828)

antibody was from Upstate Biotechnology

(Lake Placid, NY, USA). SAPK/JNK (9252)

and active form caspase 3 (9665) antibodies

were from Cell Signaling Technology

(Beverly, MA, USA). BimEL (202000)

antibody was from Calbiochem (San Diego,

CA, USA). Glyceraldehyde 3-phosphate

dehydrogenase (GAPDH, RDI-TRK5G4-6C5;

Fitzgerald Inc.; Concord, MA, US ) antibody

was used to verify the equal loading of protein

across lanes. Goat anti-rabbit (31460) and goat

anti-mouse (31430) conjugated to horseradish

peroxidase were from Pierce (Rockford, IL,

USA). Other reagents were obtained from

different commercial sources and were of the

highest purity available.

Cell cultures and treatments

Spontaneously immortalized rat brain

neuroblasts were used in this study. This cell

line was obtained by spontaneous

immortalization from cultures of 17-day fetal

rat cerebral cortices and was kindly provided

by Dr. Alberto Muñoz (Instituto de

Investigaciones Biomédicas, CSIC, Madrid,

Spain). The cells represented primitive

neuroblasts that expressed NF 68 and the

primitive neuronal marker nestin, but lacked

the astrocyte marker, glial fibrillary acidic

protein (GFAP). After partial differentiation

induction with dibutyryl –cAMP, the cells

expressed further neuronal markers such as NF

145, NF 220, and neuron-specific enolase [49].

Cells were grown in Ham’s F-12 supplemented

with 10% fetal calf serum (FCS), L-glutamine

(2 mM), streptomycin (100 µg/ml) and

penicillin (100 U/ml). Cells were seeded at 5 x

105 in 75-cm2 tissue culture flask and

incubated at 37ºC under a 5% CO2/95% air

atmosphere.

Confluent cells were trypsinized and

seeded in tissue culture dishes at a density of 2

x 104 cells/cm2. After 24 h, the medium was

aspirated and replaced with fresh medium

alone or containing the indicated

concentrations of lovastatin, mevalonate,

SP600125, JNK inhibitor I (iJNK-I),

SB203580 or BIRB796 and the incubation was

continued for a further 6 h or 24 h. Cells were

incubated with JNK and p38 MAPK inhibitors

for 1h before lovastatin addition. For the time

course experiments, cells were incubated with

10 µM lovastatin for different periods of time.

JNK kinase activity assay

To assay for total JNK activity (JNK1-

3), a JNK capture assay was performed.

Glutathione-S-transferase (GST)-c-Jun (1-79)

was used as substrate. Neuroblasts were seeded

in 100 mm tissue culture dishes and after

indicated treatments, cells were harvested in

phosphate-buffered saline (PBS) and lysed for

15 min in ice-cold lysis buffer containing 20

mM Tris-HCl, pH 7.5, 150 mM KCl, 1 mM

EDTA, 10% (v/v) glycerol, 1% (v/v) Triton X-

90

Submitted JNKs activation in lovastatin-induced neuronal apoptosis 100, 500 µM Na3VO4, 5 mM NaF and 4 µg/ml

complete protease inhibitor cocktail. Lysates

were cleared by centrifugation at 20000 g for

15 min at 4 ºC and protein concentrations in

the supernatants were determined by using the

Bio-Rad protein assay, according to the

instructions of the manufacturer. Cell extract

proteins (200 µg) were incubated with GST-c-

Jun (1-79), previously immobilized on

Glutathione-Sepharose 4B beads, for 1 h at 4

ºC. After centrifugation at 20000 g for 1 min at

4ºC, beads were washed four times in washing

buffer (20 mM Tris-HCl pH 7.5, 50 mM NaCl,

2,5 mM MgCl2, 0,1 mM EGTA, 0.05% (v/v)

Triton X-100, 0.1% (v/v) 2-mercaptoethanol

and 1 mM Na3VO4) and once in the reaction

buffer (25 mM Tris-HCl pH 7.5, 20 mM ß-

glycerophosphate, 10 mM MgCl2, 0,1 mM

EGTA, 0,5 mM NaF and 1 mM Na3VO4).

Precipitates were incubated with 5 µCi of [γ-32P] ATP in the reaction buffer for 20 min at

30 ºC. The kinase reaction was terminated by

the addition of Laemmli sample buffer. In

some experiments, iJNK-I was added 20 min

prior to the start of reaction. Phosphorylated

[32P] GST-c-Jun (1-79) was detected by

autoradiography after it was resolved on 10 %

SDS-PAGE gels.

Western blot analysis

Treated and control cells were

harvested in PBS and lysed for 15 min in ice-

cold lysis buffer containing 50 mM HEPES

(pH 7.5), 150 mM NaCl, 1% Triton X-100,

10% glycerol, 5 mM MgCl2, 25 mM NaF, 10

mM sodium pyrophosphate, 1 mM EGTA,

500µM Na3VO4 and 4 µg/ml complete

protease inhibitor cocktail. After lysis, cell

debris was removed by centrifugation at 20000

g for 10 min at 4 ºC and protein concentrations

determined in the supernatants as indicated

above. Equal amounts of protein (20 µg) were

separated on 10 % SDS-PAGE and blotted

onto PVDF membranes (PolyScreen, NEN life

Science Products, Inc. Boston, MA, USA). The

membranes were then blocked with 5% non-fat

dry milk or 3 % BSA in Tris-buffered saline

(pH 7.5) containing 0.5% tween 20 and

incubated with appropriate primary and

horseradish peroxidase (HRP)-conjugated

secondary antibodies in antibody buffer [5%

non-fat dry milk or 3 % BSA in Tris-buffered

saline (pH 7.5) containing 0.05% tween 20

(TBS-T)]. After required washes with TBS-T,

proteins were analyzed using an enhanced

chemiluminescence detection system

(SuperSignal West Pico Chemiluminescent

Substrate, Supersignal West Dura Extended

Duration Substrate or Supersignal West Femto

Maximum Sensitivity Substrate, Pierce,

Rockford, IL, USA) and exposed to hyperfilm-

ECL (Amersham, Pharmacia Biotech,

Freiburg, Germany). Films were photographed

and the intensity of each band was analyzed

using a ChemiDoc System (Documentation

and Analysis System, Bio-Rad, Hercules, CA,

USA). Results were expressed as percentage of

control.

Electrophoretic mobility shift assay (EMSA)

Nuclear extracts were prepared using

the MBLTM “Nuclear/Cytosol Fractionation”

Kit (Woburn, MA, USA) according to

manufacturer's instructions. Double-stranded

oligonucleotide containing consensus

sequences for AP-1 (5'-

91

Submitted JNKs activation in lovastatin-induced neuronal apoptosis tgcaCGCTTGATGACTCAGCCGGAA-3´)

were labelled by using Klenow polymerase and

[α32P]dCTP. Nuclear extracts containing 10 µg

protein were incubated with 1 µg of

poly(dIdC)-poly(dIdC) and labelled

oligonucleotides (200000 cpm) in reaction

buffer [20 mM HEPES p.H 8, 1 mM EDTA,

50 mM NaCl, 1 mM DTT, 1% glycerol and

1mM MgCl2] for 20 min at room temperature.

For competition studies and supershift test,

nuclear extracts were preincubated with a 100-

fold excess of both unlabelled AP-1 or NFκB

probe (5´-

tcgaAGTTGAGGGGACTTTCCCAGGC-3´),

or 1 µg of c-Jun, c-Fos and CREB antibodies

for 10 min at room temperature prior to

addition of labelled probe. Samples were

electrophoresed on a non-denaturin 6%

polyacrylamide gel. Gels were fixed, vacuum

dried and exposed to x-ray film.

Luciferase reporter construct and assay

The control β-galactosidase construct

was pSV- β-Galactosidase (Promega). To

construct the AP-1 and SRE response elements

luciferase reporter, the SV40 promoter in the

vector pGL3-promoter (Promega) was excised

with BglII and Hind III and replaced by a

minimal HSV TK promoter (obtained by PCR

amplification) containing nucleotides – 109 to

+ 17 flanked by BglII and Hind III sites. A

double stranded oligonucleotide containing the

AP-1 response element from the somatostatin

promoter (GTGACATCAT) and the serum

response element (SRE) from the c-Fos

promoter

(AGGATGTCCATATTAGGACATC) flanked

by Asp718 and BglII sites was then cloned into

these vectors (pGL3-AP-1 and pGL3-SRE).

Neuroblasts were co-transfected with 1 µg of

pGL3-AP-1 or 1 µg of pGL3-SRE and 1 µg of

β-Galactosidase reporter vector using

GenePORTER transfection reagent (Genlantis,

San Diego, CA, USA), as recommended by the

manufacturer. Following transfection the cells

were incubated for 24 h, the medium was

exchanged, and the cells were incubated for an

additional 24 h with 10 µM lovastatin in the

presence or absence of 100 µM mevalonate.

The cells were then lysed and luciferase and β-

galactosidase assays performed using Promega

reagents as recommended by the manufacturer.

Luciferase activity was normalized to β-

galactosidase activity. Results were expressed

as percentage of control.

Cell and Nuclei Morphology Analysis

Cell and nuclei morphology was study

using Axiovert 200 fluorescence microscope

(Carl Zeiss, Jena), equipped with Axioscam

HRc CCD (Zeiss). After treatment, cells were

washed in PBS and fixed in 70% ethanol for 5

min at room temperature. After washing the

cells with PBS, they were incubate in PBS

containing 1 mg/ml of RNase A for 15 min at

37ºC and stained with 50 µM propidium iodide

(PI) for 30 min at room temperature. Images

were acquired using transmitted light and

green excitation filter and fluorescence

emissions were detected through 590 nm LP

filter. Images were acquired using Axiovision

4.3 (Zeiss). Image analysis software (Laserpix,

Bio-Rad) was used to count total and apoptotic

nuclei by thresholding on 8 bits grey-scale

images. Apoptotic nuclei characterizes by their

92

Submitted JNKs activation in lovastatin-induced neuronal apoptosis higher PI fluorescence due to higher chromatin

condensation, therefore different thresholding

were used to count apoptotic nuclei. Data are

mean from 3 different experiments.

Cell viability assay

Cell viability was evaluated by the

crystal violet method. For these experiments

35 mm tissue culture dishes were used. At the

end of each treatment, the medium was

discarded, and the remaining viable adherent

cells were stained with crystal violet (0.03% in

2% ethanol) for 5 min. Dishes were rinsed with

tap water and 1 ml of 1% sodium dodecyl

sulfate was added to each plate to solubilize

the stained cells. The absorbance of each plate

was read at 560 nm. Dishes without cells were

processed in parallel to correct the nonspecific

adhesion of crystal violet to the plastic. Viable

cells were calculated as percentage of

absorbance with respect to untreated cells.

DNA Fragmentation Assay

Neuroblasts were plated on 100 mm

culture dishes. After indicated treatments,

floating cells were harvested by centrifugation

at 20000 g for 1 min and adherent cells were

detached mechanically with a rubber

policeman. Adherent and floating cells were

mixed, washed twice in ice-cold PBS and lysed

in lysis buffer [10 mM Tris (pH 7.4), 5 mM

EDTA and 0.5 % Triton X-100) for 60 min at

4ºC with agitation. After centrifugation at

20000 g for 30 min at 4ºC, supernatants were

incubated with RNase A (0.1 mg/ml) at 37ºC

for 45 min and then with Proteinase K (0.2

mg/ml) with 0.5% SDS solution at 37ºC for 45

min. Soluble DNA was then isolated by

phenol-chloroform-isoamylalcohol extraction

and ethanol precipitation. DNA was collected

by centrifugation at 20000 g for 20 min,

dissolved in autoclaved water and resolved on

2% agarose-0.1 µg/ml ethidium bromide gels

in TBE buffer [80 mM Tris-borate (pH 8.0), 2

mM EDTA]. DNA fragments were visualized

under ultraviolet light and photographed using

a ChemiDoc System (Documentation and

Analysis System, Bio-Rad, USA).

Analysis of Nuclear DNA Content by Flow

Cytometry

The ploidy determination of

neuroblasts was estimated by flow cytometry

DNA analysis. For these experiments 100 mm

tissue culture dishes were used. After culture

under the indicated conditions, adherent cells

were detached from dishes by the addition of a

trypsin-EDTA solution. They were mixed with

non-adherent cells and washed twice in ice-

cold PBS without Ca2+ and Mg2+. Cells were

resuspended in ice-cold 70% ethanol and fixed

for 5 min. After centrifugation at 500 g for 5

min, cells were resuspended in PBS containing

1 mg/ml of RNAsa A and incubated at 37ºC

for 30 min. Cells were stained with 50 µg/ml

propidium iodide for 30 min at room

temperature and then flow cytometry analysis

was done. DNA content per nucleus was

evaluated in a CyAn MLE flow cytometer

(DAKO, Gostrup, Denmark). This analysis

was performed using a doublet discriminator

system, which distinguishes between the

signals coming from a single nucleus and the

ones produced by two or more aggregated

nuclei. For the computer analysis, only signals

from single cells were considered (10000

93

Submitted JNKs activation in lovastatin-induced neuronal apoptosis cells/sample). This method of analysis of DNA

content permits the identification and

quantification of apoptotic cells, as revealed by

peak localized below the G0/G1 peak.

Statistical analysis

Each experiment was repeated at least

three times, with good agreement among the

results of individual experiments. All data are

expressed as the mean ± standard error of the

mean. Results were analyzed by one-way

analysis of variance (ANOVA) followed by

Student´s t test. P values of less than 0.05 were

considered significant.

RESULTS

Lovastatin activates JNK but not p38

MAPK in rat brain neuroblasts

We have previously shown that

lovastatin induced apoptosis of rat brain

neuroblasts in a dose- and time-dependent

manner [21]. It is well known that JNK and

p38 MAPK are involved in neuronal apoptosis

triggered by a variety of stimuli and

withdrawal of growth factors [25-34].

Therefore, in the present work we first studied

whether changes in the activity of these

kinases contributed to lovastatin-induced

apoptosis in rat brain neuroblasts. To clarify

this issue, time course and concentration-

dependent experiments were done and JNK

activation was analyzed by a capture assay

using GST-c-Jun (1-79) as substrate. The

activity of p38 MAPK was studied by Western

blotting using antibodies that specifically

recognize the dually phosphorylated

(Thr180/Tyr182) catalytically active form of

this kinase.

GST-c-Jun→

JNK-1→

P-GST-c-Jun→

GST-c-Jun→

JNK-1→

P-GST-c-Jun→

0

100

200

300

LovMev

--

++

-+

+-

JNK

act

ivity

(% o

fcon

trol

) **

ns ns

GST-c-Jun→

JNK-1→

P-GST-c-Jun→

0

100

200

300

400

0 10 201Lovastatin (µM)

JNK

act

ivity

(% o

fcon

trol

)

**

**

ns

0

250

500

750

1000

0 1 3 6 12 24Time (h)

JNK

act

ivity

(% o

fcon

trol

)

****

*

*

*

A

B

C

GST-c-Jun→

JNK-1→

P-GST-c-Jun→

GST-c-Jun→

JNK-1→JNK-1→

P-GST-c-Jun→

0

100

200

300

LovMev

--

++

-+

+-

JNK

act

ivity

(% o

fcon

trol

)

0

100

200

300

LovMev

--

++

-+

+-

0

100

200

300

LovMevLovMev

--

++

-+

+-

JNK

act

ivity

(% o

fcon

trol

) **

ns ns

GST-c-Jun→

JNK-1→

P-GST-c-Jun→

0

100

200

300

400

0 10 201Lovastatin (µM)

JNK

act

ivity

(% o

fcon

trol

)

**

**

ns

0

250

500

750

1000

0 1 3 6 12 24Time (h)

JNK

act

ivity

(% o

fcon

trol

)

****

*

*

*

0

250

500

750

1000

0 1 3 6 12 24Time (h)

JNK

act

ivity

(% o

fcon

trol

)

0

250

500

750

1000

0 1 3 6 12 24Time (h)

JNK

act

ivity

(% o

fcon

trol

)

****

*

*

*

A

B

C

Figure 1. Effect of lovastatin on JNK activation. A: Time-dependent effect: Neuroblasts initially cultured for 24 hours in Ham´s F12/10% FCS were incubated in culture media alone or with 10 µM lovastatin for different periods of time. B: Concentration-dependent effect: cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated for an additional 24 hours in the presence of media alone (0) or various concentrations of lovastatin. C: Effect of mevalonate treatment: Cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated with lovastatin (Lov 10 µM) in absence or presence of mevalonate (Mev 100 µM) for an additional 24

94

Submitted JNKs activation in lovastatin-induced neuronal apoptosis hours. Control cells were incubated in presence of media or mevalonate alone. At the end of each experiment, JNK activation was measured by a JNK capture assay using GST-c-Jun (1-79) as substrate. An aliquot of each lysate was also loaded in another gel to analyze total JNK protein levels. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; compared to untreated cells.

Time course experiments showed that in

comparison to the control cells grown in 10%

FCS media, lovastatin (10 µM) increased JNK

activation in a time dependent manner (Fig.

1A). The lovastatin effect started to be

significant after 1 hour of treatment and was

markedly elevated 24 hours after lovastatin

treatment. JNK activation occurred before

induction of apoptosis that started to be

significant after 12 hours of lovastatin

treatment [21]. Additionally, neuroblasts were

treated with increasing concentrations of

lovastatin for 24 hours and as shown in Fig.

1B, JNK activation increased in a

concentration-dependent manner after

lovastatin treatment, reaching the maximum

effect at a concentration of 10 µM. In order to

know whether the lovastatin effect on JNK

activation was specific of HMG-CoA

reductase inhibition, cells were incubated with

lovastatin (10 µM) in presence or absence of

mevalonate (100 µM) for 24 h. Co-treatment

with mevalonate prevented the incresed in JNK

activation induced by lovastatin (Fig. 1C).

Treatment of cells with mevalonate alone did

not modify JNK activation. Levels of both

GST-c-Jun (1-79) and JNK-1 proteins did not

change throughout the experiments (Fig. 1),

suggesting that JNK activation was specifically

affected by lovastatin exposure. In contrast,

despite de high level of p38 MAPK

phosphorylation detected in control conditions,

treatment with lovastatin did not modulate the

levels of phosphorylation of this kinase in rat

brain neuroblasts at any time tested (Fig. 2).

Ours results suggest that the JNK, but

not the p38 MAPK, signalling pathway was

activated in neuroblasts after lovastatin

treatment and that activated JNK may be

related to the molecular machinery preceding

neuroblast apoptosis induced by lovastatin.

igure 2. Effect of lovastatin on p38 MAPK phosphorylation. euroblasts initially cultured for 24 hours in Ham´s F12/10%

ovastatin increases c-Jun phosphorylation,

scription

factor

course experiments (Fig. 3A) showed that

P-p38 MAPK→

p38 MAPK→

0 1 3 6 12 24Time (h)

P-p38 MAPK→

p38 MAPK→

0 1 3 6 12 24Time (h)

FNFCS were incubated in culture media alone or with 10 µM lovastatin for different periods of time. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using an anti-phospho-p38 MAPK specific antibody. As a control of the amount of protein, total p38 MAPK were also analyzed in the same samples. A representative blot is shown.

L

AP-1 activation and AP-1-mediated gene

expression in rat brain neuroblasts

c-Jun is an inducible tran

whose activity is modulated by

phosphorylation at the trans-activation domain

by JNK. Phosphorylation of c-Jun results in its

stabilization, as well as its enhanced DNA

binding and transcriptional activation.

Activation of c-Jun regulates transcription of

several genes involved in apoptosis [41-44].

Therefore, we next examined both the

phosphorylation and protein levels of c-Jun by

Western blot using anti-phospho-(Ser-63) c-

Jun and c-Jun antibodies, respectively. Time

95

Submitted JNKs activation in lovastatin-induced neuronal apoptosis

Figure 3. Effect of lovastatin on both c-Jun phosphorylation and protein levels. A: Time-dependent effect. B: Concentration-

P-c-Junc-Jun

0 1 3 6 12 24Time (h)

0

50

100

150

200** **

***

ns

***

**

**

ns

*

c-Jun→

GAPDH→

0

250

500

750

1000

Lovastatin (µM)0 10 201

P-c-Junc-Jun

Arb

itrar

yU

nits

(% o

fcon

trol

)

**

*

**

*** *

P-c-Jun→

c-Jun→

GAPDH→

Arb

itrar

yU

nits

(% o

fcon

trol

)

P-c-Junc-Jun

0

400

800

1200

Arb

itrar

yU

nits

(% o

fcon

trol

)

**

***

ns*** ns ns

LovMev

--

++

-+

+-

P-c-Jun→

c-Jun→

GAPDH→

B

C

P-c-Junc-Jun

0 1 3 6 12 24Time (h)

0

50

100

150

200** **

***

ns

***

**

**

ns

*

P-c-Junc-JunP-c-Junc-Jun

0 1 3 6 12 24Time (h)

0

50

100

150

200** **

***

ns

***

**

**

ns

*

0 1 3 6 12 24Time (h)

0 1 3 6 12 24Time (h)

0

50

100

150

200** **

***

ns

***

**

**

ns

*

0

50

100

150

200** **

***

ns

***

**

**

ns

*

c-Jun→

GAPDH→

c-Jun→c-Jun→

GAPDH→GAPDH→

0

250

500

750

1000

Lovastatin (µM)0 10 201

P-c-Junc-Jun

Arb

itrar

yU

nits

(% o

fcon

trol

)

**

*

**

*** *

0

250

500

750

1000

0

250

500

750

1000

Lovastatin (µM)0 10 201

P-c-Junc-JunP-c-Junc-Jun

Arb

itrar

yU

nits

(% o

fcon

trol

)

**

*

**

*** *

P-c-Jun→

c-Jun→

GAPDH→

P-c-Jun→P-c-Jun→

c-Jun→c-Jun→

GAPDH→GAPDH→

Arb

itrar

yU

nits

(% o

fcon

trol

)

P-c-Junc-JunP-c-Junc-Jun

0

400

800

1200

Arb

itrar

yU

nits

(% o

fcon

trol

)

**

***

ns*** ns ns

LovMev

--

++

-+

+-

0

400

800

1200

Arb

itrar

yU

nits

(% o

fcon

trol

)

**

***

ns*** ns ns

**

***

ns*** ns ns

LovMev

--

++

-+

+-

LovMevLovMev

--

++

-+

+-

P-c-Jun→

c-Jun→

GAPDH→

P-c-Jun→P-c-Jun→

c-Jun→c-Jun→

GAPDH→GAPDH→

B

C

deww

pendent effect. C: Effect of mevalonate treatment. Neuroblasts ere treated as described in Fig. 1 but concentration-dependent

d to an increase in both the phosphorylation

um

other

membe

ndent effect. C: Effect of mevalonate treatment. Neuroblasts ere treated as described in Fig. 1 but concentration-dependent

d to an increase in both the phosphorylation

um

other

membe

and expression of c-Jun that was significant at

1 hour after treatment and got a peak level

after 3 hours. Phosphorylation and protein

levels of c-Jun decreased under control level

when lovastatin exposure was prolonged to 24

hours. As shown in Fig. 3B, the treatment with

lovastatin for 6 hours also induced an increase

in both the phosphorylation and expression of

c-Jun in a concentration-dependent manner

with respect to untreated control cells. The

effect of lovastatin was evident at a

concentration of 1 µM reaching the maxim

and expression of c-Jun that was significant at

1 hour after treatment and got a peak level

after 3 hours. Phosphorylation and protein

levels of c-Jun decreased under control level

when lovastatin exposure was prolonged to 24

hours. As shown in Fig. 3B, the treatment with

lovastatin for 6 hours also induced an increase

in both the phosphorylation and expression of

c-Jun in a concentration-dependent manner

with respect to untreated control cells. The

effect of lovastatin was evident at a

concentration of 1 µM reaching the maxim

P-c-Jun→A

P-c-Jun→P-c-Jun→P-c-Jun→A

effect at 10 µM. Co-treatment with mevalonate

(100 µM) partially prevented the increase in c-

Jun phosphorylation induced by lovastatin. In

contrast, the increase in the protein levels of c-

Jun induced by lovastatin was fully prevented

by mevalonate. Treatment of cells with

mevalonate alone did not significantly modify

c-Jun phosphorylation and expression (Fig.

3C). Lovastatin effects on c-Jun

phosphorylation and expression were specific

as the protein levels of GAPDH remained

unchanged throughout the experiments.

Activated c-Jun functions either as a

homodimer or as a heterodimer with

effect at 10 µM. Co-treatment with mevalonate

(100 µM) partially prevented the increase in c-

Jun phosphorylation induced by lovastatin. In

contrast, the increase in the protein levels of c-

Jun induced by lovastatin was fully prevented

by mevalonate. Treatment of cells with

mevalonate alone did not significantly modify

c-Jun phosphorylation and expression (Fig.

3C). Lovastatin effects on c-Jun

phosphorylation and expression were specific

as the protein levels of GAPDH remained

unchanged throughout the experiments.

Activated c-Jun functions either as a

homodimer or as a heterodimer with

rs of the Jun, Fos or ATF families to

bind activator protein-1 (AP-1) sequence

elements within the promoters of a variety of

genes [41]. Therefore, we next studied the

effect of lovastatin on AP-1 DNA-binding

activity by EMSA. Exposure of neuroblasts to

10 µM lovastatin caused an increase in the

activity of AP-1 in a time-dependent manner

(Fig. 4A). The elevation was significant at 1

hour and progressively increased for at least 3

hours after lovastatin treatment.

rs of the Jun, Fos or ATF families to

bind activator protein-1 (AP-1) sequence

elements within the promoters of a variety of

genes [41]. Therefore, we next studied the

effect of lovastatin on AP-1 DNA-binding

activity by EMSA. Exposure of neuroblasts to

10 µM lovastatin caused an increase in the

activity of AP-1 in a time-dependent manner

(Fig. 4A). The elevation was significant at 1

hour and progressively increased for at least 3

hours after lovastatin treatment.

and mevalonate effects were analyzed 6 hours after lovastatin treatment. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using anti-phospho-c-Jun and anti-c-Jun specific antibodies. As a control of the amount of protein, total GAPDH was also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.

treatment of neuroblasts with 10 µM lovastatin

and mevalonate effects were analyzed 6 hours after lovastatin treatment. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using anti-phospho-c-Jun and anti-c-Jun specific antibodies. As a control of the amount of protein, total GAPDH was also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.

treatment of neuroblasts with 10 µM lovastatin

lele

96

Submitted JNKs activation in lovastatin-induced neuronal apoptosis

Fi ffect of mevalonate treatme E SA using an

P-1 specific oligonucleotide as described in Material and Methods. D: Specificity and supershift of lovastatin-induced AP-1 activation. uclear extract from lovastatin-treated cells (10 µM, 6 hours) were preincubated with 100-fold excess of unlabelled AP-1 or NFκB double-

P-1 gradually decreased under basal levels at

24 hour

consensus oligonucleotide, but remained

unaffec

ression; we next performed the

A BA B

gure 4. Effect of lovastatin on AP-1 activation. A: Time-dependent effect. B: Concentration-dependent effect. C: Ent. Neuroblasts were treated as described in Fig. 3. After treatment, nuclear extracts were prepared and assayed by

AP-1→

AP-1→

C D

*

*

*

0

100

200

300

400

0 10 201Lovastatin (µM)

AP-

1 ac

tivity

(% o

fcon

trol

)

0

50

100

150

200

250*

LovMev

--

++

-+

+-

AP-

1 ac

tivity

(% o

fcon

trol

)

AP-1→

AP-

1 ac

tivity

(% o

fcon

trol

)

0

40

80

120

160

200

**

**

****

***

0 1 3 6 12 24Time (h)

AP-1→

1 µg

CR

EB

1 µg

c-F

os

1 µg

c-J

un

NF-κB

AP-

1

cont

rol

ns ns

AP-1→AP-1→

AP-1→AP-1→

C D

*

*

*

0

100

200

300

400

0 10 201Lovastatin (µM)

AP-

1 ac

tivity

(% o

fcon

trol

)

*

*

*

*

*

*

0

100

200

300

400

0

100

200

300

400

0 10 201Lovastatin (µM)

0 10 201Lovastatin (µM)

AP-

1 ac

tivity

(% o

fcon

trol

)

0

50

100

150

200

250*

LovMevLovMev

--

++

-+

+-

AP-

1 ac

tivity

(% o

fcon

trol

)

AP-1→

AP-

1 ac

tivity

(% o

fcon

trol

)

0

40

80

120

160

200

**

**

****

***

0 1 3 6 12 24Time (h)

AP-

1 ac

tivity

(% o

fcon

trol

)

0

40

80

120

160

200

0

40

80

120

160

200

**

**

****

***

**

**

****

***

0 1 3 6 12 24Time (h)

0 1 3 6 12 24Time (h)

AP-1→

1 µg

CR

EB

1 µg

c-F

os

1 µg

c-J

un

NF-κB

AP-

1

cont

rol

ns ns

MANstranded oligonucleotides or 1 µg of c-Jun, c-Fos and CREB antibodies for 10 min at room temperature prior to addition of labelled AP-1 probe. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.

After the first increase, the activity of

active phosphorylated form of c-Jun

A

s of treatment. As shown in Fig. 4 B,

lovastatin treatment for 6 hours also increased

AP-1 activity in a concentration-dependent

manner. Mevalonate (100 µM) prevented the

increase in the activity of AP-1 induced by

lovastatin, indicating that the lovastatin effect

was specific (Fig. 4C). Treatment of

neuroblasts with mevalonate alone did not

affect AP-1 activity. In all the experiments, the

activity of AP-1 paralleled the increase in the

(Fig. 3). As shown in Fig. 4C, AP-1 activity

was abolished by the addition of excess AP-1

ted in the presence of the NFκB

consensus site. Supershift experiments showed

that c-Jun and c-Fos were present in the AP-1

complex.

To determinate whether the increase in

AP-1 activity induced by lovastatin was

associated with an increase in AP-1-mediated

gene exp

97

Submitted JNKs activation in lovastatin-induced neuronal apoptosis luciferase reporter gene assay. As shown in

Fig. 5A, the incubation of the AP-1-plasmid

containing cells with 10 µM lovastatin resulted

in an increase in luciferase expression. The

effect of lovastatin on AP-1-mediate gene

expression was specific because as it is shown

in Fig. 5 B, lovastatin decreased SRE-mediate

luciferase expression. Again, co-treatment with

mevalonate prevented the effect of lovastatin

and completely restored AP-1-mediated gene

expression to control levels (Fig. 5A).

pGL3-AP-1

200

**)

A pGL3-AP-1

200

**)

pGL3-AP-1

200

**)

200

**)

A

Fan

i 1-

β-

ol lls were incubated in presence of media or mevalonate alone.

t role

the transcription of several pro-apoptotic

[28, 45, 46]. Of the three

major

150ns ns

trol

gure 5. Effect of lovastatin on transcription from the AP-d SRE-response element. Neuroblasts initially cultured for hours in Ham´s F12/10% FCS were co-transfected with L3-AP-1-luciferase or pGL3-SRE-luciferase and pSV-

alactosidase reporter constructs. Following transfection, cellsere incubated with lovastatin (Lov 10 µM) in absence or esence of mevalonate (Mev 100 µM) for 24 hours. Contr

0

50

100

Luv

/Gal

(% o

fcon

LovMev

--

++

-+

+-

pGL3-SRE

0

50

100

150

Luc

/Gal

(% o

fcon

trol

)

LovMev

--

++

-+

+-

**

nsns

B

0

50

100

Luv

/Gal

(% o

fcon

LovMev

--

++

-+

+-

0

50

100

Luv

/Gal

(% o

fcon

LovMev

--

++

-+

+-

0

50

100

Luv

/Gal

(% o

fcon

LovMevLovMev

--

++

-+

+-

pGL3-SRE

0

50

100

150

Luc

/Gal

(% o

fcon

trol

)

LovMev

--

++

-+

+-

**

nsns

pGL3-SRE

0

50

100

150

Luc

/Gal

(% o

fcon

trol

)

LovMev

--

++

-+

+-

**

nsns

0

50

100

150

Luc

/Gal

(% o

fcon

trol

)

LovMevLovMev

--

++

-+

+-

**

nsns

B

24pGGwprceLuciferase and β-Galactosidase activity were measured in the same extracts and the luciferase activity standardised for transfection efficiency by dividing the luciferase activity by β-Galactosidase activity. Results are expressed as the percentage relative to untreated cells. Each value represents the mean ±SE of three independent experiments performed in triplicate. ns, not significant; **, p<0.01; compared to untreated cells.

Taken together, our results suggest that

transcriptional activity of c-Jun, which is

dependent on JNK, is likely to contribute to

lovastatin-induced neuroblast apoptosis.

Lovastatin induces BimEL expression in rat

brain neuroblasts.

c-Jun induction plays an importan

in

genes, most notably the BH3-only Bcl-2

family member Bim

isoforms of Bim [BimS (Bim short),

BimL (Bim long) and BimEL (Bim extra

long), BimEL is induced and potentiated by

JNK at both the transcriptional and

posttranslational levels [45]. Therefore, we

next examined the protein levels of BimEL

after lovastatin treatment by immunoblot

analysis. As shown in Fig. 6, lovastatin

increased the protein levels of BimEL in a

time- and concentration-dependent manner

(Fig. 6A and Fig. 6B, respectively). Lovastatin

(10 µM) produced an increase in BimEL that

was significant at 3 hours and was maximum at

about 12 hours of treatment (Fig. 6A). On the

other hand, the effect of lovastatin on protein

levels of BimEL was evident at a

concentration of 1 µM and reached the

maximum effect at a concentration of 10 µM.

Mevalonate (100 µM) prevented the increase

in the protein levels of BimEL induced by

lovastatin, indicating that the lovastatin effect

was specific (Fig. 6C). Treatment of

neuroblasts with mevalonate alone decreased

the protein levels of BimEL when compared to

control cells. Expression levels of GAPDH

remained unchanged throughout the

experiment (Fig. 6), suggesting that BimEL

150ns ns

trol 150

ns ns

trol 150

ns ns

trol

98

Submitted JNKs activation in lovastatin-induced neuronal apoptosis

Figure 6. Effect of lovastatin on BimEL protein levels. Time-dependent effect. B: Concentration-dependent effect.Effect of mevalonate treatment. Neuroblasts were trdescribed in Fig. 1. At the end of each experiment, cells werelysed and total proteins (20 µg/lane) were separated byPAGE and analyzed by Western blotting using anti-

B

C

0

400

800

1200

*

*

*

ns

0 1 3 6 12 24Time (h)

Bim

EL

(% o

fcon

trol

)

0 10 201Lovastatin (µM)

0

1000

2000

3000

**

*

**

BimEL→

GAPDH→

Bim

EL

(% o

fcon

trol

)

0

50

100

150

200

250

LovMev

--

++

-+

+-

**

ns*

BimEL→

GAPDH→

Bim

EL

(% o

fcon

trol

)

B

C

0

400

800

1200

0

400

800

1200

*

*

*

ns *

*

*

ns

0 1 3 6 12 24Time (h)

0 1 3 6 12 24Time (h)

Bim

EL

(% o

fcon

trol

)

0 10 201Lovastatin (µM)

0 10 201Lovastatin (µM)

0

1000

2000

3000

**

*

**

0

1000

2000

3000

0

1000

2000

3000

**

*

**

**

*

**

BimEL→

GAPDH→

Bim

EL

(% o

fcon

trol

)

0

50

100

150

200

250

0

50

100

150

200

250

LovMev

--

++

-+

+-

LovMevLovMev

--

++

-+

+-

**

ns*

**

ns*

BimEL→

GAPDH→

Bim

EL

(% o

fcon

trol

)

A: C:

eated as

SDS-BimEL

tal A

presentative blot of each experiment is shown with the ensitometric analysis corresponding to the mean ±SE of at least

s a downstream

component of the activated JNK signalling

pathway in this apoptotic model.

st apoptosis

duced by lovastatin

capacity to activate the JNK/c-Jun/BimEL

signalling pathway. Therefore, we next studied

whether the pharmacological inhibition of this

pathway results in a corresponding inhibition

of neuroblast apoptosis. Thus, cells were

treated with 10 µM lovastatin alone or in

combination with various concentrations of

two JNK inhibitors, iJNK-I [50] and SP600125

for 24 hours. In these experiments, JNK

inhibitors were added to the cells 1 hour before

lovastatin treatment. Apoptotic response was

evaluated by cell and nuclei morphology

analysis, internucleosomal DNA fragmentation

and quantification of neuroblasts undergoing

apoptosis by flow cytometry. As shown in Fig.

7A, lovastatin-treated cells in the absence of

JNK inhibitor were totally rounded up and

detached from the plate, while in the presence

of iJNK-I (50 µM), the cells were viable and

maintained normal cell shape in the presence

of lovastatin. iJNK-I (50 µM) also prevented

the increase in the number of nuclei showing

chromatin condensation elicited by lovastatin

(Fig. 7A and 7B).

1600

specific antibody. As a control of the amount of protein, toGAPDH was also analyzed in the same samples.

ABimEL→

ABimEL→

redthree independent experiments. ns, not significant; *, p<0.05; **, p<0.01; compared to untreated cells.

expression was specifically affected by

exposure to lovastatin. These results suggest

that BimEL may act a*

GAPDH→

16001600**

GAPDH→

JNK, but not p38 MAPK, activation is

required for rat brain neurobla

in

Our results suggested that lovastatin

might induce neuroblast apoptosis by its

99

Submitted JNKs activation in lovastatin-induced neuronal apoptosis

Fi

AA

gure 7. The specific JNK inhibitor (iJNK-I) prevents lovastatin effects. Neuroblasts previously cultured for 24 hours in growth e incubated with 10 µM lovastatin (Lov) in absence or presence of different concentrations of iJNK-I (10, 25 and 50 µM) f

additional 24 h. (A) Cell and nuclei morphology was analyzed as described in Material and Methods. Untreated neuroblasts (A andoblasts treated with 10µM lovastatin (B and G), 10µM lovastatin plus 50 µM iJNK-I (C and H) and 50 µM iJNK-I (D and I). Norma

--

LoviJNK-I

+-

+10

+25

+50

-50

MW 0

5

10

15

20

25

--

LoviJNK-I

+-

+10

+25

+50

-50

***

ns

**

***A

popt

osis

(% o

ftot

al c

ells

)

0

25

50

75

100

-50

--

LoviJNK-I

+-

+10

+25

+50

Cel

lVia

bilit

y(%

ofc

ontr

ol)

*** *** ***

***

***

JNK-1→

P-GST-c-Jun→

-50

--

LoviJNK-I

+-

+10

+25

+50

BimEL→

Caspase 3Active Fragment→

GAPDH→

-50

--

LoviJNK-I

+-

+10

+25

+50

E F G H

B C

D E

F

P-c-Jun→

Total Nuclei

Apoptotic Nuclei

0

100

200

300

Nuc

leiN

umbe

rpe

rIm

age

-50

--

LoviJNK-I

+-

+50

***

ab b

ns ns

nn nn

anan

--

LoviJNK-I

+-

+10

+25

+50

-50

MW 0

5

10

15

20

25

--

LoviJNK-I

+-

+10

+25

+50

-50

***

ns

**

***A

popt

osis

(% o

ftot

al c

ells

)

0

25

50

75

100

-50

--

LoviJNK-I

+-

+10

+25

+50

Cel

lVia

bilit

y(%

ofc

ontr

ol)

*** *** ***

***

***

--

LoviJNK-I

+-

+10

+25

+50

-50

MW--

LoviJNK-I

+-

+10

+25

+50

-50

MW--

LoviJNK-I

+-

+10

+25

+50

-50

MW 0

5

10

15

20

25

--

LoviJNK-I

+-

+10

+25

+50

-50

***

ns

**

***A

popt

osis

(% o

ftot

al c

ells

)

0

5

10

15

20

25

--

LoviJNK-I

+-

+10

+25

+50

-50

***

ns

**

***

***

ns

**

***A

popt

osis

(% o

ftot

al c

ells

)

0

25

50

75

100

-50

--

LoviJNK-I

+-

+10

+25

+50

Cel

lVia

bilit

y(%

ofc

ontr

ol)

*** *** ***

***

***

0

25

50

75

100

0

25

50

75

100

-50

--

LoviJNK-I

+-

+10

+25

+50

-50

--

LoviJNK-I

+-

+10

+25

+50

Cel

lVia

bilit

y(%

ofc

ontr

ol)

*** *** ***

***

****** *** ***

***

***

JNK-1→JNK-1→

P-GST-c-Jun→P-GST-c-Jun→

-50

--

LoviJNK-I

+-

+10

+25

+50

-50

--

LoviJNK-I

+-

+10

+25

+50

BimEL→BimEL→

Caspase 3Active Fragment→

Caspase 3Active Fragment→

GAPDH→GAPDH→

-50

--

LoviJNK-I

+-

+10

+25

+50

-50

--

LoviJNK-I

+-

+10

+25

+50

EE F GG HH

B C

D E

F

P-c-Jun→P-c-Jun→

Total Nuclei

Apoptotic Nuclei

0

100

200

300

Nuc

leiN

umbe

rpe

rIm

age

-50

--

LoviJNK-I

+-

+50

Total Nuclei

Apoptotic Nuclei

Total Nuclei

Apoptotic Nuclei

0

100

200

300

Nuc

leiN

umbe

rpe

rIm

age

-50

--

LoviJNK-I

+-

+50

0

100

200

300

Nuc

leiN

umbe

rpe

rIm

age

-50

--

LoviJNK-I

+-

+50

***

ab b

ns ns

nn nn

anan

A B CAA BB CC DDD

media wer or an

F), neur l (nn) and apoptotic nuclei (an). (B) Total and apoptotic nuclei were counted as described in Material and Methods. (C) neuroblast viability was determined by the crystal violet method. (D) Internucleosomal DNA degradation was analyzed by using electrophoresis on 2% agarose gel. (E) The percentage of cells with hypodiploid DNA content was evaluated by flow cytometry and (F) JNK activity, c-Jun phosphorylation,

imEL expression, caspase-3 active form and GAPDH protein levels were analyzed as described in Material and Methods. Each value presents the mean ± standard error of at least three independent experiments made in triplicate. (B) ns, not significant; ***, p<0.001;

ompared to apoptotic nuclei in untreated cells. a, p<0.001; b, p<0.01; compared to normal nuclei in untreated cells. (C and E) ns, not

Brecsignificant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells. A representative photograph or a blot of at least 3 independent experiments is shown in A, D and F. MW represents 100 bp molecular weight markers.

100

Submitted JNKs activation in lovastatin-induced neuronal apoptosis

It is noteworthy that the JNK inhibitor

alone or in combination with lovastatin

produced a decrease in the number of cells

hen compared to both control and lovastatin-

to block the apoptotic effect of lovastatin (Fig.

8).

to block the apoptotic effect of lovastatin (Fig.

8).

AAw

treated

apoptotic neuroblasts when compared to

control cells. In all the experiments tested,

iJNK-I effects were concentration-dependent.

To further study the contribution of the JNK/c-

Jun/BimEL signalling pathway in neuroblast

apoptosis induced by lovastatin, we examined

the effect of iJNK-I on the different

components of this pathway. As shown in Fig.

7G, pre-treatment with 10-50 µM iJNK-I

suppressed the increase in JNK activation, c-

Jun phosphorylation and BimEL protein levels

and BIRB796 (data not shown), were not able

Taken together, these results suggest

40

120140

duced by lovastatin, we examined

the effect of iJNK-I on the different

components of this pathway. As shown in Fig.

7G, pre-treatment with 10-50 µM iJNK-I

suppressed the increase in JNK activation, c-

Jun phosphorylation and BimEL protein levels

and BIRB796 (data not shown), were not able

Taken together, these results suggest

40

120140cells (Fig 7A, B and C). Furthermore,

iJNK-I also prevented the appearance of

internucleosomal DNA fragmentation (Fig.

7C) and the increase in the percentage of

apoptotic neuroblasts (Fig. 7D) induced by

lovastatin. iJNK-I alone produced no effect on

DNA fragmentation nor in the percentage of

triggered by lovastatin. Moreover, iJNK-I also

inhibited the increase in the active form of

caspase 3 induced by lovastatin (Fig.7G).

iJNK-I effects were concentration dependent

and correlated well with its neuroprotective

effects. Due to non-specific cytotoxic effect,

the neuroblasts could not be treated with

SP600125 (data not shown). Thus, we could

not determine whether this JNK inhibitor was

able to prevent neuroblast apoptosis in this

model.

The involvement of p38 MAPK in the

induction of neuroblast apoptosis by lovastatin

was again excluded by the fact that specific

inhibitors of this kinase, SB203580 (Fig. 8)

triggered by lovastatin. Moreover, iJNK-I also

inhibited the increase in the active form of

caspase 3 induced by lovastatin (Fig.7G).

iJNK-I effects were concentration dependent

and correlated well with its neuroprotective

effects. Due to non-specific cytotoxic effect,

the neuroblasts could not be treated with

SP600125 (data not shown). Thus, we could

not determine whether this JNK inhibitor was

able to prevent neuroblast apoptosis in this

model.

The involvement of p38 MAPK in the

induction of neuroblast apoptosis by lovastatin

was again excluded by the fact that specific

inhibitors of this kinase, SB203580 (Fig. 8)

020

6080

100

020

6080

100***

*** ***

** **

ns

(% o

fnt

ro

SB 203580 (µM)

1 5 10 1 5 10 20Lov - + + ++ + - - - -

B

020

6080

100***

*** ***

** **

ns

(% o

fnt

ro

SB 203580 (µM)

1 5 10 1 5 10 20Lov - + + ++ + - - - -

020

6080

100

020

6080

100***

*** ***

** **

ns

****** ***

** **

ns

(% o

fnt

ro

SB 203580 (µM)

1 5 10 1 5 10 20Lov - + + ++ + - - - -

SB 203580 (µM)

1 5 10 1 5 10 20

SB 203580 (µM)

1 5 10 1 5 10 201 5 10 1 5 10 20Lov - + + ++ + - - - -Lov - + + ++ + - - - -

B

*** ***

ns

Cel

lVia

bilit

yco

l)

20

40

120140

*** ***

ns

Cel

lVia

bilit

yco

l)

20

40

120140

40

120140

*** ***

ns

*** ***

ns

Cel

lVia

bilit

yco

l)

20202020

Figure 8. Effect of p38 MAPK inhibitor (SB 203580) alone or in combination with lovastatin on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of SB203580 (1, 5, 10 and 20 µM) in absence or presence of 10 µM lovastatin (Lov) for an additional 24 h. At the end of the experiment, cell viability, internucleosomal DNA degradation and the percentage of cells with hypodiploid DNA content was evaluated as described in Material and Methods. Each value represents the mean ± standard error of at least three independent experiments made in triplicate. ns, not significant; **, p<0.01; ***, p<0.001; compared to untreated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.

Figure 8. Effect of p38 MAPK inhibitor (SB 203580) alone or in combination with lovastatin on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of SB203580 (1, 5, 10 and 20 µM) in absence or presence of 10 µM lovastatin (Lov) for an additional 24 h. At the end of the experiment, cell viability, internucleosomal DNA degradation and the percentage of cells with hypodiploid DNA content was evaluated as described in Material and Methods. Each value represents the mean ± standard error of at least three independent experiments made in triplicate. ns, not significant; **, p<0.01; ***, p<0.001; compared to untreated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.

SB 203580 (µM)

Lov -1+

5+

10++

20+

1-

5-

10-

20- MW

SB 203580 (µM)

1 5 10 20 1 5 10 20

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls) ***

*** *** *** ***

ns ns ns ns

Lov - + + ++ + - - - -

CSB 203580 (µM)

Lov -1+

5+

10++

20+

1-

5-

10-

20- MW

SB 203580 (µM)

Lov -1+

5+

10++

20+

1-

5-

10-

20- MW

SB 203580 (µM)

Lov -1+

5+

10++

20+

1-

5-

10-

20- MWLov -

1+1+

5+5+

10+10++

20+20+

1-1-

5-5-

10-

10-

20-

20- MW

SB 203580 (µM)

1 5 10 20 1 5 10 20

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls) ***

*** *** *** ***

ns ns ns ns

Lov - + + ++ + - - - -

SB 203580 (µM)

1 5 10 20 1 5 10 20

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls) ***

*** *** *** ***

ns ns ns ns

Lov - + + ++ + - - - -

SB 203580 (µM)

1 5 10 20 1 5 10 20

SB 203580 (µM)

1 5 10 20 1 5 10 201 5 10 20 1 5 10 20

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls) ***

*** *** *** ***

ns ns ns ns

Lov - + + ++ + - - - -0

5

10

15

20

25

0

5

10

15

20

25

Apo

ptos

is(%

oft

otal

cel

ls) ***

*** *** *** ***

ns ns ns ns

****** *** *** ***

ns ns ns ns

Lov - + + ++ + - - - -Lov - + + ++ + - - - -

C

that the JNK signalling pathway seemed to be

linked to lovastatin-induce apoptosis of rat

brain neuroblasts.

that the JNK signalling pathway seemed to be

linked to lovastatin-induce apoptosis of rat

brain neuroblasts.

101

Submitted JNKs activation in lovastatin-induced neuronal apoptosis DISCUSSION

The mevalonate pathway is essential to

ensure normal growth, differentiation and

maintenance of neuronal tissues [13-14]. The

inhibition of the biosynthesis of mevalonate by

statins

nvolved in these effects of

been elucidated. In the present

study, w

MAPK

has been associated with CNS defects

[16, 17] and the induction of apoptosis in

cultured neuronal cells [18-21]. However, the

signalling events i

statins have not

e used rat brain neuroblasts in order to

investigate the molecular mechanisms

underlying lovastatin-induced neuronal

apoptosis. We found that lovastatin induced

neuroblast apoptosis through the activation of

the JNK/c-Jun/BimEL signalling pathway and

their downstream molecule, caspase-3.

The role of JNK and p38 MAPK in

neuronal apoptosis has been investigated

extensively [25, 26]. However, these kinases

have been also associated with neuronal

survival [38] and differentiation [39, 40]. In

the present work, we show that lovastatin

treatment led to a time- and concentration

dependent increase in the activity of JNK. In

contrast, the phosphorylation of p38

was not affected by lovastatin exposure at any

time tested. These results suggest that the JNK,

but not the p38 MAPK, signalling pathway

may play a role in the apoptosis of neuroblasts

induced by lovastatin. Although p38 MAPK

activation caused apoptosis in some neuronal

damage models, it seemed to be irrelevant in

others. Thus, p38 MAPK activation was

required for apoptosis induced by survival-

factor withdrawal [27, 29, 30], ceramide and

cadmium exposure [31, 33], while in contrast,

p38 MAPK was not implicated in other models

of neuronal apoptosis [35-37]. These

controversial findings suggest the existence of

differences in regulation of of p38 MAPK

depending on cell types and environmental

conditions. The role that plays the stress-

activated kinases in lovastatin-induced

apoptosis is also contradictory. Consistent with

our findings, some reports show that statin-

induced apoptosis in both rat pulmonary vein

endothelial [12] and C6 glioma cells [9]

correlates with up-regulation of JNK without

affecting p38 MAPK activity. In contrast,

lovastatin induces apoptosis in both human

aortic smooth muscle and acute myelogenous

leukemia cells but not affect the level of

expression and activation status of p38 MAPK

and JNK [10, 11]. On the other hand,

lovastatin-induced apoptosis in glioblastoma

cells was independent of the activation of JNK

and p38 MAPK [51] and simvastatin-induced

apoptosis in human myeloma cells was

associated with the inactivation of both JNK

and p38 MAPK [52]. Such a discrepancy may

be attributed to different biological actions of

statins depending on cell types. At the

moment, we do not know the mechanisms by

which lovastatin treatment leads to an

activation of JNK in neuroblasts. However, we

may postulate that the activation of JNK may

be associated, at least partially, with the

decrease in the activity of phosphoinositide 3-

kinase (PI3-K) induced by lovastatin in

neuroblasts [53], as a previously report

suggests that the inhibition of PI3-K signalling

pathway involves and elevation of the JNK

activity in cultured neuronal cells [54, 55]. On

the other hand, the increase in the JNK activity

observed in this apoptotic model may be a

102

Submitted JNKs activation in lovastatin-induced neuronal apoptosis downstream response to either induction of

Rac 1, mainly implicated in cell apoptosis, or

loss of membrane-associated Rho A, a

regulator of cell survival [56] or both, as we

have previously reported that lovastatin

treatment was associated with a decrease in the

prenylation of RhoA whereas membrane-

associated Rac 1 was not affected [21].

The transcription factor c-Jun is a

substrate for JNK, which phosphorylates its

transcriptional activation domain at serines 63

and 73 and thereby potentiates its

transcriptional activity. c-Jun is a well-

characterized member of the AP-1 family of

transcription factors that also includes fos and

ATF2. Members of AP-1 family integrate a

complex network of incoming extracellular

signals,

the JNK pathway both at the

transcri

which are responsible for multifaceted

functions like cell proliferation, differentiation

and neuronal apoptosis [41]. In the present

work, we found that both the phosphorylation

at serine 63 and protein levels of c-Jun were

induced in lovastatin-treated neuroblasts in a

time- and concentration dependent manner and

that AP-1 activity was modulated in parallel

with the changes of c-Jun phosphorylation and

protein, too. Furthermore, these effects were

associated with an increase in AP-1-mediated

gene expression. These results indicate that

AP-1 activity could be required for apoptosis

in lovastatin-treated neuroblasts and suggest

that c-Jun plays a key role. The activation of

JNK/c-Jun/AP-1 signalling pathway has been

related to apoptosis induced by lovastatin in

non-neuronal [9, 12] but, to our knowledge,

this is the first report that shows that lovastatin

induces the activation of this cell death

signalling pathway in neuronal cells and in

particular in rat brain neuroblasts. Increased

levels of c-Jun protein, phosphorylation and

AP-1 activity have been described in several

models of neuronal apoptosis, suggesting an

important role for this transcription factor in

this process.

Bcl-2 family members are critical for

making life- or-death decisions in neurons

[57]. The proapoptotic Bcl-2 family protein

Bax is necessary for neuronal death. Bax

activity is regulated by the BH3-only members

of the Bcl-2 family, such as Bim. Bim is

increased in sympathetic and cerebellar

granule neurons during apoptosis and is up-

regulated by

ptional and posttranslational levels [45,

46]. In our study, we found that lovastatin

increased the protein levels of BimEL in rat

brain neuroblasts undergoing apoptosis.

Lovastatin effects were time- and

concentration dependent and parallel to JNK

activity. Our results are in good agreement

with a previous work that shows that

lovastatin-induced up-regulation of Bim and

cell death in glioblastoma cells [51], and

suggest that lovastatin may induce neuroblast

apoptosis by increasing the expression of this

BH3-only protein. Bim expression is increase

in response to various apoptotic inducers in

different neuronal cells [58-61], which

indicates that up-regulation of Bim plays an

important role in the execution of neuronal

apoptosis.

We have also shown that lovastatin

effects were prevented by simultaneous

exposure of cells to exogenous mevalonate,

demonstrating that the activation of the JNK/c-

103

Submitted JNKs activation in lovastatin-induced neuronal apoptosis Jun/Bim signalling pathway induced by

lovastatin was specifically due to a blockade of

HMG-CoA reductase activity.

Our results suggest that lovastatin may

induce

hibitor of JNK

activity

JNK/c-Jun/BimEL signalling pathway in

revented by adding

mevalo

e argument that JNK/c-

Jun pat

m Junta de

Extrem Spain.

REFE

reactions in the biosynthesis of cholesterol,

neuroblast apoptosis by its capacity to

activate the JNK/c-Jun/Bim pathway.

Therefore, we investigated whether the

pharmacological inhibition of this pathway

was able to prevent the apoptosis of

neuroblasts induced by lovastatin. Our results

show that iJNK-I, a specific in

, was able to prevent the morphological

and biochemical features of apoptosis induced

by lovastatin in a concentration-dependent

manner. In a parallel way, iJNK-I prevented

the increase in JNK activation, c-Jun

phosphorylation, BimEL expression and

caspase-3 activation elicited by lovastatin. Our

results are consistent with data obtained in

other neuronal apoptotic models, and indicate

that the JNK signalling pathway plays an

important role in the apoptosis induced by

lovastatin in rat brain neuroblasts. On the other

hand, we show that iJNK-I treatment produced

a decrease in the number of neuroblasts when

compared to control and lovastatin-treated

cells. At the moment, we do not know the

mechanisms by which iJNK-I treatment

produce this cell cycle inhibitory effect.

Inhibition of p38 MAPK by SB203580 showed

no appreciable effects on apoptosis in the same

experimental conditions, confirming that the

p38 MAPK pathway does not play a role in

this apoptotic model.

In conclusion, we have shown for the

first time that HMG-CoA reductase inhibition

by lovastatin leads to an activation of the

spontaneously immortalized rat brain

neuroblasts which may contribute to

explaining its apoptotic effect. The lovastatin

effects were time- and concentration-

dependent and p

nate to the medium, which indicates

that they were due to an inhibition of

mevalonate synthesis.

These findings could contribute to

elucidate the molecular mechanisms by which

statins induce growth suppression and/or

apoptosis in neuronal cells and may also help

to explain the CNS side effects associated with

statin therapy. On the other hand, our data

demonstrating the involvement of the JNK/c-

Jun pathway in another model of neuronal

apoptosis, strengthen th

hway inhibitors may be a good therapy

for the neurodegenerative diseases.

ACKNOWLEDGMENTS

The authors thank Mary Harper for the

preparation of the manuscript. This work has

been supported by Grants, SAF 2001-0154

from the Ministerio de Ciencia y Tecnologia,

and 2PR01B007 from the Junta de

Extremadura. M. I. Cerezo-Guisado is

supported by a Ph D fellowship fro

adura,

RENCES [1] H. W. Chen, Role of cholesterol metabolism in cell growth, Fed. Proc. 43 (1984) 126-130.

[2] J. L. Goldstein, M. S. Brown, Regulation of the mevalonate pathway, Nature 343 (1990) 425-429. [3] J. Grunler, J. Ericsson, G. Dallner, Branch-point

104

Submitted JNKs activation in lovastatin-induced neuronal apoptosis dolichol, ubiquinone and prenylated proteins,

cta 1212 (1994) 259-277.

osis in rostate stromal cells, J. Clin. Endocrinol. Metabol.

[5] L. M. Blanco-Colio, A. Villa, M. Ortego, M. A. Hernández-Presa, A. Pascual, J. J. Plaza, J. Egido, 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase inhibitors, atorvastatin and simvastatin, induce apoptosis of vascular smooth muscle cells by downregulation of Bcl-2 expression and Rho A

arshall, N. Johnston, A. G. rdine, Inhibition of proliferation and signalling

em. harmacol. 65 (2003) 1295-1303.

[8] M. R. Graaf, D. J. Richel, C. J. F. van Noorden, H. J. Guchelarr, Effect of statins and farnesyltransferase inhibitors on the development and progression of cancer, Cancer Treat. Rev. 30 (2004) 609-641.

of extracellular signal-regulated inases, Cardiovasc. Pathol. 13 (2004) 41-48.

[11] J. Wu, W. W. Wong, F. Khosravi, M. D. Minden, L. Z. Penn, Blocking the Raf/MEK/ERK

apoptosis, Cancer Res. 4 (2004) 6461-6468.

5] C. P. Cavender, S. D. Turley, J. M. Dietschy,

, M. Muenke M. Central nervous stem and limb anomalies in case reports of first-

. Edison, M. Muenke Mechanistic and pidemiologic considerations in the evaluation of

8] M. Michikawa, K. Yanagisawa, Inhibition of

9] T. Tanaka, I. Tatsuno, D. Uchida, I. Moroo, H.

neurons to protect the cell death

Biochim. Biophys. A

[4] S. J. Padayatty, M. Marcelli, T. C. Shao, G.R. Cunningham, Lovastatin-induced apoptp82 (1997) 1434-1439.

prenylation, Atherosclerosis 161 (2002) 17-26. [6] D. Z. Hillyard, A. J. Cameron, A. H. McIntyre, N. H. Hadden, C. E. MJamechanisms in human lymphocytes by fluvastatin, Clin. Exp. Pharmacol. Physiol. 29 (2002) 673-678. [7] R. Jaster, P. Brock, G. Sparmann, J. Emmrich, S. Liebe, Inhibition of pancreatic stellate cell activation by the hydroxymethylglutaryl coenzyme A reductase inhibitor lovastatin, BiochP

[9] M. Koyuturk, M. Ersoz, N. Altiok, Simvastatin induces proliferation inhibition and apoptosis in C6 glioma cells via c-jun N-terminal kinase, Neurosci. Lett. 370 (2004) 212-217. [10] R. Takata, S. Fukasawa, T. Hara, H. Nakajima, A. Yamashina, N. Yanase, J. Nizuguchi, Cerivastatin-induced apoptosis of human aortic smooth muscle cells through partial inhibition of basal activation k

pathway sensitizes acute myelogenous leukaemia cells to lovastatin-induced 6 [12] S. Kaneta, K. Satoh, S. Kano, M. Kanda, K. Ichihara, All hydrophobic HMG-CoA reductase inhibitors induce apoptotic death in rat pulmonary vein endothelial cells, Atheroscleoris 17 (2003) 237-243. [13] W. A. Maltese, J. J. Volpe, Developmental changes in the distribution of 3-hydroxy-3-methylglutaryl coenzyme A reductase among subcellular fractions of rat brain, J. Neurochem. 33 (1979) 107-115. [14] D. K. Spady, J. M. Dietschy, Sterol synthesis in vivo in 18 tissues of the squirrell monkey, guinea pig, rabbit, hamster and rat, J. Lipids Res. 24 (1983) 303-315. [1Sterol metabolism in fetal, newborn and suckled lambs and their response to cholesterol after weaning, Am. J. Physiol. 269 (1995) E331-E340. [16] R. J. Edisonsytrimester statin exposure, N. Engl. J. Med. 350 (2004) 1579-1582. [17] R. Jeadverse birth outcomes following gestational exposure to statins, Am. J. Med. Genet. 131A (2004) 287-298. [1cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death, J. Neurochem. 72 (1999) 2278-2285. [1Morio, S. Nakamura, Y. Noguchi, T. Yasuda, M. Kitagawa, Y. Saito, A. Hirai, Geranylgeranyl-pirophosphate, an isoprenoid of mevalonate cascade, is a critical compound for rat primary cultured cortical

105

Submitted JNKs activation in lovastatin-induced neuronal apoptosis induced by 3-hydroxy-3-methylglutaryl-CoA

. Stoeckel, D. egow, U. Dirnagl, M. Endres, HMG-CoA

hibition, Mol. Cell. Neurosci. 17 1) 329-341.

3] D. De Zio, L. Giunta, M. Corvazo, E. Ferraro,

urodegenerative disorders, Curr.

s-degenerative effectors of signal-ansduction-cascades in the nervous system, Prog.

role of stress-ctivated kinases, JNK and p38, Cell Signal. 13

aud, R. J. Davis, .E. Greenberg, Opposing effects of ERK and

o E, Y. Kasuya, F-X. laret, D.R. Green, M. Karin, Withdrawal of

survival factors results in activation of JNK

9] N. Lambeng, S. Willaime-Morawek, J.

rain Res. 111 (2003) 52-60

3] S. D. Kim, C. K. Moon, S-Y Eun, P. D. Ryu,

4] U. Namgung, Z. Xia, Arsenite-induced

5] F. J. Gunn-Moore, J. M. Tavare, Apoptosis of

pathway in neuronal cells leading to Fas Lingand induction and cell death, Mol. Cell. Biol. 19 (1999) 751-763.

reductase inhibition, J. Neurosci. 20 (2000) 2852-2859. [20] J. G. Schulz, J. Bosel J, M [2

Mariani, M. Ruberg, B. Brugg, Activation of mitogen-activated protein kinase pathways during the death of PC12 cells is dependent on the state of differentiation, Mol B

Mreductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate synthesis, J. Neurochem (2004) 89:24-32. [21] N. García-Román, A. M. Álvarez, M. J. Toro, A. Montes, M. J. Lorenzo, Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosíntesis in

[30] J. Cao, M. M. Semenova, V. T. Solovyan, J. Han, E. L. T. Coffey, Distinct requirements for p38� and c-Jun N-terminal kinase stress-activated protein kinases in different forms of apoptotic neuronal death, J. Biol. Chem. 279 (2004) 35903-35913 (200 [22] L. Lossi, A. Merighi, In vivo cellular and

molecular mechanisms of neuronal apoptosis in the mammalian CNS, Prog. Neurobiol. 69 (2003) 287-312.

[31] S. Willaime-Moravek, K. Brami-Cherrier, J. Mariani, J. Caboche, B. Brugg, c-Jun N-Terminal kinases/c-Jun and p38 pathways cooperate in ceramide-induced neuronal apoptosis, Neuroscience 119 (2003) 387-397. [2 F. Cecconi, Expanding roles of programmed cell

death in mammalian neurodevelopment, Semin. Cell. Dev. Biol. 16 (2005) 281-294. [24] L. Stefanis, R.E. Burke, L.A. Greene, Apoptosis in ne

[32] K. P. Sarker, K. K. Biswas, M. Yamakuchi, R-Y. Lee, T. Hahiguchi, M. Kracht, I. Kitajima, I. Maruyama, ASK-1-p38 MAPK/JNK signaling cascade mediates anandamide-induced PC12 cell death, J. Neurochem. 85 (2003) 50-61. Opin. Neurol. 10 (1997) 299-305.

[25] K. Mielke, T. Herdegen, JNK and p38 stress kinase

[3S. A. Jo, Identification of ASK1, MKK4, JNK, c-Jun and caspase-3 as a signaling cascade involved in cadmium-induced neuronal cell apoptosis, Biochem Biophys Res Comm 328 (2005) 326-334.

trNeurobiol. 61 (2000) 45–60. [26] S. J. Harper, P. LoGrasso, P, Signalling for survival and death in neurones: the

[3apoptosis in cortical neurons is mediated by c-Jun-N-terminal protein kinase 3 and p38 mitogen-activated protein kinase, J. Neurosci. 20 (2000) 6442-6451.

a(2001) 299–310. [27] Z. Xia, M. Dickens, J. Rainge

[3Mcerebellar granule cells induced by serum withdrawal, glutamate or beta-amyloid, is independent of Jun kinase or p38 mitogen activated protein kinase activation, Neurosci. Lett. 250 (1998) 53–56

JNK-p38 MAP kinases on apoptosis, Science 270 (1995) 1326-1331. [28] H. Le-Niculescu, BonfocC

106

Submitted JNKs activation in lovastatin-induced neuronal apoptosis [36] A. Eilers, J. Whitfield, C. Babij, L. L. Rubin, J. Ham, Role of the Jun kinase pathway in the regulation of c-Jun expression and apoptosis in sympathetic neurons, J Neurosci 18 (1998) 1713–1724. [37] C. N. G. Anderson, A. M. Tolkovsky, A role for MAPK/ERK in sympathetic neuron survival: protection against a p53-dependent, JNKindependent induction of apoptosis by cytosine arabinoside, J. Neurosci. 19 (1999) 664–673. [38] Z. Mao, A. Bonni, F. Xia, M. Nadal-Vicens,

. Leppa, R. Saffrich, W. Ansorge, D. ohmann, Differential regulation of c-Jun by ERK

onal ifferentiation in PC12 cells, J. Biol. Chem. 273

riptional control of euronal apoptosis, Biochem. Pharmacol 60 (2000)

J. Ham, Phosphorylation of -Jun is necessary for apoptosis induced by survival

. Weller, T. Klockgether, otassium deprivation-induced apoptosis of

urosci.16 (1996) 4696-706.

6] C. A. Harris, E. M. Jonhson Jr., BH3-only Bcl-

7] F. L. Zhang, P. J. Casey, Protein prenylation:

. Kita, M. S. Brown, J. L. Goldstein, eedback regulation of 3-hydroxy-3-methylglutaryl

Wrighton, B. Seliger, J. Bernal, . Beug, Thyroid hormone receptor/c-erbA:

0] C. Bonny, A. Oberson, S. Negri, C. Sauser,

. Lytle, R. igashikubo, K. M. Rich, Lovastatin-induced up-

chi, T. Hatayama, T. ujii, T. Tsujioka, T. Sugihara, A. Takata, F.

myeloma cells, Oncol. Rep. 11 (2004) 1053-1058.

M. E. Greenberg, Neuronal activity dependent cell survival mediated by transcription factor MEF2, Science 286 (1999) 785–790. [39] SBand JNK during PC12 cell differentiation, EMBO J. 17 (1998) 4404–4413. [40] T. Morooka, E. Nishida, Requirement of p38 mitogen-activated protein kinase for neurd(1998) 24285–24288. [41] J. Ham, A. Eilers, J. Whitfield, S. J. Neame, B. Shah, c-Jun and the transcn1015-1021. [42] A. Watson, A. Eliers, D. Lallemand, J. Kyriakis, L. L. Rubin, csignal withdrawal in cerebellar granule neurons, J. Neurosci.18 (1998) 751-62. [43] J. B. Schulz, MPcerebellar granule neurons: a sequential requirement of new mRNA and protein synthesis, ICE-like protease activity, and reactive oxygen species, J. Ne [44] J. Ham, C. Babij, J. Whitfield, C. M. Pfarr, D. Lallemand, M. Yaniv, L. L. Rubin, A c-Jun dominant negative mutant protects sympathetic

neurons against programmed cell death, Neuron 14 (1995) 927–939. [45] E. B.E. Becker, J. Howell, Y Kodama, P.A. Barker, A. Bonni, Characterization of the c-Jun N-terminal kinase-BimEL signalling pathway in neuronal apoptosis, J. Neurosci. 24 (2004) 8762-8770. [42 Family Members are co-ordinately regulated by the JNK pathway and require Bax to induce apoptosis in neurons, J. Biol Chem. 276 (2001) 37754-37760. [4molecular mechanisms and functional consequences, Ann. Rev. Biochem. 65 (1996) 241-269. [48] TFcoenzyme A reductase in livers of mice treated with mevilonin, a competitive inhibitor of the reductase, J. Clin. Invest. 66 (1980) 1094-1100. [49] A. Muñoz, C. HControl of commitment and differentiation in the neuronal/chromaffin progenitor line PC12, J. Cell Biol. 121 (1993) 423-438. [5D.F. Schorderet, Cell-permeable peptide inhibitors of JNK. Novel blockers of beta-cell death, Diabetes 50 (2001) 77-82. [51] Z. Jiang, X. Zheng, R.AHregulation of the BH3-only protein, Bim, and cell death in glioblastoma cells, J. Neurochemistry 89 (2004) 168-178. [52] T. Otsuki, H. SakaguFHyodoh, M. Eto, Effects of an HMG-CoA reductase inhibitor, simvastatin, on human

107

Submitted JNKs activation in lovastatin-induced neuronal apoptosis

108

[53] M. I. Cerezo-Guisado, L. J. García-Marín, M. J. Lorenzo, M. J. Bragado, Lovastatin inhibits the

rowth and survival pathway of phosphoinositide 3-

Hatanaka, Inhibition of hosphatidylinositol 3-kinase activity elevates c-

.

embers: activators of MAP kinase cascades, Cell

8] G.V. Putcha, S. Le, F. Frank, C.G. Bersili, K.

9] S. S. Le, F. A. Loucks, H. Udo, S. Richardson-

cerebellar ranule neurons, J. Neurochem. 94 (2005) 1025-

4) 7879-7887.

gkinase/protein kinase B in immortalized rat brain neuroblasts, J. Neurochem. 94 (2005) 1277-1287. [54] K. Shimoke, S. Yamagishi, M. Yamada, T. Ikeuchi, H. pJun-N-terminal kinase activity in apoptosis of cultured cerebellar granule neurons, Develop. Brain Res. 112 (1999) 245-253. [55] A.H. Kim, H. Yano, H. Cho, D. Meyer, BMonks, B. Margolis, M. J. Birnabaum, M.V. Chao, Akt1 regulates a JNK scaffold during excitotoxic apoptosis, Neuron 35 (2002) 697-709. [56] A.B. Vojtek, J. A. Cooper, Rho familym82 (1995) 527-529. [57] D. E. Merry, S. J. Korsmeyer, Bcl-2 gene family in the nervous system, Annu. Rev. Neurosci. 20 (1997) 245–267. [5Clark, B. Chu, S. Alix, R. J. Youle, A. LaMarche, A. C. Maroney, E. M. Johnson, Jr, JNK-mediated

Bim phosphorylation potentiates Bax-dependent apoptosis, Neuron 38 (2003) 899-914. [5Burns, R.A. Phelps, R. J. Bouchard, H. Barth, K. Aktories, K.L. Tyler, E.R. Kandel, K.A. Heidenreich, D.A. Linseman, Inhibition of Rac GTPase triggers a c-Jun- and Bim-dependent mitochondrial apoptotic cascade ing1039. [60] S. Okuno, A. Saito, T. Hayashi, P. H. Chan, The c-Jun N-terminal protein kinase signaling pathway mediates Bax activation and subsequent neuronal apoptosis through interaction with Bim alter transient focal cerebral ischemia, J. Neurosci. 24 (200 [61 S. Yoon, J. Choi, J. Yoon, J-W Huh, D. Kim, Okadaic acid induces JNK activation, bim overexpression and mitochondrial dysfunction in cultured rat cortical neurons, Neurosci. Let. 394 (2006) 190-195.

Discusión

Numerosos estudios ponen de manifiesto que la ruta de biosíntesis del colesterol

tiene un papel esencial en el desarrollo, diferenciación y mantenimiento del sistema nervioso (Maltese y Volpe, 1979; Cavender y cols., 1995; Spady y Dietschy, 1983; Opitz y De la Cruz,

1994). Recientemente hemos mostrado que la lovastatina, un inhibidor de la ruta de

biosíntesis del colesterol, induce apoptosis en neuroblastos fetales de rata (García-Román y

cols., 2001). El objetivo del presente trabajo ha sido estudiar los mecanismos intracelulares

implicados en la apoptosis de los neuroblastos inducida por la lovastatina. En particular nos

hemos centrado en estudiar las principales rutas de señalización celular que regulan la

proliferación y la supervivencia celular, la ruta de Ras/ERK y la ruta de la PI3-K/PKB, y las

que regulan la muerte celular, la ruta de la JNK y de la p38 MAPK.

1. EFECTO DE LA LOVASTATINA EN LA ACTIVIDAD DE RAS.

Resultados previos de nuestro grupo ponen de manifiesto que la lovastatina

disminuye la farnesilación de Ras en los neuroblastos fetales de rata (García-Román y cols.,

2001). Por esta razón y en primer lugar, estudiamos si la inhibición de la prenilación de Ras

por la lovastatina en neuroblastos estaba asociada a una disminución de su actividad

biológica. Nuestros resultados muestran que en neuroblastos el tratamiento con la

lovastatina disminuye significativamente la actividad de Ras. Aunque algunas estatinas

parecen inducir la apoptosis a través de mecanismos independientes de la farnesilación de

Ras (Weiss y cols., 1999; Zhong y cols., 2003), nuestros datos coinciden con numerosos

estudios que muestran que las estatinas inhiben la prenilación y, en consecuencia, la

activación de Ras en diferentes tipos celulares no neuronales (Bassa y cols., 1999; Hillyard y

cols., 2002; Miura y cols., 2004; Ghittoni y cols., 2005; Khanzada y cols., 2006). Nuestros

resultados sugieren que los efectos de la lovastatina pueden deberse a su capacidad de

bloquear las vías de transduccción de señales reguladas por Ras

2. EFECTO DE LA LOVASTATINA EN LA RUTA DE LA PI3-K/PKB.

Una de las principales rutas de señalización celular reguladas por Ras es la ruta de

la PI3-K/PKB. Nuestros resultados muestran que el tratamiento de los neuroblastos con la

lovastatina produce una clara inhibición de la actividad quinasa de la PI3-K in vitro. En este

momento desconocemos el mecanismo por el cual el tratamiento con la lovastatina induce

una inactivación de la PI3-K en los neuroblastos. Como se describió en el apartado de la

introducción, la PI3-K se encuentra en el citosol y se puede activar a través de varios

109

Discusión mecanismos: por la unión de la subunidad reguladora p85 a través de sus dominios SH2 a

proteínas fosforiladas en tirosina, o por la unión de la subunidad catalítica p110 a través de

su dominio RBD a Ras activo (Rameh y cols., 1995; Rodríguez-Viciana y cols., 1996). En

relación con este último mecanismo de activación, hay que señalar que inicialmente se

realizaron estudios para investigar la actividad quinasa de la PI3-K asociada a

inmunoprecipitados de Ras. Debido a problemas técnicos con la inmunoprecipitación de

Ras, en estos momentos no podemos implicar a Ras en la activación de la PI3-K en los

neuroblastos. Sin embargo, nuestros resultados muestran que en las mismas condiciones

en las que la lovastatina induce la apoptosis, existe un paralelismo entre la inactivación de la

quinasa PI3-K y la inactivación de Ras, lo que sugiere que la inactivación de Ras puede

contribuir, al menos en parte, a la inhibición de la actividad de la PI3-K. Esta hipótesis se ve

apoyada por estudios realizados en tipos celulares no neuronales, como mioblastos L6, en

los que la sinvastatina inhibe eficientemente la prenilación de Ras, lo que conduce a su

localización en el citoplasma y una consecuente inhibición de la actividad de PI3-K asociada

a Ras (Nakagawa y cols., 1998). Sin embargo, en la literatura existen resultados

contradictorios acerca de la implicación de la ruta Ras/PI3-K en la apoptosis inducida por las

estatinas, ya que también se ha demostrado que en células de músculo liso vascular la

pravastatina inhibe la actividad de la PI3-K al tiempo que provoca la apoptosis de una

manera independiente de Ras (Weiss y cols., 1999).

Otro de los mecanismos de activación de la PI3-K ya mencionados, implica a

proteínas fosforiladas en tirosina, por lo cual, se decidió estudiar la actividad quinasa de la

PI3-K en inmunoprecipitados con un anticuerpo antifosfotirosina. Una lógica y posible

explicación de la inactivación de la PI3-K obtenida con este procedimiento experimental,

supondría que en presencia de la lovastatina se produciría una inhibición de la fosforilación

en tirosina de diversas proteínas, lo cual conduciría a una reducción de la actividad de la

PI3-K. Este mecanismo ha sido descrito para otras estatinas, aunque en otros tipos

celulares (McGuire y cols., 1993, 1994, 1996; Xu y cols., 1996). Sin embargo, esta

explicación no es válida en el modelo de apoptosis de los neuroblastos dado que nuestros

resultados muestran que la cantidad de la subunidad reguladora, p85, que permanece

asociada a proteínas fosforiladas en tirosina no está afectada por el tratamiento con la

lovastatina.

El principal efector de la PI3-K es la proteína PKB/Akt. En este modelo de apoptosis

de los neuroblastos, el tratamiento con la lovastatina produce una marcada reducción de la

fosforilación de la PKB en la Ser473, lo que muestra indirectamente una inhibición de su

actividad quinasa. De acuerdo con nuestros resultados, están los de otros autores que

demuestran que diferentes estatinas producen una disminución de la fosforilación de PKB

110

Discusión

en tipos celulares no neuronales (Weiss y cols., 1999; Chen y cols., 2002; Ben y Yellon,

2003; Campbell y cols., 2004). Sin embargo, estos datos contrastan con los de otros

estudios en los cuales las estatinas producen un aumento en la fosforilación de PKB en

diferentes tipos celulares (Kureishi y cols., 2000; Contreras y cols., 2002; Bell y Yellon, 2003;

Wolfrum y cols., 2004). La inhibición observada de la fosforilación de la PKB en neuroblastos

puede explicarse como una consecuencia directa de la inactivación de la PI3-K observada

tras el tratamiento con la lovastatina, aunque no se debe descartar la posibilidad de que

ocurra una desfosforilación en la Ser473, como ocurre en la apoptosis inducida por ceramida

(Schubert y cols., 2000).

Un sustrato directo de PKB es la quinasa mTOR. Está ampliamente demostrado que

mTOR es esencial para la supervivencia celular mediada por PI3-K/PKB en diferentes tipos

celulares (Woltman y cols., 2003; Butzal y cols., 2004; Stromberg y cols., 2004; Wendel y

cols., 2004; Wang y cols., 2005). Recientemente se ha postulado que mTOR funciona como

una molécula integradora de señales que regulan tanto la apoptosis como el crecimiento

celular (Asnaghi y cols., 2004; Castedo y cols., 2002). Los principales sustratos descritos de

mTOR son proteínas implicadas en el control de la síntesis de proteínas, y por tanto del

crecimiento celular, y son: la proteína quinasa p70S6K o S6K (Brown y cols., 1995; Burnett y

cols., 1998) y la proteína 4EBP1, reguladora del factor de iniciación de la traducción en

eucariotas eIF4E (Gingras y cols., 1999). Nuestros resultados, mostrando que el tratamiento

con la lovastatina conduce a una inhibición de la fosforilación de p70S6K y de 4EBP1, avalan

la idea de que la lovastatina en neuroblastos induce apoptosis al producir una inhibición de

una ruta que regula la supervivencia celular como es PI3-K/PKB/mTOR. La consecuencia

biológica de un descenso en la fosforilación de 4EBP1 es un aumento de su actividad

represora del factor de traducción eIF4E. Así la lovastatina, al disminuir la fosforilación de

4EBP1, provoca de manera consecuente un aumento de la unión 4EBP1-eIF4E, lo que

conlleva a una menor disponibilidad del factor eIF4E para llevar a cabo su función celular de

iniciar la traducción dependiente de caperuza y así promover crecimiento y supervivencia

celular. En este sentido, existen varios estudios que atribuyen un papel inhibidor de la

apoptosis al factor eIF4E cuando está funcionalmente activo (Polunovsky y cols.,1996; Li y

cols., 2003; Li y cols., 2004). Por otro lado, el descenso en la fosforilación de 4EBP1

inducido por la lovastatina podría explicar, parcialmente, la apoptosis observada en los

neuroblastos ya que, utilizando dos aproximaciones experimentales complementarias,

bloqueo farmacológico de la fosforilación y expresión de mutantes de 4EBP1, se ha

demostrado que la inhibición de la fosforilación de 4EBP1 es capaz de provocar apoptosis

(Li y cols., 2002). En cuanto a la proteína quinasa p70S6K, una consecuencia biológica de su

inhibición es una disminución de la fosforilación de la proteína ribosomal S6. Cuando esta

proteína ribosomal es fosforilada se estimula la traducción de aquellos ARNm que contienen

111

Discusión oligopirimidinas en su extremo 5´ (5´-TOP) (Jefferies y cols., 1997). Recientemente, se ha

demostrado que p70S6K fosforila otros sustratos que están implicados en la síntesis de

proteínas, como son los factores de la traducción eIF4B (Gingras y cols., 2001) y la proteína

quinasa eEF2K que fosforila el factor 2 de elongación de la traducción eEF2 (Wang y cols.

2001). Adicionalmente, p70S6K se encuentra formando un complejo con el factor de la

traducción eEF3, que se disocia cuando p70S6K es fosforilada en la Thr389 (Holz y cols.,

2005). Así pues, nuestros resultados confirman estudios previos que han demostrado que

uno de los eventos bioquímicos tempranos en el proceso de apoptosis celular es una rápida

inhibición de la síntesis de proteínas (Holcik y cols., 2000). De manera adicional nuestros

resultados contribuyen a establecer mecanismos moleculares por los que se produce un

bloqueo de una función celular como es la síntesis de proteínas, importante para el

crecimiento y la supervivencia celular, durante la apoptosis en neuroblastos.

El hecho de que dos inhibidores farmacológicos de la PI3-K, LY294002 y

wortmanina, sean capaces de inducir apoptosis en neuroblastos apoyan la idea,

previamente descrita en otros tipos celulares no neuronales (Nakagawa y cols., 1998; Weiss

y cols., 1999; Prasad y cols., 2005), de que una inhibición de la PI3-K puede estar

mediando, al menos parcialmente, la apoptosis inducida por la lovastatina en neuroblastos.

Nuestros datos se ven apoyados por otros estudios en los que los inhibidores de la PI3-K

son capaces de inducir apoptosis en diferentes tipos celulares, como las células MDCK

(Khwaja y cols., 1997) y PC12 (Yao y Cooper., 1995). Sin embargo, únicamente se

observaron efectos en los parámetros indicadores de la apoptosis a las máximas

concentraciones utilizadas de ambos inhibidores. Por esta razón y porque adicionalmente

comprobamos que el grado de apoptosis provocado por la inhibición de la PI3-K es menor

que el inducido por la lovastatina, podemos sugerir la idea de que además de la PI3-K

deben necesariamente estar implicadas otras rutas intracelulares en este modelo de

apoptosis de los neuroblastos.

3. EFECTO DE LA LOVASTATINA EN LA RUTA DE RAS/ERKs.

Otra de las rutas de señalización celular reguladas por Ras es la ruta de

Raf/MEK/ERK. Raf fosforila y activa a las proteínas quinasas MEK1/2 que, a su vez,

fosforilan y activan a las proteínas quinasas ERK1/2. Nuestros resultados muestran

claramente que la lovastatina disminuye la fosforilación, y por lo tanto la actividad, de las

proteínas ERK1/2 de una manera dependiente del tiempo y de la concentración de

lovastatina utilizada. Estos resultados sugieren que la disminución en la fosforilación de las

proteínas ERK1/2 puede estar mediando la apoptosis de los neurobalstos inducida por la

112

Discusión

lovastatina. De acuerdo con nuestros resultados, varios autores muestran que la apoptosis o

la inhibición de la proliferación celular inducida por diferentes estatinas en varios tipos

celulares no neuronales está asociada con una disminución en la fosforilación o actividad de

las proteínas ERK1/2 (Melchert y cols., 2001; Johnson y cols., 2002; Otsuki y cols., 2004;

Takata y cols., 2004; Wu y cols., 2004; Nishida y cols, 2005). Sin embargo, tenemos que

mencionar que las estatinas inhiben la proliferación de células RBL-2H3 de rata (Graham y

cols., 1998) e inducen la apoptosis de células de glioblastoma (Jiang y cols., 2004) de una

manera independiente de la disminución de la fosforilación de las proteínas ERK1/2. La

diferencia que existe entre estos resultados puede deberse, a los diferentes efectos

biológicos que tienen las estatinas en función del tipo celular. Tenemos que señalar que

mientras que la incubación de los neuroblastos con la lovastatina durante 24 horas produce

una inhibición casi completa de la actividad de Ras, sólo disminuye parcialmente la

fosforilación de las proteínas ERK1/2 cuando se compara con las células control. Esta

ausencia de paralelismo puede ser debida a que el tratamiento con la lovastatina active a

diferentes moléculas de señalización intracelular, como las proteínas PKC y Rac (Skaletz-

Rorowski y cols., 2001; Negre-Aminou y cols., 2002), que a su vez estén activando la ruta

Raf/MEK/ERK. Otra posible explicación se basaría en el hecho de que la proteína quinasa

PKB, inactiva en este modelo de apoptosis, no esté fosforilando y, por tanto inhibiendo, la

actividad de Raf (Guan y cols., 2000). De esta forma Raf perdería su regulación negativa por

PKB y podría fosforilar y activar a las proteínas MEK1/2 y éstas a ERK1/2. No se debe

descartar la posibilidad de una inhibición de fosfatasas inducida por la lovastatina.

Está ampliamente aceptado que uno de los mecanismos por los cuales la ruta de

Ras/ERK1/2 promueve la supervivencia neuronal es a través de la activación de la proteína

quinasa p90rsk, que a su vez fosforila y activa al factor de transcripción CREB en la Ser133

(Bonni y cols., 1999). La fosforilación de CREB promueve la supervivencia neuronal

mientras que la desfosforilación de este factor de transcripción induce apoptosis (Mabuchi y

cols., 2001; Hara y cols., 2003). Nuestros resultados indican que la disminución en la

fosforilación de ERK1/2 inducida por la lovastatina está asociada a una disminución

significativa en la fosforilación de CREB de una manera dependiente del tiempo y de la

concentración de lovastatina utilizada. Asimismo, el tratamiento con la lovastatina produce

una disminución de la expresión génica regulada por CREB. La desactivación de la ruta de

señalización Ras/ERK/CREB se ha relacionado con la apoptosis inducida por diferentes

agentes en células neuronales y no neuronales (Bonni y cols., 1999; Mabuchi y cols., 2001;

Lonze y Ginty, 2002; Jaworski y cols., 2003; Rabelo y cols., 2003; Hansen y cols, 2004).

Pero este es el primer trabajo que muestra que las estatinas, y en particular la lovastatina,

inhiben la activación de esta ruta de supervivencia en células neuronales. Estudios recientes

muestran que la sinvastatina inhibe la activación de CREB en células endoteliales a través

113

Discusión de un mecanismo dependiente de la ruta Rho/ROCK (Crespo y cols., 2005). Ya que en

nuestras condiciones experimentales la lovastatina también inhibe la prenilación de la

proteína Rho A (García-Román y cols., 2001) no podemos descartar que la disminución en

la fosforilación de CREB y en la expresión génica regulada por CREB observada en este

trabajo sean también debidas a una desactivación de las rutas de señalización reguladas

por Rho A.

Está ampliamente descrito que CREB puede ejercer sus efectos neuroprotectores a

través de la regulación de la expresión de genes que controlan la superviencia celular tales

como Bcl-2 (Bonni y cols., 1999; Mabuchi y cols., 2001; Sugiura y cols., 2004). Nuestro

grupo también ha mostrado que la lovastatina es capaz de disminuir los niveles

intracelulares de la proteína Bcl-2 (García-Román y cols., 2001) por lo que, en conjunto,

nuestros datos sugieren que la lovastatina podría inducir la apoptosis de los neuroblastos a

través de la inhibición de la ruta de señalización Ras/ERK/CREB y la consecuente

disminución de la expresión de genes que inducen supervivencia celular como Bcl-2.

Nuestros resultados están de acuerdo con otros que muestran que la inhibición de la ruta de

supervivencia celular Ras/ERK/CREB conduce a la apoptosis de celulares neuronales y no

neuronales inducida por diferentes estímulos apoptóticos (Rabelo y cols., 2003; Hansen y

cols., 2004).

Nuestros resultados sugieren que la lovastatina puede inducir apoptosis por su

capacidad de inhibir la ruta Ras/ERK/CREB, por lo que a continuación estudiamos si la

inhibición farmacológica de esta ruta puede inducir la apoptosis en los neuroblastos.

Nuestros resultados muestran que PD98059 induce la apoptosis de los mismos siendo su

efecto mucho menor que el observado con la lovastatina. Sin embargo, PD98059 aumenta

significativamente la apoptosis de los neuroblastos inducida por lovastatina. Nuestros

resultados están de acuerdo con otros que muestran que la inhibición de la ruta

Ras/Raf/MEK/ERK, por sí sola, no promueve la muerte celular pero potencia la apoptosis

inducida por diferentes estatinas y otros estímulos apoptóticos en células no neuronales

(Brantley-Finley y cols., 2003; Rabelo y cols., 2003; Takata y cols., 2004; Wu y cols., 2004).

114

Discusión

4. EFECTO DE LA INHIBICIÓN DE LAS RUTAS DE LA PI3-K Y DE LAS ERKs EN LA SUPERVIVENCIA DE LOS NEUROBLASTOS.

Nuestros resultados muestran por primera vez que la lovastatina es capaz de inhibir

las dos rutas de señalización que inducen la supervivencia celular, la de la PI3-K y la de las

ERKs, en neuroblastos fetales de rata. Por otra parte, también muestran que la inhibición

farmacológica de cada una de estas rutas, por separado, no es suficiente para inducir la

apoptosis de los neuroblastos observada con la lovastatina. Por ello, se estudió el efecto de

una inhibición conjunta de ambas rutas en la supervivencia de los neuroblastos. Nuestros

resultados muestran que la inhibición conjunta de ambas rutas potencia los efectos en la

apoptosis de los neuroblastos que se observa cuando se inhibe a cada una de las rutas por

separado, siendo su efecto comparable al producido por la lovastatina. Por lo tanto, nuestros

resultados sugieren que la lovastatina puede inducir la apoptosis de los neuroblastos por su

capacidad de inhibir, de forma simultánea, las rutas de supervivencia celular de

Raf/MEK/ERK y la de PI3-K/PKB.

5. EFECTO DE LA LOVASTATINA EN LAS RUTAS DE LAS JNKs Y p38 MAPK.

Se ha descrito que, además de la inhibición de la actividad de las rutas que regulan

la supervivencia celular, es necesario que se produzca la activación de las rutas que

controlan la muerte celular para inducir la apoptosis neuronal (Xia y cols., 1995). Nuestros

resultados muestran que el tratamiento con la lovastatina aumenta la actividad de las

proteínas JNKs en los neuroblastos fetales de rata de una forma dependiente del tiempo y

de la concentración de lovastatina utilizada, mientras que los niveles de fosforilación de p38

MAPK no se ven modificados. Nuestros datos sugieren que la activación de la ruta de las

JNKs, pero no la de las p38 MAPKs, puede mediar la apoptosis de los neuroblastos inducida

por la lovastatina y sostiene que las JNKs son las principales proteínas quinasas que

producen la muerte neuronal (Carimalo y cols., 2005; Lee y cols., 2005; Kanzawa y cols.,

2006). Nuestros resultados están de acuerdo con los obtenidos en otros estudios que

muestran que diferentes estatinas inducen la apoptosis de células no neuronales a través de

la activación de las JNKs sin afectar a la activación de las p38 MAPKs (Kaneta y cols., 2003;

Koyuturk y cols., 2004). Por el contrario, otros estudios muestran que las estatinas inducen

apoptosis celular de una forma independiente de la activación de JNK (Otsuki y cols., 2004;

Kibayashi y cols., 2005; Takata y cols., 2004; Wu y cols., 2004). Nuevamente, esta

discrepancia en los resultados puede deberse a los diferentes efectos biológicos que tienen

115

Discusión las estatinas en función del tipo celular. De momento, desconocemos el mecanismo

mediante el cual la lovastatina aumenta la actividad de las proteínas JNKs en nuestras

condiciones experimentales. Es posible que sea consecuencia de la disminución de la

actividad de la ruta de la PI3-K/PKB producida por la lovastatina, ya que estudios previos

muestran que la inhibición de esta ruta debida a una disminución de la concentración de

potasio extracelular, está asociada a un aumento en la actividad de las proteínas JNKs y a la

inducción de la apoptosis en células granulares de cerebelo (Shimoke y cols., 1999).

Uno de los mecanismos por los cuales las proteínas JNKs promueven la muerte

neuronal es a través de la fosforilación y, en consecuencia, de la activación del factor de

transcripción c-Jun (Palmada y cols., 2002; Willaime-Morawek y cols., 2003; Oh y cols.,

2006). Nuestros resultados muestran que el aumento de la actividad de las proteínas JNKs

inducida por la lovastatina está asociado con un aumento de la fosforilación y de los niveles

de expresión del factor de transcripción c-Jun de una forma dependiente del tiempo y de la

concentración de lovastatina utilizada. Pero a diferencia de lo que ocurre con la actividad de

las proteínas JNKs, que es máxima a las 24 horas después del tratamiento con la

lovastatina, los niveles de expresión y de fosforilación de c-Jun alcanzan su máximo entre

las 3 y 6 horas, disminuyendo a continuación. Este efecto bifásico podría deberse en parte a

la activación de fosfatasas que estarían desfosforilando y, en consecuencia, desactivando a

c-Jun. La fosforilación de c-Jun se ha asociado con la apoptosis celular inducida por las

estatinas en otros modelos celulares (Kaneta y cols., 2003; Koyuturk y cols., 2004), pero

esta es la primera vez que se asocia con la muerte de los neuroblastos.

c-Jun forma parte del factor de transcripción AP-1 (Karin y cols., 1997). La actividad

de AP-1 tiene una función esencial en la apoptosis neuronal (Porcile y cols., 2003; Li y cols.,

2005; Jin y cols., 2006). Nuestros resultados muestran que la lovastatina aumenta la

actividad del factor de transcripción AP-1 de una forma dependiente del tiempo y de la

concentración de lovastatina utilizada. Los efectos de la lovastatina en la actividad de AP-1

son paralelos a los observados en la fosforilación de c-Jun, lo que sugiere que, en nuestras

condiciones experimentales, c-Jun puede ser el componente principal del factor de

transcripción AP-1. Por otra parte, pudimos comprobar que el aumento de la actividad del

factor de transcripción AP-1 se traduce en un aumento de la transcripción de los genes que

éste controla, ya que la lovastatina provoca un aumento en la expresión del gen de la

luciferasa controlado por TRE, elemento de respuesta al que se une AP-1. En conjunto

nuestros resultados sugieren que la lovastatina puede inducir la apoptosis de los

neuroblastos al inducir la expresión de genes pro-apoptóticos dependientes de la ruta

JNK/c-Jun.

116

Discusión

Entre los genes pro-apoptóticos regulados por JNK/c-Jun se encuentra bim. Varios

estudios muestran que la proteína Bim promueve apoptosis neuronal por un mecanismo

dependiente de la ruta JNK/c-Jun (Harris y Johnson, 2001; Putcha y cols., 2003; Okuno y

cols., 2004; Le y cols., 2005; Jin y cols., 2006). En este trabajo mostramos que la lovastatina

produce un aumento de los niveles intracelulares de la proteína BimEL de una manera

dependiente del tiempo y de la concentración de lovastatina utilizada. Previamente, Jiang y

cols. (2004) mostraron que la lovastatina induce la apoptosis en células de glioblastoma

aumentando la expresión de BimEL de una forma independiente de las MAPKs. Por lo tanto,

nuestros resultados muestran por primera vez, que una estatina puede inducir la apoptosis

neuronal a través de un aumento en la expresión de Bim inducido por la ruta de JNK/c-Jun.

Finalmente, nuestros datos muestran claramente que la apoptosis de los

neuroblastos inducida por la lovastatina está mediada por la ruta de JNK/c-Jun, ya que un

inhibidor específico de esta ruta, el péptido inhibidor I, previene los efectos de la lovastatina

en la fosforilación de c-Jun, la expresión de Bim, la actividad de caspasa 3 y de todos los

parámetros indicadores de la apoptosis celular. Por otra parte, la utilización de inhibidores

específicos de la p38 MAPK, SB 203580 y BIRB 796, no previene la apoptosis inducida por

la lovastatina, lo que confirma que la ruta de la p38 MAPK no está implicada en este modelo

de apoptosis neuronal. Nuestros resultados concuerdan con los de Koyuturk y cols. (2004)

que demuestran que la inhibición farmacológica de la ruta de las JNKs, pero no la de la p38

MAPK, previene los efectos apoptóticos de la sinvastatina en células de glioma C6.

En conjunto estos resultados muestran por primera vez que la lovastatina es capaz

de inducir la apoptosis de los neuroblastos a través de la activación de las JNKs, la

consecuente fosforilación de c-Jun, la inducción de Bim y la activación de caspasa 3.

Los efectos de la lovastatina descritos en este trabajo son específicos ya que se

previenen completamente en presencia de mevalonato, el producto de la HMG-CoA

reductasa, lo que implica que dichos efectos se deben a la capacidad que tiene la

lovastatina de inhibir la actividad de la HMG-CoA reductasa.

117

Discusión

6. LAS ESTATINAS Y LAS RUTAS DE SEÑALIZACIÓN INTRACELULAR.

Los efectos antiproliferativos y apoptóticos de las estatinas se han mostrado en

varios sistemas experimentales (Hillyard y cols., 2002; Zhong y cols., 2003; Matzno y cols.,

2005; Zhong y cols., 2005). En todos los estudios, incluido el nuestro, se sugiere que los

efectos de las estatinas se deben principalmente a una inhibición de la prenilación de varias

proteínas implicadas en el crecimiento y la supervivencia celular, como las proteínas Ras y

RhoA. Pero los mecanismos moleculares concretos responsables de los efectos apoptóticos

y antiproliferativos de las estatinas en diferentes tipos celulares son heterogéneos. En este

sentido, nuestro grupo sugiere por primera vez que, en células neuronales, la lovastatina

puede inducir la apoptosis por 1) su capacidad de inhibir la prenilación de proteínas, 2)

provocar la inactivación simultánea de las rutas de la PI3-K y de las ERKs y 3) estimular la

activación de la ruta de las JNKs, sin afectar a la ruta de la p38 MAPK. Sin embargo, un

estudio defiende que las estatinas pueden inducir apoptosis al disminuir la actividad de las

ERKs sin afectar a los niveles de activación de las JNKs en células de músculo liso vascular

(Takata y cols., 2004). Otro trabajo muestra que algunas estatinas pueden inducir la

apoptosis de células C6 de glioma vía JNK sin afectar a los niveles de activación ni de las

ERKs ni de la PI3-K (Koyuturk y cols., 2004). El grupo de Chen y cols., (2004) muestra que

el efecto de las estatinas está asociado a una activación de las ERKs y de la p38 MAPK.

Mientras que Otsuki y cols. (2004) muestran que la sinvastatina es capaz de inducir la

apoptosis por la inactivación de las ERKs, las JNKs y la p38 MAPK, Jiang y cols., (2004)

postulan que es precisamente la activación de estas tres rutas lo que está relacionado con la

apoptosis inducida por lovastatina en células de glioblastoma. Esta gran heterogeneidad que

se encuentra en la literatura en lo que se refiere al efecto de las estatinas puede deberse al

tipo de estatina utilizado y al tipo celular objeto de estudio.

La lovastatina se utiliza de forma habitual en el tratamiento de la hipercolestrolemia,

es capaz de atravesar la barrera hematoencefálica y se detecta en el fluido cerebroespinal

(Triscari y cols., 1993). Estudios epidemiológicos muestran que esta droga puede producir

efectos secundarios en el SNC. Los efectos de la lovastatina en la regulación de la actividad

de diferentes rutas de transducción de señales mostrados en este trabajo pueden contribuir

a explicar los efectos secundarios que produce esta droga en el SNC. Por lo tanto nuestros

resultados junto con los estudios epidemiológicos y experimentales, aportan datos

suficientes para plantear de forma más cuidadosa, la elección y la dosis de la droga que se

utilice para el tratamiento de la hipercolesterolemia.

118

Discusión

Esquema general de los mecanismos de señalización intracelular implicados en

la apoptosis de los neuroblastos inducida por la lovastatina.

PI3-K

FT

Raf JNK

MEK1/2

ERK1/2

CREB

PKB

mTOR

p70S6K

Bcl-2

Rac

c-Jun

BIM

CASPASA 3

APOPTOSIS DE LOS NEUROBLASTOS

c-Jun c-Jun

c-Jun c-Fos

AP-1

LOVASTATINA

?

Ras

F

Ras

4EBP1P

eIF4E4EBP1

SÍNTESIS DEPROTEÍNAS

PI3-KPI3-K

FT

RafRaf JNKJNK

MEK1/2MEK1/2

ERK1/2ERK1/2

CREBCREB

PKBPKB

mTORmTOR

p70S6Kp70S6K

Bcl-2

RacRac

c-Junc-Jun

BIMBIM

CASPASA 3CASPASA 3

APOPTOSIS DE LOS NEUROBLASTOS

c-Jun c-Jun

c-Jun c-Fos

c-Jun c-Jun

c-Jun c-Fos

AP-1

LOVASTATINA

?

Ras

F

RasRas

FF

RasRas

4EBP1P

4EBP1PP

eIF4E4EBP1eIF4E4EBP14EBP1

SÍNTESIS DEPROTEÍNASSÍNTESIS DEPROTEÍNAS

119

Conclusiones

CONCLUSIONES.

1. El tratamiento de los neuroblastos con lovastatina produce una

disminución de la actividad de la proteína Ras.

2. El tratamiento de los neuroblastos con lovastatina produce una inactivación

enzimática de la proteína quinasa PI3-K y una inhibición de la fosforilación

de PKB.

3. El tratamiento de los neuroblastos con lovastatina provoca una inhibición

de la fosforilación de las proteínas p70S6K y 4EBP-1 implicadas en el

control de la síntesis de proteínas dependiente de caperuza.

4. La incubación de los neuroblastos con lovastatina disminuye la

fosforilación de las proteínas ERK1/2, del factor de transcripción CREB y la

expresión génica regulada por dicho factor de transcripción.

5. Es necesaria la inhibición conjunta de las rutas de supervivencia celular,

PI3-K y ERK, para inducir una apoptosis similar a la inducida por la

lovastatina.

6. La incubación de los neuroblastos con lovastatina produce la activación

enzimática de las proteínas quinasas JNKs, la fosforilación de c-Jun y un

aumento, tanto en la actividad del factor de transcripción AP-1, como en la

expresión génica regulada por dicho factor de transcripción. Todo ello

conlleva a la expresión de la proteína pro-apoptótica Bim y a la activación

de la caspasa 3.

7. El tratamiento de los neuroblastos con lovastatina no afecta a la

fosforilación de la proteína p38 MAPK.

121

Conclusiones

122

En definitiva, de nuestro estudio se puede obtener la siguiente conclusión general:

La apoptosis de neuroblastos inducida por la lovastatina está asociada a la

inactivación de la proteína Ras, la inhibición de las rutas que regulan la supervivencia

celular, PI3-K y ERKs, y a la activación de la principal ruta de señalización celular que

controla la muerte neuronal, la ruta de las JNKs. Por lo tanto, el balance o la

integración de estas rutas de señalización intracelular desencadenan la apoptosis de

los neuroblastos inducida por la lovastatina.

Bibliografía

Adamson P, Marshall CJ, Hall A, Tilbrook PA. (1992). Post-translational modifications of

p21rho proteins. J. Biol. Chem. 267: 20033-20038.

Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P. (1997). Characterization of a 3-phosphoinositide-dependent protein kinase which

phosphorylates and activates protein kinase B alpha. Curr. Biol. 7: 261–269.

Asnaghi L, Bruno P, Priulla M, Nicolin A. (2004). mTOR: a protein kinase switching

between life and death. Pharmacol. Res. 50: 545-549.

Baker SK, Tarnopolsky MA. (2005). Statin-associated neuromyotoxicity. Drugs Today. 41:

267-293. Barinaga M. (1993). Death gives birth to the nervous system but how?. Science. 259: 762-

763.

Barr RK, Kendrick TS, Bogoyevitch MA. (2002). Identification of the critical features of a

small peptide inhibitor of JNK activity. J. Biol. Chem. 277: 10987-10997.

Bassa BV, Roh DD, Vaziri ND, Kirschenbaum MA, Kamanna VS. (1999). Effect of

inhibition of cholesterol synthetic pathway on the activation of Ras and MAP kinase in

mesangial cells. Biochim Biophys Acta. 1449: 137-149.

Becker EB, Bonni A. (2004). Cell cycle regulation of neuronal apoptosis in development and

disease. Prog. Neurobiol. 72: 1-25.

Bell RM, Yellon DM. (2003). Atorvastatin, administered at the onset of reperfusion, and

independent of lipid lowering, protects the myocardium by up-regulating a pro-survival

pathway. J Am. Coll. Cardiol. 41:508–515.

Bernards A, Settleman J. (2004). GAP control: regulating the regulators of small GTPases.

Trends Cell Biol. 14:377-385.

Besirli CG., Johnson EM Jr. (2003). JNK-independent activation of c-Jun during neuronal

apoptosis induced by multiple DNA-damaging agents. J. Biol. Chem. 278: 22357–22366.

Blumenthal RS. (2000). Statins: Effective antiatherosclerotic therapy. Am. Heart. J. 139:

577-583.

Bonni A, Brunet A, West AE, Datta SR, Takasu MA, Greenberg ME. (1999). Cell survival

promoted by the Ras-MAPK signaling pathway by transcription-dependent and independent

mechanisms. Science. 286: 1358-1362.

Borsello T, Clarke PG, Hirt L, Vercelli A, Repici M, Schorderet DF, Bogousslavsky J, Brantley-Finley C, Lyle CS, Du L, Goodwin ME, Hall T, Szwedo D, Kaushal GP, Cambers TC. (2003). The JNK, ERK and p53 pathways play distinct roles in apoptosis

mediated by the antitumor agents vinblastine, doxorubicin, and etoposide. Biochem.

Pharmacol. 66: 459-469.

Brown EJ, Beal PA, Keith CT, Chen J, Shin TB, Schreiber SL. (1995). Control of p70s6

kinase by kinase activity of FRAP in vivo. Nature. 377: 441-446.

123

Bibliografía Brown MS, Goldstein JL. (1980). Multivalent feedback regulation of HMG CoA reductase, a

control mechanism coordinating isoprenoid synthesis and cell growth. J. Lipid. Res. 21:505-

517.

Brunet A, Datta S, Greenberg M. (2001). Transcription-dependent and-independent control

of neuronal survival by the PI3K-Akt signalling pathway. Curr. Opin. Neurobiol. 11: 297–305.

Burnett PE, Barrow RK, Cohen NA, Zinder SH, Sabatini DM. (1998). RAFT1

phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc. Natl. Acad.

Sci. USA. 95: 1432-1437.

Butzal M, Loges S, Schweizer M, Fischer U, Gehling UM, Hossfeld DK, Fiedler W. (2004). Rapamycin inhibits proliferation and differentiation of human endothelial progenitor

cells in vitro. Exp. Cell. Res. 300: 65-71.

Campbell M, Allen WE, Sawyer C, Vanhaesebroeck B, Trimble ER. (2004). Glucose-

potentiated chemotaxis in human vascular smooth muscle is dependent on cross-talk

between the PI3K and MAPK signaling pathways. Circ. Res. 95: 380-388.

Campbell SL, Khosravi-Far R, Rossman KL, Clark GJ, Der CJ. (1998). Increasing

complexity of Ras signaling. Oncogene. 17:1395–1413.

Cantrell DA. (2001). Phosphoinositide 3-kinase signalling pathways. J. Cell. Sci. 114: 1439-

1445.

Cardone MH, Roy N, Stennicke HR, Salvesen GS, Franke TF, Stanbridge E, Frisch S, Reed JC. (1998). Regulation of cell death protease caspase-9 by phosphorylation. Science.

282:1318-1321.

Carimalo J, Cronier S, Petit G, Peyrin JM, Boukhtouche F, Arbez N, Lemaigre-Dubreuil Y, Brugg B, Miquel MC. (2005). Activation of the JNK-c-Jun pathway during the early phase

of neuronal apoptosis induced by PrP106-126 and prion infection. Eur. J. Neurosci. 21: 2311-

2319.

Casey PJ. (1995). Protein lipidation in cell signaling. Science. 268: 221–5.

Castedo M, Ferri KF, Kroemer G. (2002). Mammalian target of rapamycin (mTOR): pro-

and anti-apoptotic. Cell Death Differ. 9: 99-100.

Cavender CP, Turley SD, Dietschy JM. (1995). Sterol metabolism in fetal, newborn and

suckled lambs and their response to cholesterol after weaning. Am. J. Physiol. 269: E331-

E340.

Cecconi F, Alvarez-Bolado G, Meyer BI, Roth KA, Gruss P. (1998). Apaf1 (CED-4

homolog) regulates programmed cell death in mammalian development. Cell. 94: 727–737.

Chen Z, Fukutomi T, Zago AC, Ehlers R, Detmers PA, Wright SD, Rogers C, Simon DI. (2002). Simvastatin reduces neointimal thickening in lowdensity lipoprotein receptor-deficient

mice after experimental angioplasty without changing plasma lipids. Circulation. 106: 20–23.

124

Bibliografía

Chen Z, Gibson TB, Robinson F, Silvestro L, Pearson G, Xu B, Wright A, Vanderbilt C, Cobb MH. (2001). MAP kinases. Chem. Rev. 101: 2449–2476.

Chen JC, Huang KC, Wingerd B, Wu WT, Lin WW. (2004). HMG-CoA reductase inhibitors

induce COX-2 gene expression in murine macrophages: role of MAPK cascades and

promoter elements for CREB and C/EBPbeta. Exp. Cell Res. 301: 305-319.

Choi KM, Macmahon LP, Lawrence JCJr. (2003). Two motifs in the translational repressor

PHAS-I required for efficient phosphorylation by mammalian target of rapamycin and for

recognition by raptor. J. Biol. Chem. 278: 19667-19673.

Chong H, Vikis HG, Guan KL. (2003). Mechanisms of regulating the Raf kinase family. Cell

Signal. 15:463–469.

Chu CT, Levinthal DJ, Kulich SM, Chalovich EM, DeFranco DB. (2004). Oxidative

neuronal injury. The dark side of ERK1/2. Eur. J. Biochem. 271: 2060–2066.

Coelho CM, Leevers SJ. (2000). Do growth and cell division rates determine cell size in

multicellular organisms?. J. Cell. Sci. 113 : 2927-2934.

Cohen P. (2002). Protein Kinases- the major drugs target of the twenty-first century?. Nature

Rev.Drug Disc. 1: 309-315.

Contreras JL, Smyth CA, Bilbao G, Young CJ, Thompson JA, Eckhoff DE. (2002).

Simvastatin induces activation of the serine-threonine protein kinase AKT and increases

survival of isolated human pancreatic islets. Transplantation. 74: 1063-1069.

Corsini A, Bellosta S, Baetta R, Fumagalli R, Bernini F. (1999). New insights into the

pharmacodynamics and pharmacokinetic properties of statins. Pharmacol. Ther. 84: 413-

428.

Coso OA, Chiariello M, Yu JC, Teramoto H, Crespo P, Xu N, Miki T, Gutkind JS. (1995).

The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK

signalling pathway. Cell. 81:1137-46.

Cox A, Der CJ. (2003). The dark side if Ras: regulation of apoptosis. Oncogene. 22: 8999-

9006.

Crespo J, Martinez-Gonzalez J, Rius J, Badimon L. (2005). Simvastatin inhibits NOR-1

expression induced by hyperlipemia by interfering with CREB activation. Cardiovasc. Res.

67: 333-341.

Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. (1995). Inhibition of

glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 378: 785-789.

Cryns V, Yuan J. (1998). Proteases to die for. Genes Dev. 12 : 1551–1570.

Dan I, Watanabe NM, Kusumi A. (2001). The Ste20 group kinases as regulators of MAP

kinase cascades. Trends Cell Biol. 11: 220–230.

Darzynkiewicz Z, Bruno S, Bino GD, Goreczyca W, Hotz MA, Lassota P, Traganos F. (1992). Features of apoptotic cells measrues by flow cytometry. Cytometry. 13: 795-808.

125

Bibliografía Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. (1997). Akt

phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell.

91: 231-241.

Davis RJ. (2000). Signal transduction by the JNK group of MAP Kinases. Cell. 103: 239-252.

De Zio D, Giunta L, Corvaro M, Ferraro E, Cecconi F. (2005). Expanding roles of

programmed cell death in mammalian neurodevelopment. Semin. Cell. Dev. Biol. 16: 281-

294.

Devarenne TP, Ekengren SK, Pedley KF, Martin GB. (2006). Adi3 is a Pdk1-interacting

AGC kinase that negatively regulates plant cell death. EMBO J. 25: 255-265.

Donovan N, Becker EBE, Konishi Y, Bonni A. (2002). JNK phosphorylation and activation

of BAD couples the stress-activated signaling pathway to the cell death machinery. J. Biol.

Chem. 277: 40944–40949.

Drysdale BE, Zacharchuk CM, Shin HS. (1983). Mechanism of macrophage-mediated

cytotoxicity: production of a soluble cytotoxic factor. J. Immunol. 131: 2362-2367.

Duits N, Bos FM. (1993). Depressive symptoms and cholesterol-lowering drugs. Lancet.

341: 114.

Duronio V, Scheid MP, Ettinger S. (1998). Downstream signalling events regulated by

phosphatidylinositol 3-kinase activity. Cell Signal. 10: 233-239. Edison RJ, Muenke M. (2004a). Central nervous system and limb anomalies in case reports

of first-trimester statin exposure. N. Engl. J. Med. 350: 1579-1582.

Edison RJ, Muenke M. (2004b). Mechanistic and epidemiologic considerations in the

evaluation of adverse birth outcomes following gestational exposure to statins. Am. J. Med.

Genet. 131A: 287-298.

Fleming Y, Armstrong CG, Morrice N, Paterson A, Goedert M, Cohen P. (2000). Biochem. J. 352: 145–154.

Freshney NW, Rawlinson L, Guesdon F, Jones E, Cowley S, Hsuan J, Saklatvala J. (1994). Interleukin-1 activates a novel protein kinase cascade that results in the

phosphorylation of HSP27. Cell. 78: 1039-1049.

Friesen JA, Rodwell VW. (2004). The 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA)

reductases. Genome Biol. 5: 248.

Frodin M, Gammeltoft S. (1999). Role and regulation of 90 KDa ribosomal S6 kinase (RSK)

in signal transduction. Mol. Cell Endocrinol. 151: 65-77.

Gagliardini V, Fernandez PA, Lee RK, Drexler HC, Rotello RJ, Fishman MC, Yuan J. (1994). Prevention of vertebrate neuronal death by the crmA gene. Science. 263: 826–828.

García Román N, Álvarez AM, Toro MJ, Montes A, Lorenzo MJ. (2001). Lovastatin

induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of

nonsterol isoprenoid biosynthesis inhibition. Mol. Cell Neurosci. 17: 329-341.

126

Bibliografía

Geyer M, Wittinghofer A. (1997). GEFs, GAPs, GDIs and effectors: taking a closer (3D)

look at the regulation of Ras-related GTP-binding proteins. Curr. Opin. Struct. Biol. 7:786–

792.

Ghittoni R, Patrussi L, Pirozzi K, Pellegrini M, Lazzerini PE, Capecchi PL, Pasini FL, Baldari CT. (2005). Simvastatin inhibits T-cell activation by selectively impairing the function

of Ras superfamily GTPases. FASEB J. 19: 605-607.

Giasson BI, Mushynski WE. (1997). Study of proline-directed protein kinases involved in

phosphorylation of the heavy neurofilament subunit. J. Neurosci. 17: 9466-9472.

Gingras AC, Gygi SP, Raught B, Polakiewicz RD, Abraham RT, Hoekstra MF, Aebersold R Sonenberg N. (1999). Regulation of 4E-BP1 phosphorylation: a novel two-step

mechanism. Genes Dev. 13: 1422-1437.

Gingras AC, Raught B, Sonenberg N. (2001). Regulation of translation initiation by

FRAP/mTOR. Genes Dev. 15: 807-826.

Glucksman A. (1951). Cell deaths in normal vertebrate ontogeny. Biol. Rev. 26: 59-86.

Goedert M, Cuenda A, Craxton M, Jakes R, Cohen P. (1997a). Activation of the novel

stress-activated protein kinase SAPK4 by cytokines and cellular stresses is mediated by

SKK3 (MKK6); comparison of its substrate specificity with that of other SAP kinases. EMBO

J. 16: 3563–3571.

Goedert M, Hasegawa J, Craxton M, Leversha MA, Clegg S. (1997b). Assignment of the

human stress-activated protein kinase-3 gene (SAPK3) to chromosome 22q13.3 by

fluorescence in situ hybridization. Genomics. 41: 501–502.

Golden LH, Insogna KL. (2004). The expanding role of PI3-kinase in bone. Bone. 34 : 3-12. Goldstein JL, Brown MS. (1990). Regulation of the mevalonate pathway. Nature. 343: 425-

429.

Gonzalez-Garcia M, Garcia I, Ding L, O'Shea S, Boise LH, Thompson CB, Nunez G. (1995). bcl-x is expressed in embryonic and postnatal neural tissues and functions to prevent

neuronal cell death. Proc. Natl Acad. Sci. USA. 92: 4304–4308.

Graaf MR, Richel DJ, van Noorden CJF, Guchelarr HJ. (2004). Effect of statins and

farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat

Rev. 30: 609-641.

Graham TE, Pfeiffer JR, Lee RJ, Kusewitt DF, Martinez AM, Faotz T, Wilson BS, Oliver JM. (1998). MEK and ERK activation in ras-disabled RBL-2H3 mast cells and novel roles for

geranylgeranylated and farnesylated proteins in Fc ecpsilonRI-mediated signaling. J.

Immunol. 161: 6733-6744.

Gross A, Yin XM, Wang K, Wei MC, Jockel J, Milliman C, Erdjument-Bromage H, Tempst P, Korsmeyer SJ. (1999). Caspase cleaved BID targets mitochondria and is

127

Bibliografía required for cytochrome c release, while BCL-XL prevents this release but not tumour

necrosis factor-R1/Fas death. J. Biol. Chem. 274: 1156–63.

Guan KL, Figueroa C, Brtva TR, Zhu T, Taylor J, Barber TD, Vojtek AB. (2000). Negative

regulation of the serine/threonine kinase B-Raf by Akt. J. Biol. Chem. 275: 27354-27359.

Guijarro C, Blanco-Colio LM, Ortego M, Alonso C, Ortiz A, Plaza JJ, Diaz C, Hernández G, Egido J. (1998). 3-Hidroxy-3methylglutaryl coenzyme A reductase and isoprenylation

inhibitors induce apoptosis of vascular smooth muscle cells in culture. Cir. Res. 83: 490-500.

Hall A. (1998). Rho GTPases and the actin cytoskeleton. Science. ;279:509–14.

Hall C, Michael G, Cann N, Ferrari G, Teo M, Jacobs T, Monfries C, Lim L. (2001).

alpha2-chimaerin, a Cdc42/Rac1 regulator, is selectively expressed in the rat embryonic

nervous system and is involved in neuritogenesis in N1E-115 neuroblastoma cells. J.

Neurosci. 21: 5191–5202.

Hallberg B, Rayter SI, Downward J. (1994). Interaction of Ras and Raf in intact mammalian

cells upon extracellular stimulation. J. Biol. Chem. 269:3913–3916.

Han J, Lee JD, Bibbs L, Ulevitch RJ. (1994). A MAP kinase targeted by endotoxin and

hyperosmolarity in mammalian cells. Science. 265: 808–811.

Hancock JF, Magee AI, Childs JE, Marshall CJ. (1989). All ras proteins are

polyisoprenylated but only some are palmitoylated Cell. 57: 1167–1177.

Hansen HH, Briem T, Dzietko M, Sifringer M, Voss A, Rzeski W, Zdzisinska B, Thor F, Heumann R, Stepulak A, Bittigau P, Ikonomidou C. (2004). Mechanisms leading to

disseminated apoptosis following NMDA receptor blockade in the developing rat brain.

Neurobiol. Dis.16: 440-453.

Hara T, Hamada J, Yano S, Morioka M, Kai Y, Ushio Y. (2003). CREB is required for

acquisition of ischemic tolerance in gerbil hippocampal CA1 region. J. Neurochem. 86: 805–

814.

Harper SJ, LoGrasso P. (2001) Signalling for survival and death in neurones: the role of

stress-activated kinases, JNK and p38. Cell Signal. 13: 299–310.

Harris CA, Deshmukh M, Tsui-Pierchala B, Maroney AC, Johnson Jr EM. (2002).

Inhibition of the c-Jun N-terminal kinase signalling pathway by the mixed lineage kinase

inhibitor CEP-1347 (KT7515) preserves metabolism and growth of trophic factor-deprived

neurons. J. Neurosci. 22: 103–113.

Harris CA, Johnson EM Jr. (2001). BH3-only BCL-2 family members are coordinately

regulated by the JNK pathway and re-quire BAX to induce apoptosis in neurons. J. Biol.

Chem. 276: 37754–37760. Hawkins PT, Jackson TR, Stephens LR. (1992). Platelet-derived growth factor stimulates

synthesis of PtdIns(3,4,5)P3 by activating a PtdIns(4,5)P2 3-OH kinase. Nature. 358 : 157-

159.

128

Bibliografía

Hengartner MO, Horvitz RH. (1994). C. elegans cell survival gene ced-9 encodes a

functional homolog of the mammalian ptotooncogen bcl-2. Cell. 76: 665-676.

Hetman M, Gozdz A. (2004). Role of extracellular signal regulated kinases 1 and 2 in

neuronal survival. Eur. J. Biochem. 271: 2050-2055.

Hibi M, Lin A, Smeal T, Minden A, Karin M. (1993). Identification of an oncoprotein and UV

responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes

Dev. 7: 2135-2148.

Hillyard DZ, Cameron AJ, McIntyre AH, Hadden MH, Marshall HE, Johnston N, Jardine AG. (2002). Inhibition of proliferation and signalling mechanisms in human lymphocytes by

fluvastatin. Clin. Exp. Pharmacol. Physiol. 29: 673-678.

Holcik M, Sonenberg N, Korneluk RG. (2000). Internal ribosome initiation of translation and

the control of cell death. Trends Genet. 16: 469-473.

Holland EC, Sonenberg N, Pandolfi PP, Thomas G. (2004). Signalling control of mRNA

translation in cancer pathogenesis. Oncogene. 23: 3138-3144.

Holz MK, Ballif BA, Gygi SP, Blenis J. (2005). mTOR and S6K1 mediate assembly of the

translation preinitiation complex through dynamic protein interchange and ordered

phosphorylation events. Cell. 123: 569-580.

Hresko RC, Mueckler M. (2005). mTOR-RICTOR is the Ser473 Kinase for Akt/Protein

Kinase B in 3T3-L1 Adipocytes. J. Biol. Chem. 280: 40406-40416.

Huang C, Jacobson K, Schaller MD. (2004). A role for JNK-paxillin signalling in cell

migration. Cell Cycle. 3: 4-6.

Hunot S, Vila M, Teismann P, Davis RJ, Hirsch EC, Przedborski S, Rakic P, Flavell RA. (2004). JNK-mediated induction of cyclooxygenase 2 is required for neurodegeneration in a

mouse model of Parkinson’s disease. Proc. Natl. Acad. Sci. USA. 101: 665–670.

Jaworski J, Mioduszewska B, Sanchez-Capelo A, Figiel I, Habas A, Gozdz A, Proszynski T, Hetman M, Mallet J, Kaczmarek L. (2003). Inducible cAMP early repressor,

an endogenous antagonist of cAMP responsive element-binding protein, evokes neuronal

apoptosis in vitro. J. Neurosci. 23: 4519–4526.

Jefferies, HB, Fumagalli S, Dennis PB, Reinhard C, Pearson RB, Thomas G. (1997).

Rapamycin suppresses 5´-TOP mRNA translation through inhibition of p70s6k. EMBO J. 16:

3693–3704.

Jiang Y, Chen C, Li Z, Guo W, Gegner JA, Lin S, Han J. (1996). Characterization of the

structure and function of a new mitogen-activated protein kinase (p38beta). J. Biol. Chem.

271: 17920–17926.

Jiang Y, Gram H, Zhao M, New L, Gu J, Feng L, Di Padova F, Ulevitch RJ, Han J. (1997).

Characterization of the structure and function of the fourth member of p38 group mitogen-

activated protein kinases, p38delta. J. Biol. Chem. 272: 30122–30128.

129

Bibliografía Jiang T, Qiu Y. (2003). Interaction between Src and a C-terminal proline-rich motif of Akt is

required for Akt activation. J. Biol. Chem. 278: 15789-15793.

Jiang Z, Zheng X, Lytle RA, Higashikubo R, Rich KM. (2004). Lovastatin-induced up-

regulation of the BH3-only protein, Bim, and cell death in glioblastoma cells. J. Neurochem.

89: 168-178.

Jin HO, Park IC, An S, Lee HC, Woo SH, Hong YJ, Lee SJ, Park MJ, Yoo DH, Rhee CH, Hong SI. (2006). Up-regulation of Bak and Bim via JNK downstream pathway in the

response to nitric oxide in human glioblastoma cells. J. Cell Physiol. 206: 477-486.

Johnson GL , Lapadat R. (2002). Mitogen-activated protein kinase pathways mediated by

ERK, JNK, and p38 protein kinases. Science. 298: 1911–1912.

Johnson MD, Woodard A, Okediji EJ, Toms SA, Allen GS. (2002) Lovastatin is a potent

inhibitor of meningioma cell proliferation: Evidence for inhibition of a mitogen associated

protein kinase. J. Neurooncol. 56: 133-142.

Jones KD, Couldwell WT, Hinton DR, Su Y, He S, Anker L, Law RE. (1994). Lovastatin

induces growth inhibition and apoptosis in human malignant glioma cells. Biochem. Biophys.

Res. Commun. 205: 1681-1687.

Juretic N, Santibanez JF, Hurtado C and Martinez J. (2001). ERK 1,2 and p38 pathways

are involved in the proliferative stimuli mediated by urokinase in osteoblastic SaOS-2 cell

line. J. Cell. Biochem. 83: 92–98.

Kanamoto T, Mota M, Takeda K, Rubin LL, Miyazono K, Ichijo H, Bazenet CE. (2000).

Role of apoptosis signal-regulating kinase in regulation of the c-Jun N-terminal kinase

pathway and apoptosis in sympathetic neurons. Mol. Cell. Biol. 20: 196–204.

Kaneta S, Satoh K, Kano S, Kanda M, Ichihara K. (2003). All hydrophobic HMG-CoA

reductase inhibitors induce apoptotic death in rat pulmonary vein endothelial cells.

Atherosclerosis. 170: 237-243.

Kanzawa T, Iwado E, Aoki H, Iwamaru A, Hollingsworth EF, Sawaya R, Kondo S, Kondo Y. (2006). Ionizing radiation induces apoptosis and inhibits neuronal differentiation in rat

neural stem cells via the c-Jun NH(2)-terminal kinase (JNK) pathway. Oncogene. En prensa.

Kaplan D, Miller F. (2001). Neurotrophin signal transduction in the nervous system. Curr.

Opin. Neurobiol. 10: 381–391.

Karin M, Liu ZG, Zandi E. (1997). AP-1 function and regulation. Curr. Opin. Cell Biol. 9:

240–246.

Kawasaki H, Morooka T, Shimohama S, Kimura J, Hirano T, Gotoh Y, Nishida E. (1997).

Activation and involvement of p38 mitogen-activated protein kinase in glutamate-induced

apoptosis in rat cerebellar granule cells. J. Biol. Chem. 272: 18518–18521.

Kazlauskas A. (1994). Receptor tyrosine kinases and their targets. Curr. Opin. Genet. Dev.

4: 5-14.

130

Bibliografía

Kerr JFR, Wyllie AH, Curie AR. (1972). Apoptosis: a basic biological phenomenon with

wide-ranging implications in tissue kinectics. Br. J. Cancer. 26: 239-257.

Khanzada UK, Pardo OE, Meier C, Downward J, Seckl MJ, Arcaro A. (2006). Potent

inhibition of small-cell lung cancer cell growth by simvastatin reveals selective functions of

Ras isoforms in growth factor signalling. Oncogene. 25: 877-887.

Khwaja A, Rodriguez-Viciana P, Wennstrom S, Warne PH, Downward J. (1997) Matrix

adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein

kinase B/Akt cellular survival pathway. EMBO J. 16: 2783–2793.

Kibayashi E, Urakaze M, Kobashi C, Kishida M, Takata M, Sato A, Yamazaki K, Kobayashi M. (2005). Inhibitory effect of pitavastatin (NK-104) on the C-reactive-protein-

induced interleukin-8 production in human aortic endothelial cells. Clin. Sci. 108: 515-521.

Kita T, Brown MS, Goldstein JL. (1980). Feedback regulation of 3-hydroxy-3-methylglutaryl

coenzyme A reductase in livers of mice treated with mevinolin, a competitive inhibitor of the

reductase. J. Clin. Invest. 66(5): 1094-100.

Kolch W, Heidecker G, Kochs G, Hummel R, Vahidi H, Mischak H, Finkenzeller G,

Marme D, Rapp UR. (1993). Protein kinase C alpha activates RAF-1 by direct

phosphorylation. Nature. 364: 249-252.

Kolch W. (2000). Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway

by protein interactions. Biochem J. 351: 289–305.

Kotti TJ, Ramirez DM, Pfeiffer BE, Huber KM, Russell DW. (2006). Brain cholesterol

turnover required for geranylgeraniol production and learning in mice. Proc. Natl. Acad. Sci.

U S A. 103: 3869-3874.

Koyuturk M, Ersoz M, Altiok N. (2004). Simvastatin induces proliferation inhibition and

apoptosis in C6 glioma cells via c-jun N-terminal kinase. Neurosci. Lett. 370: 212-217.

Krebs EG, Fischer EH. (1956). The phosphorylase b to a converting enzyme of rabbit

skeletal muscle. Biochim. Biophys. Acta. 20: 150-157.

Ku H, Meier KE. (2000). Phosphorylation of paxillin via the ERK mitogen-activated protein

kinase cascade in EL4 thymoma cells. J. Biol. Chem. 275: 11333-11340. Kuan CY, Yang DD, Roy DRS, Davis RJ, Rakic P, Flavell RA. (1999). The JNK1 and JNK2

protein kinases regulate regional-speci®c apoptosis during early brain development. Neuron.

22: 667-676.

Kuan CY, Roth KA, Flavell RA, Rakic P. (2000). Mechanisms of programmed cell death in

the developing brain. Trends Neurosci. 23: 291-297.

Kuida K, Haydar TF, Kuan CY, Gu Y, Taya C, Karasuyama H, Su MS, Rakic P, Flavell RA. (1998). Reduced apoptosis and cytochrome c-mediated caspase activation in mice

lacking caspase 9. Cell. 94: 325–337.

131

Bibliografía Kuida K, Zheng TS, Na S, Kuan C, Yang D, Karasuyama H, Rakic P, Flavell RA. (1996).

Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature.

384: 368–372.

Kuipers HF, Rappert AA, Mommaas AM, van Haastert ES, van der Valk P, Boddeke HW, Biber KP, van den Elsen PJ. (2006). Simvastatin affects cell motility and

actincytoskeleton distribution of microglia. Glia. 53: 115-123. Kureishi Y, Luo Z, Shiojima I, Bialik A, Fulton D, Lefer DJ, Sessa WC, Walsh K. (2000).

The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes

angiogenesis in normocholesterolemic animals. Nat. Med. 6: 1004-1110.

Kyriakis JM. (1999). Signaling by the germinal center kinase family of protein kinases, J.

Biol. Chem. 274: 5259–5262.

Kyriakis JM, Avruch J. (1990). pp54 microtubule-associated protein 2 kinase. A novel

serine/threonine protein kinase regulated by phosphorylation and stimulated by poly-L-lysine.

J. Biol. Chem. 265: 17355–17363.

Kyriakis JM, Avruch J. (2001). Mammalian mitogen-activated protein kinase signal

transduction pathways activated by stress and inflammation. Physiol. Rev. 81: 807–869.

Lawlor MA, Alessi DR. (2001). PKB/Akt: a key mediator of cell proliferation, survival and

insulin responses? J. Cell Sci. 114: 2903-2910.

Le SS, Loucks FA, Udo H, Richardson-Burns S, Phelps RA, Bouchard RJ, Barth H, Aktories K, Tyler KL, Kandel ER, Heidenreich KA, Linseman DA. (2005). Inhibition of

Rac GTPase triggers a c-Jun- and Bim-dependent mitochondrial apoptotic cascade in

cerebellar granule neurons. J. Neurochem. 94: 1025-1039.

Lee JH, Koh H, Kim M, Park J, Lee SY, Lee S, Chung J. (2005). JNK pathway mediates

apoptotic cell death induced by tumor suppressor LKB1 in Drosophila. Cell Death Differ.

Lee JC, Laydon JT, McDonnell PC, Gallagher TF, Kumar S, Green D, McNulty D, Blumenthal MJ, Heys JR, Landvatter SW et al. (1994). A protein kinase involved in the

regulation of inflammatory cytokine biosynthesis. Nature 372: 739–746.

Lee W, Mitchell P, Tijan R. (1987). Purified transcription factor AP-1 interacts with TPA-

inducible enhancer elements. Cell. 49: 741-52.

Leevers SJ, Vanhaesebroeck B, Waterfield MD. (1999). Signalling through

phosphoinositide 3-kinases: the lipids take centre stage. Curr. Opin. Cell Biol. 11:219-225.

Le-Niculescu H, Bonfoco E, Kasuya Y, Claret FX, Green DR, Karin M. (1999) Withdrawal

of survival factors results in activation of the JNK pathway in neuronal cells leading to Fas

ligand induction and cell death. Mol. Cell. Biol. 19: 751–763.

Lewis TS, Shapiro PS, Ahn NG. (1998). Signal transduction through MAP kinase cascades.

Adv. Cancer Res. 74:49–139.

132

Bibliografía

Li MH, Jang JH, Surh YJ. (2005). Nitric oxide induces apoptosis via AP-1-driven

upregulation of COX-2 in rat pheochromocytoma cells. Free Radic. Biol. Med. 39: 890-899.

Li W, Cui Y, Kushner SA, Brown RA, Jentsch JD, Frankland PW, Cannon TD, Silva AJ. (2005). The HMG-CoA reductase inhibitor lovastatin reverses the learning and attention

deficits in a mouse model of neurofibromatosis type 1. Curr. Biol. 15: 1961-1967.

Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. (1997).

Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an

apoptotic protease cascade. Cell. 91: 479–489.

Li S, Sonenberg N, Gingras AC, Peterson M, Avdulov S, Polunovsky VA, Bitterman PB. (2002). Translational control of cell fate: availability of phosphorylation sites on translational

repressor 4E-BP1 governs its proapoptotic potency. Mol. Cell Biol. 22: 2853-2861.

Li S, Takasu T, Perlman DM, Peterson MS, Burrichter D, Avdulov S, Bitterman PB, Polunovsky VA (2003). Translational factor eIF4E rescues cells from Myc-dependent

apoptosis by inhibiting cytocrome c release. J Biol Chem 278: 3015-3022.

Li S, Perlman DM, Peterson MS, Burrichter D, Avdulov S, Polunovsky VA, Bitterman PB. (2004). Translation initiation factor 4E blocks endoplasmic reticulum-mediated apoptosis.

J. Biol. Chem. 279: 21312-21317.

Liu B, Fang M, Lu Y, Mills GB and Fan Z. (2001). Involvement of JNK-mediated pathway in

EGF-mediated protection against paclitaxel-induced apoptosis in SiHa human cervical

cancer cells. Br. J. Cancer. 85: 303–311.

Lonze BE, Ginty DD. (2002). Function and regulation of CREB family transcription factors in

the nervous system. Neuron. 35: 605– 623.

Lorenzo MJ, Gish GD, Houghton C, Stonehouse TJ, Pawson T, Ponder BAJ, Smith DP. (1997). RET alternate splicing influences the interaction of activated RET with the SH2 and

PTB domains of Shc, and the SH2 domains of Grb2. Oncogene. 14: 763-771.

Mabuchi T, Kitagawa K, Kuwabara K, Takasawa K, Ohtsuki T, Xia Z, Storm D, Yanagihara T, Hori M, Matsumoto M. (2001). Phosphorylation of cAMP response element-

binding protein in hippocampal neurons as a protective response after exposure to glutamate

in vitro and ischemia in vivo. J. Neurosci. 21: 9204 –9213.

Macara IG, Lounsbury KM, Richards SA, Mckiernan C, Bar-Sagi D. (1996). The ras

superfamily of GTPases. FASEB J. 10: 625-630.

Maltese WA, Volpe JJ. (1979). Developmental changes in the distribution of 3-hydroxy-3-

methylglutaryl coenzyme A reductase among subcellular fractions of rat brain. J. Neurochem.

33: 107-115.

Marks N, Berg MJ. (1999). Recent advances on neuronal caspases in development and

neurodegeneration. Neurochem. Int. 35: 195-200.

133

Bibliografía Marte BM, Downward J. (1997). PKB/Akt: connecting phosphoinositide 3-Kinase to cell

survival and beyond. Trends Biochem. Sci. 22: 355-358.

Matsuzawa A, Ichijo, H. (2001). Molecular mechanisms of the decision between life and

death: regulation of apoptosis by apoptosis signal-regulating kinase 1. J. Biochem. 130: 1–8.

Matthies H Jr, Schulz S, Hollt V, Krug M. (1997). Inhibition by compactin demonstrates a

requirement of isoprenoid metabolism for long-term potentiation in rat hippocampal slices.

Neuroscience. 79: 341-346.

Matzno S, Yasuda S, Juman S, Yamamoto Y, Nagareya-Ishida N, Tazuya-Murayama K, Nakabayashi T, Matsuyama K. (2005). Statin-induced apoptosis linked with membrane

farnesylated Ras small G protein depletion, rather than geranylated Rho protein. J. Pharm.

Pharmacol. 57: 1475-1484.

Mauch DH, Nagler K, Schumacher S, Goritz C, Muller EC, Otto A, Pfrieger FW. (2001).

CNS synaptogenesis promoted by glia-derived cholesterol. Science. 294: 1354– 1357.

McDonald PH, Chow CW, Miller WE, Laporte SA, Field ME, Lin FT, Davis RJ, Lefkowitz RJ. (2000). Beta-arrestin 2: a receptor-regulated MAPK scaffold for the activation of JNK3. Science. 290: 1574–1577.

McGuire TF, Corey SJ, Sebti SM. (1993). Lovastatin inhibits platelet-derived growth factor

(PDGF) stimulation of phosphatidylinositol 3-kinase activity as well as association of p85

subunit to tyrosine-phosphorylated PDGF receptor. J. Biol. Chem. 268: 22227–22230.

McGuire TF, Xu XQ, Corey SJ, Romero GG, Sebti SM. (1994). Lovastatin disrupts early

events in insulin signaling: a potential mechanism of lovastatin’s anti-mitogenic activity.

Biochem. Biophys. Res. Commun. 204: 399–406.

McGuire TF, Qian Y, Vogt A, Hamilton AD, Sebti SM. (1996). Platelet-derived growth

factor receptor tyrosine phosphorylation requires protein geranylgeranylation but not

farnesylation. J. Biol. Chem. 271: 27402–27407.

McMahon LP, Choi KM, Lin TA, Abraham RT, Lawrence JC. (2002). The rapamycin-

binding domain governs substrate selectivity by the mammalian target of rapamycin. Mol.

Cell. Biol. 22: 7428-7438.

Medema RH, Kops GJ, Bos JL, Burgering BM. (2000). AFX-like Forkhead transcription

factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature. 404: 782-

787.

Melchert RB, Liu H, Granberry MC, Kennedy RH. (2001). Lovastatin inhibits

phenylephrine-induced ERK activation and growth of cardiac. Cardiovasc. Toxicol.1: 237–

252.

Merry DE, Korsmeyer SJ. (1997). Bcl-2 gene family in the nervous system. Annu. Rev.

Neurosci. 20: 245–267.

134

Bibliografía

Metzstein MM, Stanfield GM, Horvitz HR. (1998). Genetics of programmed cell death in C.

elegans: past, present and future. Trends Genet. 14: 410–416.

Michikawa M, Yanagisawa K. (1999). Inhibition of cholesterol production but not of

nonsterol isoprenoid products induces neuronal cell death. J. Neurochem. 72: 2278-2285.

Miura S, Matsuo Y, Saku K. (2004). Simvastatin suppresses coronary artery endotelial tube

formation by disrupting Ras/Raf/ERK signaling. Atherosclerosis. 175:235-243.

Mielke K, Herdegen T. (2000). JNK and p38 stress kinases-degenerative effectors of signal-

transduction-cascades in the nervous system. Prog. Neurobiol. 61: 45–60.

Morooka T, Nishida E. (1998). Requirement of p38 mitogen activated protein kinase for

neuronal differentiation in PC12 cells. J. Biol. Chem. 273: 24285–24288.

Mossman T. (1983). Rapid colorimetric assay for cellular growth and survival: Application to

proliferation and cytotoxicity assays. J. Immunol. 65: 55-63.

Muñoz A, Wrighton C, Seliger B, Bernal J, Beug H. (1993). Thyroid hormone receptor/c-

erbA: Control of commitment and differentiation in the neuronal / chromaffin progenitor line

PC12. J. Cell Biol. 121: 423-438.

Murata M, Peranen J, Schreiner R, Wieland F, Kurzchalia TV, Simons K. (1995).

VIP21/caveolin is a cholesterol-binding protein. Proc. Natl. Acad. Sci. U S A. 92: 10339-

10343.

Nakagawa H, Mutoh T, Kumano T, Kuriyama M. (1998). HMG-CoA reductase inhibitor-

induced L6 myoblast cell death: involvement of the phosphatidylinositol 3-kinase pathway.

FEBS Letters. 438: 289-292.

Nakazawa T, Tamai M, Mori N. (2002). Brain-derived neurotrophic factor prevents

axotomized retinal ganglion cell death through MAPK and PI3K signaling pathways. Invest.

Ophthalmol. Vis. Sci. 43: 3319–3326.

Negre-Aminou P, van Vliet AK, van Erck M, van Thiel GC, van Leeuwen RE, Cohen LH. (1997). Inhibition of proliferation of human smooth muscle cells by various HMG-CoA

reductase inhibitors: comparison with other human cell types. Biochim. Biophys. Acta. 1345:

259–268.

Nishida S, Matsuoka H, Tsubaki M, Tanimori Y, Yanae M, Fujii Y, Iwaki M. (2005).

Mevastatin induces apoptosis in HL60 cells dependently on decrease in phosphorylated

ERK. Mol. Cell. Biochem. 269: 109-114.

Nishina H, Nakagawa K, Azuma N, Katada T. (2003). Activation mechanism and

physiological roles of stress-activated protein kinase/c-Jun NH2-terminal kinase in

mammalian cells. J. Biol. Regul. Homeost. Agents. 17: 295-302.

Oh HL, Seok JY, Kwon CH, Kang SK, Kim YK. (2006). Role of MAPK in ceramide-induced

cell death in primary cultured astrocytes from mouse embryonic brain. Neurotoxicology. 27:

31-38.

135

Bibliografía Okuno S, Saito A, Hayashi T, Chan PH. (2004). The c-Jun N-terminal protein kinase

signaling pathway mediates Bax activation and subsequent neuronal apoptosis through

interaction with Bim after transient focal cerebral ischemia. J. Neurosci. 24: 7879-7887.

Oliver FJ, de la Rubia G, Rolli V, Ruiz-Ruiz MC, de Murcia G, Murcia JM. (1998).

Importante of poly (ADP-ribose) polymerase and its cleavage in apoptosis. Lesson from an

uncleavable mutant. J. Biol. Chem. 273: 33533-33539.

Omoigui S. (2005). Cholesterol synthesis is the trigger and isoprenoid dependent

interleukin-6 mediated inflammation is the common causative factor and therapeutic target

for atherosclerotic vascular disease and age-related disorders including osteoporosis and

type2 diabetes. Med. Hypotheses. 65: 559-569.

Ono K, Han J. (2000). The p38 signal transduction pathway: activation and function. Cell

Signal. 12: 1–13.

Opitz JM, De la Cruz F. (1994). Cholesterol metabolism in the RSH/Smith-Lemli-Opitz

syndrome: Summary o an NICHD conference. Am. J. Med. Genet. 50: 326-338.

O’Reilly LA, Cullen L, Visvader J, Lindeman GJ, Print C, Bath ML, Huang DCS, Strasser A. (2000). The proapoptotic BH3-only protein Bim is expressed in hematopoietic, epithelial,

neuronal, and germ cells. Am. J. Pathol. 157: 449–461.

Otsuki T, Sakaguchi H, Hatayama T, Fujii T, Tsujioka T, Sugihara T, Takata A, Hyodoh F, Eto M. (2004). Effects of an HMG-CoA reductase inhibitor, simvastatin, on human

myeloma cells. Oncol. Rep. 11: 1053-1058.

Padayatty SJ, Marcelli M, Shao TC, Cunningham GR. (1997). Lovastatin-induced

apoptosis in prostate stromal cells. J. Clin. Endocrinol. Metab. 82: 1434-1439.

Palmada M, Kanwal S, Rutkoski NJ, Gufstafson-Brown C, Johnson RS, Wisdom R, Carter BD. (2002). c-jun is essential for sympathetic neuronal death induced by NGF

withdrawal but not by p75 activation. J. Cell Biol. 158: 453–461.

Panaretou C, Domin J, Cockcroft S, Waterfield MD. (1997). Characterization of p150, an

adaptor protein for the human phosphatidylinositol (PtdIns) 3-kinase. J. Biol. Chem. 272:

2477– 2485.

Patapoutian A, Reichardt L. (2001). Trk receptors: mediators of neurotrophin action. Curr.

Opin. Neurobiol. 11: 272–280.

Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH. (2001). Mitogen-activated protein (MAP) kinase pathways: regulation and

physiological functions. Endocrinol. Rev. 22: 153–183.

Pérez-Sala D, Mollinedo F. (1994). Inhibition of isoprenoid biosynthesis induces apoptosis

in human promielocytic HL-60 cells. Biochem. Biophys. Res. Commun. 199: 1209-1215.

Polunovsky VA, Rosenwald IB, Tan AT, White J, Chiang L, Sonenberg N, Bitterman PB (1996). Translational control of programmed cell death: eukaryotic translation initiation factor

136

Bibliografía

4E blocks apoptosis in growth-factor-restricted fibroblasts with physiologically expressed o

deregulated Myc. Mol Cell Biol 16: 6573-6581.

Ponting C, Benjamin D. (1996). A novel family of Ras-binding domains. Trends Biochem.

Sci. 21: 422-425.

Porcile C, Stanzione S, Piccioli P, Bajetto A, Barbero S, Bisaglia M, Bonavia R, Florio T, Schettini G. (2003). Pyrrolidinedithiocarbamate induces apoptosis in cerebellar granule

cells: involvement of AP-1 and MAP kinases. Neurochem. Int. 43: 31-38.

Porras A, Zuluaga S, Black E, Valladares A, Alvarez AM, Ambrosino C, Benito M, Nebreda AR. (2004). P38 alpha mitogen-activated protein kinase sensitizes cells to

apoptosis induced by different stimuli. Mol Biol Cell. 15: 922–933.

Porter JA, Young KE, Beachy PA. (1996). Cholesterol modification of hedgehog signaling

proteins in animal development. Science. 274: 255-259.

Prasad R, Giri S, Nath N, Singh I, Singh AK. (2005). Inhibition of phosphoinositide 3

kinase-Akt (protein kinase B)-nuclear factor-kappa B pathway by lovastatin limits endothelial-

monocyte cell interaction. J. Neurochem. 94: 204-214.

Pronk GJ, Bos JL. (1994). The role of p21ras in receptor tyrosine kinase signalling. Biochim

Biophys Acta. 1198: 131–47.

Putcha GV, Le S, Frank S, Besirli CG, Clark K, Chu B, Alix S, Youle RJ, LaMarche A, Maroney AC, Johnson Jr. EM. (2003). JNK-mediated BIM phosphorylation potentiates

BAX-dependent apoptosis. Neuron. 38: 899–914.

Quilliam LA, Mueller H, Bohl BP, Prossnitz V, Sklar LA, Der CJ, Bokoch GM. (1991). Rap1A is a substrate for cyclic AMP-dependent protein kinase in human neutrophils. J

Immunol. 147: 1628-1635. Rabelo FL, Ropert C, Ramos MG, Bonjardim CA, Gazzinelli RT, Alvarez-Leite JI. (2003).

Inhibition of ERK1/2 and CREB phosphorylation by caspase-dependent mechanism

enhances apoptosis in fibrosarcoma cell line treated with butyrate. Biochem. Biophys. Res.

Comm. 303: 968-972.

Raff MC, Barres BA, Burne JF, Coles HS, Ishizaki Y, Jacobson MD. (1993). Programmed

cell death and the control of cell survival: lessons from the nervous system. Science. 262:

695-700.

Raiteri M, Arnaboldi L, McGeady P, Gelb MH, Verri D, Tabliabue C, Quarato P, Ferraboschi P, Santaniello E, Paoletti R, Fumagalli R, Corsini A. (1997).

Pharmacological control of the mevalonate pathway: effect on arterial smooth muscle cell

proliferation. J. Pharmacol. Exp. Ther. 281: 1144-1153.

Rameh LE, Chen CS, Cantley LC. (1995). Phosphatidylinositol (3,4,5)P3 interacts with SH2

domains and modulates PI 3-kinase association with tyrosine-phosphorylated proteins. Cell.

83: 821-830.

137

Bibliografía Rameh LE, Arvidsson A, Carraway KL 3rd, Couvillon AD, Rathbun G, Crompton A, VanRenterghem B, Czech MP, Ravichandran KS, Burakoff SJ, Wang DS, Chen CS, Cantley LC. (1997). A comparative analysis of the phosphoinositide binding specificity of

pleckstrin homology domains. J. Biol. Chem. 272: 22059-22066.

Rameh LE, Cantley LC. (1999). The role of phosphoinositide 3-kinase lipid products in cell

function. J. Biol. Chem. 274: 8347-8350.

Rando RR. (1996). Chemical biology of protein isoprenylation/methylation. Biochim.

Biophys. Acta. 1300: 5–16.

Repasky GA, Chenette EJ, Der CJ. (2004). Renewing the conspiracy theory debate : does

Raf function alone to mediate Ras oncogenesis?. Trends Cell Biol. 14: 639-647.

Reynolds CH, Utton MA, Gibb GM, Yates A, Anderton BH. (1997). Stress-activated

protein kinase/c-jun N-terminal kinase phosphorylates tau protein. J. Neurochem. 68: 1736-

1744.

Rodgers EE, Theibert AB. (2002). Functions of PI 3-kinase in development of the nervous

system. Int. J. Dev. Neurosci. 20:187-197.

Rodríguez-Viciana P, Warne PH, Vanhaesebroeck B, Waterfiled MD, Downward J. (1996). Activation of phosphoinositide 3-kinase by interaction with Ras and by point mutation.

EMBO J. 15: 2442-2451.

Rouse J, Cohen P, Trigon S, Morange M, Alonso-Llamazares A, Zamanillo D, Hunt T, Nebreda AR. (1994). A novel kinase cascade triggered by stress and heat shock that

stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins. Cell. 78:

1027-1037.

Roux PP, Blenis J. (2004). ERK and p38 MAPK-Activated Protein Kinases: a Family of

Protein Kinases with Diverse Biological Finctions. Microb.Mol.Biol.Rev. 68.2: 320-344.

Sabapathy K, Hu Y, Kallunki T, Schreiber M, David JP, Jochum W, Wagner EF, Karin M. (1999). JNK2 is required for eficient T-cell activation and apoptosis but not for normal

lymphocyte development. Curr. Biol. 9: 116-125.

Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. (2005). Phosphorylation and regulation

of Akt/PKB by the Rictor-mTOR complex. Science. 307: 1098–1101.

Saunders JW Jr. (1966). Death in embryonic systems. Science. 154: 604-612.

Schafer C, Ross SE, Bragado MJ, Groblewski GE, Ernst SA, Williams JA. (1998). A role

for the p38 mitogen-activated protein kinase/Hsp 27 pathway in cholecystokinin-induced

changes in the actin cytoskeleton in rat pancreatic acini. J. Biol. Chem. 273: 24173-24180.

Scheid MP , Woodgett JR. (2003). Unravelling the activation mechanisms of protein kinase

B/Akt. FEBS Lett. 546: 108-112.

Schmid R, Pruitt W, Maness P. (2000). A MAP kinase-signaling pathway mediates neurite

outgrowth on L1 and requires Src-dependent endocytosis. J. Neurosci. 20: 4177–4188.

138

Bibliografía

Schmidt RA, Schneider CJ, Glomset JA. (1984). Evidence for post-translational

incorporation of a product of mevalonic acid into Swiss 3T3 cell proteins. J. Biol. Chem. 259:

10175-10180.

Schroeter H, Boyd CS, Ahmed R, Spencer JP, Duncan RF, Rice-Evans C, Cadenas E. (2003). c-Jun N-terminal kinase (JNK)-mediated modulation of brain mitochondria function:

new target proteins for JNK signalling in mitochondrion-dependent apoptosis. Biochem. J.

372: 359–369.

Schulz JG, Bosel J, Stoeckel M, Megow D, Dirnagl U, Endres M. (2004). HMG-CoA

reductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate

synthesis. J. Neurochem. 89: 24-32.

Schubert KM, Scheid MP, Duronio V. (2000) Ceramide inhibits protein kinase B/Akt by

promoting dephosphorylation of serine 473. J Biol Chem 275: 13330-13335.

Segarra J, Balenci L, Drenth T, Maina F, Lamballe F. (2006). Combined Signaling through

ERK, PI3K/AKT, and RAC1/p38 Is Required for Met-triggered Cortical Neuron Migration. J.

Biol. Chem. 281: 4771-4778.

Shields JM, Pruitt K, McFall A, Shaub A, Der CJ. (2000). Understanding Ras: 'it ain't over

'til it's over'. Trends Cell Biol. 10:147-154.

Shimoke K, Yamagishi S, Yamada M, Ikeuchi T, Hatanaka H. (1999). Inhibition of

phosphatidylinositol 3-kinase activity elevates c-Jun N-terminal kinase activity in apoptosis of

cultured cerebellar granule neurons. Brain. Res. Dev. Brain. Res. 112: 245-253.

Singer CA, Figueroa-Masot XA, Batchelor RH, Dorsa DM. (1999). The mitogen-activated

protein kinase pathway mediates estrogen neuroprotection after glutamate toxicityin primaryc

ortical neurons. J. Neurosci. 19: 2455–2463.

Skaletz-Rorowski A, Muller JG, Kroke A, Waltenberger J, Pulawski E, Pinkernell K, Breithardt G. (2001). Lovastatin blocks basis fibroblast growth factor-induced mitogen-

activated protein kinase signalling in coronary smooth muscle cells via phosphatase

inhibition. Eur. J. Cell Biol. 80: 207-212.

Smart EJ, Ying YS, Conrad PA, Anderson RG. (1994). Caveolin moves from caveolae to

the Golgi apparatus in response to cholesterol oxidation. J. Cell. Biol. 127: 1185-1197.

Spady DK, Dietschy JM. (1983). Sterol synthesis in vivo in 18 tissues of the squirrell

monkey, guinea pig, rabbit, hamster and rat. J. Lipids Res. 24: 303-315.

Stancu C, Sima A. (2001). Statins: mechanism of action and effects. J. Cell. Mol. Med. 5:

378-387.

Stromberg T, Dimberg A, Hammarberg A, Carlson K, Osterborg A, Nilsson K, Jernberg-Wiklund H. (2004). Rapamycin sensitizes multiple myeloma cells to apoptosis

induced by dexamethasone. Blood. 103: 3138-3147.

139

Bibliografía Sturgill TW, Ray LB, Erikson E, Maller JL. (1998). Insulin-stimulated MAP-2 kinase

phosphorylates and activates ribosomal protein S6 kimase II. Nature. 334: 715-718.

Sugiura S, Kitagawa K, Omura-Matsuoka E, Sasaki T, Tanaka S, Yagita Y, Matsushita K, Storm DR, Hori M. (2004). CRE-mediated gene transcription in the peri-infarct area after

focal cerebral ischemia in mice. J. Neurosci. Res. 75: 401-407.

Takai Y, Kaibuchi K, Kikuchi A, Kawata M. (1992). Small GTP-binding proteins. Int. Rev.

Cytol. 133: 187-230.

Takata R, Fukasawa S, Hara T, Nakajima H, Yamashina A, Yanase N, Mizuguchi J. (2004). Cerivastatin-induced apoptosis of human aortic smooth muscle cells through partial

inhibition of basal activation of extracellular signal-regulated kinases Cardiovasc. Pathol. 13:

41-48.

Takeda K, Hatai T, Hamazaki TS, Nishitoh H, Saitoh M, Ichijo, H. (2000). Apoptosis

signal-regulating kinase 1 (ASK1) induces neuronal differentiation and survival of PC12 cells.

J. Biol. Chem. 275: 9805–9813.

Takeda K, Ichijo H. (2002). Neuronal p38 MAPK signalling: an emerging regulator of cell

fate and function in the nervous system. Genes Cells. 7. 1099-1011.

Tanaka T, Tatsuno I, Uchida D, Moroo I, Morio H, Nakamura S, Noguchi Y, Yasuda T, Kitagawa M, Saito Y, Hirai A. (2000). Geranylgeranyl-pirophosphate, an isoprenoid of

mevalonate cascade, is a critical compound for rat primary cultured cortical neurons to

protect the cell death induced by 3-hydroxy-3-methylglutaryl-CoA reductase inhibition. J.

Neurosci. 20: 2852-2859.

Toker A. (2000). Protein kinases as mediators of phosphoinositide 3-kinase signaling. Mol.

Pharmacol. 57: 652–658.

Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN, Flavell RA, Davis RJ. (2000). Requirement of JNK for stress-induced activation of the

cytochrome c-mediated death pathway. Science. 288: 870–874.

Triscari J, Marckowitz JS, McGovern MW. (1993). Pravastatin and lovastatin in

cerebrospinal fluid. Clin. Neuropharmacol. 16: 559-560.

Valjent E, Caboche J, Vanhoutte P. (2001). Mitogen-activated proteinn kinase/extracellular

siganl-regulated kinase induced gene regulation in brain: a molecular substrate for learning

and memory? Mol. Neurobiol. 23: 83-99.

Vanhaesebroeck B, Leevers SJ, Panayotou G, Waterfield MD. (1997). Phosphoinositide

3-kinases: a conserved family of signal transducers. Trends Biochem. Sci. 22: 267-272

Vanhaesebroeck B, Alessi DR. (2000). The PI3-K-PDK1 connection: more than just a road

to PKB. Biochem. J. 346: 561–576

Vgontzas AN, Kales A, Bixler EO, Manfredi RL, Tyson KL. (1991). Effects of lovastatin

and pravastatin on sleep efficiency and sleep stages. Clin. Pharmacol. Ther. 50: 730-737.

140

Bibliografía

Vivanco I, Sawyers CL. (2002). The phosphatidylinositol 3-Kinase AKT pathway in human

cancer. Nat. Rev. Cancer. 2: 489-501.

Wada T, Penninger JM. (2004). Mitogen-activated protein kinases in apoptosis regulation.

Oncogene. 23: 2838-2849.

Waddick KG, Uckun FM. (1998). Innovative Treatment Programs Against Cancer. Ras

oncoprotein as a molecular target. Biochem. Pharmacol. 56: 1411-1426.

Wang XS, Diener K, Manthey CL, Wang S, Rosenzweig B, Bray J, Delaney J, Cole CN, Chan-Hui PY, Mantlo N, Lichenstein HS, Zukowski M, Yao Z. (1997). Molecular cloning

and characterization of a novel p38 mitogen-activated protein kinase. J. Biol. Chem. 272:

23668–23674.

Wang M, Kong Q, Gonzalez FA, Sun G, Erb L, Seye C, Weisman GA. (2005). P2Y

nucleotide receptor interaction with alpha integrin mediates astrocyte migration. J.

Neurochem. 95:630-640.

Wang X, Li W, Williams M, Terada N, Alessi DR, Proud CG. (2001). Regulation of

elongation factor 2 kinase by p90(RSK1) and p70 S6 kinase. EMBO J. 20: 4370-4379.

Wang L, Piguet AC, Schmidt K, Tordjmann T, Dufour JF. (2005). Activation of CREB by

tauroursodeoxycholic acid protects cholangiocytes from apoptosis induced by mTOR

inhibition. Hepatology. 41: 1241-1251.

Weiss RH, Ramirez A, Joo A. (1999). Short term pravastatin mediates growth inhibition and

apoptosis, independently of Ras, via the signalling proteins p27Kip1 and PI3 kinase. J Am.

Soc Nephrol. 10: 1880-1890.

Wen P, Locker J. (1994). A novel hepatocytic transcription factor that binds the alpha-

fetoprotein promoter-linked coupling element. Mol. Cell Biol. 14, 6616-26.

Wendel HG, De Stanchina E, Fridman JS, Malina A, Ray S, Kogan S, Cordon-Cardo C, Pelletier J, Lowe SW. (2004). Survival signalling by Akt and eIF4E in oncogenesis and

cancer therapy. Nature. 428: 332-337.

Werlen G, Hausmann B, Naeher D, Palmer E. (2003). Signaling life and death in the

thymus: timing is everything. Science. 299: 1859–1863.

Weston CR, Balmanno K, Chalmers C, Hadfield K, Molton SA, Ley R. Wagner EF, Cook SJ. (2003). Activation of ERK1/2 by deltaRaf-1:ER* represses Bim expression independently

of the JNK or PI3K pathways. Oncogene. 22: 1281–1293.

Widlak P, Garrard WT. (2005). Discovery, regulation, and action of the major apoptotic

nucleases DFF40/CAD and endonuclease G. J. Cell. Biochem. 94: 1078-1087. Willaime-Morawek S, Brami-Cherrier K, Mariani J, Caboche J, Brugg B. (2003). C-Jun

N-terminal kinases/c-Jun and p38 pathways cooperate in ceramide-induced neuronal

apoptosis. Neuroscience.119: 387-397.

141

Bibliografía Willumsen BM, Christensen A, Hubbert NL, Papageorege AG, Lowry DR. (1984) The

p21 ras C-terminus is required for transformation and membrane association. Nature 310:

583–586. Wisdom R, Johnson RS, Moore C. (1999). c-Jun regulates cell cycle progression and

apoptosis by distinct mechansims. EMBO J. 18: 188-197.

Wolfrum S, Dendorfer A, Schutt M, Weidtmann B, Heep A, Tempel K, Klein HH, Dominiak P, Richardt G. (2004). Simvastatin acutely reduces myocardial reperfusion injury

in vivo by activating the phosphatidylinositide 3-kinase/Akt pathway. J. Cardiovasc.

Pharmacol. 44: 348-355.

Wolozin B, Kellman W, Ruosseau P, Celesia GG, Siegel G. (2000). Decreased

prevalence of Alzheimer disease associated with 3-hydroxy-3-methyglutaryl coenzyme A

reductase inhibitors. Arch. Neurol. 57. 1439– 1443.

Woltman AM, van der Kooij SW, Coffer PJ, Offringa R, Daha MR, van Kooten C. (2003).

Rapamycin specifically interferes with GM-CSF signaling in human dendritic cells, leading to

apoptosis via increased p27KIP1 expression. Blood. 101: 1439-1445.

Wood K, Sarnecki C, Roberts TM, Blenis J. (1992). c-Ras mediates nerve growth factor

receptor modulation of three signal-transducing protein kinases: MAP kinase, Raf-1 and

RSK. Cell. 68:1041–1050.

Wu J, Wong WW, Khosravi F, Minden MD, Penn LZ. (2004). Blocking the Raf/MEK/ERK

pathway sensitizes acute myelogenous leukaemia cells to lovastatin-induced apoptosis.

Cancer Res. 64: 6461-6468.

Wyllie AH, Kerr JFR, Curie AR. (1981). Cell death : the significance of apoptosis. Int. Rev.

Cytol. 68:251-305.

Wyllie AH. (1988). ISI Atlas of Science: Inmunology. pp. 192-196.

Wymann MP, Pirola L. (1998). Structure and function of phosphoinositide 3-kinases.

Biochim. Biophys. Acta. 1436: 127-150.

Wymann MP, Zvelebil M, Laffargue M. (2003). Phosphoinositide 3-kinase signalling- which

way to target?. Trends Pharmacol. Sci. 24: 366-376

Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg, ME. (1995). Opposing effects of

ERK and JNK-p38 MAP kinases on apoptosis. Science. 270: 1326-1331.

Xu XQ, McGuire TF, Blaskovich MA, Sebti SM, Romero G. (1996). Lovastatin inhibits the

stimulation of mitogen-activated protein kinase by insulin in HIRcB fibroblasts. Arch.

Biochem. Biophys. 326: 233–237.

Yanagisawa M, Nakashima K, Takeda K, Ochiai W, Takizawa T, Ueno M, Takizawa M, Shibuya H, Taga T. (2001). Inhibition of BMP2-induced, TAK1 kinase-mediated neurite

outgrowth by Smad6 and Smad7. Genes Cells 6: 1091–1099.

142

Bibliografía

143

Yang SR, Cho SD, Ahn NS, Jung JW, Park JS, Jo EH, Hwang JW, Kim SH, Lee BH, Kang KS, Lee YS. (2005). The role of p38 MAP kinase and c-Jun N-terminal protein kinase

signaling in the differentiation and apoptosis of immortalized neural stem cells. Mutat. Res.

579: 47-57.

Yang DD, Kuan CY, Whitmarsh AJ, Rincon M, Zheng TS, Davis RJ, Rakic P, Flavell RA. (1997). Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the

Jnk3 gene. Nature. 389. 865–870.

Yao R, Cooper GM. (1995). Requirement for phosphatidylinositol 3-kinase in the prevention

of apoptosis by nerve growth factor. Science 279: 673-674.

Yee AS, Paulson EK, McDevitt MA, Rieger-Christ K, Summerhayes I, Berasi Sp, Kim J, Huang CY, Shang X. (2004). The Hbp1 transcriptional repressor and the p38 MAP kinase:

unlikely partners in G1 regulation and tumor suppression. Gene. 336: 1-13.

Yosimichi G, Nakanishi T, Nishida T, Hattori T, Takano-Yamamoto T, Takigawa M. (2001). CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated

protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal

regulated kinase (ERK). Eur. J. Biochem. 268: 6058–6065.

Yuan J, Yankner B. (2000). Apoptosis in the nervous system. Nature. 407: 802–809.

Zhang W, Liu HT. (2002). MAPK signal pathways in the regulation of cell proliferation in

mammalian cells. Cell Res. 12:9-18.

Zhong WB, Liang YC, Wang CY, Chang TC, Lee WS. (2005). Lovastatin suppresses

invasiveness of anaplastic thyroid cancer cells by inhibiting Rho geranylgeranylation and

RhoA/ROCK signaling. Endocr. Relat. Cancer. 12: 615-629.

Zhong WB, Wang CY, Chang TC, Lee WS. (2003). Lovastatin induces apoptosis of

anaplastic thyroid cancer cells via inhibition of protein geranylgeranylation and de novo

protein synthesis. Endocrinology. 144: 3852-3859.

Zhu W, Bijur GN, Styles NA, Li X. (2004). Regulation of FOXO3a by brain-derived

neurotrophic factor in differentiated human SH-SY5Y neuroblastoma cells. Brain Res. Mol.

126: 45–56.

Zhu J.-H, Kulich SM, Oury TD, Chu CT. (2002a). Cytoplasmic aggregates of

phosphorylated extracellular signalregulated kinase in Lewy body diseases. Am. J. Pathol.

161. 2087–2098.

Zhu X, Lee HG, Raina AK, Perry G, Smith MA. (2002b). The role of mitogen-activated

protein kinase pathways in Alzheimer’s disease. Neurosignals. 11: 270–281.

Zou H, Henzel WJ, Liu X, Lutschg A, Wang X. (1997). Apaf-1, a human protein

homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of

caspase-3. Cell. 90: 405–413.