UNIVERSIDAD DE EXTREMADURA
DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR Y GENÉTICA
RUTAS DE SEÑAREGULAN LA APOPT
EN NEUROB
TesisMARÍA ISABEL
Grado de Doctor
LIZACIÓN INTRACELULAR QUE OSIS INDUCIDA POR LOVASTATINA LASTOS FETALES DE RATA
Doctoral presentada por CEREZO GUISADO para optar al
por la Universidad de Extremadura.
Cáceres, 2006
Edita: Universidad de Extremadura Servicio de Publicaciones Caldereros 2. Planta 3ª Cáceres 10071 Correo e.: [email protected] http://www.unex.es/publicaciones
FACULTAD DE VETERINARIA DEPARTAMENTO DE BIOQUÍMICA, BIOLOGÍA MOLECULAR Y GENÉTICA Avda de la Universidad s/n 10071 CÁCERES Tlfno: 927257100 ext. 1332
Dña. MARÍA JULIA BRAGADO GONZÁLEZ, Profesora Contratada Doctora del Departamento de Bioquímica, Biología Molecular y Genética de la Universidad de Extremadura, y Dña. MARÍA JESÚS LORENZO BENAYAS, Profesora Titular de Universidad del Departamento de Bioquímica, Biología Molecular y Genética de la Universidad de Extremadura INFORMAN: Que el presente trabajo, titulado “Rutas de señalización intracelular que regulan la apoptosis inducida por lovastatina en neuroblastos fetales de rata”, ha sido realizado bajo nuestra dirección por María Isabel Cerezo Guisado en el Departamento de Bioquímica, Biología Molecular y Genética de la Universidad de Extremadura, y reúne todos los requisitos para obtener el grado de Doctor. Y para que así conste, firmamos el presente documento en Cáceres, a 21 de Junio de 2006. Dra. María Julia Bragado González Dra. María Jesús Lorenzo Benayas
GRACIAS….
Es tanto lo que tengo que agradecer y a tanta gente que no se si seré capaz de plasmarlo
en estas líneas; en cualquier caso ahí queda mi intento de agradecimientos de esta etapa de
mi vida:
En primer lugar a las doctoras Mª Julia Bragado González y Mª Jesús Lorenzo Benayas,
directoras de esta Tesis. A Chus, por todo lo que me has enseñado en todos estos años
tanto profesional como personalmente. Serás un referente para mí en futuros trabajos y en
la vida. Y sobre todo, por lo que me has ayudado, alentado y aconsejado en este largo, y a
veces difícil camino. Siempre has estado a mi lado y no sé si sabrás lo que eso ha
significado para mi pero gracias a ti, he podido disfrutar de esta Tesis. Espero que muchos
más tengan la suerte que he tenido yo de contar contigo en una aventura como ésta. A Julia,
por todo lo que me has enseñado y por prestarme tu apoyo, tu confianza y tu ayuda.
A Ricardo, el segundo autor de esta Tesis. No te haces a la idea de lo que ha significado
para mí contar contigo y con tu amistad estos años. Siempre has estado ahí para mí
apoyándome y soportando mis continuos lloros y quejas. Por eso, mi más sincero
agradecimiento querido marqués.
A Paco, el “director espiritual” de esta Tesis. Porque la empecé “por tu culpa” y porque
siempre que te he necesitado has estado ahí, para resolver mis dudas científicas y no tan
científicas, por tus consejos y también, cómo no, por aguantar “el monotema” que te soltado
sin parar. Echaré de menos nuestras paradas en el Km. 40.
A Pablo, no sé como agradecerte el que siempre haya podido contar contigo, que siempre
hayas estado ahí, que me hayas dado ese punto de vista coherente que tantas veces he
necesitado, que me hayas prestado tu ayuda sin dudarlo y dejando lo tuyo a un lado y sobre
todo por enseñarme cómo deben ser los amigos de verdad. A Loli, porque tú también has
aguantado mucho el mismo rollo una y otra vez y me has apoyado en los momentos más
críticos, suerte con “lo tuyo” amiga.
A mis compañeros, Inés, Lauro, Julián, Fernando, Rosa, por todo el aprecio y el cariño que
siempre me habéis demostrado. Al resto de compañeros de la Unidad de Bioquímica de la
Facultad de Veterinaria, por vuestra ayuda.
Al Dr. Alberto Álvarez Barrientos por la realización de los experimentos de Citometría de
Flujo y de Microscopía Confocal incluidos en este trabajo. Al Dr. Antonio Chiloeches Gálvez,
por su ayuda con los experimentos de actividad quinasa de Raf y por acogerme en su casa.
A Silvia, Vanessa, Belén, Carmen, Cristina, José Luís, Mar, porque cada uno en su
momento y en su lugar me habéis ayudado mucho, seguramente sin daros cuenta,
simplemente quitándole importancia a las cosas o “llevándome al teatro”. En especial a Ana,
porque no dudo que el último tramo de esta Tesis, sin tu ayuda, hubiera sido mucho más
duro de llevar.
A mis niñas “London” Belén, Eva y Pilar porque me hicisteis pasar los tres mejores meses
de mi vida, porque sin conocerme me ayudasteis y apoyasteis en todo en mi experiencia en
la city. Mi cortijo es vuestro cortijo. Al Dr. Eric Lam por aceptarme tres meses en su
laboratorio. Y a la EMBO, por hacer posible esa experiencia.
A mi madre y a mi hermana, con las que siempre he podido contar. A mi abuela y a mi tía
por escucharme pacientemente sin entender ni “papa”. A Irene, por ser mi sonrisa.
A José Ramón, porque como dice Paco, “lo tuyo tiene mérito”. Aguantar a Maribel no es
fácil, pero aguantar a Maribel haciendo una tesis es ganarse el cielo. En estos casi 5 años
me has demostrado mucho, sobre todo tu paciencia y tu cariño. Me has dicho la verdad aún
cuando yo no quería oírla y durante esos tres meses me demostraste que no podía haber
elegido un compañero mejor. Por todo y más, muchas gracias niño.
A todos, muchas gracias
MARIBEL
Esta Tesis ha sido realizada con una beca de Formación del Personal Investigador
de la Junta de Extremadura y financiada con proyectos del Ministerio de Ciencia y
Tecnología (SAF2001-0154) y de la Consejería de Educación, Ciencia y Tecnología
de la Junta de Extremadura (2PR01B007 y 2PR04A014).
A mis padres
A José Ramón
Índice
ÍNDICE I. INTRODUCCION 1
1. La ruta de biosíntesis del colesterol. 1
1.1. Inhibición de la ruta de biosíntesis del colesterol. 3 1.2. Efectos de la inhibición de la ruta de biosíntesis del colesterol y del mevalonato.
Efectos sobre el sistema nervioso. 4
2. La apoptosis y el sistema nervioso. 6
2.1. Componentes moleculares implicados en la apoptosis neuronal. 7
2.2. El papel de la familia Bcl-2 en la apoptosis neuronal. 8
2.3. El papel de Apaf-1 y las caspasas en la apoptosis neuronal. 9 3. Rutas de señalización intracelular que regulan la supervivencia y la muerte
celular. 12
4. Señalización intracelular a través de las proteínas quinasas activadas por mitógenos (MAPK). 13
4.1. La superfamilia de proteínas G monoméricas. 14
4.1.1. Las proteínas Ras. 16
4.1.1.1. Prenilación de las proteínas Ras. 17
4.1.1.2. Efectores de las proteínas Ras. 18
4.2. Las MAPKs reguladas por factores extracelulares (ERKs). 18
4.3. Las MAPKs activadas por estrés y citoquinas (JNKs). 20
4.4. Las MAPKs activadas por estrés y citoquinas (p38 MAPKs). 23
5. Señalización celular a través de la fosfatidilinositol 3-quinasa (PI3-K). 25
II. OBJETIVOS. 33
III. MATERIALES Y MÉTODOS. 35
1. Materiales. 35
1.1. Productos y reactivos generales 35
1.2. Materiales, reactivos y productos utilizados en los cultivos celulares. 36
2. Metodos. 37
2.1. Línea celular y método de cultivo. Procedimiento experimental. 37
2.2. Estudio de los niveles de proteínas por Western Blot. 38
2.2.1. Obtención de extractos celulares totales. 38
2.2.2. Obtención de extractos de proteínas nucleares. 38
2.2.3. Cuantificación de las proteínas. 38
2.2.4. Electroforesis de proteínas. 38
2.2.5. Electrotransferencia de proteínas a membrana. 39
2.2.6. Detección de las proteínas. 39
2.3. Ensayo de detección de Ras-GTP. 41
I
Índice 2.3.1. Establecimiento de bacterias competentes. 41
2.3.2. Transformación de bacterias competentes. 41
2.3.3. Expresión de la proteína GST-RBD-Raf-1 42
2.3.4. Purificación de la proteína de fusión GST-RBD-Raf-1 42
2.3.5. Ensayo de detección de Ras-GTP. 42
2.4. Ensayos de actividad de proteínas quinasas in vitro. 43
2.4.1. Ensayo in vitro de la actividad quinasa de la PI3-K. 43
2.4.1.1. Ensayos de inmunoprecipitación. 43
2.4.1.2. Ensayo in vitro de la actividad quinasa. 43
2.4.2. Ensayo in vitro de la actividad quinasa de la JNK. 44
2.5. Ensayo de retardo de la movilidad electroforética (EMSA). 44
2.5.1. Marcaje de los oligonucleótidos. 44
2.5.2. Análisis del retardo electroforético (EMSA). 45 2.6. Estudio de la expresión génica mediante la utilización de genes marcadores
(“Reporter Gene Assays”). 45
2.6.1. Vectores utilizados. 45
2.6.2. Transfección transitoria mediada por lípidos. 46
2.6.3. Detección de la actividad β-Galactosidasa in situ. 46
2.6.4. Ensayos de actividad luciferasa. 47
2.6.5. Ensayos de actividad .β-Galactosidasa. 47
2.7. Técnicas de estudio de la viabilidad y la muerte celular. 48
2.7.1. Ensayos de viabilidad celular. 48
2.7.1.1. Ensayo colorimétrico del MTT. 48
2.7.1.2. Tinción con cristal violeta. 48
2.7.2. Análisis de la fragmentación internucleosomal del ADN. 49
2.7.3. Análisis del contenido de ADN por Citometría de flujo. 49
2.8. Análisis estadístico. 50
IV. RESULTADOS 51 1. Capítulo 1: Lovastatin inhibits the growth and survival pathway of
phosphoinositide 3-kinase/Protein kinase B in immortalized rat brain neuroblasts. 51
2. Capítulo 2: Lovastatin inhibits the extracellular signal regulated kinases pathway in immortalized rat brain neuroblasts. 69
3. Capítulo 3: C-Jun N-terminal protein kinase signalling pathway mediates lovastatin-induced rat brain neuroblasts. 87
V. DISCUSIÓN 109
1. Efecto de la lovastatina en la actividad de Ras. 109
2. Efecto de la lovastatina en la ruta de la PI3-K/PKB. 109
3. Efecto de la lovastatina en la ruta de Ras/ERKs. 112
II
Índice
4. Efecto de la inhibición de las rutas de la PI3-K y de las ERKs en la supervivencia de los neuroblastos. 115
5. Efecto de la lovastatina en las rutas de las JNKs y de la p38 MAPK. 115
6. Las estatinas y las rutas de señalización intracelular. 118
VI. CONCLUSIONES. 121
VII. BIBLIOGRAFÍA. 123
III
Lista de abreviaturas ABREVIATURAS ADN Ácido desoxirribonucléico.
AMPc Monofosfato cíclico de Adenosina.
AP1 Proteína activadora 1.
ARN Ácido ribonucléico.
ARNm Acido ribonucléico mensajero.
ASK Quinasa regulada por señales de apoptosis.
ATF-2 Factor activador de la transcripción 2
ATP Adenosina Trifosfato.
BSA Albumina de suero bovino.
Cas Caspasa.
c.p.m. Cuentas por minuto.
Ci Curio. Unidad de radioactividad correspondiente a 2.2.x105 c.p.m.
Cit. c Citocromo c.
cm Centímetros.
c-Myc Homologo del oncogen viral de la mielocitomatosis aviar.
cols Colaboradores.
CRE Elemento de respuesta a AMPc
CREB Proteína que se une al elemento de respuesta CRE
dCTP Desoxinucleótidos de citosina.
DTT Ditiotreitol.
dTTP Desoxinucleótido de timidina.
EDTA Ácido etilendiaminotetraacético.
eIF4E Factor de iniciación de la traducción en eucariotas.
4E-BPs Proteínas de unión al factor de iniciación de la traducción en eucariotas.
EGF Factor de crecimiento epidérmico.
EGTA Ácido etilendiamina tetracético.
EMSA Ensayo de la movilidad electroforética.
ERK Proteína quinasa activada por señales extracelulares.
ES Error estándar.
FAK Quinasa de adhesión focal.
FBS Suero fetal bovino.
FT Factor de transcripción.
FTasa Farnesil transferasa.
GAPs Proteínas activadoras de la actividad GTPasa.
V
Lista de abreviaturas GAPDH Gliceraldehido 3-fosfato deshidrogenasa.
GDIs Inhibidores de la disociación de nucleótidos de guanina.
GDP Guanosín difosfato.
GEFs Factores intercambiadores de nucleótidos de guanina.
GGTAsa Geranil-geranil-transferasa.
GST Glutation-S-transferasa.
Grb2 Proteína unida a receptor de factores de crecimiento2.
GTP Guanosín trifosfato.
h Horas.
HEPES Ácido-4-(2-hidroxietil)-1-piperazin-etano-sulfónico.
HMG-CoA Hidroximetilglutaril-Coenzima A.
IPTG Isopropil-1-tio-β-D-galactopiranosido.
JNK Quinasa del extremo amino terminal de c-Jun.
Kb Kilobases.
KDa Kilodalton.
LB Medio Luria Bertani.
Lov Lovastatina.
LTP Potenciación a largo plazo.
MAPK Proteína quinasa activada por mitógenos.
MAPKAPK Proteína quinasa activada por MAPK.
MAPKK Proteína quinasa de MAPK.
MAPKKK Proteína quinasa quinasa de MAPK.
Mev Mevalonato.
min Minutos.
ml Mililitros.
mm Milímetros.
mM Milimolar.
mmol Milimol.
MNK Proteína quinasa integradora de la señal MAPK.
MTT Bromuro de 3-(4,5-dimetil-2-tiazolil)-2,5-difenil-2H Tetrazolio.
NADPH Nicotinamida-adenina dinucleótido fosfato.
NFκΒ Factor nuclear κΒ.
ng Nanogramos.
NGF Factor de crecimiento nervioso.
nm Nanómetros.
VI
Lista de abreviaturas p70-S6K Proteína quinasa que fosforila a la proteína ribosomal S6.
PAGE Electroforesis en gel de poliacrilamida.
PBS Tampón fosfato salino.
PDK Quinasa dependiente de 3´-fosfoinositol.
PH Dominio con homología a pleckstrina.
PI Fosfoinositoles.
PI3K Fosfatidil inositol-3-quinasa.
PIP2 Fosfatidilinositol-4,5-trifosfato.
PIP3 Fosfatidilinositol-3,4,5-trifosfato.
PKB (AKT) Proteína quinasa B.
PKC Proteína quinasa C.
PMSF Fluoruro de fenilmetanosulfonilo.
Pro Prolina.
PtdIns Fosfatidilinositol.
PVDF Difluoruro de polivinilo.
RBD Dominio de unión a Ras.
RNasa Ribonucleasa A.
RTK Receptores con actividad tirosina quinasa.
SAPK Quinasa activada por el estrés.
SDS Dodecil sulfato sódico.
Ser Serina.
sg Segundos
SH2 Dominios de homología 2 de Src
SNC Sistema Nervioso Central.
SOS “Son of sevenless”.
SRE Elemento de respuesta a suero.
T.A. Temperatura ambiente.
Thr Treonina.
TNF Factor de necrosis tumoral
TRE Elemento de respuesta a ésteres de forbol.
Tris Hidroximetil-aminometano.
Tyr Tirosina.
V Voltios.
µg Microgramo
µl Microlitro
VII
Lista de abreviaturas
VIII
µM Micromolar.
Introducción
1. LA RUTA DE BIOSÍNTESIS DEL COLESTEROL.
La ruta de biosíntesis del colesterol es multienzimática y su precursor es la acetil-
CoA, en la que, además de colesterol, se sintetizan otros compuestos no esteroideos
indispensables para la célula. El proceso de biosíntesis del colesterol se puede resumir en
las siguientes etapas principales (Omoigui, 2005):
1. La síntesis comienza cuando la acetil-CoA, derivada de una reacción de
oxidación en la mitocondria, es transportada al citoplasma.
2. Se condensan dos moléculas de acetil-CoA para dar lugar a acetoacetil-CoA.
Éste y una tercera molécula de acetil-CoA son convertidos en 3-hidroxi-3-
metilglutaril-CoA (HMG-CoA) por acción de la HMG-CoA sintasa.
3. El HMG-CoA es convertido en mevalonato en la reacción limitante de esta
ruta. La enzima que cataliza esta reacción es la HMG-CoA reductasa.
4. El mevalonato es entonces activado por tres fosforilaciones sucesivas dando
lugar al 5-pirofosfomevalonato.
5. Una reacción de descarboxilación dependiente de ATP va a dar lugar al
isopentenil pirofosfato, que es la molécula básica con la que se construirán
los isoprenoides.
6. Una molécula de isopentenil pirofosfato se condensa con una molécula de
dimetilalilpirofosfato para generar geranil pirofosfato. Este paso es catalizado
por la enzima geranil pirofosfato sintasa.
7. La enzima farnesil pirofosfato sintasa cataliza la condensación de una
molécula de geranil pirofosfato y otra molécula de isopentenil pirofosfato para
dar lugar al farnesil pirofosfato. El farnesil pirofosfato es el precursor de varios
productos tales como el colesterol, el grupo hemo A (componente de la
hemoglobina), el dolicol (requerido para la glicosilación de proteínas) y la
ubiquinona (implicada en la cadena transportadora de electrones
mitocondrial) (Graff y cols., 2004).
8. El farnesil pirofosfato se condensa con otra molécula de isopentenil
pirofosfato para generar geranil geranil pirofosfato. Esta reacción es
catalizada por la geranil geranil pirofosfato sintasa.
1
Introducción
9. La condensación de dos moléculas de farnesil pirofosfato dará lugar al
escualeno en una reacción catalizada por la escualeno sintasa.
10. En dos reacciones sucesivas de ciclación, el escualeno generará lanosterol.
11. El lanosterol, por último, es convertido en colesterol en una serie de 19
reacciones adicionales.
Como hemos visto, en la ruta de biosíntesis del colesterol se sintetizan, entre otros
compuestos, farnesil pirofosfato y geranil geranil pirofosfato (Figura 1). Ambos productos
son esenciales para la función de una gran variedad de proteínas. Los grupos farnesilos o
geranil geranilos se incorporan a las proteínas dando de esta forma lugar a proteínas
farnesiladas o geranil geraniladas. Estas reacciones están catalizadas por la farnesil
transferasa y por la geranil geranil transferasa, respectivamente. A este tipo de modificación
post-transduccional de las proteínas se le conoce con el nombre de (iso)prenilación (Graff y
cols., 2004). La importancia de los procesos de isoprenilación de proteínas radica en el
hecho de que existen varias proteínas implicadas en procesos de señalización que
dependen de la prenilación para ejercer sus funciones. Entre ellas se encuentran Ras,
lamininas nucleares A y B, transducina γ, rodopsina quinasa, Rho, proteínas G
heterotriméricas y varias proteínas que unen GTP pequeñas (Casey, 1995; Rando, 1996).
La prenilación de las proteínas permite su anclaje eficaz a las membranas celulares y su
interacción con otras proteínas, participando de este modo en diversos procesos celulares
como son la supervivencia y la proliferación celular (Graff y cols., 2004). Más adelante, se
describirá con más detalle la farnesilación de las proteínas Ras y su importancia en los
procesos de señalización celular.
2
Introducción
Acetil-CoA + Acetoacetil-CoA
HMG-CoA
Farnesil Pirofosfato
Geranil-geranil Pirofosfato
Proteínas Farnesiladas
Proteínas Geranilgeraniladas
Hemo A
Dolicol
Ubiquinona
EscualenoRutas
SeñalizaciónCelular
HMG-CoA reductasa ESTATINAS
FTasa
GGTasaCOLESTEROL
MEVALONATO
Hormonas EsteroideasVitamina DÁcidos BiliaresLipoproteínas
Figura 1. La ruta de biosíntesis del colesterol
Acetil-CoA + Acetoacetil-CoA
HMG-CoA
Farnesil Pirofosfato
Geranil-geranil Pirofosfato
Proteínas Farnesiladas
Proteínas Geranilgeraniladas
Hemo A
Dolicol
Ubiquinona
EscualenoRutas
SeñalizaciónCelular
HMG-CoA reductasaHMG-CoA reductasa ESTATINASESTATINAS
FTasaFTasaFTasa
GGTasaGGTasaGGTasaCOLESTEROLCOLESTEROL
MEVALONATOMEVALONATO
Hormonas EsteroideasVitamina DÁcidos BiliaresLipoproteínas
Figura 1. La ruta de biosíntesis del colesterol
1.1. Inhibición de la ruta de biosíntesis del colesterol.
Como se ha comentado en el apartado anterior, la reacción limitante de la ruta de
biosíntesis del colesterol es la catalizada por la enzima HMG-CoA reductasa. La regulación
de la actividad de la HMG-CoA reductasa debe de hacerse, por tanto, para cumplir con los
requerimientos celulares de, al menos, dos productos diferentes: los isoprenoides y el
colesterol (Brown y Goldstein 1980). Según la disponibilidad del colesterol y de otros
intermediarios de la ruta, la HMG-CoA reductasa se regula de varias formas: en la
transcripción, en la traducción y mediante modificaciones post-traduccionales, como son la
fosforilación y la degradación poteolítica (Friesen y Rodwell, 2004).
Además de por colesterol y otros metabolitos celulares, la enzima HMG-CoA
reductasa se inhibe por un conjunto de fármacos que reciben el nombre genérico de
estatinas. Las estatinas son análogos estructurales de la HMG-CoA, sustrato de la enzima,
que actúan como inhibidores competitivos y reversibles. Alteran la conformación del centro
activo de la enzima, lo cual hace que estos compuestos sean muy efectivos y específicos.
Su afinidad por la enzima está en el rango nanomolar, mientras que el sustrato natural de la
misma tiene afinidad micromolar (Corsini y cols., 1999). Las estatinas son los principales
fármacos que se utilizan para combatir la hipercolesterolemia, de forma que con su uso se
3
Introducción consigue reducir los niveles de colesterol-LDL entre un 15% y un 61% dependiendo de la
dosis y de la pauta del tratamiento. En la actualidad existen cinco estatinas aprobadas para
su uso clínico: estatinas de primera generación obtenidas a partir de hongos (lovastatina y
pravastatina), estatinas de segunda generación o
semisintéticas (sinvastatina) y estatinas de tercera
generación o sintéticas (fluvastatina, atorvastatina)
(Stancu y Sima, 2001).
La lovastatina, el fármaco utilizado en este
trabajo, es una estatina hidrofóbica administrada de
forma inactiva, como lactona, que debe ser
hidrolizada enzimáticamente para generar la forma
activa (Blumenthal, 2000). En la figura 2 se
representa la estructura química de esta estatina.
Figura 2. La lovastatina.
1.2. Efectos de la inhibición de la ruta de biosíntesis del colesterol y
del mevalonato. Efectos sobre el sistema nervioso.
La ruta de biosíntesis del colesterol juega un papel muy importante en el crecimiento
y la supervivencia celular (Goldstein y Brown, 1990). Mantener unos niveles adecuados de
colesterol es muy importante, ya que las células necesitan colesterol para muchas de sus
funciones, entre las que se incluyen construir las membranas celulares, mantenerlas con la
fluidez adecuada, con estructuras más o menos ordenadas o modificar covalentemente a las
proteínas (Smart y cols., 1994; Murata y cols., 1995; Porter y cols., 1996). Su función como
componente de las membranas celulares hace del colesterol una molécula imprescindible
para el crecimiento celular.
Como ya se ha mencionado, los inhibidores competitivos de la HMG-CoA reductasa
se utilizan de forma habitual en el tratamiento de la hipercolesterolemia. Mientras que los
efectos beneficiosos de las estatinas se reflejan en la disminución de la mortalidad por
arterioesclerosis, varios estudios demuestran que no sólo bloquean la biosíntesis del
colesterol sino que, adicionalmente, inhiben el crecimiento y la proliferación tanto de células
normales como tumorales (Jones y cols, 1994; Raiteri y cols., 1997). Además, la inhibición
de la HMG-CoA reductasa induce la muerte celular por apoptosis en diferentes tipos
celulares (Pérez-Sala y Mollinedo, 1994; Jones y cols., 1994; Padayatty y cols., 1997;
Guijarro y cols., 1998). Se ha demostrado que la capacidad de los inhibidores de la HMG-
CoA reductasa para interferir en la progresión del ciclo celular y para inducir apoptosis
4
Introducción
puede ser debida a su capacidad de bloquear la biosíntesis de compuestos isoprenoides
intermediarios de la ruta, más que a la inhibición de la síntesis del colesterol (Tanaka y cols.,
2000).
En el sistema nervioso central, y principalmente durante el desarrollo fetal y
postnatal, tanto la actividad de la HMG-CoA reductasa como la biosíntesis del colesterol son
muy elevadas, lo que hace pensar que esta ruta también resulta crucial en los procesos de
diferenciación, maduración y mantenimiento de los tejidos neuronales (Maltese y Volpe,
1979; Spady y Dietschy, 1983; Cavender y cols., 1995). Además, las células neuronales son
las que requieren mayor cantidad de colesterol para la síntesis de las membranas en
relación a otros tipos celulares (Graaf y cols., 2004). Sin embargo, los efectos de la
inhibición de la ruta del colesterol con estatinas en el sistema nervioso no se conocen en
profundidad y en ocasiones son contradictorios. Determinados estudios atribuyen a las
estatinas efectos beneficiosos en el sistema nervioso, ya que, entre otras acciones, reducen
el riesgo de desarrollar la enfermedad de Alzheimer y resultan esenciales para la formación
de las sinapsis (Wolozin y cols., 2000; Mauch y cols., 2001), mientras que otros autores
asocian el consumo de estatinas a varios efectos perjudiciales en el sistema nervioso
central, ya que producen alteraciones en el sueño, inducen depresión (Vgontzas y cols.,
1991; Duits y Bos, 1993) y pérdida de memoria (Matthies y cols., 1997; Kotti y cols., 2006).
Otros estudios recientes muestran que el consumo de estatinas durante el primer trimestre
de la gestación, provoca graves anomalías en el sistema nervioso central, entre las que
cabe citar la espina bífida, defectos en el tubo neuro-lumbar, etc. (Edison y Muenke, 2004a,
2004b). Por otro lado, estudios realizados in vitro muestran que las estatinas, a
concentraciones µM y mM, tienen efectos neurotóxicos en cultivos primarios de neuronas
procedentes de la corteza cerebral (Michikawa y Yanagisawa, 1999), provocan una pérdida
de neuritas al interferir en la síntesis de geranil geranil pirofosfato (Schulz y cols., 2004),
están asociadas a procesos de neuromiotoxicidad (Baker y Tarnopolsky, 2005) y en la
microglia, afectan a la motilidad celular y a la distribución del citoesqueleto de actina
(Kuipers y cols., 2006). En concordancia con estos estudios, nuestro grupo ha mostrado que
la lovastatina es capaz de inducir apoptosis en neuroblastos fetales de rata, estando este
efecto pro-apoptótico relacionado con una disminución en la prenilación de Ras (García-
Román y cols., 2001). Sin embargo, hasta la fecha, no se ha realizado una investigación
exhaustiva acerca de los mecanismos moleculares que regulan la apoptosis neuronal inducida por lovastatina.
5
Introducción
2. LA APOPTOSIS Y EL SISTEMA NERVIOSO.
La muerte de células individuales en un tejido se observó por primera vez en
vertebrados hace ya más de 40 años en estudios sobre el desarrollo (Glucksman, 1951;
Saunders, 1966). A principios de los años 70, Kerr, Wyllie y Curie observaron que en las
células se podían observar dos tipos diferentes de muerte: una bien caracterizada, la
necrosis, y una nueva forma, morfológicamente distinta, a la que llamaron apoptosis (Kerr y
cols., 1972; Wyllie y cols., 1981). La muerte celular por necrosis es violenta y se caracteriza
por la tumefacción del citoplasma, la ruptura de las membranas celulares y la desintegración
de los componentes subcelulares y nucleares. Por otro lado, la apoptosis viene definida por
una serie ordenada de eventos que tienen lugar en un período de tiempo más largo y que
afecta únicamente a cada célula individual.
Durante el proceso de apoptosis, la célula se vuelve más compacta y aparecen gran
cantidad de invaginaciones en la membrana plasmática. Estas invaginaciones finalmente
acabarán dando lugar a los llamados cuerpos apoptóticos, en los cuales quedarán recluidos
tanto restos del citoplasma como restos de los distintos orgánulos celulares. Por su parte, la
cromatina se empieza a condensar y finalmente el ADN acaba fragmentado. La apoptosis
es, por tanto, un proceso activo que conlleva, por parte de la célula, la síntesis de nuevo
ARNm así como de nuevas proteínas que participan en este proceso. Típicamente, la célula
se observa heteropicnótica, es decir, condensada y con un núcleo fragmentado y de
pequeño tamaño. La célula se fragmenta en los cuerpos apoptóticos. Estos, finalmente,
serán fagocitados por los macrófagos, evitando así cualquier tipo de respuesta inflamatoria
por parte del organismo.
En el caso del sistema nervioso, y en particular de las neuronas, la apoptosis es un
tipo de muerte celular programada responsable de la eliminación fisiológica de poblaciones
celulares que durante el desarrollo embrionario no han establecido las conexiones
adecuadas, o bien no disponen de los suficientes factores tróficos para poder llevar a cabo
sus funciones (Wyllie, 1988). Este proceso va a determinar el tamaño y la forma del sistema
nervioso de los verterbrados (Kuan y cols., 2000). Se estima que más de la mitad de las
neuronas del sistema nervioso central de los vertebrados mueren durante el desarrollo
embrionario, o bien, en la maduración postnatal temprana mediante una muerte celular
programada (Raff y cols., 1993). En el adulto, una activación inapropiada de la apoptosis
contribuye al desarrollo de enfermedades neurodegenerativas como el Parkinson, la
esclerosis múltiple o la lateral amiotrófica, así como a varias formas de degeneración
cerebelar, atrofia muscular espinal y la enfermedad de Alzheimer (Barinaga, 1993), que se
caracterizan por una pérdida gradual de subpoblaciones específicas de neuronas. Por lo
6
Introducción
tanto, no es de extrañar que el proceso apoptótico esté controlado muy rigurosamente por
distintas vías de señalización intracelular.
La apoptosis puede inducirse por multitud de efectores: ausencia de factores de
crecimiento, ligandos peptídicos específicos (factor de necrosis tumoral α, ligando de Fas,
etc.), cambios en la concentración de calcio intra o extracelular, fármacos (estaurosporina,
ésteres de forbol, etc.,) o daños tanto en el ADN como en la mitocondria. Aunque cada uno
de ellos va a actuar en un punto específico de las vías de transducción que conducen a la
apoptosis, todos ellos implican un daño celular que podemos considerar irreparable, y al que
la célula responde con el inicio del proceso apoptótico.
2.1. Componentes moleculares implicados en la apoptosis neuronal.
La identificación de los genes que regulan la muerte celular programada ced-3, ced-4
y ced-9 en el nemátodo Caenorhabditis elegans y sus homólogos en mamíferos, permitió
examinar los mecanismos moleculares por los cuales se produce la muerte neuronal
(Metzstein y cols., 1998). Pronto se descubrió que la muerte neuronal en vertebrados
inducida por la eliminación de factores tróficos requería la participación de cisteína
proteasas, más tarde denominadas caspasas, homólogos en mamíferos del gen ced-3 de C-
elegans (Gagliardini y cols., 1994). Fue la primera evidencia funcional de que la eliminación
de un factor trófico activaba un programa de muerte en las neuronas de vertebrados.
La apoptosis en mamíferos está regulada por la familia de proteínas Bcl-2, la
proteína adaptadora Apaf-1 y la familia de cisteína proteasas o caspasas, las cuales son
homólogas a los productos de los genes de muerte de C. elegans CED-9, CED-4 y CED-3,
respectivamente (Hengartner y Horvitz, 1994). Las neuronas comparten con todos los
demás tipos celulares el programa básico de apoptosis. Sin embargo, diferentes tipos de
neuronas y en diferentes etapas del desarrollo neuronal, expresan distintas combinaciones
de miembros de la familia Bcl-2 y caspasas, lo cual está estrechamente relacionado con la
especificidad de su regulación (De Zio y cols., 2005). Hasta la fecha, han sido
caracterizadas dos rutas principales que desencadenan la apoptosis (Becker y Bonni, 2004):
1. La vía extrínseca activada por estímulos extracelulares cuya acción es
mediada por receptores de membrana que tienen en común dominios
extracelulares ricos en cisteína y una secuencia citoplasmática muy similar en
todos ellos denominada dominio de muerte (DD o “death domain”). Esta vía
7
Introducción
conduce a la activación directa de la cascada de caspasas, siendo la caspasa
8 la primera en activarse.
2. La vía intrínseca activada como respuesta a señales intracelulares o
lesiones como un daño en el ADN. Las rutas que desencadenan la activación
de esta vía convergen en la mitocondria a través de la activación de los
miembros pro-apoptóticos de la familia Bcl-2 que regulan la liberación del
citocromo c. En este caso también se produce la activación de las caspasas.
En esta vía, la primera caspasa que se activa es la caspasa 9. (Figura 3).
2.2. El papel de la familia Bcl-2 en la apoptosis neuronal.
La familia de proteínas Bcl-2 desempeña un papel crucial en la transducción de
señales implicadas en la apoptosis. Esta familia incluye proteínas tanto anti- como pro-
apoptóticas que presentan uno o más dominios de homología con Bcl-2 (BH) (Merry y
Korsmeyer, 1997). Los miembros anti-apoptóticos de la familia Bcl-2, Bcl-2 y Bcl-XL, se
localizan en la membrana externa de la mitocondria, en el retículo endoplásmico y en la
membrana perinuclear. La expresión de Bcl-2 es elevada en el sistema nervioso central
durante el desarrollo y disminuye tras el nacimiento mientras que Bcl-XL se expresa en el
cerebro en desarrollo y a diferencia de Bcl-2 su expresión continúa en el individuo adulto
(González-García y cols., 1995). La proteína Bcl-2 es crítica para el mantenimiento de la
supervivencia neuronal, mientras que Bcl-XL es crucial para la supervivencia de neuronas
inmaduras antes de que éstas estabilicen sus conexiones sinápticas (Yuan y Yankner,
2000).
Bcl-2 y Bcl-XL ejercen su acción anti-apoptótica actuando sobre los miembros pro-
apoptóticos de la familia Bcl-2 (Bax, Bad, Bim, Bid, Bik) inhibiéndolos por procesos de
heterodimerización cuando éstos translocan a la mitocondria desde el citosol redirigidos por
señales pro-apoptóticas (Ferry y Korsmeyer, 1997). Allí compiten por regular la salida del
citocromo c por mecanismos aún en discusión.
La integración de las vías extrínseca e intrínseca de la apoptosis ocurre a través del
miembro pro-apoptótico Bid. La proteolisis de Bid por acción de la caspasa 8 libera su
extremo carboxilo y conduce a la traslocación de Bid a la mitocondria, promoviendo así la
salida del citocromo c al citosol. El citocromo c induce la interacción de la proteína
citoplasmática Apaf-1 con la caspasa 9, formando el complejo proteico denominado
8
Introducción
apoptosoma, que a su vez induce la autoproteolisis y activación de la caspasa 9. Ésta a su
proteoliza a la pro-caspasa 3, generándose la caspasa 3 activa (Gross y cols., 1999).
Entre los miembros pro-apoptóticos de la familia Bcl-2 se encuentra una proteína con
un sólo dominio BH3 denominada Bim que es de particular interés en el estudio de la
apoptosis en el sistema nervioso. Bim se une al dominio BH3 de Bax causando un cambio
conformacional que conduce a su oligomerización e integración en la membrana
mitocondrial externa y a la formación de canales para la liberación del citocromo c y otros
factores mitocondriales apoptóticos (Donovan y cols., 2002). Bim presenta tres isoformas
generadas por procesamiento alternativo: BimS (“Bim short”), BimL (“Bim long”) y BimEL
(“Bim extra long”) (O´Relly y cols., 2000). La actividad pro-apoptótica de Bim está regulada
por varias rutas de señalización que regulan su expresión y su fosforilación. Así, la
activación del factor de transcripción FOXO3a, como consecuencia del bloqueo de la ruta de
la fosfatidilinositol-3 quinasa, incrementa la expresión de Bim (Zhu y cols., 2004). Sin
embargo, las principales proteínas reguladoras de Bim son las quinasas que fosforilan el
extremo N-terminal de c-Jun ó JNKs y las activadas por estímulos extracelulares o ERKs. La
activación de las JNKs promueve la actividad de Bim al aumentar su expresión y su
fosforilación en el residuo serina 65 (Putcha y cols., 2003) mientras que la fosforilación
directa de Bim en el residuo serina 69 por las ERKs resulta en una disminución de los
niveles de Bim a través de un mecanismo dependiente del proteosoma (Weston y cols.,
2003).
2.3. El papel de Apaf-1 y las caspasas en la apoptosis neuronal.
Apaf-1 es el homólogo en mamíferos del gen de muerte celular de C. elegans ced-4.
Transmite la señal apoptótica desde la mitocondria y activa las caspasas. Como se comentó
en el apartado anterior Apaf-1 forma un complejo con el citocromo c, liberado de la
mitocondria, y la caspasa 9 para mediar su activación (Zou y cols., 1997). La caspasa 9
activada hidroliza y activa a la caspasa 3. Los ratones deficientes en Apaf-1 mueren durante
el desarrollo embrionario, mostrando una apoptosis reducida en el cerebro con un marcado
desarrollo de la zona proliferativa periventricular (Cecconi y cols., 1998), lo que sugiere que
Apaf-1 es indispensable para la apoptosis de células progenitoras neuronales.
La capacidad de los inhibidores de las caspasas para bloquear la muerte neuronal
inducida por la eliminación de factores tróficos y otras condiciones citotóxicas, supone una
evidencia indiscutible del papel crucial de las caspasas en la apoptosis neuronal (Cryns y
Yuan, 1998). En mamíferos se han identificado al menos 14 caspasas diferentes y las
9
Introducción neuronas, como el resto de los tipos celulares, pueden expresar varias de ellas de forma
simultánea.
Las caspasas son cisteína proteasas que actúan en secuencias específicas que
contienen residuos de aspártico (cisteína-aspártico proteasas) y que se expresan como pro-
enzimas catalíticamente inactivas compuestas por un pro-dominio en la región amino-
terminal, una subunidad grande y una subunidad pequeña. La activación de las caspasas
implica un procesamiento proteolítico entre los dominios seguido de la asociación de la
subunidad pequeña y la subunidad grande para formar el heterodímero o el tetrámero
activo. Una vez activas, las caspasas hidrolizan a otras caspasas o a otros sustratos. La
especificidad de sustrato de una caspasa la determina una secuencia de cuatro residuos
que se encuentran en la dirección amino terminal del punto de corte. Las caspasas
participan en una cascada de eventos proteolíticos que producen la alteración de la
homeostasis celular y afectan al mecanismo de reparación del ADN, produciendo los
cambios celulares característicos de la apoptosis (Marks y Berg, 1999).
Las caspasas se pueden clasificar en dos grandes grupos: caspasas iniciadoras,
entre las que se encuentran la 2, 8, 9, 10 y 12, y las caspasas efectoras o ejecutoras como
la 3, 6 y 7. Las caspasas también pueden diferenciarse en base a la secuencia de sus pro-
dominios. Así, las caspasas que presentan un dominio largo del tipo DED (“death-effector
domain”), como las caspasas 8 y 10, son activadas por la interacción con los dominios
intracelulares de receptores de muerte como el CD95 (Apo-1/Fas) y los receptores del factor
de necrosis tumoral o TNF. Las caspasas con dominios largos tipo CARD (“caspase-
activating recruitment domains”), entre las que se encuentran las caspasas 1, 2, 4, 5, 9, 11 y
12, son activadas principalmente a través de complejos intracelulares de activación tales
como el ya mencionado complejo citocromo c/Apaf-1 y caspasa 9 (Li y cols., 1997). Por otro
lado, las caspasas con pro-dominios cortos, como la caspasa 3, pueden ser activadas por la
mayoría de las caspasas. La caspasa 3 se activa al proteolizarse su precursor (el zimógeno
pro-caspasa 3) en dos fragmentos de 17 y 12 KDa que se van a unir para formar el
heterodímero activo. La caspasa 3 interviene en lo que se denomina la fase efectora de la
apoptosis. Ésta va a producir la hidrólisis de diferentes sustratos entre ellos PARP (poli-
ADP-ribosa polimerasa) y DFF (factor de fragmentación del ADN) ó CAD (ADNasa activada
por caspasa). La PARP está implicada en los procesos de reparación del ADN y es muy
importante para mantener la viabilidad de la célula. De hecho, su proteolisis facilita la
disrupción de la célula, por lo que se emplea como marcador del proceso apoptótico (Oliver
y cols., 1998). En cuanto a DFF, en células no apoptóticas, se encuentra en el núcleo como
un heterodímero formado por una subunidad inhibidora o ICAD (inhibidor de ADNasa
activada por caspasa) y una subunidad con actividad nucleasa latente o CAD. Ante un
10
Introducción
estímulo apoptótico, la caspasa 3 hidroliza a este complejo y libera y activa a la subunidad
CAD que producirá así la degradación del ADN, una de las características bioquímicas de la
apoptosis como ya se ha mencionado (Widlak y Garrard, 2005).
Las dos principales caspasas implicadas en la apoptosis neuronal son la caspasa 3 y
la caspasa 9. Ratones deficientes en caspasa 3 (Kuida y cols., 1996) y en caspasa 9 (Kuida
y cols., 1998) muestran similares y graves defectos en el desarrollo de la muerte neuronal.
Estímulos apoptóticos
Fas/TNF
Citocromo c
ApoptosomaProcaspasa-9Apaf-1Citocromo c
Bid
Bid
Caspasa 9
Caspasa-8
Caspasa-3
Pro-Cas 8FADD
Apoptosis
Figura 3. Representación esquemática de las dos principales víasque desencadenan la apoptosis.
Estímulos apoptóticos
Fas/TNF
Citocromo c
ApoptosomaProcaspasa-9Apaf-1Citocromo c
BidBid
BidBid
Caspasa 9Caspasa 9
Caspasa-8
Caspasa-3
Pro-Cas 8Pro-Cas 8FADDFADD
Apoptosis
Figura 3. Representación esquemática de las dos principales víasque desencadenan la apoptosis.
11
Introducción
3. RUTAS DE SEÑALIZACIÓN INTRACELULAR QUE REGULAN LA SUPERVIVENCIA Y LA MUERTE CELULAR.
La supervivencia y la muerte neuronal están controladas por diversas rutas de
señalización celular. Bajo el término de “transducción de señales” se agrupan los
mecanismos por los cuales estímulos extracelulares que llegan a la membrana plasmática
de la célula se convierten en respuestas celulares específicas que permiten la adaptación a
cambios en el medio externo, así como el mantenimiento de la homeostasis. La
transducción de una señal desde la membrana plasmática y su propagación en el interior
celular se realiza por la activación secuencial de distintas proteínas, entre las que podemos
encontrar proteínas quinasas y fosfatasas, organizadas en lo que se conocen como
“cascadas de señalización”. Estas cascadas pueden ser activadas por una gran variedad de
estímulos entre los que se incluyen hormonas, factores de crecimiento, citoquinas y agentes
que dañan el ADN. La organización de las proteínas quinasas en cascadas de señalización
es importante porque permite amplificar, diversificar e integrar las distintas señales que
recibe la célula.
En 1956, Krebs y Fischer pusieron de manifiesto la importancia de la fosforilación de
las proteínas en la regulación del metabolismo del glucógeno al descubrir que la fosforilasa
de glucógeno permanece activa sólo cuando un determinado residuo de serina está
fosforilado (Krebs y Fischer, 1956). Hoy se sabe que la fosforilación reversible de proteínas
se produce en casi todos los aspectos de la vida celular y que juega un papel muy
importante en la regulación de muchos procesos como el metabolismo, la expresión de
genes, la proliferación, la diferenciación y la respuesta inmune. La importancia de la
fosforilación y su correcta regulación se ha puesto de manifiesto al conocerse que la
fosforilación anormal de las proteínas puede originar o ser el resultado de diversas
enfermedades como la diabetes, el cáncer, las enfermedades autoinmunes,
neurodegenerativas o cardiovasculares (Cohen, 2002).
La fosforilación de proteínas la llevan a cabo proteínas quinasas que catalizan la
transferencia de un fosfato del ATP a residuos específicos de serina, treonina o tirosina en la
proteína sustrato. La desfosforilación de estos residuos está catalizada por proteínas
fosfatasas.
12
Introducción
4. SEÑALIZACIÓN INTRACELULAR A TRAVÉS DE LAS PROTEÍNAS QUINASAS ACTIVADAS POR MITÓGENOS (MAPK).
Las células son capaces de reconocer y responder a una gran variedad de estímulos
extracelulares a través de programas intracelulares específicos como la cascada de
señalización que conduce a la activación de las proteínas quinasas activadas por mitógenos ó MAPKs. Todas las células eucariotas poseen múltiples rutas MAPKs las
cuales coordinan diversas actividades celulares que van desde la expresión de genes,
mitosis y metabolismo hasta la motilidad, supervivencia, apoptosis y diferenciación celular
(Roux y Blenis, 2004). Hasta la fecha, se han caracterizado cinco grandes grupos de MAPKs
en mamíferos (Chen y cols., 2001; Kyriakis y Avruch, 2001):
1. Las quinasas reguladas por señales extracelulares (ERKs).
2. Las quinasas que fosforilan el extremo N-terminal de c-Jun (JNKs).
3. Las quinasas activadas por mitógenos de 38 KDa o p38 MAPKs.
4. Las ERKs 3 y 4.
5. La ERK 5.
En vertebrados, las subfamilias de MAPKs más ampliamente estudiadas son las de
ERKs, JNKs y p38 quinasas.
Todas las vías de las diferentes MAPKs comparten los siguientes componentes que
constituyen el núcleo de señalización: una MAPK quinasa quinasa (MAPKKK), una MAPK
quinasa (MAPKK) y una MAPK (Kyriakis y Avruch, 2001). Las MAPKKKs, con actividad
serina-treonina quinasa, son generalmente activadas por fosforilación y/o como resultado de
su interacción con una proteína G monomérica de la familia de Ras o Rho (Dan y cols.,
2001; Kolch, 2000). La activación de las MAPKKKs conduce a la fosforilación y activación de
una MAPKK, la cual estimulará la actividad de una MAPK a través de una fosforilación doble
en residuos de treonina y tirosina localizados en el lazo de activación del dominio VIII de la
quinasa. Una vez activadas, las MAPKs fosforilan a sus sustratos en residuos de serina o
treonina seguidos de una prolina. La selectividad del sustrato es a menudo conferida por la
existencia de dominios de interacción específica en los sustratos fisiológicos. Además, la
especificidad de la cascada de las MAPKs está también mediada por la interacción con
proteínas “scaffolding” que organizan las rutas en módulos específicos a través de la unión
simultánea de varios componentes (Roux y Blenis, 2004).
13
Introducción
Las MAPKs pueden ser activadas por una gran variedad de estímulos diferentes,
pero en general, las ERKs se activan preferentemente en respuesta a factores de
crecimiento y esteres de forbol, mientras que las JNKs y las p38 MAPKs responden a
estímulos de estrés que van desde el choque osmótico y la radiación ionizante a la
estimulación por citoquinas (Pearson y cols., 2001). (Figura 4).
Ruta ERK JNK p38-MAPK
MAPKKK(MKKK)
MAPKK(MKK)
MAPK
Sustratos
Papel enApoptosis
RafMEKK2
Raf MEKKs, ASK, MLK, TAK1
MEK1/2 MEK5 MKK4/7 MKK3/6
ERK1/2 ERK5 JNK1/2/3 p38-αβγδ
p90RSKElk
c-mycMEF2
JunATF-2ELK-1
MNK1MAPKAPK2/5
CDC25MEF2
AntiApoptosis
AntiApoptosis
Anti y proApoptosis
Anti y proApoptosis
Estímulos Mitógenos Estrés/Citoquinas
Ruta ERK JNK p38-MAPK
MAPKKK(MKKK)
MAPKK(MKK)
MAPK
Sustratos
Papel enApoptosis
RafMEKK2
Raf MEKKs, ASK, MLK, TAK1
MEK1/2 MEK5 MKK4/7 MKK3/6
ERK1/2 ERK5 JNK1/2/3 p38-αβγδ
p90RSKElk
c-mycMEF2
JunATF-2ELK-1
MNK1MAPKAPK2/5
CDC25MEF2
AntiApoptosis
AntiApoptosis
Anti y proApoptosis
Anti y proApoptosis
Estímulos Mitógenos Estrés/CitoquinasEstímulos Mitógenos Estrés/Citoquinas
Figura 4. Las proteínas quinasas activadas por mitógenos o MAPKs.
4.1. LA SUPERFAMILIA DE PROTEÍNAS G MONOMÉRICAS.
Las proteínas G monoméricas forman una superfamilia con más de cien miembros
identificados, hasta la fecha, en eucariotas. Desde un punto de vista estructural, los
miembros de esta superfamilia se clasifican en cinco grandes familias denominadas Ras,
Rho/Rac/Cdc42, Rab, Sar1/Arf y Ran, implicadas en múltiples mecanismos de señalización
intracelular. Estas proteínas sufren modificaciones post-traduccionales, en su extremo
carboxilo terminal concretamente modificaciones lipídicas, que son necesarias para que se
unan a las membranas celulares donde interaccionan con sus moléculas reguladoras y
efectoras.
14
Introducción
Las proteínas G monoméricas, con una masa molecular que varía entre los 20 y los
40 KDa, son GTPasas, es decir, enzimas capaces de unir e hidrolizar nucleótidos trifosfato
de guanina o GTP. Estas proteínas se encuentran siempre unidas a nucleótidos de guanina
y en función de la naturaleza de éste, las proteínas G se encontrarán en estado inactivo,
cuando tienen unido GDP, o en estado activo cuando tienen unido GTP (Takai y cols.,
1992). El cambio de GDP a GTP se produce tras la recepción de una señal estimuladora, la
cual provoca cambios estructurales que hacen accesible la región efectora a los
denominados efectores. La forma activa de estas proteínas es capaz de hidrolizar GTP
gracias a su actividad GTPasa intrínseca, volviendo de nuevo a su estado inactivo y
cerrándose de este modo el ciclo.
El paso limitante en el proceso de
activación es el intercambio de GDP por
GTP. Esta reacción es extremadamente
lenta por lo que se hace necesaria la
acción de un grupo de proteínas
denominadas factores intercambiadores
de nucleótidos de guanina o GEFs. Estos
GEFs interaccionan con la forma inactiva
de las proteínas G y facilitan la salida del
GDP, el cual es rápidamente sustituido por
el GTP. (Figura 5).
GTPasaGDP
GTPasa
GDI
GDI
GDP
GTPasaGTP
GAP
GEF
SeñalesReguladoras
GTP GDP
Pi
Efectores
Figura 5. Ciclo de activación de las proteínas G monoméricas
GTPasaGDP
GTPasa
GDI
GDI
GDP
GTPasaGTP
GAP
GEF
SeñalesReguladoras
GTP GDP
Pi
Efectores
Figura 5. Ciclo de activación de las proteínas G monoméricas
GTPasaGTPasaGDPGDP
GTPasaGTPasa
GDIGDI
GDIGDI
GDPGDP
GTPasaGTPasaGTPGTP
GAP
GEF
SeñalesReguladoras
GTP GDP
Pi
Efectores
Figura 5. Ciclo de activación de las proteínas G monoméricas
La actividad GTPasa de las proteínas G es bastante lenta, por lo que se hace
necesaria la participación de otro grupo de proteínas denominadas factores activadores de
la actividad GTPasa o GAPs, cuya función es acelerar la hidrólisis del GTP. Además, existe
una clase de proteínas reguladoras conocidas con el nombre de inhibidores de la
disociación de nucleótidos de guanina (GDIs), que parecen funcionar como inhibidores de la
actividad GTPasa al prevenir la disociación del GDP. Sin embargo, el papel preciso de las
GDIs en este ciclo no está muy claro (Bernards y Settleman, 2004).
La mayoría de las proteínas G monoméricas se encuentran ampliamente distribuidas
en células de mamíferos aunque los niveles de expresión de los miembros de cada familia
varían según el tipo celular. La localización subcelular de estas proteínas es variada. Así, las
podemos encontrar en la membrana plasmática, en el citosol o en el núcleo, pero siempre
unidas a un tipo específico de membranas.
Las proteínas G monoméricas intervienen en la regulación de funciones celulares
muy diversas, entre las que destacan el crecimiento y la supervivencia celular, la
15
Introducción organización del citoesqueleto, el tráfico intracelular de vesículas y el transporte nuclear
(Macara y cols., 1996). Las proteínas de la subfamilia de Rho, como Rho, Rac1 y Cdc42,
regulan la transducción de señales en una gran variedad de funciones celulares
relacionadas con la morfología, la adhesión, la motilidad y el crecimiento celular y la
metástasis de células cancerosas (Hall, 1998). Entre los efectores de estas proteínas se
encuentran las proteínas quinasas JNKs y las p38 MAPKs (Coso y cols., 1995). RhoA y
RhoC sufren una modificación post-transduccional por geranil geranilación mientras que
RhoB puede ser farnesilado y geranil geranilado (Adamson y cols., 1992). Las proteínas Ras
farnesiladas están asociadas a la transducción de señales mitogénicas en respuesta a
factores de crecimiento; entre sus principales efectores se encuentran la ruta de Raf-MEK-
ERK y la ruta de la fosfatidilinositol 3-quinasa o PI3-K, ambas implicadas principalmente en
la supervivencia celular (Pronk y Bos, 1994).
4.1.1. LAS PROTEÍNAS RAS.
Las proteínas Ras son los miembros mejor caracterizados de la superfamilia de
proteínas G monoméricas (Cox y Der, 2003). En humanos, la familia de proteínas Ras
incluye tres proto-oncogenes denominados H-ras, K-ras y N-ras y un gen muy similar
denominado TC21. Las proteínas Ras tienen un peso molecular de 21 KDa y en su
estructura primaria se pueden distinguir cuatro regiones diferentes denominadas región
constante, región variable, región hipervariable y caja CAAX. Esta última región es esencial
para la actividad de estas proteínas, ya que en ella se encuentran las secuencias señal de
prenilación que van a localizar a las proteínas Ras en la membrana plasmática. Las
proteínas Ras son sintetizadas como precursores inactivos que se localizan en el citoplasma
y, tras ser preniladas, son transportadas y localizadas en la membrana plasmática donde
realizan su función. Las proteínas Ras, tal y como se ha descrito anteriormente, se
encuentran oscilando entre un estado activo e inactivo.
Las proteínas Ras modulan muchos aspectos funcionales de la célula, incluyendo la
proliferación, la diferenciación, la motilidad y la muerte celular (Shields y cols., 2000). La
única función enzimática conocida de Ras es su actividad GTPasa, por lo demás no es
capaz de modificar directamente a ningún posible sustrato. Ras, una vez activado, sufre
cambios conformacionales que hacen accesible su región efectora a otras proteínas.
16
Introducción
4.1.1.1. Prenilación de las Proteínas Ras.
La modificación post-traduccional de algunas proteínas por la incorporación de
isoprenoides a su molécula o prenilación se demostró por primera vez en fibroblastos Swiss
3T3 (Schmidt y cols., 1984). Generalmente, la prenilación (farnesilación o geranil
geranilación) de una proteína conduce a la translocación de la misma desde el citosol a la
membrana. La importancia de la localización celular para la función de Ras se determinó al
demostrarse que las formas oncogénicas de Ras eran inactivas cuando se prevenía su
asociación a la membrana debido a una mutación en un residuo de cisteína (Willumsen y
cols., 1984). Posteriormente, se demostró que este residuo era el aceptor de un grupo
farnesilo (Hancock y cols., 1989). El sitio de prenilación de las proteínas Ras consiste en
una secuencia formada por cuatro aminoácidos situada en el extremo carboxilo terminal,
CAAX, donde C representa la cisteína, A representa los residuos alifáticos de leucina,
isoleucina o valina y X los de metionina, alanina o serina. Las proteínas Ras son sustratos
de una reacción de farnesilación catalizada por la enzima farnesil transferasa que incorpora
grupos farnesilos al sulfuro de la cadena lateral de la cisteína. Tras la prenilación, los tres
aminoácidos del extremo C-terminal son hidrolizados por proteolisis y la cisteína prenilada
es metilada (Waddick y Uckun, 1998) (Figura 6).
Ras
P P P P
Ras
F
Ras
F
FPP
PP
Ras
F
GDP
Ras
F
GTP
Rutas deSeñalización
Celular
Receptor Ligando
Figura 6. Farnesilación de Ras
Ras
P P P P
Ras
F
Ras
F
Ras
F
FPP
PP
Ras
F
GDPGDPGDP
Ras
F
GTPGTPGTP
Rutas deSeñalización
Celular
Receptor Ligando
Figura 6. Farnesilación de Ras
17
Introducción
4.1.1.2. Efectores de las proteínas Ras.
En la actualidad se conocen varios efectores de Ras que desempeñan funciones
diversas regulando tanto acciones anti-apoptóticas (Raf, la fosfatidilinositol 3-quinasa y Tiam
1) como pro-apoptóticas (Nore1 y RASSF1) (Repasky y cols., 2004). Otros efectores de Ras
son los factores intercambiadores de nucleótidos de guanina (Ral-GDS, RGL), factores
activadores de la actividad GTPasa (120 GAP, NF1), proteínas adaptadoras (AF-6), lipasas
(PLCε) y la serina-treonina quinasa PKCξ (Repasky y cols., 2004).
Los distintos efectores de Ras se caracterizan por presentar un dominio de unión a
Ras ó “Ras-binding Domain” (RBD). Los RBDs están formados por unos 100 aminoácidos y
hasta la fecha se han descrito tres: el dominio de unión a Ras de Raf 1 o Tiam 1; el dominio
de unión a Ras de la subunidad catalítica de la fosfatidilinositol 3-quinasa de la clase I y los
dominios de asociación a Ras (RA) encontrados en los demás efectores de Ras (Ponting y
cols., 1996).
4.2. LAS MAPKs REGULADAS POR FACTORES EXTRACELULARES (ERKs).
Las ERKs fueron las primeras MAPKs identificadas, por lo que se han utilizado como
modelo para el estudio de las otras vías de señalización homólogas descubiertas con
posterioridad. En mamíferos, el esquema principal de la cascada de las ERKs es el
siguiente: las MAPKKKs A-Raf, B-Raf y Raf-1, las MAPKKs MEK1 y MEK2, y las MAPKs
ERK1 y ERK2. ERK1 y ERK2 comparten un 83% de homología y se expresan en todos los
tejidos (Chen y cols., 2001). Tienen pesos moleculares de 44 KDa y 42 KDa
respectivamente, por lo que también se las conoce con el nombre de p44/p42 MAPK.
Además de por los estímulos arriba mencionados, las ERKs se activan por ligandos de los
receptores acoplados a proteínas G heterotriméricas, estrés osmótico y eventos como la
desorganización de los microtúbulos (Lewis y cols., 1998).
Como se describió en un apartado anterior, los receptores con actividad tirosina
quinasa transmiten las señales mitogénicas a la cascada Raf/MEK/ERK a través de las
diferentes isoformas de las proteínas Ras (Wood y cols., 1992; Campbell y cols, 1998). Ras
es activado tras la dimerización, activación y asociación del receptor con actividad tirosina
quinasa a una serie de proteínas adaptadoras, como Grb2, que interaccionan con los GEFs,
como SOS. SOS interacciona con Ras produciendo el intercambio de GDP por GTP. Ras-
GTP interacciona y activa a un gran número de proteínas efectoras entre las que se incluye
18
Introducción
la serina/treonina quinasa Raf (Geyer y Wittinghofer, 1997). El mecanismo exacto por el cual
se produce la activación de Raf no se conoce todavía pero se sabe que es un proceso
complejo constituido por múltiples pasos que implicarían la traslocación de Raf a la
membrana de la célula. Una vez localizada en la membrana, la actividad de Raf se regula
por fosforilación (Chong y cols., 2003). Entre las proteínas que pueden fosforilar a las
distintas isoformas de Raf se encuentran la proteína quinasa C o PKC (Kolch y cols., 1993),
la proteína quinasa A o PKA (Quilliam y cols., 1991) y la proteína quinasa B o PKB que
fosforila e inhibe a Raf (Guan y cols., 2000). Raf activo se une y fosforila a las quinasas de
especificidad dual MEK1 y MEK2 las cuales, a su vez, fosforilan en residuos de treonina y
tirosina a ERK1 y ERK2. Estos residuos se encuentran en un motivo Thr-Glu-Tyr localizado
entre los dominios VII y VIII del lazo de activación de la quinasa. La amplificación de la señal
a través de esta cascada es tal que se estima que un incremento en la activación de Ras del
5% es suficiente para inducir la activación de ERK1 y ERK2 (Hallberg y cols., 1994).
Los sustratos de las ERKs se encuentran en diferentes compartimentos celulares,
incluyendo a proteínas integrales de membrana como el receptor de TNFα CD120a, la
tirosina quinasa Syk, el receptor del factor de crecimiento epidérmico o EGFR y la proteína
calnexina (Roux y Blennis, 2004); sustratos nucleares como los factores de transcripción
Elk-1, MEF-2, c-Fos, c-Myc y STAT3 (Frodin y Gammeltoft, 1999); proteínas del
citoesqueleto como MAP-2 y paxilina (Sturgill y cols., 1998; Ku y Meier, 2000) y algunas
proteínas quinasas como la proteína p90 ribosomal S6 quinasa (RSK), las quinasa activadas
por estrés y mitógenos (MSKs) y las quinasas de interacción con MAPK o MNKs (Roux y
Blennis, 2004).
Las ERKs están implicadas en procesos de proliferación y diferenciación celular,
reorganización del citoesqueleto de actina y migración celular. Además, estas proteínas
también participan en la respuesta al estrés y la muerte celular (Johnson y Lapadat, 2002;
Werlen y cols, 2003).
En el sistema nervioso, la ruta de señalización de las ERKs juega un papel
fundamental en procesos de diferenciación, plasticidad y supervivencia neuronal (Hetman y
Gozdz, 2004). Además, esta ruta participa en la regulación de funciones cognitivas como el
aprendizaje y la memoria (Valjent y cols., 2001). Experimentos realizados en células PC12
demostraron que las ERKs podían tener un papel anti-apoptótico en neuronas ya que en
este modelo la sobre-expresión de mutantes activos de MEK-1 prevenía la apoptosis
inducida por la ausencia del factor de crecimiento nervioso ó NGF (Xia y cols., 1995).
Estudios posteriores han confirmado esta función anti-apoptótica de las ERKs en el sistema
nervioso. Por ejemplo, en células del ganglio de la retina de rata, la activación de las ERKs
19
Introducción puede bloquear la muerte celular inducida por la ausencia del factor neurotrófico derivado
del cerebro, el BDNF (Nakazawa y cols., 2002); en neuronas corticales, las ERKs son
necesarias para la neuroprotección ejercida por estrógenos contra la excitotoxicidad
inducida por glutamato (Singer y cols., 1999) y en neuronas granulares de cerebelo, la
activación del factor de transcripción CREB (“cAMP response element binding protein”) y/o
la inhibición de Bad, puede mediar la función antiápoptótica de las ERKs (Bonni y cols.,
1999).
Sin embargo, aunque las ERKs desempeñan un papel anti-apoptótico en muchos
sistemas como ya hemos visto, cada vez más estudios implican a estas quinasas en
procesos de muerte celular tanto en neuronas como en otros tipos celulares. Varios estudios
demuestran que la inhibición de las ERKs tiene un efecto anti-apoptótico en procesos de
isquemia, epilepsia o toxicidad oxidativa inducida por glutamato (Chu y cols., 2004). En
pacientes con la enfermedad de Alzheimer, se ha observado un incremento en los niveles
de la forma fosforilada de las ERKs en neuronas (Zhu y cols., 2002b) y en pacientes con la
enfermedad de Parkinson, se han detectado en la sustancia negra cantidades anormales de
fosfo-ERK1/2 (Zhu y cols., 2002a).
4.3. LAS MAPKs ACTIVADAS POR ESTRÉS Y CITOQUINAS (JNKs).
En el año 1990 se purificó una proteína de 54 KDa que se activaba por fosforilación
en tirosina y en treonina y que fosforilaba a residuos de treonina y serina seguidos de prolina
(Kyriakis y Avruch, 1990). Esta proteína quinasa se denominó proteína quinasa activada por
estrés (SAPK) ya que se activaba por estímulos nocivos como el calor, la radiación, el estrés
oxidativo, las citoquinas, agentes que dañan al ADN e inhibidores de la síntesis de
proteínas, como la anisomicina y la cicloheximida (Kyriakis y Avruch, 2001). Además,
también se la conoce como JNK porque fosforila el dominio N-terminal de trans-activación
del factor de transcripción c-Jun (Hibi y cols., 1993).
Las JNKs están codificadas por tres genes diferentes denominados jnk1, jnk2 y jnk3.
El procesamiento alternativo de estos tres genes produce 10 o más isoformas distintas de
las JNKs. Las isoformas caracterizadas son la JNK1, JNK2 y JNK3, que comparten una
homología de aminoácidos de hasta el 85 % en mamíferos (Pearson y cols., 2001). Estas
proteínas tienen pesos moleculares de 46 KDa (JNK1α, JNK2α) y 54 KDa (JNK1β, JNK2β),
mientras que las isoformas de JNK3 tienen pesos moleculares de 48 KDa la JNK3α y 57
KDa la JNK3β. Las JNK1 y JNK2 se expresan de forma ubicua mientras que la expresión de
la JNK3 tiene lugar principalmente en el cerebro (Davis, 2000).
20
Introducción
Como ya se ha comentado, las JNKs son activadas principalmente en respuesta a
citoquinas, radiación UV, ausencia de factores de crecimiento, agentes que dañan al ADN y,
en menor medida, por algunos receptores acoplados a proteínas G heterotriméricas, suero y
factores de crecimiento (Kyriakis y Avruch, 2001). Al igual que en el caso de las ERKs, las
JNKs siguen el esquema típico de activación en cascada de las MAPKs. En el caso de las
JNKs, parece ser que las MAPKKKs son activadas por proteínas adaptadoras del tipo Nck,
Crk, Shc o TRAFs y/ó proteínas G monoméricas principalmente de la familia de Rho (Rac,
Rho, Cdc42) (Kyriakis,1999). Entre las MAPKKKs de la ruta de señalización de las JNKs se
encuentran las MEKKs, MLKs, ASK-1, TAK-1 o PAKs (Kyriakis y Avruch, 2001). Estas
MAPKKKs activan y fosforilan a las MAPKKs, MKK4 y MKK7. La MKK4 fosforila
principalmente en residuos de tirosina, mientras que la MKK7 tiene preferencia por residuos
de treonina (Fleming y cols., 2000). Se requiere la actuación de ambas proteínas de forma
sinérgica para la completa activación de las JNKs. Por tanto, la MKK4 y la MKK7 fosforilan y
activan a las JNKs en un residuo de tirosina y en otro de treonina en el motivo conservado
Thr-Pro-Tyr. La ruta de las JNKs también está regulada por proteínas “scaffold” tales como
JIP, β-arrestina y JSAP1 (McDonald y cols., 2000).
Una vez activas, las JNKs pueden fosforilar a diferentes proteínas nucleares y
citoplasmáticas. El principal sustrato de las JNKs es el factor de transcripción inducible c-
Jun, que es fosforilado en los residuos serina 63 y serina 73 (Barr y Bogoyevitch, 2001). c-
Jun es el componente mayoritario del factor de transcripción AP-1 (proteína activadora 1). El
factor AP-1 puede estar compuesto por homodímeros formados por dos moléculas de la
familia de c-Jun (JunB y JunD) o heterodímeros entre una proteína de la familia de Jun y
otra de la familia de Fos (c-Fos, FosB, Fra1 y Fra2) o de la familia de ATF (Karin y cols.,
1997).
Además de c-Jun, las JNKs pueden fosforilar a otros factores de transcripción como
son ATF2 (“Activating Transcription Factor”), NFATc1 (“Nuclear Factor Activated T cells”),
STAT3 (“Signal Transduction and Activator of Transcription 3”) y Elk1. La fosforilación de
estos factores de transcripción por las JNKs afecta a su actividad transcripcional y a la
expresión de aquellas proteínas cuyo nivel de transcripción regulan (Roux y Blennis, 2004).
Las JNKs, además de factores de transcripción, también pueden fosforilar diferentes
sustratos citoplasmáticos como a proteínas del citoesqueleto, a Bim, a Bcl-2 y al receptor de
glucocorticoides.
La ruta de señalización de las JNKs participa en muchos y diferentes procesos
celulares. Así, las JNKs regulan la proliferación celular (Zhang y Liu, 2002) y la apoptosis
(Wada y Penninger, 2004); participan en la organogénesis durante el desarrollo embrionario
21
Introducción (Sabapathy y cols., 1999); controlan la respuesta inmune al regular la expresión de
citoquinas (Sabapathy y cols., 1999), la migración celular (Nishina y cols., 2003) y la
integridad del citoesqueleto (Huang y cols., 2004).
En el sistema nervioso, las JNKs han sido consideradas principalmente como
activadoras de la apoptosis. Esta conclusión se basa en los efectos neuroprotectores que
conlleva la inhibición de las JNKs en varios modelos experimentales, por ejemplo en los
procesos de apoptosis inducida por excitotoxicidad en ratones knockout para JNK3 (Yang y
cols., 1997), en la neurotoxicidad inducida por MPTP (Hunnot y cols., 2004) o en procesos
de isquemia cerebral (Borsello y cols., 2003). Además, las JNKs pueden incrementar la
fosforilación de la proteína asociada a los microtúbulos Tau, lo cual parece ser uno de los
fenómenos típicos en enfermedades neurodegenerativas como la enfermedad de Alzheimer
(Reynolds y cols., 1997). Por otro lado, las JNKs fosforilan las cadenas pesadas de los
neurofilamentos con el consiguiente incremento de la vulnerabilidad al estrés de las
neuronas (Giasson y Mushynski, 1997).
Los mecanismos concretos por los cuales las JNKs activan la apoptosis neuronal no
se conocen con exactitud. Por un lado, regulan la liberación del citocromo c en la
mitocondria (Schroeter y cols., 2003) ya que la fosforilación por las JNKs activa los
miembros pro-apoptóticos de la familia Bcl-2 (Bid, Bim, Bad), mientras que inactiva los anti-
apoptóticos (Bcl-2, Bcl-XL) (Tournier y cols., 2000; Putcha y cols., 2003). Por otro lado, las
JNKs están implicadas en la regulación de la transcripción de genes pro-apoptóticos que
codifican por ejemplo para el ligando de Fas, TNFα o Bim (Putcha y cols., 2003).
Aunque la activación de la ruta de las JNKs es importante para regular la apoptosis
neuronal, se ha demostrado que en condiciones fisiológicas existen altos niveles de JNKs
activadas en neuronas, lo cual indica que la señalización a través de las JNKs puede ser
también importante para otros procesos celulares (Harris y cols., 2002; Besirli y Johnson,
2003). En este sentido, algunos autores atribuyen a las JNKs un papel anti-apoptótico en el
sistema nervioso. Por ejemplo, en cerebros embrionarios de ratones knockout de JNK1 y
JNK2 se observa una activación de caspasa 3 (Kuan y cols., 1999); por otro lado, la
activación de las JNKs protege contra la toxicidad inducida por la radiación UV (Widsom y
cols., 1999).
22
Introducción
4.4. LAS MAPKs ACTIVADAS POR ESTRÉS Y CITOQUINAS (p38 MAPKs).
La p38 MAPK fue descrita inicialmente como un polipéptido de 38 KDa que se
fosforilaba en tirosina en respuesta al choque osmótico o al tratamiento con endotoxinas
(Han y cols., 1994), como una proteína diana de drogas con actividad antiinflamatoria
(CSAIDs) (Lee y cols., 1994) y como una quinasa que se activaba por procesos de estrés
celular o por la citoquina IL-1α (Rouse y cols., 1994; Freshney y cols., 1994).
Hasta la fecha se han descrito cuatro isoformas de p38 MAPKs todas implicadas en
procesos celulares de respuesta a estrés y citoquinas pro-inflamatorias: la isoforma original
p38α, también llamada proteína de unión a CSAIDs (CSBP) o SAPK2a; la p38β o SAPK2b
(Jiang y cols., 1996); la p38γ también llamada SAPK3 o ERK6 (Goedert y cols., 1997b) y la
p38δ o SAPK4 (Goedert y cols., 1997a). Estas cuatro isoformas de las p38 MAPKs
presentan un 60 % de homología en su secuencia. Los transcritos de los genes de p38α y
p38β se expresan de forma ubicua en todos los tejidos, mientras que los de los genes de
p38γ se expresan mayoritariamente en el músculo y los de p38δ en el pulmón y en el riñón
(Jiang y cols., 1997; Wang y cols., 1997).
La cascada principal de activación de las p38 MAPKs lo formarían las siguientes
quinasas: las MAPKKKs que incluyen a la familia de las MEK quinasas, principalmente la
MEKK4, la TGF-β quinasa 1 (TAK 1) y la quinasa reguladora de apoptosis (ASK1); las
MAPKKs MKK3 y MKK6 (también llamadas MEK3 y MEK6 respectivamente) y las MAPKs
que incluyen a las cuatro isoformas de la p38 (α, β, γ y δ) (Roux y Blenis, 2004).
Entre los candidatos para la activación y regulación de las MAPKKKs se encuentran
las proteínas de la familia de Rho, Rac y CDC42 (Ono y Han, 2000). Una vez que las
MAPKKKs están activas fosforilan en residuos de serina y treonina a la MEK3 y a la MEK6.
La MEK3 y la MEK6 activas fosforilan a las distintas isoformas de p38 pero mientras que la
MEK6 activa a todas las isoformas de p38, la MEK3 es más selectiva y fosforila
principalmente a las isoformas p38α y p38β . De esta forma, las cuatro isoformas de la p38
MAPK son activadas por doble fosforilación en residuos de treonina y tirosina localizados en
el motivo Thr-Gly-Tyr del lazo de activación situado entre los subdominos VII y VIII de la
quinasa, siendo necesaria la fosforilación conjunta de ambos residuos para su activación
(Roux y Blenis, 2004).
Las p38 MAPKs activas fosforilan a un gran número de sustratos celulares, entre
ellos factores de transcripción como ATF2 que es un componente del factor de transcripción
23
Introducción AP-1, CREB, Elk-1 y MEF2, participando de esta forma en la regulación transcripcional
necesaria para llevar a cabo la respuesta celular a estímulos de estrés (Takeda y Ichijo,
2002). Además, fosforilan proteínas quinasas como las MAPKAP-K2/5, las MSK172 y la
MNK (Takeda y Ichijo, 2002) y a proteínas como la fosfolipasa citosólica A2, Tau y p53
(Roux y Blenis, 2004).
La ruta de señalización de las p38 MAPKs está implicada en un gran número de
procesos celulares diferentes. Así, tiene un papel central en el control de la respuesta
inmune promoviendo la producción de citoquinas (Ono y Han, 2000); también participa en el
control del ciclo celular; regula la organización del citoesqueleto de actina (Schafer y cols.,
1998) y la migración celular y estimula el crecimiento y la diferenciación celular (Juretic y
cols., 2001; Yosimichi y cols., 2001). Por otro lado, dependiendo del tipo celular y del
estímulo, estas quinasas pueden llegar a ejercer efectos opuestos, induciendo o inhibiendo
la apoptosis (Porras y cols., 2004; Liu y cols., 2001). Además, se han visto implicadas en la
formación de tumores (Yee y cols., 2004).
Mientras que las JNKs parecen desempeñar un papel principal en la regulación de la
apoptosis neuronal, la función de las p38 MAPKs en el sistema nervioso aún está en
discusión. Varios estudios sugieren un papel pro-apoptótico en el sistema nervioso de las
p38 MAPKs (Xia y cols., 1995; Kawasaki y cols., 1997; Mielke y Herdegen, 2000; Harper y
LoGrasso, 2001), sin embargo, otros estudios han implicado a las p38 MAPKs en procesos
de diferenciación neuronal. Así, se ha demostrado que la señalización a través de las p38
MAPKs es necesaria para la diferenciación inducida por el factor de crecimiento nervioso
(NGF) de las células PC12 (Morooka y Nishida, 1998); la MAPKKK TAK1 es una candidata
para actuar como mediadora en la diferenciación neuronal de las células PC12 inducida por
la proteína morfogenética de hueso (BMP) (Yanagisawa y cols., 2001), mientras que la
expresión de la ASK1 constitutivamente activa induce el crecimiento de las neuritas en
células PC12 (Takeda y cols., 2000). Sin embargo, no todas las MAPKKKs que pueden
activar la ruta de las p38 MAPKs inducen necesariamente la diferenciación neuronal en
células PC12, ya que la expresión de MEKK1 induce apoptosis en lugar de diferenciación
(Le-Niculescu y cols., 1999). Una posible explicación de esta discrepancia sería que, en
situaciones fisiológicas de actividad neuronal, la ruta de las p38 MAPKs podría actuar como
un mediador de la supervivencia celular. Por el contrario, una vez que las células sufren un
fuerte estrés, la ruta de las p38 MAPKs actuaría entonces como un mediador de la apoptosis
neuronal (Takeda y Ichijo, 2002). En este sentido, la quinasa ASK1 sería un posible
candidato para actuar como regulador de estos efectos opuestos de las p38 MAPKs, ya que
parece funcionar como un intermediario tanto pro- como anti-apoptótico, dependiendo del
24
Introducción
tipo y el contexto celular (Kanamoto y cols., 2000; Matsuzawa y Ichijo 2001; Takeda y cols.,
2000).
5. SEÑALIZACIÓN CELULAR A TRAVÉS DE LA FOSFATIDILINOSITOL-3 QUINASA (PI3-K).
La fosfatidilinositol-3 quinasa, PI3-K, es una proteína quinasa que cataliza la adición
de una molécula de fosfato específicamente en la posición 3 del anillo de inositol de los
fosfoinositoles (PI) dando lugar a la formación de fosfatidilinositoles (PtdIns), precursores de
todos los fosfoinositoles, y que constituyen al menos el 10% de los lípidos totales en las
membranas de las células eucariotas (Rameh y Cantley, 1999). Además, los
fosfatidilinositoles juegan un papel muy importante en la transducción de las señales, ya que
son los precursores de muchas moléculas que actúan como segundos mensajeros en el
interior celular (Golden y Insogna, 2004). Los miembros de la familia de la PI3-K comparten
el dominio catalítico con otras proteínas quinasas entre ellas las PI4-Ks, la proteína quinasa
mTOR, ATM y la proteína quinasa dependiente de ADN (ADN-PK) (Wymann y cols., 2003).
Estructuralmente, la PI3-K presenta dos subunidades de diferente peso molecular,
denominadas subunidades p85 y p110 ó subunidades reguladora y catalítica,
respectivamente. En células de mamíferos se han caracterizado múltiples isoformas de PI3-
K que se dividen a su vez en tres clases en función de la especificidad de su sustrato, de su
estructura o de su regulación:
a) Las PI3-Ks de la clase I son heterodímeros de aproximadamente 200 KDa,
compuestos por una subunidad catalítica de 110-120 KDa y una subunidad
reguladora de 50-101 KDa. Son capaces de fosforilar in vitro PtdIns, PtdIns 4-P y
PtdIns (4,5)P2. Sin embargo, el principal sustrato in vivo de la clase I de PI3-K parece
ser PtdIns (4,5)P2 (Wymann y Pirola, 1998; Wymann y cols., 2003). Todas las PI3-Ks
de la clase I unen Ras de manera dependiente de GTP a través de un dominio de
unión específico (RBD). Como ya se ha mencionado anteriormente, la clase I de la
PI3-K puede subdividirse en dos subclases (A y B) en función del tipo de subunidad
reguladora a la que se unan (Vanhaesebroeck y cols., 1997): la clase IA de PI3-K
presenta tres isoformas de la subunidad catalítica denominadas p110α, p110β y
p110δ que pueden asociarse con las distintas subunidades reguladoras presentes en
mamíferos (p85α, p85β y p55γ). Dichas subunidades reguladoras interaccionan, a
través de sus dominios de homología 2 de Src, SH2, con residuos fosforilados en
tirosina de otras proteínas; la clase IB presenta la subunidad catalítica p110γ y se
25
Introducción
asocia a la subunidad reguladora p101. La clase IB de la PI3-K es estimulada
directamente por subunidades βγ de proteínas G heterotriméricas. La subunidad
p110γ de esta clase también presenta un dominio amino-terminal de unión a Ras
(Golden y Insogna, 2004).
b) Las PI3-Ks de la clase II son enzimas de gran tamaño (170-210 KDa) que fosforilan
in vitro PtdIns y PtdIns 4-P pero no PtdIns (4,5)P2. Los miembros de esta clase se
caracterizan por presentar dominios C2 en su región C-terminal que median la unión
de calcio y lípidos descritos en las isoformas clásicas de PKC (Cantrell, 2001). No se
conoce su mecanismo de activación ni se han identificado sus proteínas
adaptadoras.
c) Las PI3-Ks de la clase III presentan una subunidad catalítica p110 que comparte
homología con la PI3-K de levaduras, Vps34p. El homólogo humano de Vps34p,
PtdIns3K se encuentra formando un complejo con p150, el homólogo de la
subunidad reguladora de levaduras Vps15p (Panaretou y cols., 1997). Fosforilan
exclusivamente PtdIns. Regulan el transporte intracelular de vesículas.
La clase I de la PI3-K es activada por una gran variedad de estímulos estando
implicada en numerosos procesos celulares tales como el crecimiento, la motilidad, la
adhesión y la supervivencia celular (Coelho y Leevers, 2000). El principal sustrato de la
clase I de la PI3-K es el PtdIns(4,5)P2 y el primer producto de la reacción es el
PtdIns(3,4,5)P3 (Hawkins y cols., 1992). Este lípido es rápidamente metabolizado por inositol
fosfatasas para producir PtdIns(3,4)P2. Los PtdIns(3,4,5)P3 y PtdIns(3,4)P2 se unen a
proteínas con dominios de homología a pleckstrina (PH) (Rameh y cols., 1997), pudiendo de
esta forma modificar alostéricamente su actividad o inducir la relocalización de la proteína y
así definir áreas de la membrana plasmática donde puede ocurrir su activación. Además de
su capacidad para fosforilar lípidos, se ha demostrado posteriormente que las PI3-Ks de la
clase I también pueden fosforilar proteínas. Son serina treonina quinasas que pueden
fosforilar residuos localizados tanto en la subunidad reguladora como en la subunidad
catalítica (Vanhaesebroeck y cols., 1997).
En condiciones normales, la PI3-K de la clase I se encuentra en el citosol y su
activación está regulada por una serie de mecanismos que pueden actuar de una manera
cooperativa:
1. Mediante la unión, a través de dominios SH2 de su subunidad reguladora p85, a un
receptor tirosina quinasa activado o a otras proteínas fosforiladas en tirosina. Se ha
demostrado in vitro que la interacción de p85 con secuencias YMXM fosforiladas en
26
Introducción
tirosina aumenta la actividad catalítica de la subunidad p110 (Golden y Insogna,
2004). Este proceso recluta a la subunidad catalítica p110 de PI3-K hacia la
membrana plasmática, donde puede fosforilar a su principal sustrato PtdIns(4,5)P2 y
generar de esta forma PtdIns(3,4,5) P3 (Kazlauskas, 1994).
2. A través de Ras. Como ya se comentó en un apartado anterior uno de los principales
efectores de las proteínas Ras es la subunidad catalítica de la PI3-K. Así, la
subunidad catalítica p110 de la PI3-K puede unirse a la conformación activa de Ras
a través de los dominios RBD, lo cual podría estabilizar la asociación de p110 con la
membrana plasmática y favorecer su activación (Rodríguez-Viciana y cols., 1996).
3. A través de dominios SH3 de su subunidad reguladora, que se unen a secuencias
ricas en prolina, como las que presentan las proteínas adaptadoras del tipo Shc, Cbl,
Grb2, IRS-1 y Gab. Las moléculas adaptadoras tienen un papel central en la
activación y localización de la clase I de la PI3-K (Wymann y Pirola, 1998).
4. En el caso de la clase IB de las PI3-Ks, mediante la interacción con las subunidades
βγ de las proteínas G heterotriméricas (Vanhaesebroeck y cols., 1997).
5. Por un mecanismo de autofosforilación de la subunidad catalítica p110. En el caso
de la subunidad p110δ esta fosforilación tiene lugar en el residuo Ser 1039 y conlleva
una disminución en su actividad quinasa (Golden y Insogna, 2004).
6. Por la fosforilación de p85 mediante la actividad serina-treonina quinasa intrínseca
de la subunidad catalítica p110. El residuo Ser 608 ha sido identificado como el
principal sitio de fosforilación de la subunidad p85 de forma que su fosforilación
resulta en una disminución de la actividad quinasa de la PI3-K de aproximadamente
el 80% (Golden y Insogna, 2004).
La clase I de la PI3-K está también regulada por la desfosforilación de sus productos
lipídicos por parte de las fosfatasas de fosfoinositoles, PTEN, el producto del gen supresor
de tumores PTEN (“Phosphatase and tensin homolog deleted from chromosome 10”) y SHIP
(“Src homology 2-containing inositol-5-phosphatase”). Estas fosfatasas actúan limitando la
señalización a través de la PI3-K (Golden y Insogna, 2004).
Las clases I y II de la PI3-K son inhibidas de una forma irreversible por el inhibidor
wortmanina, el cual se une covalentemente a la lisina 802 de la subunidad p110 que es un
residuo necesario para su actividad catalítica y de forma reversible con el inhibidor
LY294002 que bloquea el sitio de unión al ATP (Golden y Insogna, 2004).
27
Introducción
Aunque no todas las funciones biológicas de la PI3-K están completamente
clarificadas, la elevación en los niveles de los productos de la PI3-K ha sido implicada en la
regulación de la síntesis del ADN, en la supervivencia y la apoptosis celular, en procesos de
diferenciación, en la quimiotaxis y migración, en el transporte a membranas y en la adhesión
celular y en la formación de fibras de estrés (Wymann y cols., 2003).
Los productos lipídicos de la PI3-K pueden interaccionar con determinadas proteínas
y modular su localización y/ó su actividad a través de dominios de homología a pleckstrina y
dominios C2 (Vanhaesebroeck y cols., 1997). Entre estos efectores de la PI3-K se
encuentran la quinasa dependiente de fosfoinosítidos, PDK1, los factores intercambiadores
de nucleótidos (GEFs) específicos de Rho, Rac y Arf, las tirosinas quinasas de la familia
BTK (“Bruton´s tyrosine kinase”) y la fosfolipasa C, PLCγ (Duronio y cols., 1998; Leevers y
cols., 1999). Además, la PI3-K modula, a través de las proteínas descritas, la actividad de
otros efectores celulares como PKA, PKC, Rac y Arf (Leevers y cols., 1999). Sin embargo, el
principal efector de la PI3-K es una serina-treonina quinasa de 60 KDa denominada
Proteína Quinasa B ó PKB/Akt. Esta proteína fue identificada en 1991 con tres nombres
diferentes PKB, RACPK y Akt (Marte y Downward, 1997). Pertenece a la familia de
proteínas quinasas AGC, las cuales generalmente actúan como efectores de segundos
mensajeros tales como cAMP, cGMP, fosfolípidos o Ca2+ (Devarenne y cols., 2006).
En mamíferos, existen tres isoformas de PKB (α, β, γ ; Akt 1, 2, 3) compuestas por
tres regiones funcionalmente distintas: un dominio N-terminal de homología a pleckstrina, un
dominio central catalítico y un motivo C-terminal hidrofóbico. El dominio N-terminal PH
permite a PKB/Akt unirse a los productos generados por la PI3-K, el PtdIns(3,4,5) P3 y
PtdIns(3,4)P2 mientras que el dominio C-terminal hidrofóbico, HM, parece ser que
proporciona un sitio de unión para la quinasa dependiente de fosfoinosítidos, PDK1 (Sheid y
Woodgett, 2003). El papel específico de este dominio aún no se ha determinado aunque
recientemente se ha sugerido un papel regulador. La tirosina quinasa Src se puede unir
directamente a PKB/Akt a través de la interacción entre su dominio SH3 y un motivo
conservado rico en prolina (PXXP) en este dominio C-terminal de PKB/Akt de tal forma que,
determinadas mutaciones en este motivo de PKB/Akt, disminuyen su interacción con Src, lo
cual puede ser necesario para la fosforilación en tirosina de PKB/Akt y su consecuente
activación por otras quinasas como PDK1 (Jiang y Qiu, 2003).
La unión de la PKB/Akt a los fosfoinositoles-3-fosfato a través de los dominios PH
recluta a esta quinasa a la membrana plasmática donde sufre un cambio conformacional
que permite su fosforilación en dos residuos: en el residuo Thr308 situado en el lazo de
activación del dominio catalítico y en el residuo Ser473 situado en el dominio hidrofóbico HM
28
Introducción
(Vanhaesebroeck y Alessi, 2000). La quinasa responsable de la fosforilación de PKB en la
Thr308 es la PDK1 (Alessi y cols., 1997). Sin embargo, la identidad de la quinasa
responsable de la fosforilación de PKB en la Ser473 ha causado gran controversia.
Recientes estudios atribuyen a la quinasa mTOR este papel de tal forma que cuando se
encuentra formando parte del complejo mTOR-Rictor sería la responsable de fosforilar
directamente a PKB en la Ser473 in vitro lo cual facilitaría la fosforilación del residuo Thr308
por parte de la PDK1 (Sarbassov y cols., 2005; Hresko y Mueckler, 2005). La fosforilación de
PKB en la Ser473 conduce a su activación total y consecuentemente a la regulación de
numerosos procesos celulares, entre los que se incluye la supervivencia celular generada
por estímulos extracelulares (Figura 7).
La PKB/Akt fosforila numerosos efectores que conducen finalmente a cambios
globales en la fisiología celular y promueven la supervivencia. Entre los mecanismos
implicados en esta función celular se encuentra la fosforilación de diversos factores de
transcripción y de proteínas reguladoras de la apoptosis y del ciclo celular. Adicionalmente
se ha descrito que la PKB/Akt puede inhibir la transcripción de genes pro-apoptóticos,
provocar cambios metabólicos o inducir cambios en la traducción de los ARNms que
controlan la muerte celular (Vivanco y Sawyer, 2002). De esta forma, la PKB/Akt promueve
la supervivencia celular al fosforilar e inactivar proteínas que median la apoptosis (Lawlor y
Alessi, 2001), como la glucógeno sintasa quinasa ó GSK-3, (Cross y cols., 1995), el factor
proapoptótico Bad (Datta y cols., 1997) y la caspasa 9 humana (Cardone y cols., 1998).
Entre las dianas moleculares de la PKB se encuentra la serina treonina quinasa mTOR
(Holland y cols., 2004), que a su vez tiene como efectores moleculares directos a proteínas
reguladoras de la traducción de proteínas y consecuentemente del crecimiento y la
supervivencia celular, como son la quinasa p70S6K o S6K (Burnett y cols., 1998; McMahon y
cols., 2002) y la proteína reguladora del factor de iniciación de la traducción en eucariotas
eIF4E, 4E-BP1 (Choi y cols., 2003). Entre otros muchos efectores descritos, PKB también
fosforila directamente factores de transcripción entre los que se incluyen los miembros de la
familia de los forkhead (FKHR, FKHRL y AFX) (Medema y cols., 2000) y los factores de
transcripción NF-κB y CREB (Rodgers y Theibert, 2002).
29
Introducción
Los elevados niveles en la expresión de la PI3-K durante el desarrollo normal del
sistema nervioso y los cambios observados en condiciones neurodegenerativas apoyan la
hipótesis de la contribución de la ruta de la PI3-K a los procesos que regulan el crecimiento
y la diferenciación celular en el sistema nervioso. Activada por factores tróficos, factores de
crecimiento, citoquinas o neurotransmisores, la PI3-K participa por tanto en los procesos de
diferenciación y supervivencia de células neuronales y de la glia.
Una función esencial de la PI3-K es promover la supervivencia neuronal y de las
células de la glia. Varios estudios realizados tanto en cultivos primarios de neuronas como
en líneas celulares neuronales, han puesto de manifiesto que la PI3-K es activada por las
neurotrofinas clásicas (NGF y BDNF), por factores de crecimiento neurotróficos (IGF-1 y
GDNF), a través de proteínas de la matriz extracelular como las lamininas, a través de
quimioquinas y por neurotransmisores (Rodgers y Theibert, 2002). De esta forma, la
activación de la PI3-K es necesaria para promover la supervivencia de neuronas primarias
PI3-K
Adaptador
P
p85p110
P
P
Ras GTP
PKB
PDK1P
PDK2 P
P P
CRECIMIENTO Y SUPERVIVENCIA
F
PIP2 PIP3 PH
PH
Bad
NF-κβCaspasa 9 Raf
FKHR
mTORGSK-3 CREB
Figura 7. La ruta de señalización de la PI3-K
30
Introducción
de cerebelo, simpáticas, sensoriales, motoras, corticales, del hipocampo, de la retina y de
líneas celulares de neuroblastoma. En el caso de células gliales, la activación de la PI3-K
también es crítica para la supervivencia. Así, en astrocitos y células de Schwann, la PI3-K
puede ser activada por neurogulinas, por los miembros de la familia de GDNF, IGF-1,
citoquinas como la IL-1 o neurotransmisores (Rodgers y Theibert, 2002).
La PI3-K está también implicada en procesos de migración de neuronas y de células
de la glia (Segarra y cols., 2006; Wang y cols., 2005) y en procesos de diferenciación
neuronal a través de las proteínas de la familia de Rho (Schmid y cols., 2000; Hall y cols.,
2001).
El principal efector de la PI3-K, la PKB/Akt también está implicada en procesos de
supervivencia neuronal (Brunet y cols., 2001). De las tres isoformas de Akt, Akt3 es la que
se expresa de una forma mayoritaria en neuronas. En presencia de factores tróficos, un
dominante negativo de Akt bloquea la supervivencia neuronal mientras que la expresión de
de la forma activa de Akt es suficiente para promover la supervivencia neuronal en ausencia
de factores tróficos (Toker, 2000; Yuan y Yankner, 2000). Akt además, fosforila a una gran
variedad de proteínas que están implicadas de una forma u otra en la supervivencia
neuronal: cuando GSK-3 es fosforilada por Akt se inhibe su actividad y se ha descrito que
una mayor actividad de GSK-3β aumenta la apoptosis en distintos sistemas neuronales; los
factores de transcripción forkhead, FKHRL1, promueven apoptosis al aumentar la
transcripción de genes implicados en la muerte celular como FasL por lo que Akt puede
promover supervivencia neuronal al fosforilar e inhibir a los miembros de la familia forkhead.
Además, Akt puede ejercer su acción a través de la activación de NF-κB y CREB, dos
factores de transcripción que pueden promover supervivencia neuronal (Toker, 2000; Kaplan
y Miller, 2001; Brunet y cols., 2001; Patapoutian y Reichardt, 2001).
31
Objetivos
Tal y como se ha señalado en el apartado de la Introducción, la ruta de biosíntesis
del colesterol juega un papel muy importante en el crecimiento, supervivencia,
diferenciación, maduración y mantenimiento de las funciones celulares de todos los tejidos,
incluido los tejidos neuronales. Mientras que los efectos beneficiosos de la inhibición de la
biosíntesis del colesterol con estatinas están ampliamente contrastados, los efectos de estos
fármacos en el sistema nervioso no se conocen en profundidad.
Estudios previos realizados por nuestro grupo ponen de manifiesto que la lovastatina
es capaz de inducir la apoptosis de los neuroblastos fetales de rata. Por lo tanto:
El objetivo general del presente trabajo es estudiar las cascadas de señalización intracelular que desencadenan la apoptosis de células neuronales y, en particular, estudiar las rutas de transducción de señales implicadas en la muerte de los neuroblastos fetales de rata inducida por la lovastatina.
Bajo esta perspectiva, los objetivos concretos del presente trabajo son:
1. Estudiar el efecto de la lovastatina en el estado de activación de Ras en neuroblastos
fetales de rata.
2. Estudiar la implicación de la ruta que regula la supervivencia celular PI3-K/PKB en la
apoptosis de los neuroblastos inducida por la lovastatina.
3. Estudiar el papel que desempeña la ruta que controla la supervivencia celular ERK
en la apoptosis inducida por la lovastatina en neuroblastos fetales de rata.
4. Estudiar el efecto de la lovastatina en la ruta reguladora de la muerte celular JNK en
neuroblastos fetales de rata.
5. Estudiar la implicación de la ruta de la p38 MAPK en la apoptosis de neuroblastos
inducida por la lovastatina.
La metodología empleada en este trabajo, así como los resultados obtenidos, serán
expuestos a continuación.
33
Materiales y Métodos
1. MATERIALES.
1.1. PRODUCTOS Y REACTIVOS GENERALES.
La lovastatina (MK-808) o lactona del ácido mevínico [2β, 6α-dimetil-8α-(2-metil-1-
oxobutoxy)], se obtuvo de Calbiochem (La Jolla, CA, USA). La forma lactona de la
lovastatina es inactiva, por lo que antes de utilizarla se activó según el protocolo
descrito por Kita y cols. (1980).
El ácido mevalónico y el sustrato de la PI3-K, el fosfatidilinositol, son de Sigma-
Aldrich (St.Louis, MO, USA).
Los inhibidores PD98059 (2´-amino-3´-metoxyflavona), que inhibe a MEK, LY294002
[2-(4-Morfolinyl)-8-fenil-4H-1-benzopirano-4-uno] y Wortmanina (C23H24O8 ), que
inhiben a la PI3-K, SB 203580 que inhibe a las p38 MAPKs y el Péptido Inhibidor I de
las JNKs fueron suministrados por Calbiochem (La Jolla, CA, USA). Otro inhibidor de
las p38 MAPKs, el BIRB796 fue amablemente cedido por la Dr. Ana Cuenda
(Departamento de Bioquímica y Biología Molecular de la Universidad de
Extremadura).
Los anticuerpos utilizados se obtuvieron de las siguientes casas comerciales: anti
p85 de la PI3-K (06-195), anti fosfo Ser 133-CREB (06-519) y anti fosfo Ser 63-c-jun
(06-828) de Upstate Biotechnology (Lake Placid, NY, USA); anti fosfo Ser
472/473/474-Akt (559029), anti Akt (559028), anti fosfotirosina PY20 (610000), anti
pan Ras (610002) y anti c-jun (610326) en BD Biosciences Pharmigen (San Diego,
CA, USA); anti fosfo Thr 389-p70S6K (9205L), anti p70S6K (9202), anti 4E-BP1 (9452),
anti-SAPK/JNK (9252) y anti fragmento activo de caspasa 3 (9665) de Cell Signaling
Technology; anti fosfo Thr 183/Tyr 185-ERK p44/p42 (M8159), anti ERK p44/p42
(M3807), anti CREB (8977) y anti actina (A2066) de Sigma (St.Louis, MO, USA); anti-
GAPDH (RDI-TRK5G4-6C5) de Fitzgerald Inc. (Concord, MA, USA); anti-Bim
(202000) de Calbiochem (La Jolla, CA, USA); anti-p38 MAPK (sc-535) de Santa Cruz
Biotechnology (Santa Cruz, CA, USA); el anticuerpo anti fosfo Thr 180/Tyr 182-p38
MAPK fue amablemente cedido por la Dr. Ana Cuenda (Departamento de Bioquímica
y Biología Molecular de la Universidad de Extremadura); los anticuerpos secundarios
anti-conejo (31460) y anti-ratón (31430) conjugados a la peroxidasa de rábano
picante se obtuvieron de Pierce (Rockford, IL, USA).
35
Materiales y Métodos
El resto de los reactivos y productos utilizados (sales, ácidos y bases inorgánicos,
solventes orgánicos, detergentes, etc.) fueron de la máxima pureza disponible y se
adquirieron de diferentes casas comerciales.
1.2. MATERIALES, REACTIVOS Y PRODUCTOS UTILIZADOS EN LOS CULTIVOS CELULARES.
El medio de cultivo Ham´s F-12, el suero bovino fetal (FBS), los antibióticos
(penicilina y estreptomicina), la solución de Tripsina-EDTA y la glutamina se
obtuvieron de PANTM Biotech (Aidenbach, Alemania).
El material de plástico estéril utilizado (placas de cultivo de 100, 60 y 35 mm de
diámetro, tubos Falcon de centrífuga, pipetas, etc.) se obtuvo de TPP (Trasadingen,
Suiza).
Las soluciones empleadas se esterilizaron por filtración (filtros MillexR-6S de 0.22µm
de Millipore Ibérica, Madrid), mientras que el material sólido se esterilizó en
autoclave Selecta Presoclave 75 (Barcelona).
36
Materiales y Métodos
2. MÉTODOS.
2.1. LÍNEA CELULAR Y MÉTODOS DE CULTIVO.
Todos los estudios que se muestran en el presente trabajo se realizaron en una línea
celular de neuroblastos fetales de rata, denominada línea celular E18. La línea celular E18
se estableció por inmortalización espontánea de cultivos de corteza cerebral de embriones
de rata de 17 días (Muñoz y cols., 1993) y fue amablemente cedida por el Dr. Alberto Muñoz
(Instituto de Investigaciones Biomédicas, CSIC, Madrid). Estas células son neuroblastos
primitivos que expresan las proteínas NF 68 y nestina pero que no expresan la proteína
ácida fibrilar de la glia (GFAP). Las células E18 se crecieron en presencia de medio Ham´s
F12 suplementado con un 10 % FBS, L-glutamina (2mM), penicilina (100 U/ml) y
estreptomicina (100 µg/ml) en frascos de 75cm2 y se mantuvieron en una atmósfera de 5%
CO2 /95% de aire, saturada de humedad a 37ºC. La división de los cultivos se llevó a cabo
cada dos o tres días, tras alcanzar la confluencia siguiendo el protocolo descrito en el
apartado siguiente.
Procedimiento experimental.
Las células se lavaron con PBS (9,1 mM Na2HPO4, 1,7 mM NaH2PO4, 150 mM NaCl)
y se despegaron de los frascos de mantenimiento mediante la utilización de una solución de
Tripsina-EDTA (0,05% de tripsina y 0,02% de EDTA en PBS). La suspensión celular se
centrifugó durante 5 minutos a 60 g y las células resultantes se resuspendieron en el medio
de cultivo suplementado. A continuación, se contaron las células utilizando una cámara de
Neubauer (Blau Brand, Alemania) y un microscopio de contraste de fases Leica DMIL
(Wetzlar, Alemania). Las células se sembraron en placas de cultivo a una densidad
aproximada de 20.000 células/ cm2. Después de 24 horas de incubación, el medio se eliminó
y se reemplazó por medio completo (grupo control) o conteniendo los diferentes agentes a
estudiar (grupos experimentales), tras lo cual, el periodo de incubación se prolongó durante
6 ó 24 horas más, dependiendo del objetivo del estudio. Para los experimentos de tiempo-
respuesta, las células se incubaron con lovastatina 10 µM durante diferentes periodos de
tiempo. Al final de cada experimento, las células se procesaron de forma diferente,
dependiendo del objetivo final del estudio y de acuerdo con las técnicas que se detallan a
continuación.
37
Materiales y Métodos
2.2. ESTUDIO DE LOS NIVELES DE PROTEÍNAS POR WESTERN BLOT.
2.2.1. Obtención de extractos celulares totales.
Tras los diferentes tratamientos, las células adheridas y/o en suspensión se lavaron
con PBS a 4ºC, se centrifugaron a 20.000 g durante 60 segundos y finalmente se incubaron
con un tampón de lisis [50 mM HEPES pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glicerol,
5 mM MgCl2, 25 mM NaF, 1 mM EGTA, 10 mM de pirofosfato de sodio, 4 µg/ml de la mezcla
de inhibidores de proteasas de Roche (Mannheim, Alemania), 500µM ortovanadato sódico]
durante 10 minutos en hielo. A continuación, los extractos celulares se centrifugaron a
20.000 g durante 15 minutos a 4ºC y el sobrenadante se guardó a –20ºC hasta su
utilización.
2.2.2. Obtención de los extractos de proteínas nucleares.
Los extractos de proteínas nucleares se obtuvieron siguiendo el método descrito en
el Kit “Nuclear/Cytosol Fractionation” de MBLTM (Woburn, MA, USA). Las células se lavaron
con PBS a 4ºC y se recogieron por rascado y posterior centrifugación a 20.000 g durante 60
segundos. El precipitado celular se resuspendió en el tampón CEB A (“Cytosol Extraction
Buffer A”). Tras agitar la muestra en un agitador de tubos durante 15 segundos, se incubó
10 minutos en hielo. A continuación, se añadió a la muestra el tampón CEB B (“Cytosol
Extraction Buffer B”), se agitó durante 15 segundos y se mantuvo en hielo 1 minuto.
Seguidamente se centrifugó a 20.000 g durante 5 minutos a 4ºC. El sobrenadante (extracto
citoplasmático) se guardó a -80ºC hasta su utilización. El precipitado nuclear se resuspendió
en el tampón NEB mix (“Nuclear Extraction Buffer mix”). La muestra se mantuvo en hielo
durante un total de 40 minutos agitándose durante 15 segundos cada 10 minutos. Tras este
periodo, la muestra se centrifugó a 20.000 g durante 10 minutos a 4ºC. El sobrenadante
(extracto nuclear) se recogió y se almacenó a -80ºC hasta su utilización.
2.2.3. Cuantificación de las proteínas.
La concentración de proteínas en cada muestra se determinó utilizando el reactivo de
Bio-Rad (Manchen, Alemania) siguiendo el protocolo descrito por el proveedor y utilizando
albúmina de suero bovino para construir la curva patrón.
2.2.4. Electroforesis de proteínas.
Las proteínas presentes en los extractos celulares (15-20 µg/muestra) o en los
inmunoprecipitados con anticuerpo anti-fosfotirosina PY20 (ver apartado 2.4.1.1.), se
resolvieron mediante electroforesis en geles de poliacrilamida al 10% o al 12% en
38
Materiales y Métodos
condiciones reductoras y desnaturalizantes (SDS-PAGE). La electroforesis se llevó a cabo
en presencia de 25 mM Tris base, pH 8.3, 192 mM glicina y 0,1% SDS.
Las muestras se prepararon para la electroforesis mezclándose con tampón Laemmli
(60 mM Tris pH 6.8, 2% SDS, 10% glicerol, 100 mM ditiotreitol (DTT), 0,001% azul de
bromofenol, 2,5% mercaptoetanol), tras lo cual las muestras se calentaron a 95ºC durante 5
minutos.
2.2.5. Electrotransferencia de proteínas a membrana.
Una vez terminada la electroforesis, las proteínas se transfirieron a una membrana
de PVDF (difluoruro de polivinilo) de PolyScreen NEN Life Science Products Inc. (Boston,
MA, USA) mediante el paso de corriente eléctrica a 20V durante 15 minutos, utilizando un
equipo de transferencia en semiseco Transblot SD de BioRad (Hércules, CA, USA). La
electrotransferencia se realizó en un gradiente de fuerza iónica mediante la utilización de
tres tampones diferentes: SDB-1 (40 mM ácido amino caproico, 25 mM Tris base y 20%
metanol); SDB-2 (25 mM Tris base y 20% metanol) y SDB-3 (300 mM Tris base y 20%
metanol). Una vez realizada la transferencia, las proteínas presentes en la membrana se
tiñeron con una solución de rojo Ponceau (0.5% rojo Ponceau y 5% ácido acético) con
objeto de saber si se habían resuelto y transferido de una forma correcta.
2.2.6. Detección de las proteínas.
La detección de las proteínas se realizó mediante el uso de anticuerpos específicos
(Tabla 1). Para ello, primero se incubó la membrana toda la noche a 4º C o durante 1 hora a
temperatura ambiente con una solución de bloqueo, (5% de leche desnatada ó 3% de BSA,
10 mM Tris-HCl pH 7.5, 100 mM NaCl y 0,5% Tween-20), con el fin de bloquear los sitios de
unión inespecífica de la membrana. Posteriormente la membrana se incubó durante una
hora a temperatura ambiente o toda la noche a 4ºC, con el anticuerpo primario diluido en 10
mM Tris-HCl pH 7.5, 100 mM NaCl y 0,05% Tween-20 y 5% de leche desnatada ó 3% de
BSA. Tras esta incubación se realizaron tres lavados de 10 minutos cada uno en una
solución de lavado, (10 mM Tris-HCl pH 7.5, 100 mM NaCl y 0,05% Tween-20), y a
continuación, se procedió a la incubación de la membrana durante 45 minutos a temperatura
ambiente, con el anticuerpo secundario específico conjugado con peroxidasa de rábano y
diluido en la misma solución que el anticuerpo primario. A continuación, las membranas se
lavaron tres veces durante 10 minutos, tras lo cual se secaron suavemente y se pusieron
sobre un recipiente adecuado para proceder a la detección de proteínas específicas. La
detección de las proteínas se realizó incubando las membranas durante 5 minutos con
luminol y el sustrato de la peroxidasa que se encuentra unida al anticuerpo secundario, de
39
Materiales y Métodos este modo se produce una reacción de quimioluminiscencia y la luz emitida es capaz de
impresionar una película sensible a ella (Hyperfilm, Amersham Biosciencies, UK). Como
sustrato de la reacción de luminiscencia se utilizó el reactivo SuperSignal West Pico
Chemiluminescent de Pierce (Rockford, IL, USA). En algunas ocasiones se utilizaron los
reactivos Supersignal West Dura Extended Duration Substrate y Supersignal West Femto
Maximum Sensitivity Substrate, de Pierce. Después de revelar la película, las bandas
correspondientes a las proteínas específicas se fotografiaron mediante la utilización de un
equipo de documentación y análisis de imágenes Chemi Doc de Bio-Rad (Hércules, CA,
USA).
Tabla 1. Anticuerpos específicos utilizados para la detección de proteínas por Western Blot.
Anticuerpos Primarios
Dilución Tiempo de incubación
Anticuerpo Secundario
p85 de la PI3-K 1/1000 Toda la noche a 4ºC Conejo (1/10000)
P-Akt (Ser 472/473/474) 1/1000 Toda la noche a 4ºC Ratón (1/2000)
Akt 1/1000 Toda la noche a 4ºC Conejo (1/10000)
P-p70S6K (Thr 389) 1/1000 Toda la noche a 4ºC Conejo (1/10000)
p70S6K 1/1000 Toda la noche a 4ºC Conejo (1/10000)
4E-BP1 1/3500 1 hora a T.A. Conejo (1/10000)
Ras 1/1000 1 hora a T.A. Ratón (1/2000)
P-ERK p44/p42 (Thr 183/Tyr 185)
1/5000 1 hora a T.A. Ratón (1/2000)
ERK p44/p42 1/5000 1 hora a T.A. Conejo (1/10000)
P- CREB (Ser 133) 1/1000 Toda la noche a 4ºC Conejo (1/10000)
CREB 1/1000 Toda la noche a 4ºC Conejo (1/10000)
SAPK/JNK 1/500 Toda la noche a 4ºC Conejo (1/10000)
P- c-jun (Ser 63) 1/200 Toda la noche a 4ºC Conejo (1/10000)
c-jun 1/1000 Toda la noche a 4ºC Ratón (1/2000)
P-p38 (Thr180/Tyr182) 1/1000 Toda la noche a 4ºC Conejo (1/10000)
p38 1/1000 Toda la noche a 4ºC Conejo (1/10000)
Bim 1/1000 1 hora a T.A. Conejo (1/10000)
fragmento activo de caspasa 3
1/1000 Toda la noche a 4ºC Conejo (1/10000)
actina 1/5000 1 hora a T.A. Conejo (1/10000)
GAPDH 1/20000 1 hora a T.A. Ratón (1/2000)
40
Materiales y Métodos
2.3. ENSAYO DE DETECCIÓN DE RAS-GTP.
Se trata de un método que permite detectar Ras activo mediante la unión específica
de Ras-GTP al dominio de Raf-1 que reconoce la región efectora de Ras (RBD: “Ras
Binding Domain”). Para ello, es necesario previamente amplificar y expresar la proteína de
fusión GST-RBD-Raf-1, contenida en el vector de expresión pGEX-4T-1-RBD-Raf-1,
siguiendo los protocolos que se describen a continuación.
2.3.1. Establecimiento de bacterias competentes.
El primer paso para amplificar un plásmido consiste en transformar cepas
bacterianas competentes con el plásmido de interés. Para ello se obtuvieron bacterias
competentes siguiendo el método de permeabilización con calcio. Bacterias E.coli DH5α se
crecieron en 50 ml de medio LB estéril (10% triptona, 0,17 M NaCl, 5% extracto de levadura,
pH 7.2) durante toda la noche a 37ºC, con agitación circular. A la mañana siguiente, las
bacterias se pasaron a un matraz que contenía 100 ml de medio LB dejándolas crecer
durante 2 ó 3 horas en las mismas condiciones, hasta obtener una densidad óptica de 0.4-
0.6 a una longitud de onda de 600 nm. A continuación, el contenido del matraz se distribuyó
en tubos de 50 ml y se centrifugaron a 1.800 g durante 5 minutos a 4ºC. El precipitado
bacteriano se resuspendió en 50 ml de 50 mM CaCl2, y se incubó durante 15 minutos en
hielo, centrifugándose de nuevo a 1.800 g durante 5 minutos a 4ºC, tras lo cual, el
precipitado bacteriano se resuspendió nuevamente en 10 ml de 50 mM CaCl2 y se incubó
durante 10 minutos en hielo. Finalmente, se añadió 10% de glicerol y se prepararon
alícuotas que se guardaron a –80ºC hasta su utilización.
2.3.2. Transformación de bacterias competentes.
Una vez obtenidas las células competentes se llevó a cabo una transformación
bacteriana. Las bacterias competentes se incubaron en presencia de ADN plasmídico
(aproximadamente 100 ng), durante 30 minutos en hielo. A continuación, se realizó un
choque de calor durante 1 minuto a 42ºC, e inmediatamente después se pusieron en hielo
durante 5 minutos. Posteriormente se añadió a cada tubo 1 ml de medio LB y se incubó
durante una hora en agitación a 37ºC para que las bacterias se recuperaran y replicaran.
Posteriormente se procedió a la selección de las bacterias que habían introducido el
plásmido mediante la siembra en placas de Petri previamente preparadas con medio LB
suplementado con 1,5% de bactoagar y 100 µg/ml de ampicilina, a la cual sólo son
resistentes las bacterias transformadas. Se dejaron crecer durante toda la noche a 37ºC. Al
día siguiente se seleccionó una colonia y se creció en medio LB con ampicilina,
procediéndose a continuación a expresar la proteína como se describe a continuación.
41
Materiales y Métodos
2.3.3. Expresión de la proteína GST-RBD-Raf-1.
Las bacterias DH5α, transformadas con el plásmido pGEX-4T-1-RBD-Raf-1, se
cultivaron en 50 ml de medio LB con 100 µg/ml de ampicilina durante toda la noche y a 37º
C. Posteriormente se realizó una dilución 1/10 de ese cultivo (volumen final de 500 ml) y las
células se incubaron a 37ºC hasta que alcanzaron una densidad óptica de 0.5-0.6 a 600 nm.
Una vez alcanzada dicha densidad, se indujo la expresión de la proteína de fusión
añadiendo al medio 1 mM de IPTG y prolongándose la incubación durante 3 horas a 37ºC.
Transcurrido este tiempo, las células se centrifugaron a 10.000 g durante 10 minutos a 4º C.
El precipitado bacteriano se resuspendió en 10 ml de PBS que contenía 0,05 mM DTT, 4
µg/ml de la mezcla de inhibidores de proteasas de Roche y 500 µM ortovanadato sódico.
Después de sonicar las células de 6 a 8 veces durante 1 minuto en hielo en un sonicador
modelo Vibra Cell SONICS & MATERIAL Inc. (Danbury, USA), se añadió Triton X-100 al
extracto de bacterias hasta una concentración del 1%. El extracto se incubó durante 30
minutos a 4ºC en un agitador orbital de tubos. Transcurrido este tiempo, el extracto
bacteriano se centrifugó a 3.000 g durante 10 minutos a 4ºC. Se recogió el sobrenadante y
se le añadió glicerol hasta una concentración del 10%. El extracto celular se mantuvo a -
80ºC hasta su utilización.
2.3.4. Purificación de la proteína de fusión GST-RBD-Raf-1.
Para purificar la proteína de fusión, los extractos celulares se incubaron con
Glutation-sefarosa 4B durante 2 horas en un agitador orbital a 4ºC. Transcurrido este
tiempo, las muestras se lavaron 3 veces con tampón de lisis [20 mM Tris pH 7.4, 1 mM
EDTA, 10% glicerol, 100 mM KCl, 1 % Triton X-100, 0,05% β-mercaptoetanol, 5 mM NaF;
500µM ortovanadato sódico; 5 mM MgCl2; 1 mM fenil-metil-sulfonil fluoruro (PMSF), 4 µg/ml
de la mezcla de inhibidores de proteasas de Roche] y se realizaron centrifugaciones
sucesivas de 30 segundos a 10.000 g a 4ºC.
2.3.5. Ensayo de detección de Ras-GTP.
Al final de cada experimento, las células se recogieron en PBS y se centrifugaron
durante 60 segundos a 20.000 g a 4ºC. A continuación las células se lisaron en el tampón de
lisis descrito en el apartado anterior durante 10 minutos en hielo. Transcurrido este tiempo,
los extractos celulares se centrifugaron a 20.000 g durante 5 minutos a 4ºC, se recogió el
sobrenadante y se determinó la concentración de proteínas en cada muestra como se
describió con anterioridad. A continuación, 250 µg de proteína de cada una de las
condiciones experimentales se incubaron en presencia de la proteína de fusión GST-RBD-
Raf-1/Glutation-sefarosa durante 2 horas en agitación y a 4ºC. Seguidamente, las muestras
42
Materiales y Métodos
se lavaron tres veces en tampón de lisis. A continuación, se añadió tampón Laemmli a cada
muestra, se incubaron durante 5 minutos a 95ºC y se procedió a detectar los niveles de la
proteína Ras unida a GST-RBD-Raf-1 mediante Western blot.
2.4. ENSAYOS DE ACTIVIDAD DE PROTEÍNAS QUINASAS IN VITRO.
2.4.1. Ensayo in vitro de la actividad quinasa de la PI3-K.
2.4.1.1. Ensayos de inmunoprecipitación.
Tras los diferentes tratamientos, las células se lisaron con un tampón de lisis cuya
composición era la siguiente: 20 mM Hepes pH 7.4, 10 mM EGTA, 1% NP-40, 40 mM β-D-
glicerofosfato, 10% glicerol, 2,5 mM MgCl2, 1mM DTT, 2 mM ortovanadato sódico, 1 mM
PMSF, 10 µg/ml aprotinina y 10 µg/ml leupeptina. A continuación, los extractos celulares se
centrifugaron a 20.000 g durante 15 minutos a 4ºC y se recogió el sobrenadante. Proteínas
de los lisados (150 µg) se incubaron con 4µg de anticuerpo monoclonal anti-fosfotirosina
PY20 y 30 µl de proteína A unida a sefarosa, durante toda la noche con agitación constante
y a 4°C. Los inmunoprecipitados conteniendo las proteínas fosforiladas en tirosina se
lavaron dos veces con el tampón A (PBS, 1% NP-40, 100 µM ortovanadato sódico), dos
veces en tampón B (100 mM Tris pH 7.5, 0,5 M LiCl, 1 mM EDTA, 100 µM ortovanadato
sódico) y dos veces en tampón C (Tris 25 mM pH 7.5, 100 mM NaCl, 1 mM EDTA) a 4°C.
2.4.1.2. Ensayo in vitro de la actividad quinasa.
El sustrato de la PI3-K, el fosfatidilinositol, se secó en una atmósfera suave de
nitrógeno, se resuspendió en un volumen adecuado de 25 mM HEPES pH 7.5 y 1 mM EDTA
para conseguir una concentración de 1 µg/µl y se sonicó de 3 a 4 veces durante 15
segundos. Los inmunoprecipitados con anti-fosfotirosina se resuspendieron en 25 µl de
fosfatidilinositol. La reacción quinasa in vitro empezó tras la adición del tampón de reacción
[25 mM Hepes pH 7.4, 10 mM MgCl2, 0,5 mM EGTA, 100 nM [γ-32P]ATP (10 µCi), 40 µM
ATP] y su incubación durante 20 minutos a 30 °C con agitación rápida y constante. La
reacción enzimática se paró con la adición a 4°C de 400 µl de CHCl3: metanol (1:2) con 1%
HCl, 125 µl de CHCl3 y 125 µl 10 mM de HCl. Las muestras se centrifugaron durante 2
minutos a temperatura ambiente, tras lo cual, la fase orgánica se recogió y se lavó con 500
µl de metanol: 100 mM HCl y 2 mM EDTA (1:1). La fase orgánica se secó con nitrógeno y se
resuspendió en 25 µl de CHCl3. La separación de los lípidos se realizó por cromatografía de
capa fina. Las muestras se aplicaron en placas de silica gel y la cromatografía se realizó en
CHCl3:MetOH:H2O:NH4OH (120:94:23,2:4). Los fosfolípidos de inositol, productos de la
43
Materiales y Métodos reacción, marcados con 32P se detectaron por autorradiografía utilizando una película
sensible a la radiactividad.
2.4.2. Ensayo in vitro de la actividad quinasa de la JNK.
Como sustrato de la enzima JNK se utilizó una proteína de fusión, GST-c-Jun,
formada por el fragmento N-terminal (aminoácidos 1 a 79) de la proteína c-Jun, que
presenta los sitios de unión y de fosforilación (Ser 63 y Ser 73) específica para JNK, y por la
enzima glutationil-S- transferasa (GST). La proteína de fusión se expresó siguiendo el
protocolo descrito para la proteína de fusión GST-RBD-Raf-1. Después de cada tratamiento,
los extractos celulares totales se prepararon siguiendo el protocolo descrito anteriormente.
Un volumen de extracto celular, que contenía 200 µg de proteínas, se incubó en presencia
de GST-c-Jun unida a Glutation-sefarosa 4B durante una hora a 4 ºC en una plataforma
orbital, con objeto de permitir la unión de JNK a su sustrato c-Jun. A continuación esta
suspensión se centrifugó durante 1 minuto a 20.000 g, se eliminó el sobrenadante y el
precipitado se lavó 4 veces con solución de lavado (20 mM Tris-HCl pH 7.5, 50 mM NaCl,
2,5 mM MgCl2, 0,1 mM EGTA, 0.05% (v/v) Triton X-100, 0.1% (v/v) 2-mercaptoetanol y 1
mM ortovanadato sódico) y una vez con el tampón de reacción (25 mM Tris-HCl pH 7.5, 20
mM ß-glicerofosfato, 10 mM MgCl2, 0,1 mM EGTA, 0,5 mM NaF y 1 mM ortovanadato
sódico). A continuación el precipitado se resuspendió en tampón de reacción iniciándose la
reacción de fosforilación añadiendo a la mezcla 5 µCi de [γ-32P] ATP. Después de 20
minutos de incubación a 30ºC, la reacción de fosforilación se paró añadiendo a la mezcla
tampón Laemmli. Las muestras se incubaron durante 5 minutos a 95ºC y las proteínas se
resolvieron en un gel SDS-PAGE al 10%. Después de la electroforesis, los geles se secaron
y la presencia de 32P c-Jun se visualizó por autorradiografía.
2.5. ENSAYO DE RETARDO DE LA MOVILIDAD ELECTROFORÉTICA (EMSA).
2.5.1. Marcaje de los oligonucleótidos.
El oligonucleótido de doble cadena utilizado como sonda para AP-1 está compuesto
por el sitio de reconocimiento conservado para AP-1 al que se pueden unir tanto
homodímeros de c-Jun como heterodímeros formados por Jun y Fos (Lee y cols., 1987). Su
secuencia es la que se describe a continuación:
5´-tgcaCGCTTGATGACTCAGCCGGAA-3´
5´-tgcaTTCCGGCTGAGTCATCAAGCG-3´
44
Materiales y Métodos
El oligonucleótido de doble cadena (100 ng/µl) se marcó en presencia de 10 mM Tris-
HCl pH 7.5, 10 mM MgCl2, 1 mM DTT y 50 mM NaCl, dNTP (20 µM de cada uno), 400 µg/ml
BSA, 50 µCi α-32P-dCTP (3000 Ci/mmol) y 5 unidades de Klenow. La reacción de
polimerización se llevó a cabo durante 20 minutos a 30ºC. A continuación se realizó una
extracción de proteínas con fenol/cloroformo, tras lo cual, el oligonucleótido aislado se
precipitó con etanol en presencia de acetato sódico durante toda la noche a -80ºC. Después
de centrifugar la muestra, el oligonucleótido marcado se resuspendió en agua y se guardó a
4ºC hasta su utilización.
2.5.2. Análisis del retardo electroforético (EMSA).
El ensayo de retardo de la movilidad electroforética se realizó siguiendo el protocolo
descrito por Wen y Locker (1994). Proteínas nucleares (10 µg) se incubaron en presencia de
20 mM HEPES p.H 8, 1 mM EDTA, 50 mM NaCl, 1 mM DTT, 1% glicerol, 1mM MgCl2, 1 µg
de polidIdc-polidIdc y 200.000 cpm de la secuencia AP-1 marcada durante 15 minutos a
temperatura ambiente. A continuación las muestras se resolvieron en condiciones no
desnaturalizantes en un gel de poliacrilamida al 6% en presencia de TBE. Terminada la
electroforesis, el gel se fijó durante 15 minutos en una solución al 10% de metanol y 10% de
ácido acético. Posteriormente, el gel se secó en un desecador de geles y la interacción del
factor de transcripción AP-1 con su elemento de respuesta se analizó mediante
autorradiografía utilizando películas sensibles a la radiactividad.
2.6. ESTUDIOS DE LA EXPRESIÓN GÉNICA MEDIANTE LA UTILIZACIÓN DE GENES MARCADORES (“REPORTER GENE ASSAYS”)
2.6.1. Vectores utilizados.
Como vector “control” se utilizó el vector de expresión pSV-β-Galactosidasa,
suministrado por Promega (Madison, WI, USA), que como su nombre indica contiene el gen
que codifica a la enzima β-Galactosidasa.
Como vector experimental se utilizó el vector de expresión pGL3-promotor (Promega)
modificado (Lorenzo y cols., 1997). Este vector contiene el gen de la luciferasa como gen
marcador bajo el control del promotor TK HSV mínimo. Los diferentes vectores cis utilizados
se obtuvieron clonando, en este vector básico (pGL3-Control), oligonucleótidos de doble
cadena que contenían las secuencias consenso del elemento que responde al suero ó SRE
(CAGGATGTCCATATTAGGACATC, pGL3-SRE), a ésteres de forbol ó TRE
(GTGACATCAT, pGL3-TRE) y a AMPc ó CRE (AGCCTGACGTCAGAGA, pGL3-CRE).
45
Materiales y Métodos
2.6.2. Transfección transitoria mediada por lípidos.
La introducción de los diferentes vectores al interior de las células E18 (transfección)
se realizó siguiendo el protocolo indicado en el Kit “GenePORTERTM” de Genlantis (San
Diego, CA, USA), adaptado a las condiciones de cultivo de la línea celular utilizada. La
mezcla de lípidos suministrada por la casa comercial favorece la entrada del ADN a través
de la membrana plasmática. Esta mezcla está formada por un lípido neutro, el dioleoil-
fosfatidiletanolamina (DOPE) y un lípido catiónico.
El día anterior a la transfección, se sembraron 10.000 células por pocillo en placas de
24 pocillos en las condiciones habituales de cultivo. Transcurridas 24 horas, la transfección
se llevó a cabo siguiendo el protocolo que se describe a continuación. En primer lugar se
preparó la mezcla de la transfección diluyendo los vectores (1 µg pSV-β-Galactosidasa + 1
µg pGL3-control ó pGL3-SRE/TRE/CRE) en 125 µl de medio libre de suero y de antibióticos.
A continuación, 5 µl de GenePORTER diluido en el mismo volumen de medio libre de suero
y de antibióticos, se mezcló suavemente con la solución de ADN, tras lo cual, se incubó
durante 30 minutos a temperatura ambiente. A continuación se eliminó el medio de las
placas y se añadió gota a gota la mezcla de la transfección. Después de 3 horas de
incubación a 37ºC, se añadió a cada pocillo 250 µl de medio de cultivo suplementado con
suero pero sin antibióticos durante toda la noche. Al día siguiente, se realizaron los distintos
tratamientos a las células y posteriormente se realizaron los ensayos de las actividades
luciferasa y β-Galactosidasa.
2.6.3. Detección de la actividad β-Galactosidasa in situ.
Antes de realizar los ensayos de actividad luciferasa y β-Galactosidasa es
conveniente saber si las células se han transfectado de forma correcta. Para ello, en todos
los experimentos que se llevaron a cabo, se sembraron dos placas controles que se
utilizaron para determinar la eficiencia de la transfección mediante una técnica histoquímica
que permite determinar la actividad de la enzima β-Galactosidasa in situ. Las células
transfectadas con el vector pSV-β-Galactosidasa y que expresan la enzima β-Galactosidasa
se pueden visualizar mediante microscopía óptica ya que las células se tiñen de azul tras
ser incubadas en presencia del sustrato cromógeno de la enzima β-Galactosidasa, 5-bromo-
4-cloro-3-indol-β-Galactosido (X-Gal).
Al final de cada experimento las células se lavaron dos veces con PBS y se fijaron en
presencia de 0,25% glutaraldehído en PBS durante 15 minutos. Tras un nuevo lavado con
PBS, las células se incubaron con una solución de X-Gal [0,2% de X-Gal, 1mM MgCl2, 150
mM NaCl, 3,3 mM K4Fe (CN)6* 3 H2O, 3,3 mM K3Fe (CN)6, 60 mM Na2HPO4, 40mM
46
Materiales y Métodos
NaH2PO4] a 37ºC durante al menos 1 hora. Finalmente, la solución de X-Gal se eliminó, se
sustituyó por PBS y las células se observaron en un microscopio óptico de contraste de
fases.
Los ensayos de actividad luciferasa se realizaron sólo cuando la eficiencia de la
transfección fue superior al 20%.
2.6.4. Ensayos de actividad luciferasa.
El ensayo de actividad luciferasa se realizó siguiendo el protocolo descrito en el
manual de “Luciferase assay system” de Promega (Madison, WI, USA).
Al final de cada experimento, las células se lavaron con PBS y se incubaron en
presencia de un tampón de lisis (Reporter lysis buffer, Promega) durante 10 minutos a
temperatura ambiente y en agitación. Tras centrifugar el lisado celular a 20.000 g durante 5
minutos y a 4ºC, se recogieron los sobrenadantes y se almacenaron a -80ºC hasta su
utilización.
El ensayo de actividad luciferasa se realizó tomando 20 µl de cada muestra y
depositándolos en pocillos de microplacas. A continuación estas microplacas se introdujeron
en el interior de un luminómetro modelo Microbeta TriLux de Perkin Elmer (Wellesley, MA,
USA). El aparato inyectó a cada muestra de forma automática 100 µl de reactivo de ensayo
de luciferasa [20 mM tricita, 1,07 mM (MgCO3)4Mg(OH) 2 5H2O, 2,67 mM MgSO4, 0,1 mM
EDTA, 33,3 mM DTT, 270 µM coenzima A, 470 µM luciferina, 530 µM ATP, pH 7.8), y midió
a continuación el pulso de luz producido en cada muestra durante 10 segundos a 25ºC.
2.6.5. Ensayo de la actividad β-Galactosidasa.
Con objeto de normalizar la eficiencia de la transfección entre los diferentes
experimentos y tratamientos, se valoró, en cada una de las muestras, la actividad β-
Galactosidasa siguiendo el protocolo descrito en el manual técnico de Promega.
Un volumen de muestra de 50 µl se mezcló con 50 µl de tampón de ensayo 2X (200
mM tampón fosfato sódico pH 7.3, 2 mM MgCl2, 100 mM β-mercaptoetanol, 1,33 mg/ml
ONPG) y se incubó aproximadamente 3 horas o hasta que las muestras desarrollaran un
color amarillento a 37ºC. Este cambio de color en la muestra es el resultado de la actividad
de la enzima β-Galactosidasa que hidroliza el sustrato ONPG (o-nitrofenil-β-
Galactopiranósido) convirtiéndolo en o-nitrofenol (que es de color amarillo y absorbe a una
longitud de onda de 450 nm). La reacción se paró con 1 M de carbonato sódico realizándose
a continuación la lectura de la absorbancia a una longitud de onda de 450 nm.
47
Materiales y Métodos
Los resultados obtenidos a partir de estos experimentos se expresaron como el
porcentaje de la actividad luciferasa/actividad β-Galactosidasa con respecto al grupo control,
el cual se estableció como el 100%.
2.7. TÉCNICAS DE ESTUDIO DE LA VIABILIDAD Y LA MUERTE CELULAR.
2.7.1. ENSAYOS DE VIABILIDAD CELULAR.
El crecimiento de la población celular se determinó utilizando los métodos
colorimétricos del MTT [3-(4,5-dimetil-2-tiazol)-2,5-difenil-2H bromuro de tetrazolio] y del
cristal violeta, obteniéndose en ambos casos resultados similares. Tanto el MTT como el
cristal violeta se obtuvieron de Sigma-Aldrich (St.Louis, MO, USA).
2.7.1.1. Ensayo colorimétrico del MTT.
Este método se basa en el hecho de que las células viables expresan la enzima
mitocondrial succinato deshidrogenasa, la cual es capaz de reducir el MTT a formazán, que
es un producto que absorbe la luz a una longitud de onda de 570nm (Mossman T, 1983).
Antes de realizar los experimentos se determinó el tiempo óptimo de incubación con el MTT
en la línea celular utilizada en este trabajo.
Para realizar estos experimentos, se utilizaron placas de cultivo de 35 mm de
diámetro. Al final de cada experimento se añadió a cada placa 0,5 mg/ml de MTT. Después
de 20 minutos de incubación a 37ºC, el medio se retiró y el formazán precipitado se disolvió
en una solución ácida de isopropanol (0.04-0.1N HCl en isopropanol absoluto). La cantidad
de formazán presente en cada muestra se determinó midiendo la absorción a 570 nm. La
medida de la absorbancia se hizo en un espectrofotómetro Varian modelo Cary 300 Bio UV-
Visible (Mulgrave, Australia). Los resultados obtenidos se expresaron como porcentaje de
células viables con respecto al grupo control, el cual se estableció como el 100%.
2.7.1.2. Tinción con Cristal Violeta.
Este método se basa en el hecho de que las células viables se tiñen con el colorante
cristal violeta (Drysdale y cols., 1983). Este método también se optimizó para la línea celular
de estudio.
Para realizar estos experimentos se utilizaron placas de cultivo de 35 mm de
diámetro. Al final de cada experimento, el medio se eliminó y las células viables adheridas a
la placa se tiñeron con una solución de cristal violeta (0,03% en 2% de etanol) durante 5
48
Materiales y Métodos
minutos. Tras este periodo, el exceso de colorante se eliminó con agua y las células teñidas
se solubilizaron con SDS al 1%. La medida de la absorbancia del cristal violeta se realizó a
560 nm. El número de células viables se calculó como el porcentaje de absorbancia con
respecto al grupo control, el cual se estableció como el 100%.
2.7.2. ANÁLISIS DE LA FRAGMENTACIÓN INTERNUCLEOSOMAL DEL ADN.
Las células que mueren por apoptosis presentan cambios bioquímicos muy
característicos. Uno de ellos es la degradación del ADN genómico como consecuencia de la
activación de endonucleasas endógenas dependientes de Ca2+ y Mg2+. Estas enzimas
cortan el ADN por la región internucleosomal, dando lugar a fragmentos múltiplos de 180
pares de bases que pueden salir al citoplasma. Estos fragmentos dan lugar a la
característica escalera de ADN cuando se resuelven por electroforesis en geles de agarosa.
Para la realización de estos experimentos se utilizaron placas de cultivo de 100 mm de
diámetro. Las células adheridas a la placa y en suspensión se recogieron y se lavaron dos
veces con PBS a 4ºC. A continuación las células se incubaron con tampón de lisis (5 mM
Tris pH 7.5, 20 mM EDTA pH 8, 0,5% Triton X-100) durante 1 hora a 4ºC y en agitación
constante. El lisado celular se centrifugó a 20.000 g durante 30 minutos y el sobrenadante
se incubó en presencia de 100 µg/ml de RNAsa A durante 45 minutos a 37ºC, seguida de
otra incubación con 0,5% de SDS y 200 µg/ml de proteinasa K durante 45 minutos a 37ºC.
Después de dos extracciones con fenol-cloroformo-isoamílico, el ADN se precipitó con
etanol en presencia de 0,3 M de acetato sódico a -80ºC. El ADN presente en cada muestra
se analizó mediante electroforesis en geles de agarosa al 2%, preparados en una solución
tampón de TBE (90 mM Tris-ácido bórico; 2mM EDTA) y conteniendo 0.1 µg/ml de bromuro
de etidio. La electroforesis se llevó a cabo a 80 V durante 2 horas, tras lo cual los geles se
observaron bajo una fuente de luz ultravioleta y se fotografiaron mediante la utilización de un
equipo Chemic Doc de Bio Rad.
2.7.3. ANÁLISIS DEL CONTENIDO DE ADN POR CITOMETRÍA DE FLUJO.
Este método de análisis del contenido del ADN, permite identificar y cuantificar las
células apoptóticas, ya que como consecuencia de la fragmentación del ADN aparece un
pico hipodiploide característico (sub-G0), correspondiente a células con un contenido de
ADN inferior a 2n (Darzynckiewicz y cols., 1992). Para la realización de estos experimentos
se utilizaron placas de cultivo de 100 mm de diámetro. Se recogieron tanto las células en
49
Materiales y Métodos
50
suspensión como las adheridas a las placas. Las células se despegaron de la placa
incubándolas con una solución de tripsina/EDTA (0,05% de tripsina y 0,02% de EDTA en
PBS), se lavaron con PBS a 4ºC y se centrifugaron a 3.000 g durante 10 minutos,
posteriormente se lavaron dos veces con PBS a 4ºC y se fijaron durante 5 minutos con 70%
de etanol. Después de eliminar el etanol por centrifugación, las células se resuspendieron en
PBS y se incubaron en presencia de RNAsa A (10 µg/ml) durante 30 minutos a 37ºC. Las
células se tiñeron con 50 µg/ml de yoduro de propidio durante 30 minutos a temperatura
ambiente y en oscuridad. El contenido de ADN por célula se analizó en un citómetro de flujo
modelo CyAn LX (DakoCytomation, Gostrup, Dinamarca), en la Unidad de Citometría de
Flujo del CNIC (Madrid), utilizando un láser de argón con una longitud de onda de emisión
de 488 nm. Para el análisis sólo se consideraron las señales originadas por células únicas
(10.000 células/ensayo). El porcentaje de células que se encontraban en las distintas fases
del ciclo celular se calculó a partir de sus histogramas utilizando el programa Modfit (Verity
Systems, San José, CA, USA), que es capaz de aplicar diferentes modelos matemáticos a
las distribuciones obtenidas.
2.8. ANÁLISIS ESTADÍSTICO.
Todos los tratamientos experimentales se realizaron por triplicado y cada
experimento se repitió al menos tres veces. Los resultados se muestran como la media y su
correspondiente error estándar. La comparación estadística entre los grupos experimentales
se realizó mediante el ANOVA seguido del test de Scheffee o la t- de Student. La diferencia
entre los grupos experimentales se consideró significativa cuando sus medias mostraron
una p<0.05.
CCaappííttuulloo 11
“LOVASTATIN INHIBITS THE GROWTH AND SURVIVAL PATHWAY OF PHOSPHOINOSITIDE 3-KINASE/PROTEIN KINASE B IN IMMORTALIZED
RAT BRAIN NEUROBLASTS”
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts LOVASTATIN INHIBITS THE GROWTH AND SURVIVAL PATHWAY OF
PHOSPHOINOSITIDE 3-KINASE/PROTEIN KINASE B IN IMMORTALIZED RAT BRAIN
NEUROBLASTS.
Maria Isabel Cerezo-Guisado, Luis Jesus Garcia-Marin*; Maria Jesus Lorenzo and Maria Julia
Bragado.
Departamento de Bioquímica, Biología Molecular y Genética and *Departamento de Fisiología, Universidad de
Extremadura, Cáceres, Spain.
Received April 13, 2005; accepted April 27, 2005
ABSTRACT
We previously showed that lovastatin, a
HMG-CoA reductase inhibitor, suppresses cell
growth by inducing apoptosis in rat brain
neuroblasts. Our aim was to study intracellular
signalling induced by lovastatin in neuroblasts.
Lovastatin significantly decreases the
phosphoinositide 3-kinase (PI3-K) activity in a
concentration-dependent manner. Expression
of p85 subunit and its association with
phosphotyrosine containing proteins are
unaffected by lovastatin. Lovastatin decreases
PKB/Akt phosphorylation, and its downstream
effectors, p70S6K and the eIF4E regulatory
protein, 4E-BP1, in a concentration-dependent
manner, and reduces p70S6K expression.
Lovastatin effects are fully prevented with
mevalonate. Only the highest dose of PI3-K
inhibitors which significantly reduce PI3-K
kinase activity, induces apoptosis in
neuroblasts but in a lower degree than
lovastatin. In summary, this work shows that
treatment of brain neuroblasts with lovastatin
leads to an inhibition of the main pathway that
controls cell growth and survival, PI3-K/PKB
and the subsequent blockade of downstream
proteins implicated in the regulation of protein
synthesis. This work suggests that inactivation
of the antiapoptotic PI3-K appears insufficient
to induce the degree of neuroblasts apoptosis
provoked by lovastatin which must necessarily
involve other intracellular pathways. These
findings might contribute to elucidate the
molecular mechanisms of some statins effects
in the central nervous system.
RUNNING TITLE: Lovastatin inhibits PI3-K
in brain neuroblasts
KEYWORDS: neuroblasts, apoptosis,
lovastatin, kinase, phosphorylation, PI3-K,
PKB/Akt.
51
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts INTRODUCTION
It is well established that mevalonate
pathway, which yields different isoprenoid
compounds and cholesterol, plays an important
role in cell growth and survival (Goldstein and
Brown 1990). Mevalonate is intracellularly
synthesized from 3-hydroxy-3-methylglutaryl
coenzyme A (HMG-CoA), and this process is
catalyzed by HMG-CoA reductase, the rate
limiting enzyme in this pathway (Goldstein
and Brown 1990). Several studies show that
competitive inhibitors of HMG-CoA reductase
(statins), such as lovastatin, simvastatin and
pravastatin, not only block the biosynthesis of
mevalonate but, in addition, inhibit the growth
and proliferation of both normal and tumour
cells (Falke et al. 1989; Jones et al. 1994;
Raiteri et al. 1997). Furthermore, inhibition of
HMG-CoA reductase is also known to induce
cell death by apoptosis in different non
neuronal cell types (Guijarro et al. 1998; Jones
et al. 1994; Padayatty et al. 1997; Perez-Sala
and Mollinedo 1994).
This metabolic pathway is essential
during late fetal and early neonatal life to
ensure normal growth and development of the
brain (Cavender et al. 1995; Spady and
Dietschy 1983). Several studies suggest that
HMG-CoA reductase inhibitors could seriously
affect cholesterol homeostasis in the brain, and
therefore alter the normal growth, development
and survival of neurons. Then, although statins
are widely used in the treatment of
hypercholesterolemia (Barth et al. 1990;
Tobert 1987), several epidemiological studies
indicate that long-term administration of these
drugs may have adverse side effects on the
central nervous system (CNS) (Barth et al.
1990; Roth et al. 1992). In spite of its potential
relevance, the effects of statins on CNS have
been poorly studied. In this regard, Michikawa
and Yanagisawa (1999) have shown that
compactin induces cell death in primary
neurons from rat cerebral cortices and we have
recently shown that lovastatin induces
apoptosis of immortalized rat brain
neuroblasts, being its effects associated with a
decreased prenylation of both Rho A and Ras
proteins (Garcia-Roman et al. 2001).
The Ras family operates in diverse
signalling pathways that regulate cell growth,
differentiation and survival. They function as
molecular switches by cycling between the
inactive GDP-bound state and the active GTP-
bound state. Phosphoinositide 3-kinase (PI3-K)
has been identified as a key effector of Ras in
signalling cell survival (reviewed in Anderson
and Jackson 2003). Class IA of PI3-K includes
a heterodimer possessing subunits with
molecular weights of 85 and 110 kDa (p85 and
p110) and catalytic activity that specifically
transfers phosphate to position 3´ of the
phosphoinositide ring, regulating a variety of
cell responses including cell division and
survival (reviewed in Anderson and Jackson
2003). A role for PI3-K in cell survival was
first indicated by experiments showing that
PI3-K was required for nerve growth factor to
prevent apoptosis of PC12 cells induced by
serum deprivation (Yao and Cooper 1995).
One of the molecular targets of PI3-K products
involved in signalling cell survival is the
protein kinase B or Akt (Toker and Cantley
1997), which contains a pleckstrin homology
52
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts domain that recruits PKB to the plasma
membrane where is subsequently
phosphorylated in Thr306 and Ser473
(reviewed in Scheid and Woodgett 2001).
Phosphorylation of PKB leads to its full kinase
activity and subsequently to regulation of
several cellular processes such as extracellular
stimuli-induced cell survival. It is well
accepted that PKB promotes cell survival by
inhibiting the action of proteins that mediate
apoptosis (Lawlor and Alessi 2001).
The aim of the present work was to
study the effects of lovastatin in one of the
most important intracellular pathways that
control cell growth and survival, PI3-K/PKB in
immortalized rat brain neuroblasts. The
elucidation of biochemical pathways affected
by lovastatin will contribute to gain insight in
the growth inhibition and apoptosis induced by
this statin in neuroblasts, and additionally it
will contribute to establish the role of the
mevalonate pathway in the physiological
growth and development of the brain.
EXPERIMENTAL PROCEDURES
Materials
Lovastatin (MK-808, mevinolin) [2β,
6α-dimethyl-8α-(2-methyl-1-oxobutoxy)-
mevinic acid lactone] was purchased from
Calbiochem (La Jolla, CA, USA). The inactive
lactone of lovastatin was converted to the
active form as described by Kita et al.(1980).
Mevalonic acid, MTT [3-(4,5-dimethyl-2-
thiazolyl)-2,5-diphenyl-2H tetrazolium
bromide], propidium iodide (PI), ribonuclease
A, proteinasa K, 123 bp DNA ladder,
phosphatidylinositol (P-8443) and crystal
violet were purchased from Sigma-Aldrich,
(St. Louis, MO). Complete protease inhibitor
cocktail tablets were from Roche Molecular
Biochemicals (Indianapolis, IN, USA).
Wortmannin and LY294002 were from
Calbiochem (La Jolla, CA). Anti p85 antibody
of PI3-K (06-195) was purchased from Upstate
Biotechnology (Lake Placid, NY); anti
phospho Ser472/473/474 Akt (559029) and
anti Akt1 (559028) from BD Pharmingen; anti
phospho Thr389-p70 S6K (9205L), anti p70
S6K (9202) and anti 4E-BP1 (9451) from Cell
Signaling; peroxidase-conjugated secondary
anti mouse and anti rabbit antibodies and the
chemiluminiscence detection system were
from Pierce (Rockford, IL). Protein A/G-
Sepharose (Sc-2003) was from Santa Cruz
Biotechnology (Santa Cruz, CA); [γ-32P]ATP
(3.000 mCi/mmol) was purchased from Perkin
Elmer Life Sciences (Boston, MA). Ham’s F-
12 medium, fetal calf serum, L-glutamine,
streptomycin, penicillin and trypsin/EDTA
solution were from PAN Biotech (Aidenbach,
Germany). Tissue culture flasks and dishes
were from TPP (Trasadingen, Switzerland).
All other reagents were obtained from
commercial sources and were of the highest
purity available.
Cell Line and Culture
Spontaneously immortalized rat brain
neuroblasts, E 18 cells, were used in this study.
The E18 cell line has been obtained by
spontaneous immortalization from cultures of
18-day fetal rat cerebral cortices (Muñoz et al.
1993) and was kindly provided by Dr. Alberto
Muñoz (Instituto de Investigaciones
53
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts Biomédicas, CSIC, Madrid, Spain). Cells were
grown, as described previously (Garcia-Roman
et al. 2001), in Ham’s F-12 supplemented with
10% fetal calf serum, L-glutamine (2 mM),
streptomycin (100 µg/ml) and penicillin (100
U/ml). Cells were seeded at 5 x 105 in 75-cm2
tissue culture flask and incubated at 37ºC
under a 5% CO2/95% air atmosphere.
Cell Treatments
Confluent cells were trypsinized and
seeded in tissue culture dishes at a
concentration of 2 x 104 cells/cm2. After 24 h
the medium was aspirated and replaced for a
further 24 h with fresh media alone or
containing the indicated concentrations of
lovastatin, mevalonic acid or PI3-K inhibitors.
Cell Viability Assay
Cell viability was determined by the
colorimetric MTT assay as previously
described (Garcia-Roman et al. 2001). At the
end of each treatment, cells were incubated for
15 min at 37ºC with MTT (500 µg/ml) and
formazan precipitates were solubilized with
acidic isopropanol (0.04-0.1 N HCl in absolute
isopropanol). The absorbance of converted dye
was measured at a wavelength of 570 nm. In
some experiments, cell viability was evaluated
by the crystal violet method. At the end of each
experiment, media was discarded and cells
were stained with crystal violet (0,03% in 2%
ethanol) for 5 min. Dishes were then rinsed
with tap water, allowed to dry, and 1% sodium
dodecyl sulfate was added to solubilize them.
The absorbance of dye was measured at 560
nm. Viable cells were calculated as percent of
absorbance with respect to untreated cells.
Results using both methods were similar.
DNA Fragmentation Assay
At the end of each experiment, cells
were washed twice in ice-cold phosphate-
buffered saline without Ca2+ and Mg2+ and then
scraped and pelleted at 4ºC. Cells were lysed in
10 mM Tris buffer, pH 7.4, with 5 mM EDTA,
and 0,5% Triton X-100 for 60 min at 4ºC.
After centrifugation at 20 800 g for 30 min at
4ºC, the supernatants were incubated with
RNase A (0.1 mg/ml) at 37ºC for 45 min, and
then with proteinase K (0.2 mg/ml) at 37ºC for
45 min. DNA was then extracted twice with
phenol/chloroform (1:1), precipitated with 0.1
volume of sodium acetate (3 M) and 2.5
volumes of ice-cold ethanol overnight at -80ºC.
The precipitated DNA was collected by
centrifugation at 20 800 g for 20 min and
resuspended in autoclaved water. DNA was
resolved on 2% agarose-0.1 µg/ml ethidium
bromide gels in TBE buffer (80mmol/L Tris-
borate (pH 8), 2 mmol/L EDTA). After
electrophoresis, gels were examined under
ultraviolet light and photographed using a
ChemiDoc System (Documentation and
Analysis System, Bio-Rad, Hercules, CA,
USA).
Analysis of Cell DNA Content by Flow
Cytometry
The ploidy determination of
neuroblasts was estimated by flow cytometry
DNA analysis as previously described (Garcia-
Roman et al. 2001). After treatment, cells were
trypsinized, washed in phosphate-buffered
54
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts
In vitro phosphoinositide 3-kinase activity
assay
saline, fixed at 4 ºC in 70 % ethanol and
treated at 37 ºC with RNase (10 µg/ml) for 30
min. The DNA content per cell was evaluated
in a CyAn LX flow cytometer
(DakoCytomation, Glostrup, Denmark) after
staining the cells with propidium iodide (50
µg/ml) for 30 min at room temperature in the
dark. For cell cycle analysis, only signals from
single cells were considered (10000
cells/sample).
Anti-phosphotyrosine
inmunoprecipitates were resuspended with 25
µl of the PI3-K susbtrate, phosphatidylinositol
for 20 minutes. Substrate was previously dried
under nitrogen atmosphere, resuspended
(1µg/µl) in 25 mM Hepes, pH 7.5, 1mM
EDTA and sonicated 4 times for 15 s. In vitro
kinase reaction started after addition of 15 µl
of kinase reaction buffer [100 nM [γ-32P]ATP
(10 µCi), 40 µM ATP, 25 mM Hepes pH 7.4,
10 mM MgCl2 and 0.5 mM EGTA] and kept
for 30 min at 30°C with shaking. Reaction was
stopped after addition of ice-cold chloroform:
methanol (1:2) with 1% HCl, 125 µl de CHCl3
and 125 µl HCl 10 mM. Samples were briefly
centrifuged and the lower organic phase
extracted and washed with 500 µl methanol:
100mM HCl plus 2mM EDTA (1:1). Lower
organic phase was extracted, dried under
nitrogen and resuspended with 25µl
chloroform. Lipid products were analyzed by
thin layer chromatography using silica gel
plates and developed with
CHCl3:MetOH:H2O:NH4OH
Immunoprecipitation assay.
At the end of neuroblasts treatment, cells
were rinse twice with ice-cold phosphate-
buffered saline and lysed for 10 min at 4°C in
the following buffer: 20 mM Hepes pH 7.4, 10
mM EGTA, 1% NP-40, 40 mM β-D-
glycerophosphate, 10% glycerol, 2.5 mM
MgCl2, 1mM dithiothreitol (DTT), 2mM
sodium ortovanadate (Na3VO4), 1mM phenyl-
methyl-sulphonyl fluoride (PMSF), 10 µg/ml
aprotinin and 10 µg/ml leupeptin. After
centrifugation at 20 800 g for 15 min at 4°C,
resulting supernatants were analyzed for
protein concentration using BioRad protein
assay. Equal amount of protein (150 µg) was
immunoprecipitated overnight at 4°C with 4
µg antiphosphotyrosine antibody PY20 using
30 µl of protein A-Sepharose.
Immunoprecipitates were washed twice with
ice cold buffer A (phosphate-buffered saline,
1% NP-40, 100 µM Na3VO4), twice with
buffer B (100 mM Tris pH 7.5, 0.5M LiCl,
1mM EDTA, 100 µM Na3VO4) and twice with
buffer C (Tris 25mM pH 7.5, 100 mM NaCl,
1mM EDTA).
(120:94:23.2:4). 32P-labelled phospholipids
products were detected by autoradiography
using a radioactivity sensitive film.
Western Blotting Analysis
Briefly, denatured proteins from total
cell extracts (10-20 µg) or immunoprecipitates
were separated by 10 or 12.5% sodium dodecyl
sulfate and electrophoretically transferred to
membranes that were blocked in buffer: 50
mM Tris/HCl pH 8.0, 2 mM CaCl2, 80 mM
55
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts NaCl, 5% non-fat dry milk. After overnight
incubation at 4°C with primary antibodies
(1:1000 dilution and for p70S6K 1:500),
membranes were washed and incubated with
horseradish peroxidase-conjugated secondary
antibody (anti mouse IgG 1:6000 or anti rabbit
IgG 1:10000). After three washes with 50 mM
Tris/HCl pH 8.0, 2 mM CaCl2, 80 mM NaCl,
membranes were incubated with
chemiluminescent substrate for 5 min and
exposed to Hyperfilm ECL (Amersham,
Piscataway, NJ, USA). Results were analyzed
by densitometry using the MacBAS Software,
version 2.2, and expressed as percentage of
control.
0 101 2Lovastatin (µM)
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0
25
50
75
100
Lovastatin (µM)0 1 10
*
20
*
A
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
0
25
50
75
100
125PI
3-K
Act
ivity
(% o
fcon
trol
)
--
+-
++
-+
*
B
0 101 2Lovastatin (µM)
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0
25
50
75
100
Lovastatin (µM)0 1 10
*
20
*
A0 101 2Lovastatin (µM) 0 101 2Lovastatin (µM)
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0
25
50
75
100
Lovastatin (µM)00 11 10
*
10
*
20
*
20
*
A
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
0
25
50
75
100
125PI
3-K
Act
ivity
(% o
fcon
trol
)
--
+-
++
-+
*
B--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
0
25
50
75
100
125PI
3-K
Act
ivity
(% o
fcon
trol
)
--
+-
++
-+
*
--
+-
++
-+
**
B
0000
Statistical analysis
Data are obtained from at least three
independent experiments and expressed as
mean ± standard error of the mean. Statistical
analysis of the data was performed by one way
ANOVA followed by Dunnet test. P-values
lower that 0.05 were considered significant. Figure 1. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the in vitro kinase activity of PI3-K in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0) and various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). In vitro PI3-K kinase assay was performed as described in Material and Methods and lipid products were separated by thin-layer chromatography. A representative autoradiography is shown. Densitometry analysis of results, expressed as mean ± standard error of at least three independent experiments is shown in the graphs.* P<0.05 compared to untreated cells.
RESULTS
Effect of lovastatin in the in vitro kinase
activity and the expression of the
phosphoinositide 3-kinase
We first evaluated the in vitro
enzymatic activity of one of the major kinases
that regulates cell growth and survival, PI3-K,
after treatment of neuroblasts with lovastatin
for 24 hours. We have previously shown that
the intracellular effects of lovastatin in rat
brain neuroblasts are time and concentration
dependent (Garcia-Roman et al. 2001).
As shown in Fig. 1A, treatment of neuroblasts
with lovastatin promotes a clear reduction of
the in vitro kinase activity of PI3-K in a
concentration-dependent manner. Lovastatin
effect is evident with the lower concentration
used, 1µM, which reduces by 30% the kinase
activity, whereas higher lovastatin
concentrations, 10 and 20 µM, significantly
56
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts reduce the PI3-K activity by 56% and 63%,
respectively. 0 101 20Lovastatin (µM)
p85 → 98 kDa
64 kDa
A
0 101 20Lovastatin (µM)98 kDa
64 kDa
50 kDa
p85 →
IP: PY20WB: anti-p85
B
0 101 20Lovastatin (µM)
p85 → 98 kDa
64 kDa
A0 101 20Lovastatin (µM)
p85 → 98 kDa
64 kDa
98 kDa
64 kDa
A
0 101 20Lovastatin (µM)98 kDa
64 kDa
50 kDa
p85 →
IP: PY20WB: anti-p85
B0 101 20Lovastatin (µM)
98 kDa
64 kDa
98 kDa
64 kDa
50 kDa
p85 →
IP: PY20WB: anti-p85
B
In order to know whether this effect on
PI3-K activity is specific of the inhibition of
HMG-CoA reductase, neuroblasts were
incubated with lovastatin in presence or
absence of L-mevalonate, the final product of
the reaction catalyzed by HMG-CoA reductase
(Fig. 1B). Treatment with 10 µM lovastatin
significantly reduces PI3-K activity (51 ± 6%
of control), whereas simultaneous treatment
with 100 µM mevalonate significantly prevents
the decrease of activity induced by lovastatin,
yielding PI3-K levels comparable to control
samples (86 ± 13% of control). Treatment of
neuroblasts with mevalonate alone does not
modify PI3-K activity.
Figure 2. Effect of lovastatin on the expression of p85 regulatory subunit of PI3-K (A) and on the association of p85 subunit with tyrosine-phosphorylated proteins (B) in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0) or lovastatin. A: proteins from neuroblasts lysates (15 µg) were analyzed by Western Blot using an anti-p85 antibody. B: Anti-phosphotyrosine immunoprecipitated proteins were analyzed by Western Blot using the same anti-p85 antibody. IP, inmunoprecipitation; PY20, anti-phosphotyrosine antibody; WB, western blot.
We next investigated whether lovastatin
treatment affects the expression of PI3-K
protein. Therefore we evaluated the expression
level of the regulatory subunit of PI3-K, p85,
in lysates from neuroblasts incubated with
lovastatin for 24 h. As seen in Fig. 2A,
lovastatin treatment does not modify the
expression of p85 regulatory protein.
We immunoprecipitated tyrosine-
phosphorylated proteins from neuroblasts
lysates and analyzed the p85 subunit by
Western Blot. As seen in Fig. 2B, results show
that lovastatin does not modify the amount of
p85 subunit associated with tyrosine-
phosphorylated proteins.
Effect of lovastatin on the phosphorylation
of the protein kinase B or Akt. Lovastatin has not effect on the association
of phosphoinositide 3-kinase with tyrosine-
phosphorylated proteins One of the main targets downstream of
PI3-K is PKB/Akt, key molecule involved in
the regulation of cell growth and survival. We
next study the phosphorylation state of this
protein kinase after lovastatin treatment. It is
important to note that initial phosphorylation
of PKB in Thr308 leads to activation of the
enzyme but its full activation is achieved after
a second phosphorylation on Ser473. Therefore
we evaluated the phosphorylation of PKB on
One of the pathways leading to PI3-K
activation in response to several stimuli is the
interaction of SH2 domains of the regulatory
subunit of PI3-K, p85, with tyrosine-
phosphorylated proteins. Our next aim was to
study the interaction of p85 subunit with
tyrosine-phosphorylated proteins in this
neuronal apoptosis model.
57
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts Ser473 in lysates of neuroblasts treated with
lovastatin. As seen in Fig. 3A (upper film),
incubation of neuroblasts with lovastatin is
associated with a marked decrease in the
phosphorylation on Ser473 of PKB in a
concentration dependent manner.
The effect is evident at 1 µM (decrease of
29%), being significant at higher
concentrations, 10 µM and 20 µM, where the
reduction of phosphorylation is 84% y 87%,
respectively.
In order to know whether effect is
specific of the inhibition of HMG-CoA
reductase, neuroblasts were incubated with
lovastatin in presence or absence of
mevalonate (Fig. 3B). Simultaneous treatment
of neuroblasts with 100 µM L-mevalonate
significantly prevents the decrease of
phosphorylation on Ser473 induced by
lovastatin (Fig. 3B upper film). Treatment of
neuroblasts with mevalonate alone does not
affect Ser473 phosphorylation of PKB.
P-PKB →
PKB →
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
--
++
-+
0
50
100
150
200
PKB
Pho
spho
ryla
tion
(% o
fcon
trol
)
+-
*
B
0 101 2
P-PKB →
PKB →
Lovastatin (µM)
PKB
Pho
spho
ryla
tion
(% o
fcon
trol
)
0 1Lovastatin (µM) 10
*
20
*25
50
75
100
0
A
P-PKB →
PKB →
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
--
++
-+
0
50
100
150
200
PKB
Pho
spho
ryla
tion
(% o
fcon
trol
)
+-
*
B
P-PKB →
PKB →
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
P-PKB →
PKB →
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
--
++
-+
0
50
100
150
200
PKB
Pho
spho
ryla
tion
(% o
fcon
trol
)
+-
*
B
0 101 2
P-PKB →
PKB →
Lovastatin (µM)
PKB
Pho
spho
ryla
tion
(% o
fcon
trol
)
0 1Lovastatin (µM) 10
*
20
*25
50
75
100
0
A0 101 2
P-PKB →
PKB →
Lovastatin (µM)
PKB
Pho
spho
ryla
tion
(% o
fcon
trol
)
0 1Lovastatin (µM) 10
*
10
*
20
*
20
*25
50
75
100
0
A000
In parallel, in the same samples analyzed
for PKB phosphorylation, we investigated the
expression of PKB protein, which is not
affected by treatment with lovastatin or
mevalonate (Fig. 3A and B, lower films).
Effect of lovastatin in the phosphorylation
and expression of protein kinase p70S6K
One of the molecular substrates of PKB
is the mammalian target of rapamycin, mTOR,
a kinase that controls protein translation via
p70S6K and the regulatory protein of eIF4E,
named 4E-BP1 or PHAS-I (reviewed in
Schmelzle and Hall 2000). p70S6K is activated
by mTOR via phosphorylation of several
residues, such as Thr 389 and Thr 229, that
leads to its kinase activation (Holland et al.
2004). Therefore our next aim was to study the
effect of lovastatin in the phosphorylation level
of p70S6K. Treatment of neuroblasts with
lovastatin leads to a reduction in the
Figure 3. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the phosphorylation of PKB (Ser473) in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0), various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). 15 µg proteins from neuroblasts lysates were analyzed by Western Blotting using an anti phospho-Ser473-PKB (upper films) or anti-PKB (lower films) antibody. Representative films are shown. Densitometry analysis of results, expressed as mean ± standard error of six (A) and four (B) independent experiments, is shown at the bottom graphs. * P<0.05 compared to untreated cells.
58
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts phosphorylation of p70S6K in Thr389 that is
concentration dependent, as seen in Fig. 4A
graphic and upper film). This effect is
significant at higher concentrations used, 10
µM y 20 µM, where the decrease on the
phosphorylation state is 76% and 71%,
respectively.
Figure 4. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the phosphorylation and expression of p70S6K (Thr389) in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0), various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). The phosphorylation state was evaluated in proteins (15 µg) from neuroblasts lysates analyzed by Western Blotting using an anti phosphor-Thr389-p70S6K (upper films). As a loading control the membranes were blotted with antibody anti-actin (middle films). The expression of p70S6K was analyzed using an antibody anti p70S6K (lower films). Each experiment was performed several times (three to five times) and representative films are shown.
We next confirmed that this effect was
specifically due to inhibition of the HMG-CoA
reductase. As seen in Fig. 4B, treatment with
mevalonate significantly prevents the decrease
on p70S6K phosphorylation observed in
presence of lovastatin. Treatment of
neuroblasts with mevalonate alone does not
affect Thr389 phosphorylation of p70S6K. As a
loading control in the gels, we have analyzed
the expression levels of actin (Fig. 4, middle
films).
Figure 4 (lower films) shows that
lovastatin treatment leads to a reduction of the
expression of p70S6K protein in a
concentration-dependent manner (A) which
results prevented by mevalonate (B).
Effect of lovastatin in the phosphorylation
and expression of eukaryotic initiation
translation factor 4E-binding protein 1
A direct substrate of the kinase mTOR is
4E-BP1, protein that regulates the eukaryotic
initiation factor eIF4E.
P-p70S6K →
Actin →
BLovastatin (10 µM)
Mevalonate (100 µM) --
+-
++
-+
p70S6K →
ALovastatin (µM) 0 101 2
P-p70S6K →
Actin →
p70S6K →
P-p70S6K →
Actin →
BLovastatin (10 µM)
Mevalonate (100 µM) --
+-
++
-+
p70S6K →
P-p70S6K →P-p70S6K →
Actin →
BLovastatin (10 µM)
Mevalonate (100 µM) --
+-
++
-+
p70S6K →
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
p70S6K →p70S6K →
ALovastatin (µM) 0 101 2
P-p70S6K →
Actin →
p70S6K →
ALovastatin (µM) 0 101 2
P-p70S6K →
Actin →
p70S6K →
000
γ →β →α→
Lovastatin (µM) 0 101 2
4E-BP1→
A
γ →α →β→
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
4E-BP1→
B
γ →β →α→
Lovastatin (µM) 0 101 2
4E-BP1→
A
γ →β →α→
Lovastatin (µM) 0 101 2
4E-BP1→
γ→β→α→
Lovastatin (µM) 0 101 2
γ →β →α→
γ →β→α→
γ →β→α→
Lovastatin (µM) 0 101 2Lovastatin (µM) 0 101 2
4E-BP1→4E-BP1→4E-BP1→
A
γ →α →β→
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
4E-BP1→
B
γ →α →β→
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
4E-BP1→
γ→α→β→
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
γ →α →β→γ →α→β→γ →α→β→
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
Lovastatin (10 µM) Mevalonate (100 µM)
Lovastatin (10 µM) Mevalonate (100 µM)
--
+-
++
-+
--
+-
++
-+
4E-BP1→4E-BP1→4E-BP1→
B
000000
Figure 5. Effect of lovastatin alone (A) or in combination with mevalonate (B) on the phosphorylation and expression of 4E-BP1 in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0), various concentrations of lovastatin alone (A) or in combination with 100 µM mevalonate (B). The three phosphorylation states of 4E-BP1 corresponding to α, β, and γ isoforms, are shown at the upper films and were evaluated as changes in its electrophoretic mobility analyzed by a 12% SDS-PAGE followed by Western Blotting using an anti 4E-BP1 antibody. A representative film of five (A) and four (B) independent experiments is shown. In the bottom films (A and B) the expression of 4E-BP1 was analyzed in 10% SDS-PAGE followed by Western Blotting using same antibody. A representative film of three independent experiments is shown.
59
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts
We next investigated whether lovastatin
affects the phosphorylation state of 4E-BP1 in
rat brain neuroblasts. It is well established that
phosphorylation of 4E-BP1 decreases its
electrophoretic mobility in 12% sodium
dodecyl sulphate-polyacrylamide gel
electrophoresis gels, where it appears as three
bands called α, β and γ with decreasing
electrophoretic mobility, which represent
protein 4E-BP1 phosphorylated to different
extents. Treatment of neuroblasts with
lovastatin leads to a marked concentration-
dependent increase in the electrophoretic
mobility of 4E-BP1 (Fig. 5A, upper film). This
increase of the electrophoretic mobility of 4E-
BP1 corresponds with a change of the
phosphorylation state, which is visualized by
an increasing intensity in the less
phosphorylated form, α, at higher lovastatin
concentrations, 10 µM and 20 µM.
We next confirmed that this effect was
specific of the HMG-CoA reductase inhibition,
as treatment with mevalonate significantly
prevents the decrease on 4E-BP1
phosphorylation observed in presence of 10
µM lovastatin (Fig. 5B, upper film). This effect
is more evident with the appearance of the
most phosphorylated form, γ, after mevalonate
treatment. Incubation of neuroblasts with
mevalonate alone leads to a phosphorylation
pattern of 4E-BP1 comparable to neuroblasts
without treatment.
Incubation of neuroblasts with
lovastatin or mevalonate does not modify the
expression levels of protein 4E-BP1 visualized
as a unique band in 10% sodium dodecyl
sulphate-polyacrylamide gel electrophoresis
gel (Fig 5A and B, lower films).
Effect of inhibitors of the phosphoinositide
3-kinase, LY294002 and wortmannin, in the
in vitro kinase activity of phosphoinositide 3-
kinase in neuroblasts
Our results suggest that lovastatin might
exert its effects in neuroblasts by its capacity to
inhibit the pathway of PI3-K.
A
LY 294002 (µM)
0
50
100
150
0 1 10010
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0 101 1LY 294002 (µM)
*
B
0
50
100
150
0 0,10,01 1Wortmannin (µM)
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0 0,10,01 1Wortmannin (µM)
*
A
LY 294002 (µM)
0
50
100
150
0 1 10010
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0 101 1LY 294002 (µM)
*
A
LY 294002 (µM)
0
50
100
150
0 1 100100
50
100
150
0
50
100
150
0 1 1001000 11 1001001010
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0 101 1LY 294002 (µM)
*
B
0
50
100
150
0 0,10,01 1Wortmannin (µM)
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0 0,10,01 1Wortmannin (µM)
*
B
0
50
100
150
0
50
100
150
0 0,10,01 10 0,10,01 1Wortmannin (µM)
PI3-
K A
ctiv
ity(%
ofc
ontr
ol)
0 0,10,01 1Wortmannin (µM) 0 0,10,01 1Wortmannin (µM)
*
000000
Figure 6. Effects of PI3-K inhibitors, LY294002 and wortmannin, on the in vitro kinase activity of PI3-K in neuroblasts. Neuroblasts were incubated for 24 h in the presence of medium (0) or various concentrations of PI3-K inhibitors, LY294002 (1, 10 and 100 µM) and wortmannin (0.01, 0.1 and 1 µM). In vitro PI3-K kinase assay was performed in anti-phosphotyrosine immunoprecipitates as described in Material and Methods. A representative autoradiography is shown. Densitometry analysis of results, expressed as mean ±
60
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts standard error of at least three independent experiments is shown at the bottom graphs.* P<0.05 compared to untreated cells.
Therefore, our next aim was to
investigate whether the pharmacological
inhibition of PI3-K is able to induce apoptosis
in neuroblasts. But previously we first checked
the effect of different concentrations of two
unrelated inhibitors of PI3-K, LY294002 and
wortmannin in its in vitro kinase activity (Fig.
6). As shown in Fig. 6A and B, treatment of
neuroblasts with different concentrations of
LY294002 (1-100µM) and wortmannin
(10nM-1µM) promotes an inhibition of the in
vitro kinase activity of PI3-K in a
concentration-dependent manner. Although
LY294002 and wortmannin effects result
evident at 10 µM and 100nM, respectively,
they significantly inhibit the PI3-K activity at
the higher concentrations used, 100 µM and 1
µM, respectively.
Effect of inhibitors of the phosphoinositide
3-kinase on parameters indicative of
apoptosis.
We therefore incubated neuroblasts with
different concentrations of the two PI3-K
inhibitors and then evaluated direct or indirect
parameters of apoptosis: cell viability, analysis
of internucleosomal fragmentation of DNA
and quantification of neuroblasts in apoptosis
by flow cytometry. We have checked that final
concentration of vehicle, 0.01% and 0.1%
DMSO, does not alter neuroblasts viability.
Neuroblasts were incubated with different
concentrations of wortmannin and LY294002
for 24 h. As seen in Fig. 7A, the percentage of
viable cells observed after exposure to 0.1µM,
1µM and 10 µM of LY294002 remains similar
to control sample (0.1% DMSO). Incubation
with a higher concentration, 100 µM, promotes
a significant decrease of neuroblasts viability
(43%), percentage similar to the obtained after
lovastatin treatment. Treatment of neuroblasts
with different concentrations of wortmannin
(1nM to 1 µM) does not significantly affect
cell viability compared to control samples with
0.01% DMSO.
As a decrease in cell viability is not a
specific indicator of apoptosis, we next
evaluated by flow cytometry the population of
neuroblasts that posses a hypodiploid DNA
content (phase of cell cycle Sub Go–G1), which
is a characteristic feature of cells undergoing
apoptosis (Darzynkiewicz et al. 1992). Results
in Fig. 7B show that 0.1µM of wortmannin and
10 µM of LY294002 do not significantly
modify the percentage of hypodiploid
neuroblasts compared with control neuroblasts.
Interestingly, 1 µM wortmannin and 100 µM
of LY294002 significantly increase, by almost
2 times, the percentage of neuroblasts in
apoptosis. However, the percentage of
apoptotic cells observed after 1 µM
wortmannin or 100 µM LY294002 (9 ± 1 %
and 11.7 ± 3 %, respectively) are significantly
lower than the observed after lovastatin
treatment (27.8±1%). Rest of cell cycle phases
are not affected after PI3-K inhibitors in our
conditions (data not shown).
In parallel experiments we have
analyzed a biochemical hallmark of apoptosis,
the internucleosomal fragmentation of DNA,
consequence of cellular DNA degradation by
endonuclease.
61
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts
C
4MW 5 6 72 31
B
0 10 100 Lov
Apo
ptos
is(%
oft
otal
cel
ls)
LY 294002 (µM)
05
10
15
202530
*
05
101520
2530
Apo
ptos
is(%
oft
otal
cel
ls)
0,1 1 LovWortm (µM)0
*C
ellV
iabi
lity
(% o
fcon
trol
)
0
25
50
75
100
125
0 0,001 0,10,01 1 LovWortm (µM)LY 294002 (µM)
0
25
50
75
100
125
Lov0 0.1 1 10010
Cel
lVia
bilit
y(%
ofc
ontr
ol)
*
A
C
4MW 5 6 72 31
C
4MW 5 6 72 31 4MW 5 6 72 31
B
0 10 100100 LovLov
Apo
ptos
is(%
oft
otal
cel
ls)
LY 294002 (µM)
05
10
15
202530
*
05
101520
2530
Apo
ptos
is(%
oft
otal
cel
ls)
0,1 1 LovWortm (µM)0
*
05
101520
2530
Apo
ptos
is(%
oft
otal
cel
ls)
0,1 1 LovWortm (µM)0
05
101520
2530
Apo
ptos
is(%
oft
otal
cel
ls)
0,1 1 LovLovWortm (µM)0
*C
ellV
iabi
lity
(% o
fcon
trol
)
0
25
50
75
100
125
0 0,001 0,10,01 1 LovWortm (µM)LY 294002 (µM)
0
25
50
75
100
125
LovLov0 0.1 1 10010
Cel
lVia
bilit
y(%
ofc
ontr
ol)
*
A
Figure 7. Effects of PI3-K inhibitors on neuroblasts viability (A), quantification of apoptotic cells (B) and internucleosomal DNA fragmentation (C). Neuroblasts were incubated for 24 h in the presence of medium (0), 10 µM lovastatin (black histograms) or the indicated concentrations of inhibitors LY294002 and wortmannin. Cell viability was determined by the MTT assay (A), the hypodiploid DNA content was evaluated by flow cytometry (B), and isolated DNA was analyzed by using electrophoresis on 2% agarose gel (C). In experiment C, MW, molecular weight ladder; lane 1: 0.01% DMSO; lane 2: wortmannin 0.1 µM; lane 3: wortmannin 1 µM; lane 4: 0.1% DMSO; lane 5: LY294002 10 µM; lane 6: LY294002 100 µM and lane 7: lovastatin 10 µM. Results in A and B are expressed as mean ± standard error of eleven and three independent experiments, respectively. A representative film of three independent experiments is shown in C. Samples in experiments A and B were evaluated in triplicate. * P<0.05 compared to untreated cells.
DISCUSSION Treatment of neuroblasts with 10 µM
LY294002 does not induce internucleosomal
degradation of DNA, whereas a higher
concentration, 100 µM, leads to a typical
apoptotic pattern of DNA laddering (Fig. 7C,
lane 6). Wortmannin treatment does not
promote internucleosomal DNA fragmentation,
as seen in Fig. 7C (lanes 2, 3).
The ability of lovastatin to induce
apoptosis has been well documented in several
non-neuronal cell types (Guijarro et al. 1998;
Jones et al. 1994; Padayatty et al. 1997; Perez-
Sala and Mollinedo 1994). A recent study by
our group shows that lovastatin suppressed cell
growth by inducing apoptosis in rat brain 62
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts neuroblasts (Garcia-Roman et al. 2001). The
aim of this work was to investigate the
intracellular mechanisms induced by lovastatin
in rat brain neuroblasts, focused on one of the
main pathways that regulate cell growth and
survival, PI3-K/PKB. In the present work, we
show that lovastatin treatment leads to a clear
reduction of the kinase activity of PI3-K in
neuroblasts. This result agrees with previous
works on the apoptosis induced by other statins
in non neuronal cell types (Nakagawa et al.
1998; Weiss et al. 1999), which point to PI3-K
as a key regulatory molecule on cell survival.
However, our finding differs from other study
in which a different statin, simvastatin, reduced
myocardial reperfusion injury in vivo by
activating the PI3-K activity in myocardial
tissue (Wolfrum et al. 2004). These
controversial results may be explained by both,
the different cell type used and different
biological actions of statins, apoptosis or
cardioprotective effect. At this moment, we do
not know the mechanisms by which lovastatin
treatment leads to an inactivation of PI3-K in
neuroblasts. However, we may postulate that
the inhibition of PI3-K activity observed after
lovastatin treatment could be due, at least
partially, to a reduction of the prenylation of
Ras (Garcia-Roman et al. 2001), an upstream
regulator of PI3-K as previously reported by
Nakagawa et al. (1998). The suggested
hypothesis that Ras is involved in PI3-K
activation in neuroblasts could not be
confirmed in our experimental conditions due
to technical problems. Therefore, we measured
PI3-K activity in tyrosine phosphorylated
proteins immunoprecipitates. The decrease in
the PI3-K activity observed might be attributed
to an inhibition of the tyrosine phosphorylation
of several proteins after lovastatin treatment, as
it has been described in previous studies but in
other cell types (McGuire et al. 1993; McGuire
et al. 1994; McGuire et al. 1996; Xu et al.
1996). However, our data clearly show that the
amount of p85 regulatory subunit associated
with tyrosine phosphorylated proteins is not
modified by lovastatin treatment. A different
explanation of the reduction of PI3-K activity
could involve the tyrosine phosphorylation of
the p110 subunit of PI3-K, which negatively
reduces its kinase activity, as it has been
shown in L6 myoblasts after simvastatin,
treatment (Nakagawa et al. 2001).Therefore,
the mechanisms underlying the inhibition of
PI3-K activity evoked by lovastatin in
neuroblasts will be an objective of future
studies.
Among the main signal transduction
pathways initiated by PI3-K to promote its
cellular actions is PKB/Akt. In the present
work, we show that lovastatin treatment leads
to a clear reduction on the phosphorylation of
PKB in Ser473 in brain neuroblasts that point
to an inhibition of its kinase activity. By
contrast, previous works show that simvastatin
activated PKB in myocardial tissue (Wolfrum
et al. 2004) and endothelial cells (Kureishi et
al. 2000) in two experimental models unrelated
to apoptosis. As mentioned above, these
controversial findings may be attributed to
different biological actions of statins
depending on the cell type. The decrease in the
phosphorylation/activation of PKB observed in
brain neuroblasts can be explained as a direct
63
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts consequence of the decrease in PI3-K activity
induced by lovastatin. However, we should not
discard the possibility of a dephosphorylation
in Ser 473, as it occurs in the apoptosis
induced by ceramide (Schubert et al. 2000).
It is generally accepted that PKB
promotes cell survival by inhibiting the action
of proteins that mediate apoptosis (Lawlor and
Alessi 2001). Among its multiples effectors is
the kinase mTOR (Holland et al. 2004), which
phosphorylates two substrates involved in the
regulation of protein translation, p70S6K
(Holland et al. 2004; McMahon et al. 2002)
and the regulatory protein of the eukaryotic
translation initiation factor 4E, 4E-BP1 (Choi
et al. 2003). In the present work, we have
shown that the decrease in PKB
phosphorylation/activity caused by lovastatin
is associated with a reduction of both p70S6K
and 4E-BP1 phosphorylation. Although a
decrease in the phosphorylation of 4E-BP1
after lovastatin treatment has been previously
reported in non neuronal cells (Polunovsky et
al. 2000), this is the first study showing a
reduction of 4E-BP1 phosphorylation in brain
neuroblasts. Moreover, we also report for the
first time that the phosphorylation of another
protein involved in the translational process,
p70S6K, is markedly decreased in neuroblasts in
response to lovastatin. The reduction of p70S6K
phosphorylation can be also greatly attributed
to the clear inhibition of p70S6K protein levels
induced by lovastatin in neuroblasts. Our data
support the recent hypothesis that points at
regulatory proteins of the translation initiation
as important modulators involved in the
programmed cell death (Herbert et al. 2000; Li
et al. 2002; Polunovsky et al. 1996). However
further experiments are necessary to elucidate
the mechanism underlying the inhibition of
p70S6K protein expression and to confirm the
plausible relationship between protein
synthesis and apoptosis in rat neuroblasts.
In this work we show that all lovastatin
effects are completely prevented by
simultaneous exposure of neuroblasts to
exogenous mevalonate, which allow us to
conclude that the inhibition of PI3-K/PKB
pathway in these cells is specifically due to a
blockade of HMG-CoA reductase.
Our results might suggest that lovastatin
could suppress rat brain neuroblasts growth
and induce apoptosis (Garcia-Roman et al.
2001) by its capacity to inhibit the growth and
survival pathway of the PI3-K/PKB.
Therefore, and because previous studies
demonstrated that pharmacological inhibition
of PI3-K leads to apoptosis in different cell
types, such as MDCK (Khwaja et al. 1997) and
PC12 cells (Yao and Cooper 1995), we
investigated whether PI3-K inhibition is able to
induce apoptosis in neuroblasts. Our results
show that only the highest doses of both
inhibitors of the PI3-K activity are able to
induce apoptosis in rat neuroblasts.
Additionally, the pharmacological inhibition of
PI3-K activity in neuroblasts was less effective
at triggering apoptosis than lovastatin.
Concentrations of LY294002 and wortmannin
used in this work are within the range widely
described in the literature to potently inhibit
the PI3-K activity in numerous cell types
(Cheatham et al. 1994; Vlahos et al. 1994). We
have further confirmed that inhibitors
64
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts concentrations of 1 µM wortmannin and 100
µM LY294002, which promote neuroblasts
apoptosis, significantly inhibit the in vitro PI3-
K activity in rat neuroblasts. The fact that both
inhibitors are less effective at inducing
neuronal apoptosis than lovastatin allow us to
suggest the idea that, besides the inhibition of
PI3-K alone, the activation/inactivation of
other intracellular pathways should be
necessarily involved in the neuronal apoptosis
induced by lovastatin. We have shown in this
work that incubation of neuroblasts with 1 µM
lovastatin causes a repetitive reduction (about
30%) of PI3-K activity (Fig. 1) but under the
same conditions there was not effect on
neuroblasts apoptosis (Garcia-Roman et al.
2001), confirming the above mentioned idea
that the inhibition of the PI3-K pathway alone
does not mean a relevant mechanism involved
in neuroblasts-induced apoptosis. According to
the hypothesis of the involvement of different
signalling mechanisms, Xia et al. (1995)
propose that cellular fate is determined by a
dynamic balance between pathways that
regulate cell survival and those activated by
cellular stress such as JNK and p38MAPK.
Supporting the idea that other pathways
different from PI3-K are regulating neuronal
apoptosis, Li et al. (2000) demonstrate that
neuronal survival is also promoted by the
cAMP pathway. If neuroblasts death induced
by lovastatin involves other intracellular
pathways is unknown at present but current
work is in progress to test this hypothesis.
In summary, we have shown in this
work that the specific inhibition of HMG-CoA
reductase in rat brain neuroblasts leads to an
inhibition of the main pathway that controls
cell growth and survival, PI3-K/PKB and to
the subsequent blockade of downstream
proteins implicated in the regulation of protein
synthesis. Our results suggest that PI3-K
pathway inactivation appears insufficient to
induce the degree of apoptosis provoked by
lovastatin and that apoptosis of neuroblasts
induced by this statin must necessarily involve
the activation/inactivation of other intracellular
pathways. We propose that the integration
between different intracellular pathways
simultaneously affected in different degree by
lovastatin, including PI3-K/PKB, might lead to
a cell death by apoptosis in neuroblasts.
These findings might contribute to
elucidate the molecular mechanisms of some
statins effects in the central nervous system,
such as induction of neuroblasts apoptosis.
ACKNOWLEDGEMENTS
The authors thank J. Ricardo Argent for
his excellent technical assistance, Dr. Alberto
Alvarez Barrientos for his kind and valuable
help on the flow cytometry experiments and
Dr. Pedro Fernandez for his kind advice in the
in vitro PI3-K assay. This work has been
supported by Grants, SAF 2001-0154 from the
Ministerio de Ciencia y Tecnologia (Spain),
2PR01B007 and 2PR04A014 from the Junta de
Extremadura (Spain). M. I. Cerezo-Guisado is
supported by a doctoral fellowship from Junta
de Extremadura, Spain.
65
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts REFERENCES Goldstein J. L. and Brown M. S. (1990) Regulation
of the mevalonate pathway. Nature 343, 425-430. Anderson K. E. and Jackson S. P. (2003) Class I phosphoinositide 3-kinases. Int J Biochem Cell Biol 35, 1028-1033.
Guijarro C., Blanco-Colio L. M., Ortego M., Alonso C., Ortiz A., Plaza J. J., Diaz C., Hernandez G., and Egido J. (1998) 3-Hydroxy-3-methylglutaryl coenzyme a reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res 83, 490-500.
Barth J. D., Kruisbrink O. A., and Van Dijk A. L. (1990) Inhibitors of hydroxymethylglutaryl coenzyme A reductase for treating hypercholesterolaemia. BMJ 301, 669.
Cavender C. P., Turley S. D., and Dietschy J. M. (1995) Sterol metabolism in fetal, newborn, and suckled lambs and their response to cholesterol after weaning. Am J Physiol 269, E331-E340.
Herbert T. P., Fahraeus R., Prescott A., Lane D. P., and Proud C. G. (2000) Rapid induction of apoptosis mediated by peptides that bind initiation factor eIF4E. Curr Biol 10, 793-796.
Cheatham B., Vlahos C. J., Cheatham L., Wang L., Blenis J., and Kahn C. R. (1994) Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol 14, 4902-4911.
Holland E. C., Sonenberg N., Pandolfi P. P., and Thomas G. (2004) Signaling control of mRNA translation in cancer pathogenesis. Oncogene 23, 3138-3144.
Jones K. D., Couldwell W. T., Hinton D. R., Su Y., He S., Anker L., and Law R. E. (1994) Lovastatin induces growth inhibition and apoptosis in human malignant glioma cells. Biochem Biophys Res Commun 205, 1681-1687.
Choi K. M., McMahon L. P., and Lawrence J. C., Jr. (2003) Two motifs in the translational repressor PHAS-I required for efficient phosphorylation by mammalian target of rapamycin and for recognition by raptor. J Biol Chem 278, 19667-19673. Khwaja A., Rodriguez-Viciana P., Wennstrom S.,
Warne P. H., and Downward J. (1997) Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J 16, 2783-2793.
Darzynkiewicz Z., Bruno S., Del Bino G., Gorczyca W., Hotz M. A., Lassota P., and Traganos F. (1992) Features of apoptotic cells measured by flow cytometry. Cytometry 13, 795-808.
Falke P., Mattiasson I., Stavenow L., and Hood B. (1989) Effects of a competitive inhibitor (mevinolin) of 3-hydroxy-3-methylglutaryl coenzyme A reductase on human and bovine endothelial cells, fibroblasts and smooth muscle cells in vitro. Pharmacol Toxicol 64, 173-176.
Kita T., Brown M. S., and Goldstein J. L. (1980) Feedback regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase in livers of mice treated with mevinolin, a competitive inhibitor of the reductase. J Clin Invest 66, 1094-1100.
Kureishi Y., Luo Z., Shiojima I., Bialik A., Fulton D., Lefer D. J., Sessa W. C., and Walsh K. (2000) The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med 6, 1004-1010.
Garcia-Roman N., Alvarez A. M., Toro M. J., Montes A., and Lorenzo M. J. (2001) Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosynthesis inhibition. Mol Cell Neurosci 17, 329-341.
66
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts Lawlor M. A. and Alessi D. R. (2001) PKB/Akt: a key mediator of cell proliferation, survival and insulin responses? J Cell Sci 114, 2903-2910.
Li M., Wang X., Meintzer M. K., Laessig T., Birnbaum M. J., and Heidenreich K. A. (2000) Cyclic AMP promotes neuronal survival by phosphorylation of glycogen synthase kinase 3beta. Mol Cell Biol 20, 9356-9363.
Li S., Sonenberg N., Gingras A. C., Peterson M., Avdulov S., Polunovsky V. A., and Bitterman P. B. (2002) Translational control of cell fate: availability of phosphorylation sites on translational repressor 4E-BP1 governs its proapoptotic potency. Mol Cell Biol 22, 2853-2861.
McGuire T. F., Corey S. J., and Sebti S. M. (1993) Lovastatin inhibits platelet-derived growth factor (PDGF) stimulation of phosphatidylinositol 3-kinase activity as well as association of p85 subunit to tyrosine-phosphorylated PDGF receptor. J Biol Chem 268, 22227-22230.
McGuire T. F., Qian Y., Vogt A., Hamilton A. D., and Sebti S. M. (1996) Platelet-derived growth factor receptor tyrosine phosphorylation requires protein geranylgeranylation but not farnesylation. J Biol Chem 271, 27402-27407.
McGuire T. F., Xu X. Q., Corey S. J., Romero G. G., and Sebti S. M. (1994) Lovastatin disrupts early events in insulin signaling: a potential mechanism of lovastatin's anti-mitogenic activity. Biochem Biophys Res Commun 204, 399-406.
McMahon L. P., Choi K. M., Lin T. A., Abraham R. T., and Lawrence J. C., Jr. (2002) The rapamycin-binding domain governs substrate selectivity by the mammalian target of rapamycin. Mol Cell Biol 22, 7428-7438.
Michikawa M. and Yanagisawa K. (1999) Inhibition of cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death. J Neurochem 72, 2278-2285.
Muñoz A., Wrighton C., Seliger B., Bernal J., and Beug H. (1993) Thyroid hormone receptor/c-erbA:
control of commitment and differentiation in the neuronal/chromaffin progenitor line PC12. J Cell Biol 121, 423-438.
Nakagawa H., Mutoh T., Kumano T., and Kuriyama M. (1998) HMG-CoA reductase inhibitor-induced L6 myoblast cell death: involvement of the phosphatidylinositol 3-kinase pathway. FEBS Lett 438, 289-292.
Nakagawa H., Mutho T., Kumano T., and Kuriyama M. (2001). Tyrosine phosphorylation of the cartalytic subunit p110 of phosphatidylinositol-3 kinase induced by HMG-CoA reductase inhibitor inhibits its kinase activity in L6 myoblasts. FEBS Lett 508, 53-56.
Padayatty S. J., Marcelli M., Shao T. C., and Cunningham G. R. (1997) Lovastatin-induced apoptosis in prostate stromal cells. J Clin Endocrinol Metab 82, 1434-1439.
Perez-Sala D. and Mollinedo F. (1994) Inhibition of isoprenoid biosynthesis induces apoptosis in human promyelocytic HL-60 cells. Biochem Biophys Res Commun 199, 1209-1215.
Polunovsky V. A., Gingras A. C., Sonenberg N., Peterson M., Tan A., Rubins J. B., Manivel J. C., and Bitterman P. B. (2000) Translational control of the antiapoptotic function of Ras. J Biol Chem 275, 24776-24780.
Polunovsky V. A., Rosenwald I. B., Tan A. T., White J., Chiang L., Sonenberg N., and Bitterman P. B. (1996) Translational control of programmed cell death: eukaryotic translation initiation factor 4E blocks apoptosis in growth-factor-restricted fibroblasts with physiologically expressed or deregulated Myc. Mol Cell Biol 16, 6573-6581.
Raiteri M., Arnaboldi L., McGeady P., Gelb M. H., Verri D., Tagliabue C., Quarato P., Ferraboschi P., Santaniello E., Paoletti R., Fumagalli R., and Corsini A. (1997) Pharmacological control of the mevalonate pathway: effect on arterial smooth muscle cell proliferation. J Pharmacol Exp Ther 281, 1144-1153.
67
Journal of Neurochemistry, 2005, 94, 1277-1287 Lovastatin inhibits PI3-K in brain neuroblasts
68
Roth T., Richardson G. R., Sullivan J. P., Lee R. M., Merlotti L., and Roehrs T. (1992) Comparative effects of pravastatin and lovastatin on nightime sleep and daytime performance. Clin Cardiol 15, 426-432.
Scheid M. P. and Woodgett J. R. (2001) PKB/AKT: functional insights from genetic models. Nat Rev Mol Cell Biol 2, 760-768.
Schmelzle T. and Hall M. N. (2000) TOR, a central controller of cell growth. Cell 103, 253-262.
Schubert K. M., Scheid M. P., and Duronio V. (2000) Ceramide inhibits protein kinase B/Akt by promoting dephosphorylation of serine 473. J Biol Chem 275, 13330-13335.
Spady D. K. and Dietschy J. M. (1983) Sterol synthesis in vivo in 18 tissues of the squirrel monkey, guinea pig, rabbit, hamster, and rat. J Lipid Res 24, 303-315.
Tobert J. A. (1987) New developments in lipid-lowering therapy: the role of inhibitors of hydroxymethylglutaryl-coenzyme A reductase. Circulation 76, 534-538.
Toker A. and Cantley L. C. (1997) Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature 387, 673-676.
Vlahos C. J., Matter w. F., Hui K. Y., and Brown R. F. (1994) A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem 269, 5241-5248.
Weiss R. H., Ramirez A., and Joo A. (1999) Short-term pravastatin mediates growth inhibition and apoptosis, independently of Ras, via the signaling proteins p27Kip1 and P13 kinase. J Am Soc Nephrol 10, 1880-1890.
Wolfrum S., Dendorfer A., Schutt M., Weidtmann B., Heep A., Tempel K., Klein H. H., Dominiak P., and Richardt G. (2004) Simvastatin acutely reduces myocardial reperfusion injury in vivo by activating
the phosphatidylinositide 3-kinase/Akt pathway. J Cardiovasc Pharmacol 44, 348-355.
Xia Z., Dickens M., Raingeaud J., Davis R. J., and Greenberg M. E. (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326-1331.
Xu X. Q., McGuire T. F., Blaskovich M. A., Sebti S. M., and Romero G. (1996) Lovastatin inhibits the stimulation of mitogen-activated protein kinase by insulin in HIRcB fibroblasts. Arch Biochem Biophys 326, 233-237.
Yao R. and Cooper G. M. (1995) Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science 267, 2003-2006.
CCaappííttuulloo 22
“LOVASTATIN INHIBITS THE EXTRACELLULAR SIGNAL-REGULATED KINASES PATHWAY IN IMMORTALIZED RAT BRAIN NEUROBLASTS”
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis LOVASTATIN INHIBITS THE EXTRACELLULAR SIGNAL-REGULATED KINASES
PATHWAY IN IMMORTALIZED RAT BRAIN NEUROBLASTS
1Maria Isabel Cerezo-Guisado, 2Natalia García-Román, 3Luis Jesús García-Marín, 4Alberto Álvarez-
Barrientos, 1Maria Julia Bragado and 1Maria Jesús Lorenzo
1Departamento de Bioquímica, Biología Molecular y Genética and 3Departamento de Fisiología, Universidad de
Extremadura, Cáceres. 2Departamento de Bioquímica y Biología Molecular, Universidad de Alcalá, 4Unidad de
Citometría, Centro Nacional de Investigaciones Cardiovasculares, Madrid. Spain.
ABSTRACT Furthermore, we showed that
pharmacological inhibition of both MEK and
PI3K activities was able to induce neuroblast
apoptosis with the same efficacy as lovastatin.
Our results suggest that lovastatin triggers
neuroblast apoptosis by regulating several
signalling pathways, including the
Ras/ERK1/2 pathway. These findings might
also contribute to elucidate the intracellular
mechanisms involved in the central nervous
system side effects associated to statin therapy.
We have previously shown that
lovastatin, an HMG-CoA reductase inhibitor,
induces apoptosis in spontaneously
immortalized rat brain neuroblasts. In the
present study, we analyzed the intracellular
signal transduction pathways by which
lovastatin induces neuroblast apoptosis. We
showed that lovastatin efficiently inhibited Ras
activation which was associated with a
significant decrease in ERK1/2
phosphorylation. Lovastatin also decreased
CREB phosphorylation and CREB-mediated
gene expression. The effects of lovastatin on
the Ras/ERK1/2/CREB pathway were time-
and concentration dependent and fully
prevented by mevalonate. In addition, we
showed that the MEK inhibitor, PD98059, was
a poor inducer of apoptosis in serum-treated
neuroblasts. However, PD98059 significantly
increased apoptosis induced by lovastatin
treatment.
RUNNING TITLE: ERKs inhibition in
lovastatin-induced neuronal apoptosis.
KEYWORDS: Lovastatin, apoptosis,
neuroblasts, ERK1/2, PD98059, LY294002
ABBREVIATIONS USED: HMG-CoA, 3-
hydroxy-3-methylglutaryl coenzyme A; ERK,
extracellular signal-regulated kinase; CREB,
cAMP response element binding protein,
PI3K, phosphoinositide 3-kinase; PKB, protein
kinase B.
69
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis INTRODUCTION
3-hydroxy-3-methylglutaryl
coenzyme A reductase inhibitors (HMG-CoA
reductase inhibitors or “statins”) are widely
used in the treatment of lipid disorders,
especially hypercholesterolemia. They
decrease the risk for vascular disease including
vascular death, myocardial infarction and
stroke. The statin family is composed of six
members: lovastatin, simvastatin, atorvastatin,
cerivastatin, pravastatin and fluvastatin. The
last two are hydrophilic, whereas the others are
lipid soluble, and each member differs in its
specificity for HMG-CoA reductase
(Blumenthal et al. 2000; Chong et al. 2001;
Graaf et al. 2004).
HMG-CoA reductase is a rate-limiting
enzyme that catalyses the conversion of HMG-
CoA into mevalonate (Goldstein et al. 1990;
Graaf et al. 2004). It is well established that
the mevalonate pathway plays an important
role in cell growth and survival (Goldstein et
al. 1990). Several studies show that statins not
only block the biosynthesis of mevalonate but,
in addition, inhibit the proliferation and induce
apoptosis of both normal and tumour cells
(Padayatty et al. 1997; Blanco-Colio et al.
2002; Hillyard et al. 2002; Jaster et al. 2003;
Graaf et al. 2004; Koyuturk et al. 2004; Takata
et al. 2004; Wu et al. 2004; Nishida et al.
2005). These pleiotropic effects of statins are
thought to be mediated by their ability to block
the biosynthesis of isoprenoid intermediates of
the cholesterol pathway, such as farnesyl
pyrophosphate and/or geranylgeranyl
pyrophosphate which serve as lipid
attachments for the small GTP-binding
proteins Ras, Rho and Rac (Goldstein et al.
1990; Graaf et al. 2004). This post-
translational prenylation step (either
farnesylation or geranylgeranylation) is
required both for membrane association and
cell signalling, leading to cell survival and
proliferation (Zhang and Casey 1996; Graaf et
al. 2004).
HMG-CoA reductase activity (Maltese
and Volpe 1979) and cholesterol biosynthesis
(Spady and Dietschy 1983; Cavender et al.
1995) are very high in the early phase of the
ontogenetic development of the brain. These
data indicate that the mevalonate pathway is
essential to ensure normal growth,
differentiation and maintenance of neuronal
tissues. In agreement with this, recent reports
show that the inhibition of this biosynthetic
pathway during gestation by statin exposures
are associated with severe central nervous
system (CNS) defects (Edison and Muenke
2004a,b). On the other hand, studies in vitro
show that statins at micro- and millimolar
concentrations have neurotoxic effects on
primary neuronal cultures of cerebral cortex
(Michikawa and Yanagisawa 1999; Tanaka et
al. 2000; Schulz et al. 2004) and we have
shown that lovastatin induces apoptosis of
immortalized rat brain neuroblasts, and that its
effect is associated with a decreased
prenylation of Ras (García-Román et al. 2001).
The Ras family of small GTPases are
key regulators of signal transduction pathways
that control cell proliferation, differentiation,
survival and apoptosis. Ras and its relatives are
activated in response to an extracellular or
intracellular signal that generates the GTP-
bound form and energizes the signal
transducing ability. Hydrolysis of the bound
70
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis GTP by an intrinsic GTPase activity relaxes
the conformation and terminates the signal
(Denhardt 1996; Repasky et al. 2004; Mitin et
al. 2005). Active Ras interacts with and
modulates the activity of several downstream
effectors. The best-characterized Ras effector
pathway is the interaction with, and activation
of, the three Raf serine/threonine kinases (A-
Raf, B-Raf and Raf-1) leading to stimulation of
the MEK1/MEK2 and ERK1/ERK2 (ERK1/2)
mitogen-activated protein kinase (MAPK)
cascade (Denhardt 1996; Repasky et al. 2004).
In the nervous system, ERK1/2 cascade is
critical for neuronal differentiation, plasticity
and neuronal survival (Hetman and Gozdz
2004). A role for ERK1/2 in neuronal survival
was first indicated by experiments showing
that overexpression of constitutively active
mutants of MEK1 prevented the apoptosis
induced by NGF withdrawal in neuronally
differentiated PC12 cells (Xia et al. 1995).
Thereafter, although many studies supported a
prosurvival activity of ERK1/2 in different
neuronal cell types, several other studies
suggested that ERK1/2 were not involved in
the antiapoptotic signalling in neurons. Apart
from those contradictory results, there is
accumulating evidence that ERK1/2 may
mediate the neuroprotective activity of several
factors that neuroprotect against damaging
insults and neuronal injury (Hetman and Gozdz
2004). The mechanism by which the
Ras/ERK1/2 signalling pathway promotes
neuronal survival is under study, although it
has been suggested that activation of a
transcription factor, cAMP response element
binding protein (CREB) and/or a direct
inhibition of Bad, a pro-apoptotic member of
the Bcl-2 family, may mediate the prosurvival
activity of ERK1/2 in trophic-deprived
cerebellar granule neurons (Bonni et al. 1999).
As has been previously mentioned, we
have shown that lovastatin induces apoptosis in
rat brain neuroblasts (García-Román et al.
2001). The aim of the present work was to
investigate the role of the Ras/ERK1/2
signalling pathway in regulating lovastatin-
induced apoptosis in rat brain neuroblasts. The
elucidation of the intracellular mechanisms
affected by lovastatin will contribute to gain
insight in the growth inhibition and apoptosis
induced by lovastatin and other statins in
neuronal cells, and additionally will contribute
in establishing the important role that the
mevalonate pathway plays in the development
of the nervous system.
EXPERIMENTAL PROCEDURES
Reagents and antibodies
Lovastatin (Mevinolin, MK-803) was
from Calbiochem (San Diego, CA, USA). The
inactive lactone of lovastatin was converted to
the active form as previously described (Kita et
al. 1980). Mevalonic acid was purchased from
Sigma-Aldrich (St. Louis, MO, USA). Ham’s
F-12 medium, fetal calf serum, L-glutamine,
streptomycin, penicillin and trypsin/EDTA
solution were from PAN Biotech (Aidenbach,
Germany, Europe). Tissue culture flasks and
dishes were from TPP (Trasadingen,
Switzerland, Europe). MEK1 inhibitor
PD98059 (2´-amino-3´-methoxyflavone) and
PI3K inhibitor LY294002 [2-(4-Morpholinyl)-
8-phenyl-4H-1-benzopyran-4-one] were from
Calbiochem (San Diego, CA, USA). Complete
protease inhibitor cocktail tablets were from
71
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Roche Molecular Biochemicals (Indianapolis,
IN, USA). Glutathione-Sepharose 4B was from
Pharmacia (Freiburg, Germany), Ras antibody
(cat. 610002) was from BD Biosciences
Pharmigen (San Diego, CA, USA). ERK1/2
(cat. M3807) and phospho-ERK1/2 (Thr183
and Tyr185, cat. M8159) antibodies were from
Sigma (St. Louis, MO, USA). CREB antibody
(cat. 8977) was from Sigma, phospho-CREB
(Ser 133, cat. 06-519) antibody was from
Upstate Biotechnology (Lake Placid, NY,
USA). Goat anti-rabbit (cat. 31460) and goat
anti-mouse (cat. 31430) conjugated to
horseradish peroxidase were from Pierce
(Rockford, IL, USA). Other reagents were
obtained from different commercial sources
and were of the highest purity available.
Cell cultures and treatments
Spontaneously immortalized rat brain
neuroblasts were used in this study. This cell
line was obtained by spontaneous
immortalization from cultures of 17-day fetal
rat cerebral cortices (Muñoz et al. 1993) and
was kindly provided by Dr. Alberto Muñoz
(Instituto de Investigaciones Biomédicas,
CSIC, Madrid, Spain). The cells represented
primitive neuroblasts that expressed NF 68 and
the primitive neuronal marker nestin, but
lacked the astrocyte marker, glial fibrillary
acidic protein (GFAP). After partial
differentiation induction with dibutyryl –
cAMP, the cells expressed further neuronal
markers such as NF 145, NF 220, and neuron-
specific enolase (A. Muñoz, personal
communication). Cells were grown in Ham’s
F-12 supplemented with 10% fetal calf serum,
L-glutamine (2 mM), streptomycin (100
µg/ml) and penicillin (100 U/ml). Cells were
seeded at 5 x 105 in 75-cm2 tissue culture flask
and incubated at 37ºC under a 5% CO2/95% air
atmosphere.
Confluent cells were trypsinized and
seeded in tissue culture dishes at a density of 2
x 104 cells/cm2. After 24 h, the medium was
aspirated and replaced with fresh medium
alone or containing the indicated
concentrations of lovastatin, mevalonate,
PD98059 or LY294002 and the incubation was
continued for a further 24 h. When indicated,
cells were incubated with PD98059 for 1h
before lovastatin addition. For the time course
experiments, cells were incubated with 10 µM
lovastatin for different periods of time.
Measurement of Ras activation
The capacity of Ras-GTP to bind to
RBD (Ras-binding domain of Raf-1) was used
to analyze the amount of active Ras as
previously described (Villalonga et al. 2002).
Neuroblasts were seeded in 100 mm tissue
culture dishes and after indicated treatments,
cells were harvested in phosphate-buffered
saline (PBS) and lysed for 15 min in 100 µl
ice-cold lysis buffer containing 20 mM Tris
(pH 7.4), 5 mM MgCl2, 1 mM EDTA, 0.2 mM
sodium orthovanadate, 5 mM NaF, 10 %
glycerol, 100 mM KCl, 1 % Triton X-100, 0.05
% 2-mercaptoethanol and 4 µg/ml complete
protease inhibitor cocktail. Cell lysates were
centrifuged at 20000 g for 10 min at 4ºC and
protein concentrations in the supernatants were
determined by using the Bio-Rad protein
assay, according to the instructions of the
manufacturer. Protein-equalized supernatants
(250 µg) were incubated for 2 h at 4ºC with
72
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis glutathione-Sepharose 4B beads pre-coupled
with GST-RBD (1h at 4ºC). The beads were
washed four times in the lysis buffer. Bound
proteins were solubilized by the addition of 30
µl of Laemmli loading buffer and analyzed in
12 % SDS-PAGE gels. The amount of Ras in
the bound fraction was analyzed by Western
blot as described below.
Western blot analysis
Treated and control cells were
harvested in PBS and lysed for 15 min in ice-
cold lysis buffer containing 50 mM HEPES
(pH 7.5), 150 mM NaCl, 1% Triton X-100,
10% glycerol, 5 mM MgCl2, 25 mM NaF, 10
mM sodium pyrophosphate, 1 mM EGTA, 0,5
mM sodium orthovanadate and 4 µg/ml
complete protease inhibitor cocktail. After
lysis, cell debris was removed by
centrifugation at 20000 g for 10 min at 4 ºC
and protein concentrations determined in the
supernatants as indicated above. Equal
amounts of protein (20 µg) were separated on
10 or 12% SDS-PAGE and blotted onto PVDF
membranes (PolyScreen, NEN life Science
Products, Inc. Boston, MA). The membranes
were then blocked with 5% non-fat dry milk in
Tris-buffered saline (pH 7.5) containing 0.5%
tween 20 and incubated with appropriate
primary and horseradish peroxidase (HRP)-
conjugated secondary antibodies in antibody
buffer [5% non-fat dry milk in Tris-buffered
saline (pH 7.5) containing 0.05% tween 20
(TBS-T)]. After required washes with TBS-T,
proteins were analyzed using an enhanced
chemiluminescence detection system (Signal®
West Pico Chemiluminescent Substrate,
Pierce, Rockford, IL) and exposed to
hyperfilm-ECL (Amersham, Pharmacia
Biotech, Freiburg, Germany). Films were
photographed and the intensity of each band
was analyzed using a ChemiDoc System
(Documentation and Analysis System, Bio-
Rad, Hercules, CA, USA). Results were
expressed as percentage of control.
Luciferase reporter construct and assay
The control ß-galactosidase construct
was pSV- ß-Galactosidase (Promega). To
construct the CRE response element luciferase
reporter, the SV40 promoter in the vector
pGL3-promoter (Promega) was excised with
BglII and Hind III and replaced by a minimal
HSV TK promoter (obtained by PCR
amplification) containing nucleotides – 109 to
+ 17 flanked by BglII and Hind III sites. A
double stranded oligonucleotide containing the
CRE response element from the somatostatin
promoter (AGCCTGACGTCAGAGA) flanked
by Asp718 and BglII sites was then cloned into
this vector (pGL3-CRE). Neuroblasts were co-
transfected with 1 µg of pGL3-CRE and 1 µg
of ß-Galactosidase reporter vector using
GenePORTER transfection reagent (Genlantis,
San Diego, CA, USA), as recommended by the
manufacturer. Following transfection the cells
were incubated for 24 h, the medium was
exchanged, and the cells were incubated for an
additional 24 h with 10 µM lovastatin in the
presence or absence of 100 µM mevalonate.
The cells were then lysed and luciferase and ß-
galactosidase assays performed using Promega
reagents as recommended by the manufacturer.
Luciferase activity was normalized to ß-
galactosidase activity. Results were expressed
as percentage of control.
73
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Cell viability assay
Cell viability was evaluated by the
crystal violet method (Drysdale et al. 1983).
For these experiments 35 mm tissue culture
dishes were used. At the end of each
treatment, the medium was discarded, and the
remaining viable adherent cells were stained
with crystal violet (0.03% in 2% ethanol) for 5
min. Dishes were rinsed with tap water and 1
ml of 1% sodium dodecyl sulfate was added to
each plate to solubilize the stained cells. The
absorbance of each plate was read at 560 nm.
Dishes without cells were processed in parallel
to correct the nonspecific adhesion of crystal
violet to the plastic. Viable cells were
calculated as percentage of absorbance with
respect to untreated cells.
DNA Fragmentation Assay
Neuroblasts were plated on 100 mm
culture dishes. After indicated treatments,
floating cells were harvested by centrifugation
at 20000 g for 1 min and adherent cells were
detached mechanically with a rubber
policeman. Adherent and floating cells were
mixed, washed twice in ice-cold PBS and lysed
in lysis buffer [10 mM Tris (pH 7.4), 5 mM
EDTA and 0.5 % Triton X-100)] for 60 min at
4ºC with agitation. After centrifugation at
20000 g for 30 min at 4ºC, supernatants were
incubated with RNase A (0.1 mg/ml) at 37ºC
for 45 min and then with Proteinase K (0.2
mg/ml) with 0.5% SDS solution at 37ºC for 45
min. Soluble DNA was then isolated by
phenol-chloroform-isoamylalcohol extraction
and ethanol precipitation. DNA was collected
by centrifugation at 20000 g for 20 min,
dissolved in autoclaved water and resolved on
2% agarose-0.1 µg/ml ethidium bromide gels
in TBE buffer [80 mM Tris-borate (pH 8.0), 2
mM EDTA]. DNA fragments were visualized
under ultraviolet light and photographed using
a ChemiDoc System (Documentation and
Analysis System, Bio-Rad, USA).
Analysis of Nuclear DNA Content by Flow
Cytometry
The ploidy determination of
neuroblasts was estimated by flow cytometry
DNA analysis. After culture under the
indicated conditions, adherent cells were
detached from dishes by the addition of a
trypsin-EDTA solution. They were mixed with
non-adherent cells and washed twice in ice-
cold PBS without Ca2+ and Mg2+. Cells were
resuspended in ice-cold 70% ethanol and fixed
for 5 min. After centrifugation at 500 g for 5
min, cells were resuspended in PBS containing
1 mg/ml of RNAsa A and incubated at 37ºC
for 30 min. Cells were stained with 50 µg/ml
propidium iodide for 30 min at room
temperature and then flow cytometry analysis
was done. DNA content per nucleus was
evaluated in a CyAn MLE flow cytometer
(DAKO, Gostrup, Denmark). This analysis
was performed using a doublet discriminator
system, which distinguishes between the
signals coming from a single nucleus and the
ones produced by two or more aggregated
nuclei. For the computer analysis, only signals
from single cells were considered (10000
cells/sample). This method of analysis of DNA
content permits the identification and
quantification of apoptotic cells, as revealed by
peak localized below the G0/G1 peak
(Darzynkiewicz et al. 1992).
74
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Statistical analysis
Each experiment was repeated at least
three times, with good agreement among the
results of individual experiments. All data are
expressed as the mean ± standard error of the
mean. Results were analyzed by one-way
analysis of variance (ANOVA) followed by
Student´s t test. P values of less than 0.05 were
considered significant.
RESULTS
Effect of lovastatin on Ras activation
We have previously shown that
lovastatin induced apoptosis of neuroblasts in a
dose- and time-dependent manner and also that
the lovastatin effect was associated with an
inhibition of Ras prenylation evaluated by the
decrease of the level of Ras in the membrane
compartment (García-Román et al. 2001). This
post-translational prenylation step is required
both for membrane association and Ras
activation. Therefore, in the present work we
first studied whether the inhibition of Ras
prenylation by lovastatin was also associated
with a decrease in its biological activity. To
clarify this issue, time course and
concentration-dependent experiments were
done and Ras activation was analyzed by the
GST-RBD-Raf-1 pull-down method. Time
course experiments showed that in comparison
to the control cells grown in 10% FCS media,
lovastatin (10 µM) inhibited Ras activation in a
time dependent manner (Fig. 1A). The
lovastatin effect started to be significant after 3
hours of treatment and reached its maximum at
24 hours, the last time tested. Inhibition of Ras
activation occurred before induction of
apoptosis that started to be significant after 12
hours of lovastatin treatment (García-Román et
al. 2001). Additionally, neuroblasts were
treated with increasing concentrations of
lovastatin for 24 hours and as shown in Fig.
1B, Ras activation decreased in a
concentration-dependent manner after
lovastatin treatment. The effect of lovastatin
was evident at a concentration as low as 1 µM
reaching the maximum effect at a
concentration of 10 µM. In order to know
whether the lovastatin effect on Ras activation
was specific of HMG-CoA reductase
inhibition, cells were incubated with lovastatin
(10 µM) in presence or absence of mevalonate
(100 µM) for 24 h. Co-treatment with
mevalonate prevented the decrease in Ras
activation induced by lovastatin (Fig. 1C).
Treatment of cells with mevalonate alone did
not modify Ras activation. In all the
experiments, lovastatin decreased Ras
prenylation evaluated by the presence of the
unprocessed form of Ras (unprocessed Ras
migrates more slowly that its processed form
in SDS-PAGE). Taken together, these data
suggest that the decrease of Ras activation
induced by lovastatin may be due to a specific
failure of Ras prenylation.
75
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
Effect of lovastatin on ERK1/2
phosphorylation
C
B
0 10 2010
25
50
75
100
Lovastatin (µM)
ns
******
Ras
-GT
P(%
ofc
ontr
ol)
Ras-GTP →
A
Processed Ras →
Time (h)
Ras-GTP →
Ras
-GT
P(%
ofc
ontr
ol)
0 3 6 12 240
25
50
75
100
**
****
*
0
50
100
150
LovMev
--
++
-+
+-
***
ns ns
Ras
-GT
P(%
ofc
ontr
ol)
Ras-GTP →
Unprocessed Ras →
Processed Ras →Unprocessed Ras →
Processed Ras →Unprocessed Ras →
C
B
0 10 2010
25
50
75
100
Lovastatin (µM)
ns
******
Ras
-GT
P(%
ofc
ontr
ol)
Ras-GTP →
A
Processed Ras →
Time (h)
Ras-GTP →
Ras
-GT
P(%
ofc
ontr
ol)
0 3 6 12 240
25
50
75
100
**
****
*
0
50
100
150
LovMevLovMev
--
++
-+
+-
***
ns ns
Ras
-GT
P(%
ofc
ontr
ol)
Ras-GTP →
Unprocessed Ras →
Processed Ras →Unprocessed Ras →
Processed Ras →Unprocessed Ras →
The best characterized Ras effector is
the serine/threonine kinase Raf, which leads to
the activation of the ERK1/2 pathway
(Denhardt 1996; Repasky et al. 2004).
Therefore, we next studied the phosphorylation
state of these kinases after lovastatin treatment
by immunoblot analysis using phosphospecific
antibodies. As shown in Fig. 2, lovastatin
decreased ERK1/2 phosphorylation in a time-
and concentration-dependent manner (Fig. 2A
and Fig. 2B, respectively). Lovastatin (10 µM)
produced a decrease in ERK1/2
phosphorylation that was significant at 3 hours
and was maximum at 12 hours of treatment
(Fig. 2A). On the other hand, the lovastatin
effect on ERK1/2 phosphorylation was evident
at a concentration of 1 µM, but the decrease in
the phosphorylation of both kinases was only
significant at higher concentrations (10 µM
and 20 µM). Mevalonate (100 µM) prevented
the decrease in ERK1/2 phosphorylation
induced by lovastatin, indicating that the
lovastatin effect was specific (Fig. 2C).
Treatment of neuroblasts with mevalonate
alone did not affect ERK1/2 phosphorylation.
Expression levels of ERK1/2 remained
unchanged throughout the experiment (Fig. 2),
suggesting that ERK1/2 phosphorylation was
specifically affected by exposure to lovastatin.
It is noteworthy that the lovastatin effect on
ERK1/2 phosphorylation was less potent than
the effect on Ras activation. In fact, neuroblast
incubation with lovastatin 10 µM for 24 hours
reduced ERK1/2 phosphorylation by 45 % vs.
control cells while the same treatment inhibited
Ras activation by 90% vs. control.
Figure 1. Effect of lovastatin on Ras activation. A: Time-dependent effect: Neuroblasts initially cultured for 24 hours in Ham´s F12/10% FCS were incubated in culture media alone or with 10 µM lovastatin for different periods of time. B: Concentration-dependent effect: cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated for an additional 24 hours in the presence of media alone (0) or various concentrations of lovastatin. C: Effect of mevalonate treatment: Cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated with lovastatin (Lov 10 µM) in absence or presence of mevalonate (Mev 100 µM) for an additional 24 hours. Control cells were incubated in presence of media or mevalonate alone. At the end of each experiment, Ras activation was measured by GST-RBD pull-down followed by Western blot with anti-(pan)-Ras antibody. An aliquot of each lysate was also loaded in another gel to analyze total Ras protein levels. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.
76
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
Figure 2. Effect of lovastatin on ERK1/2 phosphorylation. A: Time-dependent effect. B: Concentration-dependent effect. C: Effect of mevalonate treatment. Neuroblasts were treated as described in Fig. 1. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using an anti-phospho-ERK1/2 specific antibody. As a control of the amount of protein, total ERK1/2 were also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; **, p<0.01; ***, p<0.001; compared to untreated cells.
Effect of lovastatin on CREB
phosphorylation and CREB-mediated gene
expression
It has been shown that one of the mechanisms
by which the Ras/ERK1/2 signalling pathway
promotes neuronal survival is by activating
p90rsk, which in turn phosphorylates the
transcription factor CREB at serine 133.
Activated CREB promotes cell survival, and
inhibition of CREB phosphorylation triggers
apoptosis. Therefore, we next evaluated the
effect of lovastatin on the phosphorylation
level of CREB. Treatment of neuroblasts with
10 µM lovastatin during different periods of
time led to a reduction in the phosphorylation
at Ser133 of CREB that was significant at 6
hours. The maximum effect was observed after
12 hours of treatment (Fig. 3A). As shown in
Fig. 3B, lovastatin treatment induced a
decrease in the phosphorylation of CREB in a
concentration-dependent manner with respect
to untreated control cells, but in these
experiments the maximum decrease in CREB
phosphorylation was detected at 20 µM
lovastatin. Co-treatment with mevalonate (100
µM) prevented the decrease in CREB
phosphorylation induced by lovastatin.
Treatment of cells with mevalonate alone did
not modify CREB phosphorylation (Fig. 3C).
Lovastatin treatment did not modify CREB
expression in any of the experimental
conditions (Fig. 3). To determinate whether the
decrease in CREB phosphorylation induced by
lovastatin was associated with an inhibition on
CREB-mediated gene expression we next
performed the luciferase reporter gene assay.
As shown in Fig. 4, the incubation of the CRE-
plasmid containing cells with 10 µM lovastatin
for 24 hour resulted in an inhibition in
luciferase expression.
A
P-ERK1P-ERK2
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
020406080
100
120
0 1 3 6 12 24
**
ns
****** ***
P-ERK1 →P-ERK2 →
ERK1 →ERK2 →
Time (h)
Lovastatin (µM)0 10 201
0
25
50
75
100
**
ns
*** ***
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
B
P-ERK1
P-ERK2
P-ERK1 →P-ERK2 →
ERK1 →ERK2 →
LovMev
--
++
-+
+-
0
25
50
75
100**
ns ns
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
CP-ERK1 →P-ERK2 →
ERK1 →ERK2 →
P-ERK1
P-ERK2
A
P-ERK1P-ERK2
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
020406080
100
120
0 1 3 6 12 24
**
ns
****** ***
P-ERK1 →P-ERK2 →
ERK1 →ERK2 →
A
P-ERK1P-ERK2
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
020406080
100
120
0 1 3 6 12 24
**
ns
****** ***
P-ERK1 →P-ERK2 →P-ERK1 →P-ERK2 →
ERK1 →ERK2 →ERK1 →ERK2 →
Time (h)
Lovastatin (µM)0 10 201
0
25
50
75
100
**
ns
*** ***
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
B
P-ERK1
P-ERK2
P-ERK1 →P-ERK2 →
ERK1 →ERK2 →
Time (h)
Lovastatin (µM)0 10 201
0
25
50
75
100
**
ns
*** ***
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
Lovastatin (µM)0 10 201
0
25
50
75
100
**
ns
*** ***
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
B
P-ERK1
P-ERK2
P-ERK1 →P-ERK2 →P-ERK1 →P-ERK2 →
ERK1 →ERK2 →ERK1 →ERK2 →
LovMev
--
++
-+
+-
0
25
50
75
100**
ns ns
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
CP-ERK1 →P-ERK2 →
ERK1 →ERK2 →
P-ERK1
P-ERK2
LovMevLovMev
--
++
-+
+-
0
25
50
75
100**
ns**
ns ns
ER
K P
hosp
hory
latio
n(%
ofc
ontr
ol)
CP-ERK1 →P-ERK2 →P-ERK1 →P-ERK2 →
ERK1 →ERK2 →ERK1 →ERK2 →
P-ERK1
P-ERK2
77
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
Figure 3. Effect of lovastatin on CREB phosphorylation. A: Time-dependent effect. B: Concentration-dependent effect. C: Effect of mevalonate treatment. Neuroblasts were treated as described in Fig. 1. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using an anti-phospho-CREB specific antibody. As a control of the amount of protein, total CREB was also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.
This effect was not observed in the cells
transfected with the plasmid control lacking
CREB binding sites (data not shown). Again,
co-treatment with mevalonate prevented the
effect of lovastatin and completely restored
CREB-mediated gene expression to control
levels. Taken together, these data suggest that
lovastatin not only decreases CREB
phosphorylation in neuroblasts but this action
also correlates with decreased CREB capacity
to activate transcription.
AC
RE
B P
hosp
hory
latio
n(%
ofc
ontr
ol)
0
20
40
60
80100
120
0 1 3 6 12 24Time (h)
**
ns
***
ns
*
P-CREB →
CREB →
B
ns
*
*
0 10 2010
25
50
75
100
Lovastatin (µM)
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
P-CREB →
CREB →
C
LovMev
--
++
-+
+-
ns
0
50
100
150
*
ns
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
P-CREB →
CREB →
AC
RE
B P
hosp
hory
latio
n(%
ofc
ontr
ol)
0
20
40
60
80100
120
0 1 3 6 12 24Time (h)
**
ns
***
ns
*
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
0
20
40
60
80100
120
0 1 3 6 12 24Time (h)
**
ns
***
ns
***
ns
***
ns
*
P-CREB →
CREB →
P-CREB →
CREB →
B
ns
*
*
0 10 2010
25
50
75
100
Lovastatin (µM)
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
P-CREB →
CREB →
ns
*
*
0 10 2010
25
50
75
100
Lovastatin (µM)
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
ns
*
*
0 10 2010
25
50
75
100
Lovastatin (µM)
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
P-CREB →
CREB →
P-CREB →
CREB →
C
LovMevLovMev
--
++
-+
+-
ns
0
50
100
150
*
ns
ns
0
50
100
150
*
ns
*
ns
CR
EB
Pho
spho
ryla
tion
(% o
fcon
trol
)
P-CREB →
CREB →
P-CREB →
CREB →
0
50
100
150
**
ns
ns
Luc
/Gal
(% o
fCon
trol
)
LovMev
--
+-
++
-+
0
50
100
150
**
ns
ns
Luc
/Gal
(% o
fCon
trol
)
LovMev
--
+-
++
-+
Figure 4. Effect of lovastatin on transcription from the CRE-response element. Neuroblasts initially cultured for 24 hours in Ham´s F12/10% FCS were co-transfected with pGL3-CRE-luciferase and pSV-β-Galactosidase reporter constructs. Following transfection, cells were incubated with lovastatin (Lov 10 µM) in absence or presence of mevalonate (Mev 100 µM) for 24 hours. Control cells were incubated in presence of media or mevalonate alone. Luciferase and β-Galactosidase activity were measured in the same extracts and the luciferase activity standardised for transfection efficiency by dividing the luciferase activity by β-Galactosidase activity. Results are expressed as the percentage relative to untreated cells. Each value represents the mean ±SE of four independent experiments performed in triplicate. ns, not significant; **, p<0.01; compared to untreated cells
Effect of MEK inhibitor PD98059 on
neuroblast survival in absence or presence
of lovastatin
Our results suggested that lovastatin
might induce neuroblast apoptosis by its
capacity to inhibit the Ras/ERK1/2 signalling
pathway. Therefore, we next studied whether
the pharmacological inhibition of this pathway
was able to induce neuroblast apoptosis.
Neuroblasts were incubated for 24 hours with
different concentrations of PD98059 that
inhibits MEK1/2, the MAP kinase kinase
responsible for ERK1/2 phosphorylation and
then the ability of this inhibitor to induce
apoptosis was assessed by three independent
78
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis assays, neuroblast viability, internucleosomal
DNA fragmentation and quantification of
neuroblasts undergoing apoptosis by flow
cytometry.
As shown in Fig 5, the treatment of neuroblasts
with PD98059 alone was associated with a
concentration-dependent decrease in cell
viability (Fig. 5A), the appearance of
internucleosomal DNA fragmentation (Fig.
5B) and an increase in the percentage of
apoptotic neuroblasts (Fig. 5C). It is
noteworthy that PD98059 effects were
minimal when compared with control samples
and never reached the parameters seen with
lovastatin treatment (Fig. 5). PD98059 20 µM
and 50 µM partially inhibited ERK1/2
phosphorylation in a concentration-dependent
manner (data not shown). These data suggest
that the inactivation of the Ras/ ERK1/2
pathway may be necessary but not sufficient to
evoke the lovastatin effect on neuroblast
apoptosis.
0
20
40
60
80
100
120
**
***
**
**
a
Lov 10µM
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
+--
-+
+
-
-+
+
--
+
-+PD 20µM
PD 50µM
A
Lov 10µM ---
+--
-+
+
-
-+
+
--
+
-+PD 20µM
PD 50µM
MW
B
0
10
20
30
40
50
Lov 10µM ---
+--
-+
+
-
-+
+
--
+
-+PD 20µM
PD 50µM
*****
***
***
b
b
Apo
ptos
is(%
oft
otal
cel
ls)
C
0
20
40
60
80
100
120
**
***
**
**
a
Lov 10µM
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
+--
-+
+
-
-+
+
--
+
-+PD 20µM
PD 50µM
A
Lov 10µM ---
---
+--
-+
+
-
-+
+
--
+
-+PD 20µM
PD 50µM
MW
B
0
10
20
30
40
50
Lov 10µM ---
---
+--
-+
+
-
-+-
-+
+
--+
--
+
-+PD 20µM
PD 50µM
*****
***
***
b
b
Apo
ptos
is(%
oft
otal
cel
ls)
C
It has been recently shown that the
inhibition of the Raf/ERK pathway sensitizes
cells to statins-induced apoptosis (Takata et al.
2004; Wu et al. 2004). To evaluate whether
direct inhibition of this pathway can increase
the efficacy of lovastatin to trigger neuroblast
apoptosis, cells were treated with lovastatin
(10 µM) alone or in combination with PD
98059 (20 µM and 50 µM) for 24 hours. In
these experiments, MEK inhibitor was added
to the cells 1 hour before lovastatin treatment.
As shown in Fig. 5, lovastatin effects were
enhanced by preteatment with PD98059 in a
concentration-dependent manner. As expected,
the down-regulation of ERK1/2
phosphorylation was also enhanced when
lovastatin and PD98059 were used together
(data not shown).
Figure 5. Effect of MEK inhibitor (PD98059) alone or in combination with lovastatin on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of PD98059 (PD 20 and 50 µM) in absence or presence of 10 µM lovastatin (Lov) for an additional 24 h. At the end of the experiment, cell viability was determined by the crystal violet method (A), internucleosomal DNA degradation was analyzed by using electrophoresis on 2% agarose gel (B) and the percentage of cells with hypodiploid DNA content was evaluated by flow cytometry (C). Each value represents the mean ±standard error of at least three independent experiments made in triplicate. *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells. a, p<0.01; b, p<0.05; compared to lovastatin-treated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.
79
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis Effect of the inhibition of Ras/ ERK1/2 and
phosphoinositide 3-kinase/protein kinase B
(PI3K/PKB) pathways on neuroblast
survival
We have shown that Ras/ERK1/2 and
PI3K/PKB signalling pathways are down-
regulated by lovastatin in neuroblasts and that
the pharmacological inhibition of each of these
pathways was not sufficient to induce the
apoptosis degree elicited by lovastatin
(Cerezo-Guisado et al. 2005) and the present
work. Therefore, we next studied the effect of
co-incubation of PD98059 (MEK1/2 inhibitor)
and LY294002 (PI3K inhibitor) on neuroblast
survival and apoptosis. The treatment of
neuroblasts with PD98059 (20 and 50 µM) or
LY294002 (50 µM) alone during 24 h was
associated with a decrease in cell viability (Fig.
6A), the appearance of internucleosomal DNA
fragmentation (Fig. 6B) and a slight increase in
the percentage of cells in the apoptotic sub-G1
population (Fig. 6C) when compared with
control. However, the effects of both inhibitors
were additive on all the parameters studied
(Fig. 6) and only the concomitant use of both
inhibitors resembled the lovastatin efficacy in
inducing neuroblasts apoptosis (Fig. 5A,B,C).
LY294002 at this concentration range
efficiently decreased PI3K activation (Cerezo-
Guisado et al. 2005).
DISCUSSION
It is known that the mevalonate
pathway is essential to ensure normal growth,
differentiation and maintenance of neuronal
tissues (Maltese and Volpe 1979; Spady and
Dietschy 1983; Cavender et al. 1995). We
have recently shown that mevalonate pathway
inhibition by lovastatin induces apoptosis of
spontaneously immortalized rat brain
neuroblasts (García-Román et al. 2001).
A
PD 20µM0
20
40
60
80
100
120
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
*** ***ns a
B
MWPD 20µM ---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
C
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls)
PD 20µM ---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
***
*b
b
A
PD 20µM0
20
40
60
80
100
120
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
*** ***ns a
A
PD 20µM0
20
40
60
80
100
120
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
*** ***ns a
PD 20µM0
20
40
60
80
100
120
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
PD 20µM0
20
40
60
80
100
120
Cel
lVia
bilit
y(%
ofc
ontr
ol)
---
---
+--
+--
+-
-+-
-
+
+-+
+-
+
--+
--
-
++-
++PD 50µM
LY 50µM
*** ***ns a
B
MWPD 20µM ---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
B
MWPD 20µM ---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
MWPD 20µM ---
---
+--
+--
+-
-+-
-
+
+-+
+-
+
--+
--
-
++-
++PD 50µM
LY 50µM
C
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls)
PD 20µM ---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
C
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls)
PD 20µM ---
+--
+-
-
+
+-
+
--
-
++PD 50µM
LY 50µM
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls)
PD 20µM ---
---
+--
+--
+-
-+-
-
+
+-+
+-
+
--+
--
-
++-
++PD 50µM
LY 50µM
***
*b
b
Figure 6. Effect of the coincubation with MEK inhibitor (PD98059) and PI3K inhibitor (LY294002) on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of PD98059 (PD 20 and 50 µM) in absence or presence of 50 µM LY294002 (LY 50 µM) and with LY 50 µM alone for an additional 24 h. At the end of the experiment, cell viability (A), internucleosomal DNA degradation (B) and the percentage of cells with hypodiploid DNA content (C) were determined as described in Materials and Methods. Each value represents the mean ±standard error of at least three independent experiments made in triplicate. *, p<0.05; ***, p<0.001; compared to their respective PD-treated cells. ns, not significant; a, p<0.05; b, p<0.01; compared to LY-treated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.
80
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
In the present study, we investigated
the molecular mechanisms underlying
lovastatin-induced neuroblast apoptosis,
focusing our work on the involvement of the
Ras/ERK1/2/CREB signalling pathway.
In the present work, we have shown
for the first time that lovastatin significantly
decreased the activation of Ras stimulated by
serum in spontaneously immortalized rat brain
neuroblasts. The lovastatin effect on Ras
activation was time- and concentration
dependent and preceded neuroblast apoptosis
(García-Román et al. 2001). Our results are in
agreement with previous studies that show that
statins inhibit Ras prenylation and activation in
different non-neuronal cell types (Nakagawa et
al. 1998; Bassa et al. 1999; Hillyard et al.
2002; Miura et al. 2004) and strongly suggest
that lovastatin may induce neuroblast apoptosis
by its capacity to disrupt Ras-mediated signal
transduction in the cells.
Activation of Ras has been
demonstrated to initiate activation of Raf and
MEK1/2, resulting in ERK activation
(Denhardt 1996; Repasky et al. 2004). Since
the Ras-MEK-ERK signalling pathway plays a
key role in the transmission of cell survival
signals, the phosphorylation of ERK 1/2 after
lovastatin treatment was investigated. Our data
show that lovastatin treatment led to a time-
and concentration dependent decrease in the
phosphorylation of ERK1/2 in neuroblasts that
pointed to an inhibition of its kinase activity.
These results suggest that the decrease in the
phosphorylation of ERK1/2 may play a role in
the apoptotic induction by lovastatin.
Consistent with our findings, several reports
show that statin-induced apoptosis and/or
growth inhibition of various cell types
correlates with down-regulation of ERK
activity (Bassa et al. 1999; Hillyard et al.
2002; Johnson et al. 2002; Miura et al. 2004;
Wu et al. 2004; Nishida et al. 2005). In
contrast, another study reported that statin-
induced growth inhibition of rat RBL-2H3
cells did not involve down-regulation of ERK
activity (Graham et al. 1998). These
controversial findings may be attributed to
different biological actions of statins
depending on the cell type. We have also
shown that although the activation of Ras was
almost completely inhibited by lovastatin, the
serum-induced phosphorylation of the ERK1/2
was only partially inhibited in lovastatin-
treated cells compared with control. The
sustained phosphorylation of ERK1/2 in
lovastatin-treated neuroblasts may be due to
the activation of other upstream intracellular
signalling molecules, such as PKC or Rac
(Skaletz-Rorowski et al. 2001; Negre-Aminou
et al. 2002) which in turn produce the
activation of the MEK/ERK pathway.
It is accepted that ERK1/2 activation
promotes neuronal survival by its capacity to
activate p90rsk, which in turn phosphorylates
and activates CREB as well as increased
CREB-mediated gene expression (Bonni et al.
1999; Riccio et al. 1999). In the present work,
we have shown that the decrease in ERK1/2
phosphorylation/activity caused by lovastatin
is associated with a reduction of both CREB
phosphorylation and CREB-mediated gene
expression. The turn off Ras/ERK/CREB
signalling pathway has been related to
apoptosis induced by other stimuli (Bonni et
al. 1999; Rabelo et al. 2003; Hansen et al.
81
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis 2004) but, to our knowledge, this is the first
report that demonstrates that lovastatin inhibits
the activation of this survival signalling
pathway in neuronal cells. We have previously
shown that lovastatin decreased the expression
of Bcl-2 in neuroblasts undergoing apoptosis
(García-Román et al. 2001). As this pro-
survival gene is a target of CREB in neurons
(Bonni et al. 1999), our present data suggest
that lovastatin may induce neuroblast apoptosis
by decreasing the expression of Bcl-2 through
the inhibition of the Ras/ERK/CREB
signalling pathway. Our findings are in
agreement with several works that indicate that
CREB is essential for neuronal survival
(Walton and Dragunow 2000).
We have also shown that lovastatin
effects were completely prevented by
simultaneous exposure of cells to exogenous
mevalonate, demonstrating that the inhibition
of the Ras/ERK/CREB pathway induced by
lovastatin was specifically due to a blockade of
HMG-CoA reductase activity.
As said above, our results could
suggest that lovastatin may induce neuroblasts
apoptosis by its capacity to inhibit the
Ras/ERK/CREB pathway. Therefore, we
investigated whether the pharmacological
inhibition of this pathway was able to induce
apoptosis in neuroblasts. Our results show that
the MEK inhibitor alone was a poor inducer of
apoptosis in serum-treated neuroblasts.
However, PD98059 significantly increased
apoptosis induced by lovastatin treatment.
Taken together, these results suggest 1) that
lovastatin does not trigger neuroblast apoptosis
by down-regulating the Ras/ERK/CREB
signalling cascade alone, and 2) that the
sustained phosphorylation of ERK1/2 in
lovastatin-treated neuroblasts may play a
protective role (Hetman and Gozdz 2004). Our
findings are in agreement with other reports
where MEK inhibitors enhance the apoptotic
actions of statins and other drugs in different
non-neuronal cell types (Wu et al. 2004;
Rabelo et al. 2003; Brantley-Finley et al.
2003).
Finally, in the present work we have
shown that only the pharmacological inhibition
of both MEK and PI3K activities was able to
induce neuroblast apoptosis with the same
efficacy as lovastatin. These data suggest that
lovastatin may induce neuroblast apoptosis by
inducing the simultaneous inactivation of both
Ras/ERK1/2 and PI3K/PKB signalling
pathways. Whether neuroblast death induced
by lovastatin involves other intracellular
pathways is under study.
In conclusion, we have shown for the
first time that HMG-CoA reductase inhibition
by lovastatin leads to an inhibition of the
Ras/ERK/CREB signalling pathway in
spontaneously immortalized rat brain
neuroblasts which may contribute to
explaining its apoptotic effect. The lovastatin
effects were time- and concentration-
dependent and prevented by adding
mevalonate to the medium, which indicates
that they were due to an inhibition of
mevalonate synthesis. Our results also suggest
that Ras/ERK pathway inactivation appears
insufficient to induce the degree of apoptosis
evoked by lovastatin and that apoptosis of
neuroblasts induced by this statin could require
the simultaneous inhibition of both the
Ras/ERK and PI3K-PKB signalling pathways.
82
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
These findings could contribute to
elucidate the molecular mechanisms by which
statins induce growth suppression and/or
apoptosis in neuronal cells and may also help
to explain the CNS side effects associated with
statin therapy.
Brantley-Finley C., Lyle C.S., Du L., Goodwin M.E., Hall T., Szwedo D., Kaushal G.P. and Cambers T.C. (2003) The JNK, ERK and p53 pathways play distinct roles in apoptosis mediated by the antitumor agents vinblastine, doxorubicin, and etoposide. Biochem. Pharmacol. 66, 459-469. Cavender C.P., Turley S.D. and Dietschy J.M. (1995) Sterol metabolism in fetal, newborn and suckled lambs and their response to cholesterol after weaning. Am. J. Physiol. 269, E331-E340.
ACKNOWLEDGMENTS
The authors thank Ricardo Argent for
his excellent technical assistance. We also
thank Mary Harper for the preparation of the
manuscript. This work has been supported by
Grants, SAF 2001-0154 from the Ministerio de
Ciencia y Tecnologia, and 2PR01B007 from
the Junta de Extremadura. M. I. Cerezo-
Guisado is supported by a Ph D fellowship
from Junta de Extremadura, Spain.
Cerezo-Guisado M.I., García-Marín L.J., Lorenzo M.J. and Bragado M.J. (2005) Lovastatin inhibits the growth and survival pathway of phosphoinositide 3-kinase/protein kinase B in immortalized rat brain neuroblasts. J. Neurochem. 94, 1277-1287. Chong P.H., Seeger J.D. and Franklin C. (2001) Clinically relevant differences between the statins: implications for therapeutic selection. Am. J. Med. 111, 390–400.
REFERENCES Darzynkiewicz Z., Bruno S., Bino G.D., Gorczyca W., Hotz M.A., Lassota P. and Traganos F. (1992) Features of apoptotic cells measured by flow cytometry. Cytometry 13, 795-808.
Bassa B.V., Roh D.D., Vaziri N.D., Kirschenbaum M.A. and Kamanna V.S. (1999) Effect of inhibition of cholesterol synthetic pathway on the activation of Ras and MAP kinase in mesangial cells. Biochim. Biophys. Acta 1449, 137-149.
Denhardt D.T. (1996) Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex signalling. Biochem. J. 318, 729-747.
Blanco-Colio L.M., Villa A., Ortego M., Hernández-Presa M.A., Pascual A., Plaza J.J and Egido J. (2002) 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase inhibitors, atorvastatin and simvastatin, induce apoptosis of vascular smooth muscle cells by downregulation of Bcl-2 expression and Rho A prenylation. Atherosclerosis 161, 17-26.
Drysdale B.E., Zacharchuk C.M. and Shin H.S. (1983) Mechanism of macrophage-mediated cytotoxicity: production of a soluble cytotoxic factor. J. Immunol. 131, 2362-2367. Blumenthal R.S. (2000) Statins: effective
antiatherosclerotic therapy. Am. Heart J. 139, 577–83.
Edison R.J. and Muenke M. (2004a) Central nervous system and limb anomalies in case reports of first-trimester statin exposure. N. Engl. J. Med. 350, 1579-1582.
Bonni A., Brunet A., West A.E., Datta S.R., Takasu M.A. and Greenberg M.E. (1999) Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and independent mechanisms. Science 286, 1358-1362.
Edison R.J. and Muenke M. (2004b) Mechanistic and epidemiologic considerations in the evaluation of adverse birth outcomes following gestational
83
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis exposure to statins. Am. J. Med. Genet. 131A, 287-298. García-Román N., Álvarez A.M., Toro M.J., Montes A. and Lorenzo M.J. (2001) Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosíntesis inhibition. Mol. Cell. Neurosci. 17, 329-341. Goldstein J.L. and Brown M.S. (1990) Regulation of the mevalonate pathway. Nature 343, 425-429. Graaf M.R., Richel D.J., van Noorden C.J.F. and Guchelarr H.J. (2004) Effect of statins and farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat. Rev. 30, 609-641. Graham T.E., Pfeiffer J.R., Lee R.J., Kusewitt D.F., Martinez A.M., Faotz T., Wilson B.S. and Oliver J.M. (1998) MEK and ERK activation in ras-disabled RBL-2H3 mast cells and novel roles for geranylgeranylated and farnesylated proteins in Fc ecpsilonRI-mediated signaling. J. Immunol. 161, 6733-6744. Hansen H.H., Briem T., Dzietko. M., et al. (2004) Mechanisms leading to disseminated apoptosis following NMDA receptor blockade in the developing rat brain. Neurobiology of Disease 16, 440-453. Hetman M. and Gozdz A. (2004) Role of extracellular signal regulated kinases 1 and 2 in neuronal survival. Eur. J. Biochem. 271, 2050-2055. Hillyard D.Z., Cameron A.J., McIntyre A.H., Hadden N.H., Marshall C. E., Johnston N. and Jardine A.G. (2002) Inhibition of proliferation and signalling mechanisms in human lymphocytes by fluvastatin. Clin. Exp. Pharmacol. Physiol. 29, 673-678. Jaster R., Brock P., Sparmann G., Emmrich J. and Liebe S. (2003) Inhibition of pancreatic stellate cell activation by the hydroxymethylglutaryl coenzyme
A reductase inhibitor lovastatin. Biochem. Pharmacol. 65, 1295-1303. Johnson M.D., Woodard A., Okediji E.J., Toms S.A. and Allen G.S. (2002) Lovastatin is a potent inhibitor of meningioma cell proliferation: Evidence for inhibition of a mitogen associated protein kinase. J, Neurooncol, 56, 133-142. Kita T., Brown M.S. and Goldstein J.L. (1980) Feedback regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase in livers of mice treated with mevilonin, a competitive inhibitor of the reductase. J. Clin. Invest. 66, 1094-1100. Koyuturk M., Ersoz M. and Altiok N. (2004) Simvastatin induces proliferation inhibition and apoptosis in C6 glioma cells via c-jun N-terminal kinase. Neurosci. Lett. 370, 212-217. Maltese W.A. and Volpe J.J. (1979) Developmental changes in the distribution of 3-hydroxy-3-methylglutaryl coenzyme A reductase among subcellular fractions of rat brain. J. Neurochem. 33, 107-115. Michikawa M. and Yanagisawa K. (1999) Inhibition of cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death. J. Neurochem. 72, 2278-2285. Mitin N., Rossman K.L. and Der C.J. (2005) Signaling interplay in ras superfamily function. Curr. Biol. 15, R563-R574. Miura S., Matsuo Y. and Saku K. (2004) Simvastatin suppresses coronary artery endotelial tube formation by disrupting Ras/Raf/ERK signaling. Atherosclerosis 175, 235-243. Muñoz A., Wrighton C., Seliger B., Bernal J. and Beug H. (1993) Thyroid hormone receptor/c-erbA: Control of commitment and differentiation in the neuronal/chromaffin progenitor line PC12. J. Cell. Biol. 121, 423-438. Nakagawa H., Mutoh T., Kumano T. and Kuriyama M. (1998) HMG-CoA reductase inhibitor-induced
84
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
Skaletz-Rorowski A., Müller J.G., Kroke A., Waltenberger J., Pulawski E., Pinkernell K. and Breithardt G. (2001) Lovastatin blocks basis fibroblast growth factor-induced mitogen-activated protein kinase signalling in coronary smooth muscle cells via phosphatase inhibition. Eur. J. Cell. Biol. 80, 207-212.
L6 myoblast cell death: involvement of the phosphatidylinositol 3-kinase pathway. FEBS Lett. 438, 289-292. Negre-Aminou P., van Leeuwen R.E., van Thiel G.C., van den IJssel P., de Jong W.W., Quinland R. A. and Cohen L. H. (2002) Differential effect of simvastatin on activation of Rac(1) vs. activation of the heat shock protein 27-mediated pathway upon oxidative stress, in human smooth muscle cells. Biochem. Pharmacol. 64, 1483–1491.
Spady D.K. and Dietschy J.M. (1983) Sterol synthesis in vivo in 18 tissues of the squirrell monkey, guinea pig, rabbit, hamster and rat. J. Lipids Res. 24, 303-315. Nishida S., Matsuoka H., Tsubaki M., Tanimori Y.,
Yanae M., Fujii Y. and Iwaki M. (2005) Mevastatin induces apoptosis in HL60 cells dependently on decrease in phosphorylated ERK. Mol. Cell. Biochem. 269, 109-114.
Takata R., Fukasawa S., Hara T., Nakajima H., Yamashina A., Yanase N. and Nizuguchi J. (2004) Cerivastatin-induced apoptosis of human aortic smooth muscle cells through partial inhibition of basal activation of extracellular signal-regulated kinases. Cardiovasc. Pathol. 13, 41-48.
Padayatty S.J., Marcelli M., Shao T.C. and Cunningham G.R. (1997) Lovastatin-induced apoptosis in prostate stromal cells. J. Clin. Endocrinol. Metabol. 82, 1434-1439.
Tanaka T., Tatsuno I., Uchida D., Moroo I., Morio H., Nakamura S., Noguchi Y., Yasuda T., Kitagawa M., Saito Y. and Hirai A. (2000) Geranylgeranyl-pirophosphate, an isoprenoid of mevalonate cascade, is a critical compound for rat primary cultured cortical neurons to protect the cell death induced by 3-hydroxy-3-methylglutaryl-CoA reductase inhibition. J. Neurosci. 20, 2852-2859.
Rabelo F.L.A., Ropert C., Ramos M.G., Bonjardim C.A., Gazzinelli R.T. and Alvarez-Leite J.I. (2003) Inhibition of ERK1/2 and CREB phosphorylation by caspase-dependent mechanism enhances apoptosis in fibrosarcoma cell line treated with butyrate. Biochem. Biophys. Res. Comm. 303, 968-972.
Villalonga P., Lopez-Alcala C., Chiloeches A., Gil J., Marais R., Bachs O. and Agell N. (2002) Calmodulin prevents activation of Ras by PKC in 3T3 fibroblasts. J. Biol. Chem. 277, 37929-37935.
Repasky G.A., Chenette E.J. and Der C.J. (2004) Renewing the conspiracy theory debate: does Raf function alone to mediate Ras oncogenesis? Trends Cell. Biol. 14, 639-647.
Walton M.R. and Dragunow M. (2000) Is CREB a key to neuronal survival? Trends Neurosci. 23, 48-53.
Riccio A., Ahn S., Davenport C.M., Blendy J.A. and Ginty D.D. (1999) Mediation by CREB family transcription factor of NGF-dependent survival of sympathetic neurons. Science 286, 2358-2361.
Wu J., Wong W.W., Khosravi F., Minden M.D. and Penn L.Z. (2004) Blocking the Raf/MEK/ERK pathway sensitizes acute myelogenous leukaemia cells to lovastatin-induced apoptosis. Cancer Res. 64, 6461-6468.
Schulz J.G., Bosel J., Stoeckel M., Megow D., Dirnagl U. and Endres M. (2004) HMG-CoA reductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate synthesis. J. Neurochem. 89:24-32.
Xia Z., Dickens M., Raingeaud J., Davis R.J. and Greenberg M.E. (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326-1331.
85
Submitted ERKs inhibition in lovastatin-induced neuronal apoptosis
86
Zhang F.L. and Casey P.J. (1996) Protein prenylation: molecular mechanisms and functional
consequences. Ann. Rev. Biochem. 65, 241-269.
CCaappííttuulloo 33
“C-Jun N-terminal protein kinase signalling pathway mediates lovastatin-induced rat brain
neuroblasts apoptosis”
Submitted JNKs activation in lovastatin-induced neuronal apoptosis C-JUN N-TERMINAL PROTEIN KINASE SIGNALLING PATHWAY MEDIATES
LOVASTATIN-INDUCED RAT BRAIN NEUROBLASTS APOPTOSIS
Maria Isabel Cerezo-Guisadoa, Alberto Álvarez-Barrientosb, Ricardo Argenta, Luis Jesús García-
Marínc, Maria Julia Bragadoa, Maria Jesús Lorenzo*a
a Departamento de Bioquímica, Biología Molecular y Genética and c Departamento de Fisiología, Universidad de
Extremadura, Facultad de Veterinaria, E-10071 Cáceres. b Unidad de Citometría, Centro Nacional de
Investigaciones Cardiovasculares, E-28029 Madrid. Spain.
ABSTRACT
We have previously shown that
lovastatin, an HMG-CoA reductase inhibitor,
induces apoptosis in rat brain neuroblasts. C-
Jun N-terminal kinase (JNK) and p38 mitogen-
activated protein kinase (MAPK) are
implicated in regulation of neuronal apoptosis.
In this work, we investigated the role of JNK
and p38 MAPK in neuroblast apoptosis
induced by lovastatin. We showed that
lovastatin induced the activation of JNK, but
not p38 MAPK. It also induced c-Jun
phosphorylation with a subsequent increase in
activator protein-1 (AP-1) binding, AP-1-
mediated gene expression and BimEL protein
levels. The effects of lovastatin were prevented
by mevalonate. Pre-treatment with iJNK-I (a
selective JNK inhibitor) prevented the effect of
lovastatin on both neuroblast apoptosis and the
activation of the JNK cascade. Furthermore,
we found that activation of JNK signalling
pathway triggered by lovastatin is
accompanied by caspase-3 activation which is
also inhibited by iJNK-I pre-treatment. Finally,
a specific inhibitor of p38 MAPK, SB203580,
had no effect on lovastatin-induced neuroblast
apoptosis. Taken together, our data suggest
that the activation of the JNK/c-Jun/BimEL
signalling pathway plays a crucial role in
lovastatin-induced neuroblast apoptosis. Our
findings may also contribute to elucidate the
intracellular mechanisms involved in the
central nervous system side effects associated
to statin therapy.
KEYWORDS: Apoptosis, statins, nervous
system, JNK, p38 MAPK, Bim
87
Submitted JNKs activation in lovastatin-induced neuronal apoptosis INTRODUCTION
A large body of evidence indicates that
the mevalonate pathway plays an important
role in cell growth [1, 2]. Mevalonate is
intracellularly synthesized from 3-hydroxy-3-
methylglutaryl coenzyme A (HMG-CoA), and
this process is catalyzed by HMG-CoA
reductase, the rate-limiting enzyme in this
pathway [2]. Mevalonate metabolism yields a
series of isoprenoid compounds which are
incorporated into cholesterol, isopentenyl
adenine, prenylated proteins, and other end-
products essential for cell growth and survival
[2, 3]. Competitive inhibitors of HMG-CoA
reductase (statins), such as lovastatin,
simvastatin, atorvastatin, cerivastatin,
pravastatin and fluvastatin, not only block the
biosynthesis of mevalonate but, in addition,
inhibit the proliferation and induce apoptosis
of both normal and tumour cells [4-12].
HMG-CoA reductase activity [13] and
cholesterol biosynthesis [14, 15] are very high
in the early phase of the ontogenetic
development of the brain. These data indicate
that the mevalonate pathway is essential to
ensure normal growth, differentiation and
maintenance of neuronal tissues. In agreement
with this, recent reports show that the
inhibition of this biosynthetic pathway during
gestation by statin exposures are associated
with severe central nervous system (CNS)
defects [16, 17]. On the other hand, studies in
vitro show that statins have neurotoxic effects
on primary neuronal cultures of cerebral cortex
[18-20]. Moreover, we have also shown that
lovastatin induces apoptosis of immortalized
rat brain neuroblasts [21].
Apoptosis plays an important role
during neuronal development and in the
homeostasis of the adult nervous system [22,
23]. However, abnormal neuronal apoptosis
contributes to the onset and progression of
several neurodegenerative diseases [24].
Consequently, elucidation of molecular
mechanisms that regulate neuronal apoptosis is
important in order to develop drugs to prevent
and treat these disorders. Several studies have
implicated the stress-activated protein kinase
c-Jun N-terminal protein kinase (JNK) and p38
mitogen activated protein kinase (MAPK)
pathways as key regulators of neuronal
apoptosis [25, 26]. Experiments with cerebellar
granule neurons, pheochromocytoma 12
(PC12) cells and sympathetic neurons cultured
in vitro, have demonstrated that activation of
JNK or p38 MAPK can promote apoptosis
following survival-factor withdrawal [27-30]
and, ceramide [31], glutamate [30],
anandamide [32], cadmium [33] and arsenite
[34] exposure. Nevertheless, other studies fail
to implicate these kinases in neuronal
apoptosis [35-37] and demonstrate that JNK
and p38 MAPK are implicated in promoting
neuronal survival [38] and differentiation [39,
40].
c-Jun, a well-known downstream
target of activated JNK and one of substrates
of p38 MAPK, has been also implicated in
neuronal apoptosis [41]. c-Jun phosphorylation
is necessary for apoptosis induced by survival
signal withdrawal and potassium deprivation in
cerebellar granule neurons, sympathetic
neurons and PC12 cells [42-44]. c-Jun
activation is also implicated in neuronal
apoptosis induced by several insults [9, 28, 30,
88
Submitted JNKs activation in lovastatin-induced neuronal apoptosis 31, 33, 34, 41]. c-Jun is a part of the larger AP-
1 transcription factor family which mediates an
immediate-early gene response following
cellular exposure to external stimuli [41]. AP-1
is also involved in the increased expression of
pro-apoptotic proteins, such as Bax, Fas-L and
Bim [28, 45]. Thus, c-Jun appears to
participate in both internal and external
apoptotic pathways. Bim is a member of the
BH3-only Bcl-2 family that plays an important
role in neuronal apoptosis. Developmentally
regulated neuronal apoptosis is delayed in mice
in which the Bim gene is disrupted, suggesting
a critical role for Bim in neuronal cell death.
Moreover, it has been shown that the apoptotic
stimuli of growth factor and neuronal activity
withdrawal induce Bim transcription in
sympathetic and cerebellar granule neurons, in
part through the JNK-mediated
phosphorylation and activation of c-Jun. The
activation of Bim seems to depend on cell type
neurons [45-46].
Statins are widely used in the treatment
of hypercholesterolemia. As it has been
previously mentioned, antiproliferative and
apoptotic effects of statins have been observed
in several experimental systems [4-12, 18-21].
These pleiotropic effects of statins are thought
to be mediated by their ability to block the
biosynthesis of isoprenoids intermediates of
cholesterol pathway, such as farnesyl
pyrophosphate and/or geranylgeranyl
pyrophosphate which serve as lipid
attachments for the small GTP-binding
proteins Ras, Rho and Rac [2]. This post-
translational prenylation step (either
farnesylation or geranylgeranylation) is
required both for membrane association and
cell signalling, leading to cell survival and
proliferation [2, 47]. Although recent studies
have shown that statins inhibit both small
GTP-binding protein prenylation and
activation in different neuronal cells [19-21],
the molecular mechanisms by which statins
induce neuronal apoptosis are not well
understood. The aim of the present work was
to investigate the role of both the JNK and p38
MAPK signalling pathways in mediating
lovastatin-induced neuronal apoptosis. A
spontaneously immortalized rat brain
neuroblast cell line was used in this study.
Here we report that lovastatin induces
neuroblast apoptosis through activation of the
JNK/c-Jun/Bim signalling pathway.
EXPERIMENTAL PROCEDURES
Reagents and antibodies
Lovastatin (Mevinolin, MK-803) was
from Calbiochem (San Diego, CA, USA). The
inactive lactone of lovastatin was converted to
the active form as previously described [48].
Mevalonic acid was purchased from Sigma-
Aldrich, (St. Louis, MO, USA). Ham’s F-12
medium, fetal calf serum, L-glutamine,
streptomycin, penicillin and trypsin/EDTA
solution were from PAN Biotech (Aidenbach,
Germany, Europe). Tissue culture flasks and
dishes were from TPP (Trasadingen,
Switzerland, Europe). JNK inhibitors
(SP600125 and JNK inhibitor I), and p38
MAPK inhibitor (SB203580), were from
Calbiochem (San Diego, CA, USA). p38
MAPK inhibitor (BIRB796) was kindly
provided by Dr. Ana Cuenda (Departamento
de Bioquimica y Biologia Molecular,
Universidad de Extremadura, Caceres, Spain).
89
Submitted JNKs activation in lovastatin-induced neuronal apoptosis Complete protease inhibitor cocktail tablets
were from Roche Molecular Biochemicals
(Indianapolis, IN, USA). Glutathione-
Sepharose 4B was from Pharmacia (Freiburg,
Germany). p38 MAPK (sc-535) antibody was
from Santa Cruz Biotechnology (Santa Cruz,
CA, USA) and phospho-p38 MAPK (Thr
180/Tyr 182) was kindly provided by Dr. Ana
Cuenda. c-Jun antibody (610326) was from
BD Biosciences Pharmigen (San Diego, CA,
USA) and phospho-c-Jun (Ser 63, 06-828)
antibody was from Upstate Biotechnology
(Lake Placid, NY, USA). SAPK/JNK (9252)
and active form caspase 3 (9665) antibodies
were from Cell Signaling Technology
(Beverly, MA, USA). BimEL (202000)
antibody was from Calbiochem (San Diego,
CA, USA). Glyceraldehyde 3-phosphate
dehydrogenase (GAPDH, RDI-TRK5G4-6C5;
Fitzgerald Inc.; Concord, MA, US ) antibody
was used to verify the equal loading of protein
across lanes. Goat anti-rabbit (31460) and goat
anti-mouse (31430) conjugated to horseradish
peroxidase were from Pierce (Rockford, IL,
USA). Other reagents were obtained from
different commercial sources and were of the
highest purity available.
Cell cultures and treatments
Spontaneously immortalized rat brain
neuroblasts were used in this study. This cell
line was obtained by spontaneous
immortalization from cultures of 17-day fetal
rat cerebral cortices and was kindly provided
by Dr. Alberto Muñoz (Instituto de
Investigaciones Biomédicas, CSIC, Madrid,
Spain). The cells represented primitive
neuroblasts that expressed NF 68 and the
primitive neuronal marker nestin, but lacked
the astrocyte marker, glial fibrillary acidic
protein (GFAP). After partial differentiation
induction with dibutyryl –cAMP, the cells
expressed further neuronal markers such as NF
145, NF 220, and neuron-specific enolase [49].
Cells were grown in Ham’s F-12 supplemented
with 10% fetal calf serum (FCS), L-glutamine
(2 mM), streptomycin (100 µg/ml) and
penicillin (100 U/ml). Cells were seeded at 5 x
105 in 75-cm2 tissue culture flask and
incubated at 37ºC under a 5% CO2/95% air
atmosphere.
Confluent cells were trypsinized and
seeded in tissue culture dishes at a density of 2
x 104 cells/cm2. After 24 h, the medium was
aspirated and replaced with fresh medium
alone or containing the indicated
concentrations of lovastatin, mevalonate,
SP600125, JNK inhibitor I (iJNK-I),
SB203580 or BIRB796 and the incubation was
continued for a further 6 h or 24 h. Cells were
incubated with JNK and p38 MAPK inhibitors
for 1h before lovastatin addition. For the time
course experiments, cells were incubated with
10 µM lovastatin for different periods of time.
JNK kinase activity assay
To assay for total JNK activity (JNK1-
3), a JNK capture assay was performed.
Glutathione-S-transferase (GST)-c-Jun (1-79)
was used as substrate. Neuroblasts were seeded
in 100 mm tissue culture dishes and after
indicated treatments, cells were harvested in
phosphate-buffered saline (PBS) and lysed for
15 min in ice-cold lysis buffer containing 20
mM Tris-HCl, pH 7.5, 150 mM KCl, 1 mM
EDTA, 10% (v/v) glycerol, 1% (v/v) Triton X-
90
Submitted JNKs activation in lovastatin-induced neuronal apoptosis 100, 500 µM Na3VO4, 5 mM NaF and 4 µg/ml
complete protease inhibitor cocktail. Lysates
were cleared by centrifugation at 20000 g for
15 min at 4 ºC and protein concentrations in
the supernatants were determined by using the
Bio-Rad protein assay, according to the
instructions of the manufacturer. Cell extract
proteins (200 µg) were incubated with GST-c-
Jun (1-79), previously immobilized on
Glutathione-Sepharose 4B beads, for 1 h at 4
ºC. After centrifugation at 20000 g for 1 min at
4ºC, beads were washed four times in washing
buffer (20 mM Tris-HCl pH 7.5, 50 mM NaCl,
2,5 mM MgCl2, 0,1 mM EGTA, 0.05% (v/v)
Triton X-100, 0.1% (v/v) 2-mercaptoethanol
and 1 mM Na3VO4) and once in the reaction
buffer (25 mM Tris-HCl pH 7.5, 20 mM ß-
glycerophosphate, 10 mM MgCl2, 0,1 mM
EGTA, 0,5 mM NaF and 1 mM Na3VO4).
Precipitates were incubated with 5 µCi of [γ-32P] ATP in the reaction buffer for 20 min at
30 ºC. The kinase reaction was terminated by
the addition of Laemmli sample buffer. In
some experiments, iJNK-I was added 20 min
prior to the start of reaction. Phosphorylated
[32P] GST-c-Jun (1-79) was detected by
autoradiography after it was resolved on 10 %
SDS-PAGE gels.
Western blot analysis
Treated and control cells were
harvested in PBS and lysed for 15 min in ice-
cold lysis buffer containing 50 mM HEPES
(pH 7.5), 150 mM NaCl, 1% Triton X-100,
10% glycerol, 5 mM MgCl2, 25 mM NaF, 10
mM sodium pyrophosphate, 1 mM EGTA,
500µM Na3VO4 and 4 µg/ml complete
protease inhibitor cocktail. After lysis, cell
debris was removed by centrifugation at 20000
g for 10 min at 4 ºC and protein concentrations
determined in the supernatants as indicated
above. Equal amounts of protein (20 µg) were
separated on 10 % SDS-PAGE and blotted
onto PVDF membranes (PolyScreen, NEN life
Science Products, Inc. Boston, MA, USA). The
membranes were then blocked with 5% non-fat
dry milk or 3 % BSA in Tris-buffered saline
(pH 7.5) containing 0.5% tween 20 and
incubated with appropriate primary and
horseradish peroxidase (HRP)-conjugated
secondary antibodies in antibody buffer [5%
non-fat dry milk or 3 % BSA in Tris-buffered
saline (pH 7.5) containing 0.05% tween 20
(TBS-T)]. After required washes with TBS-T,
proteins were analyzed using an enhanced
chemiluminescence detection system
(SuperSignal West Pico Chemiluminescent
Substrate, Supersignal West Dura Extended
Duration Substrate or Supersignal West Femto
Maximum Sensitivity Substrate, Pierce,
Rockford, IL, USA) and exposed to hyperfilm-
ECL (Amersham, Pharmacia Biotech,
Freiburg, Germany). Films were photographed
and the intensity of each band was analyzed
using a ChemiDoc System (Documentation
and Analysis System, Bio-Rad, Hercules, CA,
USA). Results were expressed as percentage of
control.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared using
the MBLTM “Nuclear/Cytosol Fractionation”
Kit (Woburn, MA, USA) according to
manufacturer's instructions. Double-stranded
oligonucleotide containing consensus
sequences for AP-1 (5'-
91
Submitted JNKs activation in lovastatin-induced neuronal apoptosis tgcaCGCTTGATGACTCAGCCGGAA-3´)
were labelled by using Klenow polymerase and
[α32P]dCTP. Nuclear extracts containing 10 µg
protein were incubated with 1 µg of
poly(dIdC)-poly(dIdC) and labelled
oligonucleotides (200000 cpm) in reaction
buffer [20 mM HEPES p.H 8, 1 mM EDTA,
50 mM NaCl, 1 mM DTT, 1% glycerol and
1mM MgCl2] for 20 min at room temperature.
For competition studies and supershift test,
nuclear extracts were preincubated with a 100-
fold excess of both unlabelled AP-1 or NFκB
probe (5´-
tcgaAGTTGAGGGGACTTTCCCAGGC-3´),
or 1 µg of c-Jun, c-Fos and CREB antibodies
for 10 min at room temperature prior to
addition of labelled probe. Samples were
electrophoresed on a non-denaturin 6%
polyacrylamide gel. Gels were fixed, vacuum
dried and exposed to x-ray film.
Luciferase reporter construct and assay
The control β-galactosidase construct
was pSV- β-Galactosidase (Promega). To
construct the AP-1 and SRE response elements
luciferase reporter, the SV40 promoter in the
vector pGL3-promoter (Promega) was excised
with BglII and Hind III and replaced by a
minimal HSV TK promoter (obtained by PCR
amplification) containing nucleotides – 109 to
+ 17 flanked by BglII and Hind III sites. A
double stranded oligonucleotide containing the
AP-1 response element from the somatostatin
promoter (GTGACATCAT) and the serum
response element (SRE) from the c-Fos
promoter
(AGGATGTCCATATTAGGACATC) flanked
by Asp718 and BglII sites was then cloned into
these vectors (pGL3-AP-1 and pGL3-SRE).
Neuroblasts were co-transfected with 1 µg of
pGL3-AP-1 or 1 µg of pGL3-SRE and 1 µg of
β-Galactosidase reporter vector using
GenePORTER transfection reagent (Genlantis,
San Diego, CA, USA), as recommended by the
manufacturer. Following transfection the cells
were incubated for 24 h, the medium was
exchanged, and the cells were incubated for an
additional 24 h with 10 µM lovastatin in the
presence or absence of 100 µM mevalonate.
The cells were then lysed and luciferase and β-
galactosidase assays performed using Promega
reagents as recommended by the manufacturer.
Luciferase activity was normalized to β-
galactosidase activity. Results were expressed
as percentage of control.
Cell and Nuclei Morphology Analysis
Cell and nuclei morphology was study
using Axiovert 200 fluorescence microscope
(Carl Zeiss, Jena), equipped with Axioscam
HRc CCD (Zeiss). After treatment, cells were
washed in PBS and fixed in 70% ethanol for 5
min at room temperature. After washing the
cells with PBS, they were incubate in PBS
containing 1 mg/ml of RNase A for 15 min at
37ºC and stained with 50 µM propidium iodide
(PI) for 30 min at room temperature. Images
were acquired using transmitted light and
green excitation filter and fluorescence
emissions were detected through 590 nm LP
filter. Images were acquired using Axiovision
4.3 (Zeiss). Image analysis software (Laserpix,
Bio-Rad) was used to count total and apoptotic
nuclei by thresholding on 8 bits grey-scale
images. Apoptotic nuclei characterizes by their
92
Submitted JNKs activation in lovastatin-induced neuronal apoptosis higher PI fluorescence due to higher chromatin
condensation, therefore different thresholding
were used to count apoptotic nuclei. Data are
mean from 3 different experiments.
Cell viability assay
Cell viability was evaluated by the
crystal violet method. For these experiments
35 mm tissue culture dishes were used. At the
end of each treatment, the medium was
discarded, and the remaining viable adherent
cells were stained with crystal violet (0.03% in
2% ethanol) for 5 min. Dishes were rinsed with
tap water and 1 ml of 1% sodium dodecyl
sulfate was added to each plate to solubilize
the stained cells. The absorbance of each plate
was read at 560 nm. Dishes without cells were
processed in parallel to correct the nonspecific
adhesion of crystal violet to the plastic. Viable
cells were calculated as percentage of
absorbance with respect to untreated cells.
DNA Fragmentation Assay
Neuroblasts were plated on 100 mm
culture dishes. After indicated treatments,
floating cells were harvested by centrifugation
at 20000 g for 1 min and adherent cells were
detached mechanically with a rubber
policeman. Adherent and floating cells were
mixed, washed twice in ice-cold PBS and lysed
in lysis buffer [10 mM Tris (pH 7.4), 5 mM
EDTA and 0.5 % Triton X-100) for 60 min at
4ºC with agitation. After centrifugation at
20000 g for 30 min at 4ºC, supernatants were
incubated with RNase A (0.1 mg/ml) at 37ºC
for 45 min and then with Proteinase K (0.2
mg/ml) with 0.5% SDS solution at 37ºC for 45
min. Soluble DNA was then isolated by
phenol-chloroform-isoamylalcohol extraction
and ethanol precipitation. DNA was collected
by centrifugation at 20000 g for 20 min,
dissolved in autoclaved water and resolved on
2% agarose-0.1 µg/ml ethidium bromide gels
in TBE buffer [80 mM Tris-borate (pH 8.0), 2
mM EDTA]. DNA fragments were visualized
under ultraviolet light and photographed using
a ChemiDoc System (Documentation and
Analysis System, Bio-Rad, USA).
Analysis of Nuclear DNA Content by Flow
Cytometry
The ploidy determination of
neuroblasts was estimated by flow cytometry
DNA analysis. For these experiments 100 mm
tissue culture dishes were used. After culture
under the indicated conditions, adherent cells
were detached from dishes by the addition of a
trypsin-EDTA solution. They were mixed with
non-adherent cells and washed twice in ice-
cold PBS without Ca2+ and Mg2+. Cells were
resuspended in ice-cold 70% ethanol and fixed
for 5 min. After centrifugation at 500 g for 5
min, cells were resuspended in PBS containing
1 mg/ml of RNAsa A and incubated at 37ºC
for 30 min. Cells were stained with 50 µg/ml
propidium iodide for 30 min at room
temperature and then flow cytometry analysis
was done. DNA content per nucleus was
evaluated in a CyAn MLE flow cytometer
(DAKO, Gostrup, Denmark). This analysis
was performed using a doublet discriminator
system, which distinguishes between the
signals coming from a single nucleus and the
ones produced by two or more aggregated
nuclei. For the computer analysis, only signals
from single cells were considered (10000
93
Submitted JNKs activation in lovastatin-induced neuronal apoptosis cells/sample). This method of analysis of DNA
content permits the identification and
quantification of apoptotic cells, as revealed by
peak localized below the G0/G1 peak.
Statistical analysis
Each experiment was repeated at least
three times, with good agreement among the
results of individual experiments. All data are
expressed as the mean ± standard error of the
mean. Results were analyzed by one-way
analysis of variance (ANOVA) followed by
Student´s t test. P values of less than 0.05 were
considered significant.
RESULTS
Lovastatin activates JNK but not p38
MAPK in rat brain neuroblasts
We have previously shown that
lovastatin induced apoptosis of rat brain
neuroblasts in a dose- and time-dependent
manner [21]. It is well known that JNK and
p38 MAPK are involved in neuronal apoptosis
triggered by a variety of stimuli and
withdrawal of growth factors [25-34].
Therefore, in the present work we first studied
whether changes in the activity of these
kinases contributed to lovastatin-induced
apoptosis in rat brain neuroblasts. To clarify
this issue, time course and concentration-
dependent experiments were done and JNK
activation was analyzed by a capture assay
using GST-c-Jun (1-79) as substrate. The
activity of p38 MAPK was studied by Western
blotting using antibodies that specifically
recognize the dually phosphorylated
(Thr180/Tyr182) catalytically active form of
this kinase.
GST-c-Jun→
JNK-1→
P-GST-c-Jun→
GST-c-Jun→
JNK-1→
P-GST-c-Jun→
0
100
200
300
LovMev
--
++
-+
+-
JNK
act
ivity
(% o
fcon
trol
) **
ns ns
GST-c-Jun→
JNK-1→
P-GST-c-Jun→
0
100
200
300
400
0 10 201Lovastatin (µM)
JNK
act
ivity
(% o
fcon
trol
)
**
**
ns
0
250
500
750
1000
0 1 3 6 12 24Time (h)
JNK
act
ivity
(% o
fcon
trol
)
****
*
*
*
A
B
C
GST-c-Jun→
JNK-1→
P-GST-c-Jun→
GST-c-Jun→
JNK-1→JNK-1→
P-GST-c-Jun→
0
100
200
300
LovMev
--
++
-+
+-
JNK
act
ivity
(% o
fcon
trol
)
0
100
200
300
LovMev
--
++
-+
+-
0
100
200
300
LovMevLovMev
--
++
-+
+-
JNK
act
ivity
(% o
fcon
trol
) **
ns ns
GST-c-Jun→
JNK-1→
P-GST-c-Jun→
0
100
200
300
400
0 10 201Lovastatin (µM)
JNK
act
ivity
(% o
fcon
trol
)
**
**
ns
0
250
500
750
1000
0 1 3 6 12 24Time (h)
JNK
act
ivity
(% o
fcon
trol
)
****
*
*
*
0
250
500
750
1000
0 1 3 6 12 24Time (h)
JNK
act
ivity
(% o
fcon
trol
)
0
250
500
750
1000
0 1 3 6 12 24Time (h)
JNK
act
ivity
(% o
fcon
trol
)
****
*
*
*
A
B
C
Figure 1. Effect of lovastatin on JNK activation. A: Time-dependent effect: Neuroblasts initially cultured for 24 hours in Ham´s F12/10% FCS were incubated in culture media alone or with 10 µM lovastatin for different periods of time. B: Concentration-dependent effect: cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated for an additional 24 hours in the presence of media alone (0) or various concentrations of lovastatin. C: Effect of mevalonate treatment: Cells initially cultured for 24 hours in Ham´s F12/10% FCS were incubated with lovastatin (Lov 10 µM) in absence or presence of mevalonate (Mev 100 µM) for an additional 24
94
Submitted JNKs activation in lovastatin-induced neuronal apoptosis hours. Control cells were incubated in presence of media or mevalonate alone. At the end of each experiment, JNK activation was measured by a JNK capture assay using GST-c-Jun (1-79) as substrate. An aliquot of each lysate was also loaded in another gel to analyze total JNK protein levels. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; compared to untreated cells.
Time course experiments showed that in
comparison to the control cells grown in 10%
FCS media, lovastatin (10 µM) increased JNK
activation in a time dependent manner (Fig.
1A). The lovastatin effect started to be
significant after 1 hour of treatment and was
markedly elevated 24 hours after lovastatin
treatment. JNK activation occurred before
induction of apoptosis that started to be
significant after 12 hours of lovastatin
treatment [21]. Additionally, neuroblasts were
treated with increasing concentrations of
lovastatin for 24 hours and as shown in Fig.
1B, JNK activation increased in a
concentration-dependent manner after
lovastatin treatment, reaching the maximum
effect at a concentration of 10 µM. In order to
know whether the lovastatin effect on JNK
activation was specific of HMG-CoA
reductase inhibition, cells were incubated with
lovastatin (10 µM) in presence or absence of
mevalonate (100 µM) for 24 h. Co-treatment
with mevalonate prevented the incresed in JNK
activation induced by lovastatin (Fig. 1C).
Treatment of cells with mevalonate alone did
not modify JNK activation. Levels of both
GST-c-Jun (1-79) and JNK-1 proteins did not
change throughout the experiments (Fig. 1),
suggesting that JNK activation was specifically
affected by lovastatin exposure. In contrast,
despite de high level of p38 MAPK
phosphorylation detected in control conditions,
treatment with lovastatin did not modulate the
levels of phosphorylation of this kinase in rat
brain neuroblasts at any time tested (Fig. 2).
Ours results suggest that the JNK, but
not the p38 MAPK, signalling pathway was
activated in neuroblasts after lovastatin
treatment and that activated JNK may be
related to the molecular machinery preceding
neuroblast apoptosis induced by lovastatin.
igure 2. Effect of lovastatin on p38 MAPK phosphorylation. euroblasts initially cultured for 24 hours in Ham´s F12/10%
ovastatin increases c-Jun phosphorylation,
scription
factor
course experiments (Fig. 3A) showed that
P-p38 MAPK→
p38 MAPK→
0 1 3 6 12 24Time (h)
P-p38 MAPK→
p38 MAPK→
0 1 3 6 12 24Time (h)
FNFCS were incubated in culture media alone or with 10 µM lovastatin for different periods of time. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using an anti-phospho-p38 MAPK specific antibody. As a control of the amount of protein, total p38 MAPK were also analyzed in the same samples. A representative blot is shown.
L
AP-1 activation and AP-1-mediated gene
expression in rat brain neuroblasts
c-Jun is an inducible tran
whose activity is modulated by
phosphorylation at the trans-activation domain
by JNK. Phosphorylation of c-Jun results in its
stabilization, as well as its enhanced DNA
binding and transcriptional activation.
Activation of c-Jun regulates transcription of
several genes involved in apoptosis [41-44].
Therefore, we next examined both the
phosphorylation and protein levels of c-Jun by
Western blot using anti-phospho-(Ser-63) c-
Jun and c-Jun antibodies, respectively. Time
95
Submitted JNKs activation in lovastatin-induced neuronal apoptosis
Figure 3. Effect of lovastatin on both c-Jun phosphorylation and protein levels. A: Time-dependent effect. B: Concentration-
P-c-Junc-Jun
0 1 3 6 12 24Time (h)
0
50
100
150
200** **
***
ns
***
**
**
ns
*
c-Jun→
GAPDH→
0
250
500
750
1000
Lovastatin (µM)0 10 201
P-c-Junc-Jun
Arb
itrar
yU
nits
(% o
fcon
trol
)
**
*
**
*** *
P-c-Jun→
c-Jun→
GAPDH→
Arb
itrar
yU
nits
(% o
fcon
trol
)
P-c-Junc-Jun
0
400
800
1200
Arb
itrar
yU
nits
(% o
fcon
trol
)
**
***
ns*** ns ns
LovMev
--
++
-+
+-
P-c-Jun→
c-Jun→
GAPDH→
B
C
P-c-Junc-Jun
0 1 3 6 12 24Time (h)
0
50
100
150
200** **
***
ns
***
**
**
ns
*
P-c-Junc-JunP-c-Junc-Jun
0 1 3 6 12 24Time (h)
0
50
100
150
200** **
***
ns
***
**
**
ns
*
0 1 3 6 12 24Time (h)
0 1 3 6 12 24Time (h)
0
50
100
150
200** **
***
ns
***
**
**
ns
*
0
50
100
150
200** **
***
ns
***
**
**
ns
*
c-Jun→
GAPDH→
c-Jun→c-Jun→
GAPDH→GAPDH→
0
250
500
750
1000
Lovastatin (µM)0 10 201
P-c-Junc-Jun
Arb
itrar
yU
nits
(% o
fcon
trol
)
**
*
**
*** *
0
250
500
750
1000
0
250
500
750
1000
Lovastatin (µM)0 10 201
P-c-Junc-JunP-c-Junc-Jun
Arb
itrar
yU
nits
(% o
fcon
trol
)
**
*
**
*** *
P-c-Jun→
c-Jun→
GAPDH→
P-c-Jun→P-c-Jun→
c-Jun→c-Jun→
GAPDH→GAPDH→
Arb
itrar
yU
nits
(% o
fcon
trol
)
P-c-Junc-JunP-c-Junc-Jun
0
400
800
1200
Arb
itrar
yU
nits
(% o
fcon
trol
)
**
***
ns*** ns ns
LovMev
--
++
-+
+-
0
400
800
1200
Arb
itrar
yU
nits
(% o
fcon
trol
)
**
***
ns*** ns ns
**
***
ns*** ns ns
LovMev
--
++
-+
+-
LovMevLovMev
--
++
-+
+-
P-c-Jun→
c-Jun→
GAPDH→
P-c-Jun→P-c-Jun→
c-Jun→c-Jun→
GAPDH→GAPDH→
B
C
deww
pendent effect. C: Effect of mevalonate treatment. Neuroblasts ere treated as described in Fig. 1 but concentration-dependent
d to an increase in both the phosphorylation
um
other
membe
ndent effect. C: Effect of mevalonate treatment. Neuroblasts ere treated as described in Fig. 1 but concentration-dependent
d to an increase in both the phosphorylation
um
other
membe
and expression of c-Jun that was significant at
1 hour after treatment and got a peak level
after 3 hours. Phosphorylation and protein
levels of c-Jun decreased under control level
when lovastatin exposure was prolonged to 24
hours. As shown in Fig. 3B, the treatment with
lovastatin for 6 hours also induced an increase
in both the phosphorylation and expression of
c-Jun in a concentration-dependent manner
with respect to untreated control cells. The
effect of lovastatin was evident at a
concentration of 1 µM reaching the maxim
and expression of c-Jun that was significant at
1 hour after treatment and got a peak level
after 3 hours. Phosphorylation and protein
levels of c-Jun decreased under control level
when lovastatin exposure was prolonged to 24
hours. As shown in Fig. 3B, the treatment with
lovastatin for 6 hours also induced an increase
in both the phosphorylation and expression of
c-Jun in a concentration-dependent manner
with respect to untreated control cells. The
effect of lovastatin was evident at a
concentration of 1 µM reaching the maxim
P-c-Jun→A
P-c-Jun→P-c-Jun→P-c-Jun→A
effect at 10 µM. Co-treatment with mevalonate
(100 µM) partially prevented the increase in c-
Jun phosphorylation induced by lovastatin. In
contrast, the increase in the protein levels of c-
Jun induced by lovastatin was fully prevented
by mevalonate. Treatment of cells with
mevalonate alone did not significantly modify
c-Jun phosphorylation and expression (Fig.
3C). Lovastatin effects on c-Jun
phosphorylation and expression were specific
as the protein levels of GAPDH remained
unchanged throughout the experiments.
Activated c-Jun functions either as a
homodimer or as a heterodimer with
effect at 10 µM. Co-treatment with mevalonate
(100 µM) partially prevented the increase in c-
Jun phosphorylation induced by lovastatin. In
contrast, the increase in the protein levels of c-
Jun induced by lovastatin was fully prevented
by mevalonate. Treatment of cells with
mevalonate alone did not significantly modify
c-Jun phosphorylation and expression (Fig.
3C). Lovastatin effects on c-Jun
phosphorylation and expression were specific
as the protein levels of GAPDH remained
unchanged throughout the experiments.
Activated c-Jun functions either as a
homodimer or as a heterodimer with
rs of the Jun, Fos or ATF families to
bind activator protein-1 (AP-1) sequence
elements within the promoters of a variety of
genes [41]. Therefore, we next studied the
effect of lovastatin on AP-1 DNA-binding
activity by EMSA. Exposure of neuroblasts to
10 µM lovastatin caused an increase in the
activity of AP-1 in a time-dependent manner
(Fig. 4A). The elevation was significant at 1
hour and progressively increased for at least 3
hours after lovastatin treatment.
rs of the Jun, Fos or ATF families to
bind activator protein-1 (AP-1) sequence
elements within the promoters of a variety of
genes [41]. Therefore, we next studied the
effect of lovastatin on AP-1 DNA-binding
activity by EMSA. Exposure of neuroblasts to
10 µM lovastatin caused an increase in the
activity of AP-1 in a time-dependent manner
(Fig. 4A). The elevation was significant at 1
hour and progressively increased for at least 3
hours after lovastatin treatment.
and mevalonate effects were analyzed 6 hours after lovastatin treatment. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using anti-phospho-c-Jun and anti-c-Jun specific antibodies. As a control of the amount of protein, total GAPDH was also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.
treatment of neuroblasts with 10 µM lovastatin
and mevalonate effects were analyzed 6 hours after lovastatin treatment. At the end of each experiment, cells were lysed and total proteins (20 µg/lane) were separated by SDS-PAGE and analyzed by Western blotting using anti-phospho-c-Jun and anti-c-Jun specific antibodies. As a control of the amount of protein, total GAPDH was also analyzed in the same samples. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.
treatment of neuroblasts with 10 µM lovastatin
lele
96
Submitted JNKs activation in lovastatin-induced neuronal apoptosis
Fi ffect of mevalonate treatme E SA using an
P-1 specific oligonucleotide as described in Material and Methods. D: Specificity and supershift of lovastatin-induced AP-1 activation. uclear extract from lovastatin-treated cells (10 µM, 6 hours) were preincubated with 100-fold excess of unlabelled AP-1 or NFκB double-
P-1 gradually decreased under basal levels at
24 hour
consensus oligonucleotide, but remained
unaffec
ression; we next performed the
A BA B
gure 4. Effect of lovastatin on AP-1 activation. A: Time-dependent effect. B: Concentration-dependent effect. C: Ent. Neuroblasts were treated as described in Fig. 3. After treatment, nuclear extracts were prepared and assayed by
AP-1→
AP-1→
C D
*
*
*
0
100
200
300
400
0 10 201Lovastatin (µM)
AP-
1 ac
tivity
(% o
fcon
trol
)
0
50
100
150
200
250*
LovMev
--
++
-+
+-
AP-
1 ac
tivity
(% o
fcon
trol
)
AP-1→
AP-
1 ac
tivity
(% o
fcon
trol
)
0
40
80
120
160
200
**
**
****
***
0 1 3 6 12 24Time (h)
AP-1→
1 µg
CR
EB
1 µg
c-F
os
1 µg
c-J
un
NF-κB
AP-
1
cont
rol
ns ns
AP-1→AP-1→
AP-1→AP-1→
C D
*
*
*
0
100
200
300
400
0 10 201Lovastatin (µM)
AP-
1 ac
tivity
(% o
fcon
trol
)
*
*
*
*
*
*
0
100
200
300
400
0
100
200
300
400
0 10 201Lovastatin (µM)
0 10 201Lovastatin (µM)
AP-
1 ac
tivity
(% o
fcon
trol
)
0
50
100
150
200
250*
LovMevLovMev
--
++
-+
+-
AP-
1 ac
tivity
(% o
fcon
trol
)
AP-1→
AP-
1 ac
tivity
(% o
fcon
trol
)
0
40
80
120
160
200
**
**
****
***
0 1 3 6 12 24Time (h)
AP-
1 ac
tivity
(% o
fcon
trol
)
0
40
80
120
160
200
0
40
80
120
160
200
**
**
****
***
**
**
****
***
0 1 3 6 12 24Time (h)
0 1 3 6 12 24Time (h)
AP-1→
1 µg
CR
EB
1 µg
c-F
os
1 µg
c-J
un
NF-κB
AP-
1
cont
rol
ns ns
MANstranded oligonucleotides or 1 µg of c-Jun, c-Fos and CREB antibodies for 10 min at room temperature prior to addition of labelled AP-1 probe. A representative blot of each experiment is shown with the densitometric analysis corresponding to the mean ±SE of at least three independent experiments. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells.
After the first increase, the activity of
active phosphorylated form of c-Jun
A
s of treatment. As shown in Fig. 4 B,
lovastatin treatment for 6 hours also increased
AP-1 activity in a concentration-dependent
manner. Mevalonate (100 µM) prevented the
increase in the activity of AP-1 induced by
lovastatin, indicating that the lovastatin effect
was specific (Fig. 4C). Treatment of
neuroblasts with mevalonate alone did not
affect AP-1 activity. In all the experiments, the
activity of AP-1 paralleled the increase in the
(Fig. 3). As shown in Fig. 4C, AP-1 activity
was abolished by the addition of excess AP-1
ted in the presence of the NFκB
consensus site. Supershift experiments showed
that c-Jun and c-Fos were present in the AP-1
complex.
To determinate whether the increase in
AP-1 activity induced by lovastatin was
associated with an increase in AP-1-mediated
gene exp
97
Submitted JNKs activation in lovastatin-induced neuronal apoptosis luciferase reporter gene assay. As shown in
Fig. 5A, the incubation of the AP-1-plasmid
containing cells with 10 µM lovastatin resulted
in an increase in luciferase expression. The
effect of lovastatin on AP-1-mediate gene
expression was specific because as it is shown
in Fig. 5 B, lovastatin decreased SRE-mediate
luciferase expression. Again, co-treatment with
mevalonate prevented the effect of lovastatin
and completely restored AP-1-mediated gene
expression to control levels (Fig. 5A).
pGL3-AP-1
200
**)
A pGL3-AP-1
200
**)
pGL3-AP-1
200
**)
200
**)
A
Fan
i 1-
β-
ol lls were incubated in presence of media or mevalonate alone.
t role
the transcription of several pro-apoptotic
[28, 45, 46]. Of the three
major
150ns ns
trol
gure 5. Effect of lovastatin on transcription from the AP-d SRE-response element. Neuroblasts initially cultured for hours in Ham´s F12/10% FCS were co-transfected with L3-AP-1-luciferase or pGL3-SRE-luciferase and pSV-
alactosidase reporter constructs. Following transfection, cellsere incubated with lovastatin (Lov 10 µM) in absence or esence of mevalonate (Mev 100 µM) for 24 hours. Contr
0
50
100
Luv
/Gal
(% o
fcon
LovMev
--
++
-+
+-
pGL3-SRE
0
50
100
150
Luc
/Gal
(% o
fcon
trol
)
LovMev
--
++
-+
+-
**
nsns
B
0
50
100
Luv
/Gal
(% o
fcon
LovMev
--
++
-+
+-
0
50
100
Luv
/Gal
(% o
fcon
LovMev
--
++
-+
+-
0
50
100
Luv
/Gal
(% o
fcon
LovMevLovMev
--
++
-+
+-
pGL3-SRE
0
50
100
150
Luc
/Gal
(% o
fcon
trol
)
LovMev
--
++
-+
+-
**
nsns
pGL3-SRE
0
50
100
150
Luc
/Gal
(% o
fcon
trol
)
LovMev
--
++
-+
+-
**
nsns
0
50
100
150
Luc
/Gal
(% o
fcon
trol
)
LovMevLovMev
--
++
-+
+-
**
nsns
B
24pGGwprceLuciferase and β-Galactosidase activity were measured in the same extracts and the luciferase activity standardised for transfection efficiency by dividing the luciferase activity by β-Galactosidase activity. Results are expressed as the percentage relative to untreated cells. Each value represents the mean ±SE of three independent experiments performed in triplicate. ns, not significant; **, p<0.01; compared to untreated cells.
Taken together, our results suggest that
transcriptional activity of c-Jun, which is
dependent on JNK, is likely to contribute to
lovastatin-induced neuroblast apoptosis.
Lovastatin induces BimEL expression in rat
brain neuroblasts.
c-Jun induction plays an importan
in
genes, most notably the BH3-only Bcl-2
family member Bim
isoforms of Bim [BimS (Bim short),
BimL (Bim long) and BimEL (Bim extra
long), BimEL is induced and potentiated by
JNK at both the transcriptional and
posttranslational levels [45]. Therefore, we
next examined the protein levels of BimEL
after lovastatin treatment by immunoblot
analysis. As shown in Fig. 6, lovastatin
increased the protein levels of BimEL in a
time- and concentration-dependent manner
(Fig. 6A and Fig. 6B, respectively). Lovastatin
(10 µM) produced an increase in BimEL that
was significant at 3 hours and was maximum at
about 12 hours of treatment (Fig. 6A). On the
other hand, the effect of lovastatin on protein
levels of BimEL was evident at a
concentration of 1 µM and reached the
maximum effect at a concentration of 10 µM.
Mevalonate (100 µM) prevented the increase
in the protein levels of BimEL induced by
lovastatin, indicating that the lovastatin effect
was specific (Fig. 6C). Treatment of
neuroblasts with mevalonate alone decreased
the protein levels of BimEL when compared to
control cells. Expression levels of GAPDH
remained unchanged throughout the
experiment (Fig. 6), suggesting that BimEL
150ns ns
trol 150
ns ns
trol 150
ns ns
trol
98
Submitted JNKs activation in lovastatin-induced neuronal apoptosis
Figure 6. Effect of lovastatin on BimEL protein levels. Time-dependent effect. B: Concentration-dependent effect.Effect of mevalonate treatment. Neuroblasts were trdescribed in Fig. 1. At the end of each experiment, cells werelysed and total proteins (20 µg/lane) were separated byPAGE and analyzed by Western blotting using anti-
B
C
0
400
800
1200
*
*
*
ns
0 1 3 6 12 24Time (h)
Bim
EL
(% o
fcon
trol
)
0 10 201Lovastatin (µM)
0
1000
2000
3000
**
*
**
BimEL→
GAPDH→
Bim
EL
(% o
fcon
trol
)
0
50
100
150
200
250
LovMev
--
++
-+
+-
**
ns*
BimEL→
GAPDH→
Bim
EL
(% o
fcon
trol
)
B
C
0
400
800
1200
0
400
800
1200
*
*
*
ns *
*
*
ns
0 1 3 6 12 24Time (h)
0 1 3 6 12 24Time (h)
Bim
EL
(% o
fcon
trol
)
0 10 201Lovastatin (µM)
0 10 201Lovastatin (µM)
0
1000
2000
3000
**
*
**
0
1000
2000
3000
0
1000
2000
3000
**
*
**
**
*
**
BimEL→
GAPDH→
Bim
EL
(% o
fcon
trol
)
0
50
100
150
200
250
0
50
100
150
200
250
LovMev
--
++
-+
+-
LovMevLovMev
--
++
-+
+-
**
ns*
**
ns*
BimEL→
GAPDH→
Bim
EL
(% o
fcon
trol
)
A: C:
eated as
SDS-BimEL
tal A
presentative blot of each experiment is shown with the ensitometric analysis corresponding to the mean ±SE of at least
s a downstream
component of the activated JNK signalling
pathway in this apoptotic model.
st apoptosis
duced by lovastatin
capacity to activate the JNK/c-Jun/BimEL
signalling pathway. Therefore, we next studied
whether the pharmacological inhibition of this
pathway results in a corresponding inhibition
of neuroblast apoptosis. Thus, cells were
treated with 10 µM lovastatin alone or in
combination with various concentrations of
two JNK inhibitors, iJNK-I [50] and SP600125
for 24 hours. In these experiments, JNK
inhibitors were added to the cells 1 hour before
lovastatin treatment. Apoptotic response was
evaluated by cell and nuclei morphology
analysis, internucleosomal DNA fragmentation
and quantification of neuroblasts undergoing
apoptosis by flow cytometry. As shown in Fig.
7A, lovastatin-treated cells in the absence of
JNK inhibitor were totally rounded up and
detached from the plate, while in the presence
of iJNK-I (50 µM), the cells were viable and
maintained normal cell shape in the presence
of lovastatin. iJNK-I (50 µM) also prevented
the increase in the number of nuclei showing
chromatin condensation elicited by lovastatin
(Fig. 7A and 7B).
1600
specific antibody. As a control of the amount of protein, toGAPDH was also analyzed in the same samples.
ABimEL→
ABimEL→
redthree independent experiments. ns, not significant; *, p<0.05; **, p<0.01; compared to untreated cells.
expression was specifically affected by
exposure to lovastatin. These results suggest
that BimEL may act a*
GAPDH→
16001600**
GAPDH→
JNK, but not p38 MAPK, activation is
required for rat brain neurobla
in
Our results suggested that lovastatin
might induce neuroblast apoptosis by its
99
Submitted JNKs activation in lovastatin-induced neuronal apoptosis
Fi
AA
gure 7. The specific JNK inhibitor (iJNK-I) prevents lovastatin effects. Neuroblasts previously cultured for 24 hours in growth e incubated with 10 µM lovastatin (Lov) in absence or presence of different concentrations of iJNK-I (10, 25 and 50 µM) f
additional 24 h. (A) Cell and nuclei morphology was analyzed as described in Material and Methods. Untreated neuroblasts (A andoblasts treated with 10µM lovastatin (B and G), 10µM lovastatin plus 50 µM iJNK-I (C and H) and 50 µM iJNK-I (D and I). Norma
--
LoviJNK-I
+-
+10
+25
+50
-50
MW 0
5
10
15
20
25
--
LoviJNK-I
+-
+10
+25
+50
-50
***
ns
**
***A
popt
osis
(% o
ftot
al c
ells
)
0
25
50
75
100
-50
--
LoviJNK-I
+-
+10
+25
+50
Cel
lVia
bilit
y(%
ofc
ontr
ol)
*** *** ***
***
***
JNK-1→
P-GST-c-Jun→
-50
--
LoviJNK-I
+-
+10
+25
+50
BimEL→
Caspase 3Active Fragment→
GAPDH→
-50
--
LoviJNK-I
+-
+10
+25
+50
E F G H
B C
D E
F
P-c-Jun→
Total Nuclei
Apoptotic Nuclei
0
100
200
300
Nuc
leiN
umbe
rpe
rIm
age
-50
--
LoviJNK-I
+-
+50
***
ab b
ns ns
nn nn
anan
--
LoviJNK-I
+-
+10
+25
+50
-50
MW 0
5
10
15
20
25
--
LoviJNK-I
+-
+10
+25
+50
-50
***
ns
**
***A
popt
osis
(% o
ftot
al c
ells
)
0
25
50
75
100
-50
--
LoviJNK-I
+-
+10
+25
+50
Cel
lVia
bilit
y(%
ofc
ontr
ol)
*** *** ***
***
***
--
LoviJNK-I
+-
+10
+25
+50
-50
MW--
LoviJNK-I
+-
+10
+25
+50
-50
MW--
LoviJNK-I
+-
+10
+25
+50
-50
MW 0
5
10
15
20
25
--
LoviJNK-I
+-
+10
+25
+50
-50
***
ns
**
***A
popt
osis
(% o
ftot
al c
ells
)
0
5
10
15
20
25
--
LoviJNK-I
+-
+10
+25
+50
-50
***
ns
**
***
***
ns
**
***A
popt
osis
(% o
ftot
al c
ells
)
0
25
50
75
100
-50
--
LoviJNK-I
+-
+10
+25
+50
Cel
lVia
bilit
y(%
ofc
ontr
ol)
*** *** ***
***
***
0
25
50
75
100
0
25
50
75
100
-50
--
LoviJNK-I
+-
+10
+25
+50
-50
--
LoviJNK-I
+-
+10
+25
+50
Cel
lVia
bilit
y(%
ofc
ontr
ol)
*** *** ***
***
****** *** ***
***
***
JNK-1→JNK-1→
P-GST-c-Jun→P-GST-c-Jun→
-50
--
LoviJNK-I
+-
+10
+25
+50
-50
--
LoviJNK-I
+-
+10
+25
+50
BimEL→BimEL→
Caspase 3Active Fragment→
Caspase 3Active Fragment→
GAPDH→GAPDH→
-50
--
LoviJNK-I
+-
+10
+25
+50
-50
--
LoviJNK-I
+-
+10
+25
+50
EE F GG HH
B C
D E
F
P-c-Jun→P-c-Jun→
Total Nuclei
Apoptotic Nuclei
0
100
200
300
Nuc
leiN
umbe
rpe
rIm
age
-50
--
LoviJNK-I
+-
+50
Total Nuclei
Apoptotic Nuclei
Total Nuclei
Apoptotic Nuclei
0
100
200
300
Nuc
leiN
umbe
rpe
rIm
age
-50
--
LoviJNK-I
+-
+50
0
100
200
300
Nuc
leiN
umbe
rpe
rIm
age
-50
--
LoviJNK-I
+-
+50
***
ab b
ns ns
nn nn
anan
A B CAA BB CC DDD
media wer or an
F), neur l (nn) and apoptotic nuclei (an). (B) Total and apoptotic nuclei were counted as described in Material and Methods. (C) neuroblast viability was determined by the crystal violet method. (D) Internucleosomal DNA degradation was analyzed by using electrophoresis on 2% agarose gel. (E) The percentage of cells with hypodiploid DNA content was evaluated by flow cytometry and (F) JNK activity, c-Jun phosphorylation,
imEL expression, caspase-3 active form and GAPDH protein levels were analyzed as described in Material and Methods. Each value presents the mean ± standard error of at least three independent experiments made in triplicate. (B) ns, not significant; ***, p<0.001;
ompared to apoptotic nuclei in untreated cells. a, p<0.001; b, p<0.01; compared to normal nuclei in untreated cells. (C and E) ns, not
Brecsignificant; *, p<0.05; **, p<0.01; ***, p<0.001; compared to untreated cells. A representative photograph or a blot of at least 3 independent experiments is shown in A, D and F. MW represents 100 bp molecular weight markers.
100
Submitted JNKs activation in lovastatin-induced neuronal apoptosis
It is noteworthy that the JNK inhibitor
alone or in combination with lovastatin
produced a decrease in the number of cells
hen compared to both control and lovastatin-
to block the apoptotic effect of lovastatin (Fig.
8).
to block the apoptotic effect of lovastatin (Fig.
8).
AAw
treated
apoptotic neuroblasts when compared to
control cells. In all the experiments tested,
iJNK-I effects were concentration-dependent.
To further study the contribution of the JNK/c-
Jun/BimEL signalling pathway in neuroblast
apoptosis induced by lovastatin, we examined
the effect of iJNK-I on the different
components of this pathway. As shown in Fig.
7G, pre-treatment with 10-50 µM iJNK-I
suppressed the increase in JNK activation, c-
Jun phosphorylation and BimEL protein levels
and BIRB796 (data not shown), were not able
Taken together, these results suggest
40
120140
duced by lovastatin, we examined
the effect of iJNK-I on the different
components of this pathway. As shown in Fig.
7G, pre-treatment with 10-50 µM iJNK-I
suppressed the increase in JNK activation, c-
Jun phosphorylation and BimEL protein levels
and BIRB796 (data not shown), were not able
Taken together, these results suggest
40
120140cells (Fig 7A, B and C). Furthermore,
iJNK-I also prevented the appearance of
internucleosomal DNA fragmentation (Fig.
7C) and the increase in the percentage of
apoptotic neuroblasts (Fig. 7D) induced by
lovastatin. iJNK-I alone produced no effect on
DNA fragmentation nor in the percentage of
triggered by lovastatin. Moreover, iJNK-I also
inhibited the increase in the active form of
caspase 3 induced by lovastatin (Fig.7G).
iJNK-I effects were concentration dependent
and correlated well with its neuroprotective
effects. Due to non-specific cytotoxic effect,
the neuroblasts could not be treated with
SP600125 (data not shown). Thus, we could
not determine whether this JNK inhibitor was
able to prevent neuroblast apoptosis in this
model.
The involvement of p38 MAPK in the
induction of neuroblast apoptosis by lovastatin
was again excluded by the fact that specific
inhibitors of this kinase, SB203580 (Fig. 8)
triggered by lovastatin. Moreover, iJNK-I also
inhibited the increase in the active form of
caspase 3 induced by lovastatin (Fig.7G).
iJNK-I effects were concentration dependent
and correlated well with its neuroprotective
effects. Due to non-specific cytotoxic effect,
the neuroblasts could not be treated with
SP600125 (data not shown). Thus, we could
not determine whether this JNK inhibitor was
able to prevent neuroblast apoptosis in this
model.
The involvement of p38 MAPK in the
induction of neuroblast apoptosis by lovastatin
was again excluded by the fact that specific
inhibitors of this kinase, SB203580 (Fig. 8)
020
6080
100
020
6080
100***
*** ***
** **
ns
(% o
fnt
ro
SB 203580 (µM)
1 5 10 1 5 10 20Lov - + + ++ + - - - -
B
020
6080
100***
*** ***
** **
ns
(% o
fnt
ro
SB 203580 (µM)
1 5 10 1 5 10 20Lov - + + ++ + - - - -
020
6080
100
020
6080
100***
*** ***
** **
ns
****** ***
** **
ns
(% o
fnt
ro
SB 203580 (µM)
1 5 10 1 5 10 20Lov - + + ++ + - - - -
SB 203580 (µM)
1 5 10 1 5 10 20
SB 203580 (µM)
1 5 10 1 5 10 201 5 10 1 5 10 20Lov - + + ++ + - - - -Lov - + + ++ + - - - -
B
*** ***
ns
Cel
lVia
bilit
yco
l)
20
40
120140
*** ***
ns
Cel
lVia
bilit
yco
l)
20
40
120140
40
120140
*** ***
ns
*** ***
ns
Cel
lVia
bilit
yco
l)
20202020
Figure 8. Effect of p38 MAPK inhibitor (SB 203580) alone or in combination with lovastatin on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of SB203580 (1, 5, 10 and 20 µM) in absence or presence of 10 µM lovastatin (Lov) for an additional 24 h. At the end of the experiment, cell viability, internucleosomal DNA degradation and the percentage of cells with hypodiploid DNA content was evaluated as described in Material and Methods. Each value represents the mean ± standard error of at least three independent experiments made in triplicate. ns, not significant; **, p<0.01; ***, p<0.001; compared to untreated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.
Figure 8. Effect of p38 MAPK inhibitor (SB 203580) alone or in combination with lovastatin on cell viability (A), internucleosomal DNA fragmentation (B) and percentage of apoptotic cells (C). Cells previously cultured for 24 hours in growth media were incubated with different concentrations of SB203580 (1, 5, 10 and 20 µM) in absence or presence of 10 µM lovastatin (Lov) for an additional 24 h. At the end of the experiment, cell viability, internucleosomal DNA degradation and the percentage of cells with hypodiploid DNA content was evaluated as described in Material and Methods. Each value represents the mean ± standard error of at least three independent experiments made in triplicate. ns, not significant; **, p<0.01; ***, p<0.001; compared to untreated cells (A and C). A representative photograph of 3 independent experiments is shown in B. MW represents 100 bp molecular weight markers.
SB 203580 (µM)
Lov -1+
5+
10++
20+
1-
5-
10-
20- MW
SB 203580 (µM)
1 5 10 20 1 5 10 20
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls) ***
*** *** *** ***
ns ns ns ns
Lov - + + ++ + - - - -
CSB 203580 (µM)
Lov -1+
5+
10++
20+
1-
5-
10-
20- MW
SB 203580 (µM)
Lov -1+
5+
10++
20+
1-
5-
10-
20- MW
SB 203580 (µM)
Lov -1+
5+
10++
20+
1-
5-
10-
20- MWLov -
1+1+
5+5+
10+10++
20+20+
1-1-
5-5-
10-
10-
20-
20- MW
SB 203580 (µM)
1 5 10 20 1 5 10 20
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls) ***
*** *** *** ***
ns ns ns ns
Lov - + + ++ + - - - -
SB 203580 (µM)
1 5 10 20 1 5 10 20
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls) ***
*** *** *** ***
ns ns ns ns
Lov - + + ++ + - - - -
SB 203580 (µM)
1 5 10 20 1 5 10 20
SB 203580 (µM)
1 5 10 20 1 5 10 201 5 10 20 1 5 10 20
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls) ***
*** *** *** ***
ns ns ns ns
Lov - + + ++ + - - - -0
5
10
15
20
25
0
5
10
15
20
25
Apo
ptos
is(%
oft
otal
cel
ls) ***
*** *** *** ***
ns ns ns ns
****** *** *** ***
ns ns ns ns
Lov - + + ++ + - - - -Lov - + + ++ + - - - -
C
that the JNK signalling pathway seemed to be
linked to lovastatin-induce apoptosis of rat
brain neuroblasts.
that the JNK signalling pathway seemed to be
linked to lovastatin-induce apoptosis of rat
brain neuroblasts.
101
Submitted JNKs activation in lovastatin-induced neuronal apoptosis DISCUSSION
The mevalonate pathway is essential to
ensure normal growth, differentiation and
maintenance of neuronal tissues [13-14]. The
inhibition of the biosynthesis of mevalonate by
statins
nvolved in these effects of
been elucidated. In the present
study, w
MAPK
has been associated with CNS defects
[16, 17] and the induction of apoptosis in
cultured neuronal cells [18-21]. However, the
signalling events i
statins have not
e used rat brain neuroblasts in order to
investigate the molecular mechanisms
underlying lovastatin-induced neuronal
apoptosis. We found that lovastatin induced
neuroblast apoptosis through the activation of
the JNK/c-Jun/BimEL signalling pathway and
their downstream molecule, caspase-3.
The role of JNK and p38 MAPK in
neuronal apoptosis has been investigated
extensively [25, 26]. However, these kinases
have been also associated with neuronal
survival [38] and differentiation [39, 40]. In
the present work, we show that lovastatin
treatment led to a time- and concentration
dependent increase in the activity of JNK. In
contrast, the phosphorylation of p38
was not affected by lovastatin exposure at any
time tested. These results suggest that the JNK,
but not the p38 MAPK, signalling pathway
may play a role in the apoptosis of neuroblasts
induced by lovastatin. Although p38 MAPK
activation caused apoptosis in some neuronal
damage models, it seemed to be irrelevant in
others. Thus, p38 MAPK activation was
required for apoptosis induced by survival-
factor withdrawal [27, 29, 30], ceramide and
cadmium exposure [31, 33], while in contrast,
p38 MAPK was not implicated in other models
of neuronal apoptosis [35-37]. These
controversial findings suggest the existence of
differences in regulation of of p38 MAPK
depending on cell types and environmental
conditions. The role that plays the stress-
activated kinases in lovastatin-induced
apoptosis is also contradictory. Consistent with
our findings, some reports show that statin-
induced apoptosis in both rat pulmonary vein
endothelial [12] and C6 glioma cells [9]
correlates with up-regulation of JNK without
affecting p38 MAPK activity. In contrast,
lovastatin induces apoptosis in both human
aortic smooth muscle and acute myelogenous
leukemia cells but not affect the level of
expression and activation status of p38 MAPK
and JNK [10, 11]. On the other hand,
lovastatin-induced apoptosis in glioblastoma
cells was independent of the activation of JNK
and p38 MAPK [51] and simvastatin-induced
apoptosis in human myeloma cells was
associated with the inactivation of both JNK
and p38 MAPK [52]. Such a discrepancy may
be attributed to different biological actions of
statins depending on cell types. At the
moment, we do not know the mechanisms by
which lovastatin treatment leads to an
activation of JNK in neuroblasts. However, we
may postulate that the activation of JNK may
be associated, at least partially, with the
decrease in the activity of phosphoinositide 3-
kinase (PI3-K) induced by lovastatin in
neuroblasts [53], as a previously report
suggests that the inhibition of PI3-K signalling
pathway involves and elevation of the JNK
activity in cultured neuronal cells [54, 55]. On
the other hand, the increase in the JNK activity
observed in this apoptotic model may be a
102
Submitted JNKs activation in lovastatin-induced neuronal apoptosis downstream response to either induction of
Rac 1, mainly implicated in cell apoptosis, or
loss of membrane-associated Rho A, a
regulator of cell survival [56] or both, as we
have previously reported that lovastatin
treatment was associated with a decrease in the
prenylation of RhoA whereas membrane-
associated Rac 1 was not affected [21].
The transcription factor c-Jun is a
substrate for JNK, which phosphorylates its
transcriptional activation domain at serines 63
and 73 and thereby potentiates its
transcriptional activity. c-Jun is a well-
characterized member of the AP-1 family of
transcription factors that also includes fos and
ATF2. Members of AP-1 family integrate a
complex network of incoming extracellular
signals,
the JNK pathway both at the
transcri
which are responsible for multifaceted
functions like cell proliferation, differentiation
and neuronal apoptosis [41]. In the present
work, we found that both the phosphorylation
at serine 63 and protein levels of c-Jun were
induced in lovastatin-treated neuroblasts in a
time- and concentration dependent manner and
that AP-1 activity was modulated in parallel
with the changes of c-Jun phosphorylation and
protein, too. Furthermore, these effects were
associated with an increase in AP-1-mediated
gene expression. These results indicate that
AP-1 activity could be required for apoptosis
in lovastatin-treated neuroblasts and suggest
that c-Jun plays a key role. The activation of
JNK/c-Jun/AP-1 signalling pathway has been
related to apoptosis induced by lovastatin in
non-neuronal [9, 12] but, to our knowledge,
this is the first report that shows that lovastatin
induces the activation of this cell death
signalling pathway in neuronal cells and in
particular in rat brain neuroblasts. Increased
levels of c-Jun protein, phosphorylation and
AP-1 activity have been described in several
models of neuronal apoptosis, suggesting an
important role for this transcription factor in
this process.
Bcl-2 family members are critical for
making life- or-death decisions in neurons
[57]. The proapoptotic Bcl-2 family protein
Bax is necessary for neuronal death. Bax
activity is regulated by the BH3-only members
of the Bcl-2 family, such as Bim. Bim is
increased in sympathetic and cerebellar
granule neurons during apoptosis and is up-
regulated by
ptional and posttranslational levels [45,
46]. In our study, we found that lovastatin
increased the protein levels of BimEL in rat
brain neuroblasts undergoing apoptosis.
Lovastatin effects were time- and
concentration dependent and parallel to JNK
activity. Our results are in good agreement
with a previous work that shows that
lovastatin-induced up-regulation of Bim and
cell death in glioblastoma cells [51], and
suggest that lovastatin may induce neuroblast
apoptosis by increasing the expression of this
BH3-only protein. Bim expression is increase
in response to various apoptotic inducers in
different neuronal cells [58-61], which
indicates that up-regulation of Bim plays an
important role in the execution of neuronal
apoptosis.
We have also shown that lovastatin
effects were prevented by simultaneous
exposure of cells to exogenous mevalonate,
demonstrating that the activation of the JNK/c-
103
Submitted JNKs activation in lovastatin-induced neuronal apoptosis Jun/Bim signalling pathway induced by
lovastatin was specifically due to a blockade of
HMG-CoA reductase activity.
Our results suggest that lovastatin may
induce
hibitor of JNK
activity
JNK/c-Jun/BimEL signalling pathway in
revented by adding
mevalo
e argument that JNK/c-
Jun pat
m Junta de
Extrem Spain.
REFE
reactions in the biosynthesis of cholesterol,
neuroblast apoptosis by its capacity to
activate the JNK/c-Jun/Bim pathway.
Therefore, we investigated whether the
pharmacological inhibition of this pathway
was able to prevent the apoptosis of
neuroblasts induced by lovastatin. Our results
show that iJNK-I, a specific in
, was able to prevent the morphological
and biochemical features of apoptosis induced
by lovastatin in a concentration-dependent
manner. In a parallel way, iJNK-I prevented
the increase in JNK activation, c-Jun
phosphorylation, BimEL expression and
caspase-3 activation elicited by lovastatin. Our
results are consistent with data obtained in
other neuronal apoptotic models, and indicate
that the JNK signalling pathway plays an
important role in the apoptosis induced by
lovastatin in rat brain neuroblasts. On the other
hand, we show that iJNK-I treatment produced
a decrease in the number of neuroblasts when
compared to control and lovastatin-treated
cells. At the moment, we do not know the
mechanisms by which iJNK-I treatment
produce this cell cycle inhibitory effect.
Inhibition of p38 MAPK by SB203580 showed
no appreciable effects on apoptosis in the same
experimental conditions, confirming that the
p38 MAPK pathway does not play a role in
this apoptotic model.
In conclusion, we have shown for the
first time that HMG-CoA reductase inhibition
by lovastatin leads to an activation of the
spontaneously immortalized rat brain
neuroblasts which may contribute to
explaining its apoptotic effect. The lovastatin
effects were time- and concentration-
dependent and p
nate to the medium, which indicates
that they were due to an inhibition of
mevalonate synthesis.
These findings could contribute to
elucidate the molecular mechanisms by which
statins induce growth suppression and/or
apoptosis in neuronal cells and may also help
to explain the CNS side effects associated with
statin therapy. On the other hand, our data
demonstrating the involvement of the JNK/c-
Jun pathway in another model of neuronal
apoptosis, strengthen th
hway inhibitors may be a good therapy
for the neurodegenerative diseases.
ACKNOWLEDGMENTS
The authors thank Mary Harper for the
preparation of the manuscript. This work has
been supported by Grants, SAF 2001-0154
from the Ministerio de Ciencia y Tecnologia,
and 2PR01B007 from the Junta de
Extremadura. M. I. Cerezo-Guisado is
supported by a Ph D fellowship fro
adura,
RENCES [1] H. W. Chen, Role of cholesterol metabolism in cell growth, Fed. Proc. 43 (1984) 126-130.
[2] J. L. Goldstein, M. S. Brown, Regulation of the mevalonate pathway, Nature 343 (1990) 425-429. [3] J. Grunler, J. Ericsson, G. Dallner, Branch-point
104
Submitted JNKs activation in lovastatin-induced neuronal apoptosis dolichol, ubiquinone and prenylated proteins,
cta 1212 (1994) 259-277.
osis in rostate stromal cells, J. Clin. Endocrinol. Metabol.
[5] L. M. Blanco-Colio, A. Villa, M. Ortego, M. A. Hernández-Presa, A. Pascual, J. J. Plaza, J. Egido, 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase inhibitors, atorvastatin and simvastatin, induce apoptosis of vascular smooth muscle cells by downregulation of Bcl-2 expression and Rho A
arshall, N. Johnston, A. G. rdine, Inhibition of proliferation and signalling
em. harmacol. 65 (2003) 1295-1303.
[8] M. R. Graaf, D. J. Richel, C. J. F. van Noorden, H. J. Guchelarr, Effect of statins and farnesyltransferase inhibitors on the development and progression of cancer, Cancer Treat. Rev. 30 (2004) 609-641.
of extracellular signal-regulated inases, Cardiovasc. Pathol. 13 (2004) 41-48.
[11] J. Wu, W. W. Wong, F. Khosravi, M. D. Minden, L. Z. Penn, Blocking the Raf/MEK/ERK
apoptosis, Cancer Res. 4 (2004) 6461-6468.
5] C. P. Cavender, S. D. Turley, J. M. Dietschy,
, M. Muenke M. Central nervous stem and limb anomalies in case reports of first-
. Edison, M. Muenke Mechanistic and pidemiologic considerations in the evaluation of
8] M. Michikawa, K. Yanagisawa, Inhibition of
9] T. Tanaka, I. Tatsuno, D. Uchida, I. Moroo, H.
neurons to protect the cell death
Biochim. Biophys. A
[4] S. J. Padayatty, M. Marcelli, T. C. Shao, G.R. Cunningham, Lovastatin-induced apoptp82 (1997) 1434-1439.
prenylation, Atherosclerosis 161 (2002) 17-26. [6] D. Z. Hillyard, A. J. Cameron, A. H. McIntyre, N. H. Hadden, C. E. MJamechanisms in human lymphocytes by fluvastatin, Clin. Exp. Pharmacol. Physiol. 29 (2002) 673-678. [7] R. Jaster, P. Brock, G. Sparmann, J. Emmrich, S. Liebe, Inhibition of pancreatic stellate cell activation by the hydroxymethylglutaryl coenzyme A reductase inhibitor lovastatin, BiochP
[9] M. Koyuturk, M. Ersoz, N. Altiok, Simvastatin induces proliferation inhibition and apoptosis in C6 glioma cells via c-jun N-terminal kinase, Neurosci. Lett. 370 (2004) 212-217. [10] R. Takata, S. Fukasawa, T. Hara, H. Nakajima, A. Yamashina, N. Yanase, J. Nizuguchi, Cerivastatin-induced apoptosis of human aortic smooth muscle cells through partial inhibition of basal activation k
pathway sensitizes acute myelogenous leukaemia cells to lovastatin-induced 6 [12] S. Kaneta, K. Satoh, S. Kano, M. Kanda, K. Ichihara, All hydrophobic HMG-CoA reductase inhibitors induce apoptotic death in rat pulmonary vein endothelial cells, Atheroscleoris 17 (2003) 237-243. [13] W. A. Maltese, J. J. Volpe, Developmental changes in the distribution of 3-hydroxy-3-methylglutaryl coenzyme A reductase among subcellular fractions of rat brain, J. Neurochem. 33 (1979) 107-115. [14] D. K. Spady, J. M. Dietschy, Sterol synthesis in vivo in 18 tissues of the squirrell monkey, guinea pig, rabbit, hamster and rat, J. Lipids Res. 24 (1983) 303-315. [1Sterol metabolism in fetal, newborn and suckled lambs and their response to cholesterol after weaning, Am. J. Physiol. 269 (1995) E331-E340. [16] R. J. Edisonsytrimester statin exposure, N. Engl. J. Med. 350 (2004) 1579-1582. [17] R. Jeadverse birth outcomes following gestational exposure to statins, Am. J. Med. Genet. 131A (2004) 287-298. [1cholesterol production but not of nonsterol isoprenoid products induces neuronal cell death, J. Neurochem. 72 (1999) 2278-2285. [1Morio, S. Nakamura, Y. Noguchi, T. Yasuda, M. Kitagawa, Y. Saito, A. Hirai, Geranylgeranyl-pirophosphate, an isoprenoid of mevalonate cascade, is a critical compound for rat primary cultured cortical
105
Submitted JNKs activation in lovastatin-induced neuronal apoptosis induced by 3-hydroxy-3-methylglutaryl-CoA
. Stoeckel, D. egow, U. Dirnagl, M. Endres, HMG-CoA
hibition, Mol. Cell. Neurosci. 17 1) 329-341.
3] D. De Zio, L. Giunta, M. Corvazo, E. Ferraro,
urodegenerative disorders, Curr.
s-degenerative effectors of signal-ansduction-cascades in the nervous system, Prog.
role of stress-ctivated kinases, JNK and p38, Cell Signal. 13
aud, R. J. Davis, .E. Greenberg, Opposing effects of ERK and
o E, Y. Kasuya, F-X. laret, D.R. Green, M. Karin, Withdrawal of
survival factors results in activation of JNK
9] N. Lambeng, S. Willaime-Morawek, J.
rain Res. 111 (2003) 52-60
3] S. D. Kim, C. K. Moon, S-Y Eun, P. D. Ryu,
4] U. Namgung, Z. Xia, Arsenite-induced
5] F. J. Gunn-Moore, J. M. Tavare, Apoptosis of
pathway in neuronal cells leading to Fas Lingand induction and cell death, Mol. Cell. Biol. 19 (1999) 751-763.
reductase inhibition, J. Neurosci. 20 (2000) 2852-2859. [20] J. G. Schulz, J. Bosel J, M [2
Mariani, M. Ruberg, B. Brugg, Activation of mitogen-activated protein kinase pathways during the death of PC12 cells is dependent on the state of differentiation, Mol B
Mreductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate synthesis, J. Neurochem (2004) 89:24-32. [21] N. García-Román, A. M. Álvarez, M. J. Toro, A. Montes, M. J. Lorenzo, Lovastatin induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of nonsterol isoprenoid biosíntesis in
[30] J. Cao, M. M. Semenova, V. T. Solovyan, J. Han, E. L. T. Coffey, Distinct requirements for p38� and c-Jun N-terminal kinase stress-activated protein kinases in different forms of apoptotic neuronal death, J. Biol. Chem. 279 (2004) 35903-35913 (200 [22] L. Lossi, A. Merighi, In vivo cellular and
molecular mechanisms of neuronal apoptosis in the mammalian CNS, Prog. Neurobiol. 69 (2003) 287-312.
[31] S. Willaime-Moravek, K. Brami-Cherrier, J. Mariani, J. Caboche, B. Brugg, c-Jun N-Terminal kinases/c-Jun and p38 pathways cooperate in ceramide-induced neuronal apoptosis, Neuroscience 119 (2003) 387-397. [2 F. Cecconi, Expanding roles of programmed cell
death in mammalian neurodevelopment, Semin. Cell. Dev. Biol. 16 (2005) 281-294. [24] L. Stefanis, R.E. Burke, L.A. Greene, Apoptosis in ne
[32] K. P. Sarker, K. K. Biswas, M. Yamakuchi, R-Y. Lee, T. Hahiguchi, M. Kracht, I. Kitajima, I. Maruyama, ASK-1-p38 MAPK/JNK signaling cascade mediates anandamide-induced PC12 cell death, J. Neurochem. 85 (2003) 50-61. Opin. Neurol. 10 (1997) 299-305.
[25] K. Mielke, T. Herdegen, JNK and p38 stress kinase
[3S. A. Jo, Identification of ASK1, MKK4, JNK, c-Jun and caspase-3 as a signaling cascade involved in cadmium-induced neuronal cell apoptosis, Biochem Biophys Res Comm 328 (2005) 326-334.
trNeurobiol. 61 (2000) 45–60. [26] S. J. Harper, P. LoGrasso, P, Signalling for survival and death in neurones: the
[3apoptosis in cortical neurons is mediated by c-Jun-N-terminal protein kinase 3 and p38 mitogen-activated protein kinase, J. Neurosci. 20 (2000) 6442-6451.
a(2001) 299–310. [27] Z. Xia, M. Dickens, J. Rainge
[3Mcerebellar granule cells induced by serum withdrawal, glutamate or beta-amyloid, is independent of Jun kinase or p38 mitogen activated protein kinase activation, Neurosci. Lett. 250 (1998) 53–56
JNK-p38 MAP kinases on apoptosis, Science 270 (1995) 1326-1331. [28] H. Le-Niculescu, BonfocC
106
Submitted JNKs activation in lovastatin-induced neuronal apoptosis [36] A. Eilers, J. Whitfield, C. Babij, L. L. Rubin, J. Ham, Role of the Jun kinase pathway in the regulation of c-Jun expression and apoptosis in sympathetic neurons, J Neurosci 18 (1998) 1713–1724. [37] C. N. G. Anderson, A. M. Tolkovsky, A role for MAPK/ERK in sympathetic neuron survival: protection against a p53-dependent, JNKindependent induction of apoptosis by cytosine arabinoside, J. Neurosci. 19 (1999) 664–673. [38] Z. Mao, A. Bonni, F. Xia, M. Nadal-Vicens,
. Leppa, R. Saffrich, W. Ansorge, D. ohmann, Differential regulation of c-Jun by ERK
onal ifferentiation in PC12 cells, J. Biol. Chem. 273
riptional control of euronal apoptosis, Biochem. Pharmacol 60 (2000)
J. Ham, Phosphorylation of -Jun is necessary for apoptosis induced by survival
. Weller, T. Klockgether, otassium deprivation-induced apoptosis of
urosci.16 (1996) 4696-706.
6] C. A. Harris, E. M. Jonhson Jr., BH3-only Bcl-
7] F. L. Zhang, P. J. Casey, Protein prenylation:
. Kita, M. S. Brown, J. L. Goldstein, eedback regulation of 3-hydroxy-3-methylglutaryl
Wrighton, B. Seliger, J. Bernal, . Beug, Thyroid hormone receptor/c-erbA:
0] C. Bonny, A. Oberson, S. Negri, C. Sauser,
. Lytle, R. igashikubo, K. M. Rich, Lovastatin-induced up-
chi, T. Hatayama, T. ujii, T. Tsujioka, T. Sugihara, A. Takata, F.
myeloma cells, Oncol. Rep. 11 (2004) 1053-1058.
M. E. Greenberg, Neuronal activity dependent cell survival mediated by transcription factor MEF2, Science 286 (1999) 785–790. [39] SBand JNK during PC12 cell differentiation, EMBO J. 17 (1998) 4404–4413. [40] T. Morooka, E. Nishida, Requirement of p38 mitogen-activated protein kinase for neurd(1998) 24285–24288. [41] J. Ham, A. Eilers, J. Whitfield, S. J. Neame, B. Shah, c-Jun and the transcn1015-1021. [42] A. Watson, A. Eliers, D. Lallemand, J. Kyriakis, L. L. Rubin, csignal withdrawal in cerebellar granule neurons, J. Neurosci.18 (1998) 751-62. [43] J. B. Schulz, MPcerebellar granule neurons: a sequential requirement of new mRNA and protein synthesis, ICE-like protease activity, and reactive oxygen species, J. Ne [44] J. Ham, C. Babij, J. Whitfield, C. M. Pfarr, D. Lallemand, M. Yaniv, L. L. Rubin, A c-Jun dominant negative mutant protects sympathetic
neurons against programmed cell death, Neuron 14 (1995) 927–939. [45] E. B.E. Becker, J. Howell, Y Kodama, P.A. Barker, A. Bonni, Characterization of the c-Jun N-terminal kinase-BimEL signalling pathway in neuronal apoptosis, J. Neurosci. 24 (2004) 8762-8770. [42 Family Members are co-ordinately regulated by the JNK pathway and require Bax to induce apoptosis in neurons, J. Biol Chem. 276 (2001) 37754-37760. [4molecular mechanisms and functional consequences, Ann. Rev. Biochem. 65 (1996) 241-269. [48] TFcoenzyme A reductase in livers of mice treated with mevilonin, a competitive inhibitor of the reductase, J. Clin. Invest. 66 (1980) 1094-1100. [49] A. Muñoz, C. HControl of commitment and differentiation in the neuronal/chromaffin progenitor line PC12, J. Cell Biol. 121 (1993) 423-438. [5D.F. Schorderet, Cell-permeable peptide inhibitors of JNK. Novel blockers of beta-cell death, Diabetes 50 (2001) 77-82. [51] Z. Jiang, X. Zheng, R.AHregulation of the BH3-only protein, Bim, and cell death in glioblastoma cells, J. Neurochemistry 89 (2004) 168-178. [52] T. Otsuki, H. SakaguFHyodoh, M. Eto, Effects of an HMG-CoA reductase inhibitor, simvastatin, on human
107
Submitted JNKs activation in lovastatin-induced neuronal apoptosis
108
[53] M. I. Cerezo-Guisado, L. J. García-Marín, M. J. Lorenzo, M. J. Bragado, Lovastatin inhibits the
rowth and survival pathway of phosphoinositide 3-
Hatanaka, Inhibition of hosphatidylinositol 3-kinase activity elevates c-
.
embers: activators of MAP kinase cascades, Cell
8] G.V. Putcha, S. Le, F. Frank, C.G. Bersili, K.
9] S. S. Le, F. A. Loucks, H. Udo, S. Richardson-
cerebellar ranule neurons, J. Neurochem. 94 (2005) 1025-
4) 7879-7887.
gkinase/protein kinase B in immortalized rat brain neuroblasts, J. Neurochem. 94 (2005) 1277-1287. [54] K. Shimoke, S. Yamagishi, M. Yamada, T. Ikeuchi, H. pJun-N-terminal kinase activity in apoptosis of cultured cerebellar granule neurons, Develop. Brain Res. 112 (1999) 245-253. [55] A.H. Kim, H. Yano, H. Cho, D. Meyer, BMonks, B. Margolis, M. J. Birnabaum, M.V. Chao, Akt1 regulates a JNK scaffold during excitotoxic apoptosis, Neuron 35 (2002) 697-709. [56] A.B. Vojtek, J. A. Cooper, Rho familym82 (1995) 527-529. [57] D. E. Merry, S. J. Korsmeyer, Bcl-2 gene family in the nervous system, Annu. Rev. Neurosci. 20 (1997) 245–267. [5Clark, B. Chu, S. Alix, R. J. Youle, A. LaMarche, A. C. Maroney, E. M. Johnson, Jr, JNK-mediated
Bim phosphorylation potentiates Bax-dependent apoptosis, Neuron 38 (2003) 899-914. [5Burns, R.A. Phelps, R. J. Bouchard, H. Barth, K. Aktories, K.L. Tyler, E.R. Kandel, K.A. Heidenreich, D.A. Linseman, Inhibition of Rac GTPase triggers a c-Jun- and Bim-dependent mitochondrial apoptotic cascade ing1039. [60] S. Okuno, A. Saito, T. Hayashi, P. H. Chan, The c-Jun N-terminal protein kinase signaling pathway mediates Bax activation and subsequent neuronal apoptosis through interaction with Bim alter transient focal cerebral ischemia, J. Neurosci. 24 (200 [61 S. Yoon, J. Choi, J. Yoon, J-W Huh, D. Kim, Okadaic acid induces JNK activation, bim overexpression and mitochondrial dysfunction in cultured rat cortical neurons, Neurosci. Let. 394 (2006) 190-195.
Discusión
Numerosos estudios ponen de manifiesto que la ruta de biosíntesis del colesterol
tiene un papel esencial en el desarrollo, diferenciación y mantenimiento del sistema nervioso (Maltese y Volpe, 1979; Cavender y cols., 1995; Spady y Dietschy, 1983; Opitz y De la Cruz,
1994). Recientemente hemos mostrado que la lovastatina, un inhibidor de la ruta de
biosíntesis del colesterol, induce apoptosis en neuroblastos fetales de rata (García-Román y
cols., 2001). El objetivo del presente trabajo ha sido estudiar los mecanismos intracelulares
implicados en la apoptosis de los neuroblastos inducida por la lovastatina. En particular nos
hemos centrado en estudiar las principales rutas de señalización celular que regulan la
proliferación y la supervivencia celular, la ruta de Ras/ERK y la ruta de la PI3-K/PKB, y las
que regulan la muerte celular, la ruta de la JNK y de la p38 MAPK.
1. EFECTO DE LA LOVASTATINA EN LA ACTIVIDAD DE RAS.
Resultados previos de nuestro grupo ponen de manifiesto que la lovastatina
disminuye la farnesilación de Ras en los neuroblastos fetales de rata (García-Román y cols.,
2001). Por esta razón y en primer lugar, estudiamos si la inhibición de la prenilación de Ras
por la lovastatina en neuroblastos estaba asociada a una disminución de su actividad
biológica. Nuestros resultados muestran que en neuroblastos el tratamiento con la
lovastatina disminuye significativamente la actividad de Ras. Aunque algunas estatinas
parecen inducir la apoptosis a través de mecanismos independientes de la farnesilación de
Ras (Weiss y cols., 1999; Zhong y cols., 2003), nuestros datos coinciden con numerosos
estudios que muestran que las estatinas inhiben la prenilación y, en consecuencia, la
activación de Ras en diferentes tipos celulares no neuronales (Bassa y cols., 1999; Hillyard y
cols., 2002; Miura y cols., 2004; Ghittoni y cols., 2005; Khanzada y cols., 2006). Nuestros
resultados sugieren que los efectos de la lovastatina pueden deberse a su capacidad de
bloquear las vías de transduccción de señales reguladas por Ras
2. EFECTO DE LA LOVASTATINA EN LA RUTA DE LA PI3-K/PKB.
Una de las principales rutas de señalización celular reguladas por Ras es la ruta de
la PI3-K/PKB. Nuestros resultados muestran que el tratamiento de los neuroblastos con la
lovastatina produce una clara inhibición de la actividad quinasa de la PI3-K in vitro. En este
momento desconocemos el mecanismo por el cual el tratamiento con la lovastatina induce
una inactivación de la PI3-K en los neuroblastos. Como se describió en el apartado de la
introducción, la PI3-K se encuentra en el citosol y se puede activar a través de varios
109
Discusión mecanismos: por la unión de la subunidad reguladora p85 a través de sus dominios SH2 a
proteínas fosforiladas en tirosina, o por la unión de la subunidad catalítica p110 a través de
su dominio RBD a Ras activo (Rameh y cols., 1995; Rodríguez-Viciana y cols., 1996). En
relación con este último mecanismo de activación, hay que señalar que inicialmente se
realizaron estudios para investigar la actividad quinasa de la PI3-K asociada a
inmunoprecipitados de Ras. Debido a problemas técnicos con la inmunoprecipitación de
Ras, en estos momentos no podemos implicar a Ras en la activación de la PI3-K en los
neuroblastos. Sin embargo, nuestros resultados muestran que en las mismas condiciones
en las que la lovastatina induce la apoptosis, existe un paralelismo entre la inactivación de la
quinasa PI3-K y la inactivación de Ras, lo que sugiere que la inactivación de Ras puede
contribuir, al menos en parte, a la inhibición de la actividad de la PI3-K. Esta hipótesis se ve
apoyada por estudios realizados en tipos celulares no neuronales, como mioblastos L6, en
los que la sinvastatina inhibe eficientemente la prenilación de Ras, lo que conduce a su
localización en el citoplasma y una consecuente inhibición de la actividad de PI3-K asociada
a Ras (Nakagawa y cols., 1998). Sin embargo, en la literatura existen resultados
contradictorios acerca de la implicación de la ruta Ras/PI3-K en la apoptosis inducida por las
estatinas, ya que también se ha demostrado que en células de músculo liso vascular la
pravastatina inhibe la actividad de la PI3-K al tiempo que provoca la apoptosis de una
manera independiente de Ras (Weiss y cols., 1999).
Otro de los mecanismos de activación de la PI3-K ya mencionados, implica a
proteínas fosforiladas en tirosina, por lo cual, se decidió estudiar la actividad quinasa de la
PI3-K en inmunoprecipitados con un anticuerpo antifosfotirosina. Una lógica y posible
explicación de la inactivación de la PI3-K obtenida con este procedimiento experimental,
supondría que en presencia de la lovastatina se produciría una inhibición de la fosforilación
en tirosina de diversas proteínas, lo cual conduciría a una reducción de la actividad de la
PI3-K. Este mecanismo ha sido descrito para otras estatinas, aunque en otros tipos
celulares (McGuire y cols., 1993, 1994, 1996; Xu y cols., 1996). Sin embargo, esta
explicación no es válida en el modelo de apoptosis de los neuroblastos dado que nuestros
resultados muestran que la cantidad de la subunidad reguladora, p85, que permanece
asociada a proteínas fosforiladas en tirosina no está afectada por el tratamiento con la
lovastatina.
El principal efector de la PI3-K es la proteína PKB/Akt. En este modelo de apoptosis
de los neuroblastos, el tratamiento con la lovastatina produce una marcada reducción de la
fosforilación de la PKB en la Ser473, lo que muestra indirectamente una inhibición de su
actividad quinasa. De acuerdo con nuestros resultados, están los de otros autores que
demuestran que diferentes estatinas producen una disminución de la fosforilación de PKB
110
Discusión
en tipos celulares no neuronales (Weiss y cols., 1999; Chen y cols., 2002; Ben y Yellon,
2003; Campbell y cols., 2004). Sin embargo, estos datos contrastan con los de otros
estudios en los cuales las estatinas producen un aumento en la fosforilación de PKB en
diferentes tipos celulares (Kureishi y cols., 2000; Contreras y cols., 2002; Bell y Yellon, 2003;
Wolfrum y cols., 2004). La inhibición observada de la fosforilación de la PKB en neuroblastos
puede explicarse como una consecuencia directa de la inactivación de la PI3-K observada
tras el tratamiento con la lovastatina, aunque no se debe descartar la posibilidad de que
ocurra una desfosforilación en la Ser473, como ocurre en la apoptosis inducida por ceramida
(Schubert y cols., 2000).
Un sustrato directo de PKB es la quinasa mTOR. Está ampliamente demostrado que
mTOR es esencial para la supervivencia celular mediada por PI3-K/PKB en diferentes tipos
celulares (Woltman y cols., 2003; Butzal y cols., 2004; Stromberg y cols., 2004; Wendel y
cols., 2004; Wang y cols., 2005). Recientemente se ha postulado que mTOR funciona como
una molécula integradora de señales que regulan tanto la apoptosis como el crecimiento
celular (Asnaghi y cols., 2004; Castedo y cols., 2002). Los principales sustratos descritos de
mTOR son proteínas implicadas en el control de la síntesis de proteínas, y por tanto del
crecimiento celular, y son: la proteína quinasa p70S6K o S6K (Brown y cols., 1995; Burnett y
cols., 1998) y la proteína 4EBP1, reguladora del factor de iniciación de la traducción en
eucariotas eIF4E (Gingras y cols., 1999). Nuestros resultados, mostrando que el tratamiento
con la lovastatina conduce a una inhibición de la fosforilación de p70S6K y de 4EBP1, avalan
la idea de que la lovastatina en neuroblastos induce apoptosis al producir una inhibición de
una ruta que regula la supervivencia celular como es PI3-K/PKB/mTOR. La consecuencia
biológica de un descenso en la fosforilación de 4EBP1 es un aumento de su actividad
represora del factor de traducción eIF4E. Así la lovastatina, al disminuir la fosforilación de
4EBP1, provoca de manera consecuente un aumento de la unión 4EBP1-eIF4E, lo que
conlleva a una menor disponibilidad del factor eIF4E para llevar a cabo su función celular de
iniciar la traducción dependiente de caperuza y así promover crecimiento y supervivencia
celular. En este sentido, existen varios estudios que atribuyen un papel inhibidor de la
apoptosis al factor eIF4E cuando está funcionalmente activo (Polunovsky y cols.,1996; Li y
cols., 2003; Li y cols., 2004). Por otro lado, el descenso en la fosforilación de 4EBP1
inducido por la lovastatina podría explicar, parcialmente, la apoptosis observada en los
neuroblastos ya que, utilizando dos aproximaciones experimentales complementarias,
bloqueo farmacológico de la fosforilación y expresión de mutantes de 4EBP1, se ha
demostrado que la inhibición de la fosforilación de 4EBP1 es capaz de provocar apoptosis
(Li y cols., 2002). En cuanto a la proteína quinasa p70S6K, una consecuencia biológica de su
inhibición es una disminución de la fosforilación de la proteína ribosomal S6. Cuando esta
proteína ribosomal es fosforilada se estimula la traducción de aquellos ARNm que contienen
111
Discusión oligopirimidinas en su extremo 5´ (5´-TOP) (Jefferies y cols., 1997). Recientemente, se ha
demostrado que p70S6K fosforila otros sustratos que están implicados en la síntesis de
proteínas, como son los factores de la traducción eIF4B (Gingras y cols., 2001) y la proteína
quinasa eEF2K que fosforila el factor 2 de elongación de la traducción eEF2 (Wang y cols.
2001). Adicionalmente, p70S6K se encuentra formando un complejo con el factor de la
traducción eEF3, que se disocia cuando p70S6K es fosforilada en la Thr389 (Holz y cols.,
2005). Así pues, nuestros resultados confirman estudios previos que han demostrado que
uno de los eventos bioquímicos tempranos en el proceso de apoptosis celular es una rápida
inhibición de la síntesis de proteínas (Holcik y cols., 2000). De manera adicional nuestros
resultados contribuyen a establecer mecanismos moleculares por los que se produce un
bloqueo de una función celular como es la síntesis de proteínas, importante para el
crecimiento y la supervivencia celular, durante la apoptosis en neuroblastos.
El hecho de que dos inhibidores farmacológicos de la PI3-K, LY294002 y
wortmanina, sean capaces de inducir apoptosis en neuroblastos apoyan la idea,
previamente descrita en otros tipos celulares no neuronales (Nakagawa y cols., 1998; Weiss
y cols., 1999; Prasad y cols., 2005), de que una inhibición de la PI3-K puede estar
mediando, al menos parcialmente, la apoptosis inducida por la lovastatina en neuroblastos.
Nuestros datos se ven apoyados por otros estudios en los que los inhibidores de la PI3-K
son capaces de inducir apoptosis en diferentes tipos celulares, como las células MDCK
(Khwaja y cols., 1997) y PC12 (Yao y Cooper., 1995). Sin embargo, únicamente se
observaron efectos en los parámetros indicadores de la apoptosis a las máximas
concentraciones utilizadas de ambos inhibidores. Por esta razón y porque adicionalmente
comprobamos que el grado de apoptosis provocado por la inhibición de la PI3-K es menor
que el inducido por la lovastatina, podemos sugerir la idea de que además de la PI3-K
deben necesariamente estar implicadas otras rutas intracelulares en este modelo de
apoptosis de los neuroblastos.
3. EFECTO DE LA LOVASTATINA EN LA RUTA DE RAS/ERKs.
Otra de las rutas de señalización celular reguladas por Ras es la ruta de
Raf/MEK/ERK. Raf fosforila y activa a las proteínas quinasas MEK1/2 que, a su vez,
fosforilan y activan a las proteínas quinasas ERK1/2. Nuestros resultados muestran
claramente que la lovastatina disminuye la fosforilación, y por lo tanto la actividad, de las
proteínas ERK1/2 de una manera dependiente del tiempo y de la concentración de
lovastatina utilizada. Estos resultados sugieren que la disminución en la fosforilación de las
proteínas ERK1/2 puede estar mediando la apoptosis de los neurobalstos inducida por la
112
Discusión
lovastatina. De acuerdo con nuestros resultados, varios autores muestran que la apoptosis o
la inhibición de la proliferación celular inducida por diferentes estatinas en varios tipos
celulares no neuronales está asociada con una disminución en la fosforilación o actividad de
las proteínas ERK1/2 (Melchert y cols., 2001; Johnson y cols., 2002; Otsuki y cols., 2004;
Takata y cols., 2004; Wu y cols., 2004; Nishida y cols, 2005). Sin embargo, tenemos que
mencionar que las estatinas inhiben la proliferación de células RBL-2H3 de rata (Graham y
cols., 1998) e inducen la apoptosis de células de glioblastoma (Jiang y cols., 2004) de una
manera independiente de la disminución de la fosforilación de las proteínas ERK1/2. La
diferencia que existe entre estos resultados puede deberse, a los diferentes efectos
biológicos que tienen las estatinas en función del tipo celular. Tenemos que señalar que
mientras que la incubación de los neuroblastos con la lovastatina durante 24 horas produce
una inhibición casi completa de la actividad de Ras, sólo disminuye parcialmente la
fosforilación de las proteínas ERK1/2 cuando se compara con las células control. Esta
ausencia de paralelismo puede ser debida a que el tratamiento con la lovastatina active a
diferentes moléculas de señalización intracelular, como las proteínas PKC y Rac (Skaletz-
Rorowski y cols., 2001; Negre-Aminou y cols., 2002), que a su vez estén activando la ruta
Raf/MEK/ERK. Otra posible explicación se basaría en el hecho de que la proteína quinasa
PKB, inactiva en este modelo de apoptosis, no esté fosforilando y, por tanto inhibiendo, la
actividad de Raf (Guan y cols., 2000). De esta forma Raf perdería su regulación negativa por
PKB y podría fosforilar y activar a las proteínas MEK1/2 y éstas a ERK1/2. No se debe
descartar la posibilidad de una inhibición de fosfatasas inducida por la lovastatina.
Está ampliamente aceptado que uno de los mecanismos por los cuales la ruta de
Ras/ERK1/2 promueve la supervivencia neuronal es a través de la activación de la proteína
quinasa p90rsk, que a su vez fosforila y activa al factor de transcripción CREB en la Ser133
(Bonni y cols., 1999). La fosforilación de CREB promueve la supervivencia neuronal
mientras que la desfosforilación de este factor de transcripción induce apoptosis (Mabuchi y
cols., 2001; Hara y cols., 2003). Nuestros resultados indican que la disminución en la
fosforilación de ERK1/2 inducida por la lovastatina está asociada a una disminución
significativa en la fosforilación de CREB de una manera dependiente del tiempo y de la
concentración de lovastatina utilizada. Asimismo, el tratamiento con la lovastatina produce
una disminución de la expresión génica regulada por CREB. La desactivación de la ruta de
señalización Ras/ERK/CREB se ha relacionado con la apoptosis inducida por diferentes
agentes en células neuronales y no neuronales (Bonni y cols., 1999; Mabuchi y cols., 2001;
Lonze y Ginty, 2002; Jaworski y cols., 2003; Rabelo y cols., 2003; Hansen y cols, 2004).
Pero este es el primer trabajo que muestra que las estatinas, y en particular la lovastatina,
inhiben la activación de esta ruta de supervivencia en células neuronales. Estudios recientes
muestran que la sinvastatina inhibe la activación de CREB en células endoteliales a través
113
Discusión de un mecanismo dependiente de la ruta Rho/ROCK (Crespo y cols., 2005). Ya que en
nuestras condiciones experimentales la lovastatina también inhibe la prenilación de la
proteína Rho A (García-Román y cols., 2001) no podemos descartar que la disminución en
la fosforilación de CREB y en la expresión génica regulada por CREB observada en este
trabajo sean también debidas a una desactivación de las rutas de señalización reguladas
por Rho A.
Está ampliamente descrito que CREB puede ejercer sus efectos neuroprotectores a
través de la regulación de la expresión de genes que controlan la superviencia celular tales
como Bcl-2 (Bonni y cols., 1999; Mabuchi y cols., 2001; Sugiura y cols., 2004). Nuestro
grupo también ha mostrado que la lovastatina es capaz de disminuir los niveles
intracelulares de la proteína Bcl-2 (García-Román y cols., 2001) por lo que, en conjunto,
nuestros datos sugieren que la lovastatina podría inducir la apoptosis de los neuroblastos a
través de la inhibición de la ruta de señalización Ras/ERK/CREB y la consecuente
disminución de la expresión de genes que inducen supervivencia celular como Bcl-2.
Nuestros resultados están de acuerdo con otros que muestran que la inhibición de la ruta de
supervivencia celular Ras/ERK/CREB conduce a la apoptosis de celulares neuronales y no
neuronales inducida por diferentes estímulos apoptóticos (Rabelo y cols., 2003; Hansen y
cols., 2004).
Nuestros resultados sugieren que la lovastatina puede inducir apoptosis por su
capacidad de inhibir la ruta Ras/ERK/CREB, por lo que a continuación estudiamos si la
inhibición farmacológica de esta ruta puede inducir la apoptosis en los neuroblastos.
Nuestros resultados muestran que PD98059 induce la apoptosis de los mismos siendo su
efecto mucho menor que el observado con la lovastatina. Sin embargo, PD98059 aumenta
significativamente la apoptosis de los neuroblastos inducida por lovastatina. Nuestros
resultados están de acuerdo con otros que muestran que la inhibición de la ruta
Ras/Raf/MEK/ERK, por sí sola, no promueve la muerte celular pero potencia la apoptosis
inducida por diferentes estatinas y otros estímulos apoptóticos en células no neuronales
(Brantley-Finley y cols., 2003; Rabelo y cols., 2003; Takata y cols., 2004; Wu y cols., 2004).
114
Discusión
4. EFECTO DE LA INHIBICIÓN DE LAS RUTAS DE LA PI3-K Y DE LAS ERKs EN LA SUPERVIVENCIA DE LOS NEUROBLASTOS.
Nuestros resultados muestran por primera vez que la lovastatina es capaz de inhibir
las dos rutas de señalización que inducen la supervivencia celular, la de la PI3-K y la de las
ERKs, en neuroblastos fetales de rata. Por otra parte, también muestran que la inhibición
farmacológica de cada una de estas rutas, por separado, no es suficiente para inducir la
apoptosis de los neuroblastos observada con la lovastatina. Por ello, se estudió el efecto de
una inhibición conjunta de ambas rutas en la supervivencia de los neuroblastos. Nuestros
resultados muestran que la inhibición conjunta de ambas rutas potencia los efectos en la
apoptosis de los neuroblastos que se observa cuando se inhibe a cada una de las rutas por
separado, siendo su efecto comparable al producido por la lovastatina. Por lo tanto, nuestros
resultados sugieren que la lovastatina puede inducir la apoptosis de los neuroblastos por su
capacidad de inhibir, de forma simultánea, las rutas de supervivencia celular de
Raf/MEK/ERK y la de PI3-K/PKB.
5. EFECTO DE LA LOVASTATINA EN LAS RUTAS DE LAS JNKs Y p38 MAPK.
Se ha descrito que, además de la inhibición de la actividad de las rutas que regulan
la supervivencia celular, es necesario que se produzca la activación de las rutas que
controlan la muerte celular para inducir la apoptosis neuronal (Xia y cols., 1995). Nuestros
resultados muestran que el tratamiento con la lovastatina aumenta la actividad de las
proteínas JNKs en los neuroblastos fetales de rata de una forma dependiente del tiempo y
de la concentración de lovastatina utilizada, mientras que los niveles de fosforilación de p38
MAPK no se ven modificados. Nuestros datos sugieren que la activación de la ruta de las
JNKs, pero no la de las p38 MAPKs, puede mediar la apoptosis de los neuroblastos inducida
por la lovastatina y sostiene que las JNKs son las principales proteínas quinasas que
producen la muerte neuronal (Carimalo y cols., 2005; Lee y cols., 2005; Kanzawa y cols.,
2006). Nuestros resultados están de acuerdo con los obtenidos en otros estudios que
muestran que diferentes estatinas inducen la apoptosis de células no neuronales a través de
la activación de las JNKs sin afectar a la activación de las p38 MAPKs (Kaneta y cols., 2003;
Koyuturk y cols., 2004). Por el contrario, otros estudios muestran que las estatinas inducen
apoptosis celular de una forma independiente de la activación de JNK (Otsuki y cols., 2004;
Kibayashi y cols., 2005; Takata y cols., 2004; Wu y cols., 2004). Nuevamente, esta
discrepancia en los resultados puede deberse a los diferentes efectos biológicos que tienen
115
Discusión las estatinas en función del tipo celular. De momento, desconocemos el mecanismo
mediante el cual la lovastatina aumenta la actividad de las proteínas JNKs en nuestras
condiciones experimentales. Es posible que sea consecuencia de la disminución de la
actividad de la ruta de la PI3-K/PKB producida por la lovastatina, ya que estudios previos
muestran que la inhibición de esta ruta debida a una disminución de la concentración de
potasio extracelular, está asociada a un aumento en la actividad de las proteínas JNKs y a la
inducción de la apoptosis en células granulares de cerebelo (Shimoke y cols., 1999).
Uno de los mecanismos por los cuales las proteínas JNKs promueven la muerte
neuronal es a través de la fosforilación y, en consecuencia, de la activación del factor de
transcripción c-Jun (Palmada y cols., 2002; Willaime-Morawek y cols., 2003; Oh y cols.,
2006). Nuestros resultados muestran que el aumento de la actividad de las proteínas JNKs
inducida por la lovastatina está asociado con un aumento de la fosforilación y de los niveles
de expresión del factor de transcripción c-Jun de una forma dependiente del tiempo y de la
concentración de lovastatina utilizada. Pero a diferencia de lo que ocurre con la actividad de
las proteínas JNKs, que es máxima a las 24 horas después del tratamiento con la
lovastatina, los niveles de expresión y de fosforilación de c-Jun alcanzan su máximo entre
las 3 y 6 horas, disminuyendo a continuación. Este efecto bifásico podría deberse en parte a
la activación de fosfatasas que estarían desfosforilando y, en consecuencia, desactivando a
c-Jun. La fosforilación de c-Jun se ha asociado con la apoptosis celular inducida por las
estatinas en otros modelos celulares (Kaneta y cols., 2003; Koyuturk y cols., 2004), pero
esta es la primera vez que se asocia con la muerte de los neuroblastos.
c-Jun forma parte del factor de transcripción AP-1 (Karin y cols., 1997). La actividad
de AP-1 tiene una función esencial en la apoptosis neuronal (Porcile y cols., 2003; Li y cols.,
2005; Jin y cols., 2006). Nuestros resultados muestran que la lovastatina aumenta la
actividad del factor de transcripción AP-1 de una forma dependiente del tiempo y de la
concentración de lovastatina utilizada. Los efectos de la lovastatina en la actividad de AP-1
son paralelos a los observados en la fosforilación de c-Jun, lo que sugiere que, en nuestras
condiciones experimentales, c-Jun puede ser el componente principal del factor de
transcripción AP-1. Por otra parte, pudimos comprobar que el aumento de la actividad del
factor de transcripción AP-1 se traduce en un aumento de la transcripción de los genes que
éste controla, ya que la lovastatina provoca un aumento en la expresión del gen de la
luciferasa controlado por TRE, elemento de respuesta al que se une AP-1. En conjunto
nuestros resultados sugieren que la lovastatina puede inducir la apoptosis de los
neuroblastos al inducir la expresión de genes pro-apoptóticos dependientes de la ruta
JNK/c-Jun.
116
Discusión
Entre los genes pro-apoptóticos regulados por JNK/c-Jun se encuentra bim. Varios
estudios muestran que la proteína Bim promueve apoptosis neuronal por un mecanismo
dependiente de la ruta JNK/c-Jun (Harris y Johnson, 2001; Putcha y cols., 2003; Okuno y
cols., 2004; Le y cols., 2005; Jin y cols., 2006). En este trabajo mostramos que la lovastatina
produce un aumento de los niveles intracelulares de la proteína BimEL de una manera
dependiente del tiempo y de la concentración de lovastatina utilizada. Previamente, Jiang y
cols. (2004) mostraron que la lovastatina induce la apoptosis en células de glioblastoma
aumentando la expresión de BimEL de una forma independiente de las MAPKs. Por lo tanto,
nuestros resultados muestran por primera vez, que una estatina puede inducir la apoptosis
neuronal a través de un aumento en la expresión de Bim inducido por la ruta de JNK/c-Jun.
Finalmente, nuestros datos muestran claramente que la apoptosis de los
neuroblastos inducida por la lovastatina está mediada por la ruta de JNK/c-Jun, ya que un
inhibidor específico de esta ruta, el péptido inhibidor I, previene los efectos de la lovastatina
en la fosforilación de c-Jun, la expresión de Bim, la actividad de caspasa 3 y de todos los
parámetros indicadores de la apoptosis celular. Por otra parte, la utilización de inhibidores
específicos de la p38 MAPK, SB 203580 y BIRB 796, no previene la apoptosis inducida por
la lovastatina, lo que confirma que la ruta de la p38 MAPK no está implicada en este modelo
de apoptosis neuronal. Nuestros resultados concuerdan con los de Koyuturk y cols. (2004)
que demuestran que la inhibición farmacológica de la ruta de las JNKs, pero no la de la p38
MAPK, previene los efectos apoptóticos de la sinvastatina en células de glioma C6.
En conjunto estos resultados muestran por primera vez que la lovastatina es capaz
de inducir la apoptosis de los neuroblastos a través de la activación de las JNKs, la
consecuente fosforilación de c-Jun, la inducción de Bim y la activación de caspasa 3.
Los efectos de la lovastatina descritos en este trabajo son específicos ya que se
previenen completamente en presencia de mevalonato, el producto de la HMG-CoA
reductasa, lo que implica que dichos efectos se deben a la capacidad que tiene la
lovastatina de inhibir la actividad de la HMG-CoA reductasa.
117
Discusión
6. LAS ESTATINAS Y LAS RUTAS DE SEÑALIZACIÓN INTRACELULAR.
Los efectos antiproliferativos y apoptóticos de las estatinas se han mostrado en
varios sistemas experimentales (Hillyard y cols., 2002; Zhong y cols., 2003; Matzno y cols.,
2005; Zhong y cols., 2005). En todos los estudios, incluido el nuestro, se sugiere que los
efectos de las estatinas se deben principalmente a una inhibición de la prenilación de varias
proteínas implicadas en el crecimiento y la supervivencia celular, como las proteínas Ras y
RhoA. Pero los mecanismos moleculares concretos responsables de los efectos apoptóticos
y antiproliferativos de las estatinas en diferentes tipos celulares son heterogéneos. En este
sentido, nuestro grupo sugiere por primera vez que, en células neuronales, la lovastatina
puede inducir la apoptosis por 1) su capacidad de inhibir la prenilación de proteínas, 2)
provocar la inactivación simultánea de las rutas de la PI3-K y de las ERKs y 3) estimular la
activación de la ruta de las JNKs, sin afectar a la ruta de la p38 MAPK. Sin embargo, un
estudio defiende que las estatinas pueden inducir apoptosis al disminuir la actividad de las
ERKs sin afectar a los niveles de activación de las JNKs en células de músculo liso vascular
(Takata y cols., 2004). Otro trabajo muestra que algunas estatinas pueden inducir la
apoptosis de células C6 de glioma vía JNK sin afectar a los niveles de activación ni de las
ERKs ni de la PI3-K (Koyuturk y cols., 2004). El grupo de Chen y cols., (2004) muestra que
el efecto de las estatinas está asociado a una activación de las ERKs y de la p38 MAPK.
Mientras que Otsuki y cols. (2004) muestran que la sinvastatina es capaz de inducir la
apoptosis por la inactivación de las ERKs, las JNKs y la p38 MAPK, Jiang y cols., (2004)
postulan que es precisamente la activación de estas tres rutas lo que está relacionado con la
apoptosis inducida por lovastatina en células de glioblastoma. Esta gran heterogeneidad que
se encuentra en la literatura en lo que se refiere al efecto de las estatinas puede deberse al
tipo de estatina utilizado y al tipo celular objeto de estudio.
La lovastatina se utiliza de forma habitual en el tratamiento de la hipercolestrolemia,
es capaz de atravesar la barrera hematoencefálica y se detecta en el fluido cerebroespinal
(Triscari y cols., 1993). Estudios epidemiológicos muestran que esta droga puede producir
efectos secundarios en el SNC. Los efectos de la lovastatina en la regulación de la actividad
de diferentes rutas de transducción de señales mostrados en este trabajo pueden contribuir
a explicar los efectos secundarios que produce esta droga en el SNC. Por lo tanto nuestros
resultados junto con los estudios epidemiológicos y experimentales, aportan datos
suficientes para plantear de forma más cuidadosa, la elección y la dosis de la droga que se
utilice para el tratamiento de la hipercolesterolemia.
118
Discusión
Esquema general de los mecanismos de señalización intracelular implicados en
la apoptosis de los neuroblastos inducida por la lovastatina.
PI3-K
FT
Raf JNK
MEK1/2
ERK1/2
CREB
PKB
mTOR
p70S6K
Bcl-2
Rac
c-Jun
BIM
CASPASA 3
APOPTOSIS DE LOS NEUROBLASTOS
c-Jun c-Jun
c-Jun c-Fos
AP-1
LOVASTATINA
?
Ras
F
Ras
4EBP1P
eIF4E4EBP1
SÍNTESIS DEPROTEÍNAS
PI3-KPI3-K
FT
RafRaf JNKJNK
MEK1/2MEK1/2
ERK1/2ERK1/2
CREBCREB
PKBPKB
mTORmTOR
p70S6Kp70S6K
Bcl-2
RacRac
c-Junc-Jun
BIMBIM
CASPASA 3CASPASA 3
APOPTOSIS DE LOS NEUROBLASTOS
c-Jun c-Jun
c-Jun c-Fos
c-Jun c-Jun
c-Jun c-Fos
AP-1
LOVASTATINA
?
Ras
F
RasRas
FF
RasRas
4EBP1P
4EBP1PP
eIF4E4EBP1eIF4E4EBP14EBP1
SÍNTESIS DEPROTEÍNASSÍNTESIS DEPROTEÍNAS
119
Conclusiones
CONCLUSIONES.
1. El tratamiento de los neuroblastos con lovastatina produce una
disminución de la actividad de la proteína Ras.
2. El tratamiento de los neuroblastos con lovastatina produce una inactivación
enzimática de la proteína quinasa PI3-K y una inhibición de la fosforilación
de PKB.
3. El tratamiento de los neuroblastos con lovastatina provoca una inhibición
de la fosforilación de las proteínas p70S6K y 4EBP-1 implicadas en el
control de la síntesis de proteínas dependiente de caperuza.
4. La incubación de los neuroblastos con lovastatina disminuye la
fosforilación de las proteínas ERK1/2, del factor de transcripción CREB y la
expresión génica regulada por dicho factor de transcripción.
5. Es necesaria la inhibición conjunta de las rutas de supervivencia celular,
PI3-K y ERK, para inducir una apoptosis similar a la inducida por la
lovastatina.
6. La incubación de los neuroblastos con lovastatina produce la activación
enzimática de las proteínas quinasas JNKs, la fosforilación de c-Jun y un
aumento, tanto en la actividad del factor de transcripción AP-1, como en la
expresión génica regulada por dicho factor de transcripción. Todo ello
conlleva a la expresión de la proteína pro-apoptótica Bim y a la activación
de la caspasa 3.
7. El tratamiento de los neuroblastos con lovastatina no afecta a la
fosforilación de la proteína p38 MAPK.
121
Conclusiones
122
En definitiva, de nuestro estudio se puede obtener la siguiente conclusión general:
La apoptosis de neuroblastos inducida por la lovastatina está asociada a la
inactivación de la proteína Ras, la inhibición de las rutas que regulan la supervivencia
celular, PI3-K y ERKs, y a la activación de la principal ruta de señalización celular que
controla la muerte neuronal, la ruta de las JNKs. Por lo tanto, el balance o la
integración de estas rutas de señalización intracelular desencadenan la apoptosis de
los neuroblastos inducida por la lovastatina.
Bibliografía
Adamson P, Marshall CJ, Hall A, Tilbrook PA. (1992). Post-translational modifications of
p21rho proteins. J. Biol. Chem. 267: 20033-20038.
Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P. (1997). Characterization of a 3-phosphoinositide-dependent protein kinase which
phosphorylates and activates protein kinase B alpha. Curr. Biol. 7: 261–269.
Asnaghi L, Bruno P, Priulla M, Nicolin A. (2004). mTOR: a protein kinase switching
between life and death. Pharmacol. Res. 50: 545-549.
Baker SK, Tarnopolsky MA. (2005). Statin-associated neuromyotoxicity. Drugs Today. 41:
267-293. Barinaga M. (1993). Death gives birth to the nervous system but how?. Science. 259: 762-
763.
Barr RK, Kendrick TS, Bogoyevitch MA. (2002). Identification of the critical features of a
small peptide inhibitor of JNK activity. J. Biol. Chem. 277: 10987-10997.
Bassa BV, Roh DD, Vaziri ND, Kirschenbaum MA, Kamanna VS. (1999). Effect of
inhibition of cholesterol synthetic pathway on the activation of Ras and MAP kinase in
mesangial cells. Biochim Biophys Acta. 1449: 137-149.
Becker EB, Bonni A. (2004). Cell cycle regulation of neuronal apoptosis in development and
disease. Prog. Neurobiol. 72: 1-25.
Bell RM, Yellon DM. (2003). Atorvastatin, administered at the onset of reperfusion, and
independent of lipid lowering, protects the myocardium by up-regulating a pro-survival
pathway. J Am. Coll. Cardiol. 41:508–515.
Bernards A, Settleman J. (2004). GAP control: regulating the regulators of small GTPases.
Trends Cell Biol. 14:377-385.
Besirli CG., Johnson EM Jr. (2003). JNK-independent activation of c-Jun during neuronal
apoptosis induced by multiple DNA-damaging agents. J. Biol. Chem. 278: 22357–22366.
Blumenthal RS. (2000). Statins: Effective antiatherosclerotic therapy. Am. Heart. J. 139:
577-583.
Bonni A, Brunet A, West AE, Datta SR, Takasu MA, Greenberg ME. (1999). Cell survival
promoted by the Ras-MAPK signaling pathway by transcription-dependent and independent
mechanisms. Science. 286: 1358-1362.
Borsello T, Clarke PG, Hirt L, Vercelli A, Repici M, Schorderet DF, Bogousslavsky J, Brantley-Finley C, Lyle CS, Du L, Goodwin ME, Hall T, Szwedo D, Kaushal GP, Cambers TC. (2003). The JNK, ERK and p53 pathways play distinct roles in apoptosis
mediated by the antitumor agents vinblastine, doxorubicin, and etoposide. Biochem.
Pharmacol. 66: 459-469.
Brown EJ, Beal PA, Keith CT, Chen J, Shin TB, Schreiber SL. (1995). Control of p70s6
kinase by kinase activity of FRAP in vivo. Nature. 377: 441-446.
123
Bibliografía Brown MS, Goldstein JL. (1980). Multivalent feedback regulation of HMG CoA reductase, a
control mechanism coordinating isoprenoid synthesis and cell growth. J. Lipid. Res. 21:505-
517.
Brunet A, Datta S, Greenberg M. (2001). Transcription-dependent and-independent control
of neuronal survival by the PI3K-Akt signalling pathway. Curr. Opin. Neurobiol. 11: 297–305.
Burnett PE, Barrow RK, Cohen NA, Zinder SH, Sabatini DM. (1998). RAFT1
phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc. Natl. Acad.
Sci. USA. 95: 1432-1437.
Butzal M, Loges S, Schweizer M, Fischer U, Gehling UM, Hossfeld DK, Fiedler W. (2004). Rapamycin inhibits proliferation and differentiation of human endothelial progenitor
cells in vitro. Exp. Cell. Res. 300: 65-71.
Campbell M, Allen WE, Sawyer C, Vanhaesebroeck B, Trimble ER. (2004). Glucose-
potentiated chemotaxis in human vascular smooth muscle is dependent on cross-talk
between the PI3K and MAPK signaling pathways. Circ. Res. 95: 380-388.
Campbell SL, Khosravi-Far R, Rossman KL, Clark GJ, Der CJ. (1998). Increasing
complexity of Ras signaling. Oncogene. 17:1395–1413.
Cantrell DA. (2001). Phosphoinositide 3-kinase signalling pathways. J. Cell. Sci. 114: 1439-
1445.
Cardone MH, Roy N, Stennicke HR, Salvesen GS, Franke TF, Stanbridge E, Frisch S, Reed JC. (1998). Regulation of cell death protease caspase-9 by phosphorylation. Science.
282:1318-1321.
Carimalo J, Cronier S, Petit G, Peyrin JM, Boukhtouche F, Arbez N, Lemaigre-Dubreuil Y, Brugg B, Miquel MC. (2005). Activation of the JNK-c-Jun pathway during the early phase
of neuronal apoptosis induced by PrP106-126 and prion infection. Eur. J. Neurosci. 21: 2311-
2319.
Casey PJ. (1995). Protein lipidation in cell signaling. Science. 268: 221–5.
Castedo M, Ferri KF, Kroemer G. (2002). Mammalian target of rapamycin (mTOR): pro-
and anti-apoptotic. Cell Death Differ. 9: 99-100.
Cavender CP, Turley SD, Dietschy JM. (1995). Sterol metabolism in fetal, newborn and
suckled lambs and their response to cholesterol after weaning. Am. J. Physiol. 269: E331-
E340.
Cecconi F, Alvarez-Bolado G, Meyer BI, Roth KA, Gruss P. (1998). Apaf1 (CED-4
homolog) regulates programmed cell death in mammalian development. Cell. 94: 727–737.
Chen Z, Fukutomi T, Zago AC, Ehlers R, Detmers PA, Wright SD, Rogers C, Simon DI. (2002). Simvastatin reduces neointimal thickening in lowdensity lipoprotein receptor-deficient
mice after experimental angioplasty without changing plasma lipids. Circulation. 106: 20–23.
124
Bibliografía
Chen Z, Gibson TB, Robinson F, Silvestro L, Pearson G, Xu B, Wright A, Vanderbilt C, Cobb MH. (2001). MAP kinases. Chem. Rev. 101: 2449–2476.
Chen JC, Huang KC, Wingerd B, Wu WT, Lin WW. (2004). HMG-CoA reductase inhibitors
induce COX-2 gene expression in murine macrophages: role of MAPK cascades and
promoter elements for CREB and C/EBPbeta. Exp. Cell Res. 301: 305-319.
Choi KM, Macmahon LP, Lawrence JCJr. (2003). Two motifs in the translational repressor
PHAS-I required for efficient phosphorylation by mammalian target of rapamycin and for
recognition by raptor. J. Biol. Chem. 278: 19667-19673.
Chong H, Vikis HG, Guan KL. (2003). Mechanisms of regulating the Raf kinase family. Cell
Signal. 15:463–469.
Chu CT, Levinthal DJ, Kulich SM, Chalovich EM, DeFranco DB. (2004). Oxidative
neuronal injury. The dark side of ERK1/2. Eur. J. Biochem. 271: 2060–2066.
Coelho CM, Leevers SJ. (2000). Do growth and cell division rates determine cell size in
multicellular organisms?. J. Cell. Sci. 113 : 2927-2934.
Cohen P. (2002). Protein Kinases- the major drugs target of the twenty-first century?. Nature
Rev.Drug Disc. 1: 309-315.
Contreras JL, Smyth CA, Bilbao G, Young CJ, Thompson JA, Eckhoff DE. (2002).
Simvastatin induces activation of the serine-threonine protein kinase AKT and increases
survival of isolated human pancreatic islets. Transplantation. 74: 1063-1069.
Corsini A, Bellosta S, Baetta R, Fumagalli R, Bernini F. (1999). New insights into the
pharmacodynamics and pharmacokinetic properties of statins. Pharmacol. Ther. 84: 413-
428.
Coso OA, Chiariello M, Yu JC, Teramoto H, Crespo P, Xu N, Miki T, Gutkind JS. (1995).
The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK
signalling pathway. Cell. 81:1137-46.
Cox A, Der CJ. (2003). The dark side if Ras: regulation of apoptosis. Oncogene. 22: 8999-
9006.
Crespo J, Martinez-Gonzalez J, Rius J, Badimon L. (2005). Simvastatin inhibits NOR-1
expression induced by hyperlipemia by interfering with CREB activation. Cardiovasc. Res.
67: 333-341.
Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. (1995). Inhibition of
glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 378: 785-789.
Cryns V, Yuan J. (1998). Proteases to die for. Genes Dev. 12 : 1551–1570.
Dan I, Watanabe NM, Kusumi A. (2001). The Ste20 group kinases as regulators of MAP
kinase cascades. Trends Cell Biol. 11: 220–230.
Darzynkiewicz Z, Bruno S, Bino GD, Goreczyca W, Hotz MA, Lassota P, Traganos F. (1992). Features of apoptotic cells measrues by flow cytometry. Cytometry. 13: 795-808.
125
Bibliografía Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. (1997). Akt
phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell.
91: 231-241.
Davis RJ. (2000). Signal transduction by the JNK group of MAP Kinases. Cell. 103: 239-252.
De Zio D, Giunta L, Corvaro M, Ferraro E, Cecconi F. (2005). Expanding roles of
programmed cell death in mammalian neurodevelopment. Semin. Cell. Dev. Biol. 16: 281-
294.
Devarenne TP, Ekengren SK, Pedley KF, Martin GB. (2006). Adi3 is a Pdk1-interacting
AGC kinase that negatively regulates plant cell death. EMBO J. 25: 255-265.
Donovan N, Becker EBE, Konishi Y, Bonni A. (2002). JNK phosphorylation and activation
of BAD couples the stress-activated signaling pathway to the cell death machinery. J. Biol.
Chem. 277: 40944–40949.
Drysdale BE, Zacharchuk CM, Shin HS. (1983). Mechanism of macrophage-mediated
cytotoxicity: production of a soluble cytotoxic factor. J. Immunol. 131: 2362-2367.
Duits N, Bos FM. (1993). Depressive symptoms and cholesterol-lowering drugs. Lancet.
341: 114.
Duronio V, Scheid MP, Ettinger S. (1998). Downstream signalling events regulated by
phosphatidylinositol 3-kinase activity. Cell Signal. 10: 233-239. Edison RJ, Muenke M. (2004a). Central nervous system and limb anomalies in case reports
of first-trimester statin exposure. N. Engl. J. Med. 350: 1579-1582.
Edison RJ, Muenke M. (2004b). Mechanistic and epidemiologic considerations in the
evaluation of adverse birth outcomes following gestational exposure to statins. Am. J. Med.
Genet. 131A: 287-298.
Fleming Y, Armstrong CG, Morrice N, Paterson A, Goedert M, Cohen P. (2000). Biochem. J. 352: 145–154.
Freshney NW, Rawlinson L, Guesdon F, Jones E, Cowley S, Hsuan J, Saklatvala J. (1994). Interleukin-1 activates a novel protein kinase cascade that results in the
phosphorylation of HSP27. Cell. 78: 1039-1049.
Friesen JA, Rodwell VW. (2004). The 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA)
reductases. Genome Biol. 5: 248.
Frodin M, Gammeltoft S. (1999). Role and regulation of 90 KDa ribosomal S6 kinase (RSK)
in signal transduction. Mol. Cell Endocrinol. 151: 65-77.
Gagliardini V, Fernandez PA, Lee RK, Drexler HC, Rotello RJ, Fishman MC, Yuan J. (1994). Prevention of vertebrate neuronal death by the crmA gene. Science. 263: 826–828.
García Román N, Álvarez AM, Toro MJ, Montes A, Lorenzo MJ. (2001). Lovastatin
induces apoptosis of spontaneously immortalized rat brain neuroblasts: involvement of
nonsterol isoprenoid biosynthesis inhibition. Mol. Cell Neurosci. 17: 329-341.
126
Bibliografía
Geyer M, Wittinghofer A. (1997). GEFs, GAPs, GDIs and effectors: taking a closer (3D)
look at the regulation of Ras-related GTP-binding proteins. Curr. Opin. Struct. Biol. 7:786–
792.
Ghittoni R, Patrussi L, Pirozzi K, Pellegrini M, Lazzerini PE, Capecchi PL, Pasini FL, Baldari CT. (2005). Simvastatin inhibits T-cell activation by selectively impairing the function
of Ras superfamily GTPases. FASEB J. 19: 605-607.
Giasson BI, Mushynski WE. (1997). Study of proline-directed protein kinases involved in
phosphorylation of the heavy neurofilament subunit. J. Neurosci. 17: 9466-9472.
Gingras AC, Gygi SP, Raught B, Polakiewicz RD, Abraham RT, Hoekstra MF, Aebersold R Sonenberg N. (1999). Regulation of 4E-BP1 phosphorylation: a novel two-step
mechanism. Genes Dev. 13: 1422-1437.
Gingras AC, Raught B, Sonenberg N. (2001). Regulation of translation initiation by
FRAP/mTOR. Genes Dev. 15: 807-826.
Glucksman A. (1951). Cell deaths in normal vertebrate ontogeny. Biol. Rev. 26: 59-86.
Goedert M, Cuenda A, Craxton M, Jakes R, Cohen P. (1997a). Activation of the novel
stress-activated protein kinase SAPK4 by cytokines and cellular stresses is mediated by
SKK3 (MKK6); comparison of its substrate specificity with that of other SAP kinases. EMBO
J. 16: 3563–3571.
Goedert M, Hasegawa J, Craxton M, Leversha MA, Clegg S. (1997b). Assignment of the
human stress-activated protein kinase-3 gene (SAPK3) to chromosome 22q13.3 by
fluorescence in situ hybridization. Genomics. 41: 501–502.
Golden LH, Insogna KL. (2004). The expanding role of PI3-kinase in bone. Bone. 34 : 3-12. Goldstein JL, Brown MS. (1990). Regulation of the mevalonate pathway. Nature. 343: 425-
429.
Gonzalez-Garcia M, Garcia I, Ding L, O'Shea S, Boise LH, Thompson CB, Nunez G. (1995). bcl-x is expressed in embryonic and postnatal neural tissues and functions to prevent
neuronal cell death. Proc. Natl Acad. Sci. USA. 92: 4304–4308.
Graaf MR, Richel DJ, van Noorden CJF, Guchelarr HJ. (2004). Effect of statins and
farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat
Rev. 30: 609-641.
Graham TE, Pfeiffer JR, Lee RJ, Kusewitt DF, Martinez AM, Faotz T, Wilson BS, Oliver JM. (1998). MEK and ERK activation in ras-disabled RBL-2H3 mast cells and novel roles for
geranylgeranylated and farnesylated proteins in Fc ecpsilonRI-mediated signaling. J.
Immunol. 161: 6733-6744.
Gross A, Yin XM, Wang K, Wei MC, Jockel J, Milliman C, Erdjument-Bromage H, Tempst P, Korsmeyer SJ. (1999). Caspase cleaved BID targets mitochondria and is
127
Bibliografía required for cytochrome c release, while BCL-XL prevents this release but not tumour
necrosis factor-R1/Fas death. J. Biol. Chem. 274: 1156–63.
Guan KL, Figueroa C, Brtva TR, Zhu T, Taylor J, Barber TD, Vojtek AB. (2000). Negative
regulation of the serine/threonine kinase B-Raf by Akt. J. Biol. Chem. 275: 27354-27359.
Guijarro C, Blanco-Colio LM, Ortego M, Alonso C, Ortiz A, Plaza JJ, Diaz C, Hernández G, Egido J. (1998). 3-Hidroxy-3methylglutaryl coenzyme A reductase and isoprenylation
inhibitors induce apoptosis of vascular smooth muscle cells in culture. Cir. Res. 83: 490-500.
Hall A. (1998). Rho GTPases and the actin cytoskeleton. Science. ;279:509–14.
Hall C, Michael G, Cann N, Ferrari G, Teo M, Jacobs T, Monfries C, Lim L. (2001).
alpha2-chimaerin, a Cdc42/Rac1 regulator, is selectively expressed in the rat embryonic
nervous system and is involved in neuritogenesis in N1E-115 neuroblastoma cells. J.
Neurosci. 21: 5191–5202.
Hallberg B, Rayter SI, Downward J. (1994). Interaction of Ras and Raf in intact mammalian
cells upon extracellular stimulation. J. Biol. Chem. 269:3913–3916.
Han J, Lee JD, Bibbs L, Ulevitch RJ. (1994). A MAP kinase targeted by endotoxin and
hyperosmolarity in mammalian cells. Science. 265: 808–811.
Hancock JF, Magee AI, Childs JE, Marshall CJ. (1989). All ras proteins are
polyisoprenylated but only some are palmitoylated Cell. 57: 1167–1177.
Hansen HH, Briem T, Dzietko M, Sifringer M, Voss A, Rzeski W, Zdzisinska B, Thor F, Heumann R, Stepulak A, Bittigau P, Ikonomidou C. (2004). Mechanisms leading to
disseminated apoptosis following NMDA receptor blockade in the developing rat brain.
Neurobiol. Dis.16: 440-453.
Hara T, Hamada J, Yano S, Morioka M, Kai Y, Ushio Y. (2003). CREB is required for
acquisition of ischemic tolerance in gerbil hippocampal CA1 region. J. Neurochem. 86: 805–
814.
Harper SJ, LoGrasso P. (2001) Signalling for survival and death in neurones: the role of
stress-activated kinases, JNK and p38. Cell Signal. 13: 299–310.
Harris CA, Deshmukh M, Tsui-Pierchala B, Maroney AC, Johnson Jr EM. (2002).
Inhibition of the c-Jun N-terminal kinase signalling pathway by the mixed lineage kinase
inhibitor CEP-1347 (KT7515) preserves metabolism and growth of trophic factor-deprived
neurons. J. Neurosci. 22: 103–113.
Harris CA, Johnson EM Jr. (2001). BH3-only BCL-2 family members are coordinately
regulated by the JNK pathway and re-quire BAX to induce apoptosis in neurons. J. Biol.
Chem. 276: 37754–37760. Hawkins PT, Jackson TR, Stephens LR. (1992). Platelet-derived growth factor stimulates
synthesis of PtdIns(3,4,5)P3 by activating a PtdIns(4,5)P2 3-OH kinase. Nature. 358 : 157-
159.
128
Bibliografía
Hengartner MO, Horvitz RH. (1994). C. elegans cell survival gene ced-9 encodes a
functional homolog of the mammalian ptotooncogen bcl-2. Cell. 76: 665-676.
Hetman M, Gozdz A. (2004). Role of extracellular signal regulated kinases 1 and 2 in
neuronal survival. Eur. J. Biochem. 271: 2050-2055.
Hibi M, Lin A, Smeal T, Minden A, Karin M. (1993). Identification of an oncoprotein and UV
responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes
Dev. 7: 2135-2148.
Hillyard DZ, Cameron AJ, McIntyre AH, Hadden MH, Marshall HE, Johnston N, Jardine AG. (2002). Inhibition of proliferation and signalling mechanisms in human lymphocytes by
fluvastatin. Clin. Exp. Pharmacol. Physiol. 29: 673-678.
Holcik M, Sonenberg N, Korneluk RG. (2000). Internal ribosome initiation of translation and
the control of cell death. Trends Genet. 16: 469-473.
Holland EC, Sonenberg N, Pandolfi PP, Thomas G. (2004). Signalling control of mRNA
translation in cancer pathogenesis. Oncogene. 23: 3138-3144.
Holz MK, Ballif BA, Gygi SP, Blenis J. (2005). mTOR and S6K1 mediate assembly of the
translation preinitiation complex through dynamic protein interchange and ordered
phosphorylation events. Cell. 123: 569-580.
Hresko RC, Mueckler M. (2005). mTOR-RICTOR is the Ser473 Kinase for Akt/Protein
Kinase B in 3T3-L1 Adipocytes. J. Biol. Chem. 280: 40406-40416.
Huang C, Jacobson K, Schaller MD. (2004). A role for JNK-paxillin signalling in cell
migration. Cell Cycle. 3: 4-6.
Hunot S, Vila M, Teismann P, Davis RJ, Hirsch EC, Przedborski S, Rakic P, Flavell RA. (2004). JNK-mediated induction of cyclooxygenase 2 is required for neurodegeneration in a
mouse model of Parkinson’s disease. Proc. Natl. Acad. Sci. USA. 101: 665–670.
Jaworski J, Mioduszewska B, Sanchez-Capelo A, Figiel I, Habas A, Gozdz A, Proszynski T, Hetman M, Mallet J, Kaczmarek L. (2003). Inducible cAMP early repressor,
an endogenous antagonist of cAMP responsive element-binding protein, evokes neuronal
apoptosis in vitro. J. Neurosci. 23: 4519–4526.
Jefferies, HB, Fumagalli S, Dennis PB, Reinhard C, Pearson RB, Thomas G. (1997).
Rapamycin suppresses 5´-TOP mRNA translation through inhibition of p70s6k. EMBO J. 16:
3693–3704.
Jiang Y, Chen C, Li Z, Guo W, Gegner JA, Lin S, Han J. (1996). Characterization of the
structure and function of a new mitogen-activated protein kinase (p38beta). J. Biol. Chem.
271: 17920–17926.
Jiang Y, Gram H, Zhao M, New L, Gu J, Feng L, Di Padova F, Ulevitch RJ, Han J. (1997).
Characterization of the structure and function of the fourth member of p38 group mitogen-
activated protein kinases, p38delta. J. Biol. Chem. 272: 30122–30128.
129
Bibliografía Jiang T, Qiu Y. (2003). Interaction between Src and a C-terminal proline-rich motif of Akt is
required for Akt activation. J. Biol. Chem. 278: 15789-15793.
Jiang Z, Zheng X, Lytle RA, Higashikubo R, Rich KM. (2004). Lovastatin-induced up-
regulation of the BH3-only protein, Bim, and cell death in glioblastoma cells. J. Neurochem.
89: 168-178.
Jin HO, Park IC, An S, Lee HC, Woo SH, Hong YJ, Lee SJ, Park MJ, Yoo DH, Rhee CH, Hong SI. (2006). Up-regulation of Bak and Bim via JNK downstream pathway in the
response to nitric oxide in human glioblastoma cells. J. Cell Physiol. 206: 477-486.
Johnson GL , Lapadat R. (2002). Mitogen-activated protein kinase pathways mediated by
ERK, JNK, and p38 protein kinases. Science. 298: 1911–1912.
Johnson MD, Woodard A, Okediji EJ, Toms SA, Allen GS. (2002) Lovastatin is a potent
inhibitor of meningioma cell proliferation: Evidence for inhibition of a mitogen associated
protein kinase. J. Neurooncol. 56: 133-142.
Jones KD, Couldwell WT, Hinton DR, Su Y, He S, Anker L, Law RE. (1994). Lovastatin
induces growth inhibition and apoptosis in human malignant glioma cells. Biochem. Biophys.
Res. Commun. 205: 1681-1687.
Juretic N, Santibanez JF, Hurtado C and Martinez J. (2001). ERK 1,2 and p38 pathways
are involved in the proliferative stimuli mediated by urokinase in osteoblastic SaOS-2 cell
line. J. Cell. Biochem. 83: 92–98.
Kanamoto T, Mota M, Takeda K, Rubin LL, Miyazono K, Ichijo H, Bazenet CE. (2000).
Role of apoptosis signal-regulating kinase in regulation of the c-Jun N-terminal kinase
pathway and apoptosis in sympathetic neurons. Mol. Cell. Biol. 20: 196–204.
Kaneta S, Satoh K, Kano S, Kanda M, Ichihara K. (2003). All hydrophobic HMG-CoA
reductase inhibitors induce apoptotic death in rat pulmonary vein endothelial cells.
Atherosclerosis. 170: 237-243.
Kanzawa T, Iwado E, Aoki H, Iwamaru A, Hollingsworth EF, Sawaya R, Kondo S, Kondo Y. (2006). Ionizing radiation induces apoptosis and inhibits neuronal differentiation in rat
neural stem cells via the c-Jun NH(2)-terminal kinase (JNK) pathway. Oncogene. En prensa.
Kaplan D, Miller F. (2001). Neurotrophin signal transduction in the nervous system. Curr.
Opin. Neurobiol. 10: 381–391.
Karin M, Liu ZG, Zandi E. (1997). AP-1 function and regulation. Curr. Opin. Cell Biol. 9:
240–246.
Kawasaki H, Morooka T, Shimohama S, Kimura J, Hirano T, Gotoh Y, Nishida E. (1997).
Activation and involvement of p38 mitogen-activated protein kinase in glutamate-induced
apoptosis in rat cerebellar granule cells. J. Biol. Chem. 272: 18518–18521.
Kazlauskas A. (1994). Receptor tyrosine kinases and their targets. Curr. Opin. Genet. Dev.
4: 5-14.
130
Bibliografía
Kerr JFR, Wyllie AH, Curie AR. (1972). Apoptosis: a basic biological phenomenon with
wide-ranging implications in tissue kinectics. Br. J. Cancer. 26: 239-257.
Khanzada UK, Pardo OE, Meier C, Downward J, Seckl MJ, Arcaro A. (2006). Potent
inhibition of small-cell lung cancer cell growth by simvastatin reveals selective functions of
Ras isoforms in growth factor signalling. Oncogene. 25: 877-887.
Khwaja A, Rodriguez-Viciana P, Wennstrom S, Warne PH, Downward J. (1997) Matrix
adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein
kinase B/Akt cellular survival pathway. EMBO J. 16: 2783–2793.
Kibayashi E, Urakaze M, Kobashi C, Kishida M, Takata M, Sato A, Yamazaki K, Kobayashi M. (2005). Inhibitory effect of pitavastatin (NK-104) on the C-reactive-protein-
induced interleukin-8 production in human aortic endothelial cells. Clin. Sci. 108: 515-521.
Kita T, Brown MS, Goldstein JL. (1980). Feedback regulation of 3-hydroxy-3-methylglutaryl
coenzyme A reductase in livers of mice treated with mevinolin, a competitive inhibitor of the
reductase. J. Clin. Invest. 66(5): 1094-100.
Kolch W, Heidecker G, Kochs G, Hummel R, Vahidi H, Mischak H, Finkenzeller G,
Marme D, Rapp UR. (1993). Protein kinase C alpha activates RAF-1 by direct
phosphorylation. Nature. 364: 249-252.
Kolch W. (2000). Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway
by protein interactions. Biochem J. 351: 289–305.
Kotti TJ, Ramirez DM, Pfeiffer BE, Huber KM, Russell DW. (2006). Brain cholesterol
turnover required for geranylgeraniol production and learning in mice. Proc. Natl. Acad. Sci.
U S A. 103: 3869-3874.
Koyuturk M, Ersoz M, Altiok N. (2004). Simvastatin induces proliferation inhibition and
apoptosis in C6 glioma cells via c-jun N-terminal kinase. Neurosci. Lett. 370: 212-217.
Krebs EG, Fischer EH. (1956). The phosphorylase b to a converting enzyme of rabbit
skeletal muscle. Biochim. Biophys. Acta. 20: 150-157.
Ku H, Meier KE. (2000). Phosphorylation of paxillin via the ERK mitogen-activated protein
kinase cascade in EL4 thymoma cells. J. Biol. Chem. 275: 11333-11340. Kuan CY, Yang DD, Roy DRS, Davis RJ, Rakic P, Flavell RA. (1999). The JNK1 and JNK2
protein kinases regulate regional-speci®c apoptosis during early brain development. Neuron.
22: 667-676.
Kuan CY, Roth KA, Flavell RA, Rakic P. (2000). Mechanisms of programmed cell death in
the developing brain. Trends Neurosci. 23: 291-297.
Kuida K, Haydar TF, Kuan CY, Gu Y, Taya C, Karasuyama H, Su MS, Rakic P, Flavell RA. (1998). Reduced apoptosis and cytochrome c-mediated caspase activation in mice
lacking caspase 9. Cell. 94: 325–337.
131
Bibliografía Kuida K, Zheng TS, Na S, Kuan C, Yang D, Karasuyama H, Rakic P, Flavell RA. (1996).
Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature.
384: 368–372.
Kuipers HF, Rappert AA, Mommaas AM, van Haastert ES, van der Valk P, Boddeke HW, Biber KP, van den Elsen PJ. (2006). Simvastatin affects cell motility and
actincytoskeleton distribution of microglia. Glia. 53: 115-123. Kureishi Y, Luo Z, Shiojima I, Bialik A, Fulton D, Lefer DJ, Sessa WC, Walsh K. (2000).
The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes
angiogenesis in normocholesterolemic animals. Nat. Med. 6: 1004-1110.
Kyriakis JM. (1999). Signaling by the germinal center kinase family of protein kinases, J.
Biol. Chem. 274: 5259–5262.
Kyriakis JM, Avruch J. (1990). pp54 microtubule-associated protein 2 kinase. A novel
serine/threonine protein kinase regulated by phosphorylation and stimulated by poly-L-lysine.
J. Biol. Chem. 265: 17355–17363.
Kyriakis JM, Avruch J. (2001). Mammalian mitogen-activated protein kinase signal
transduction pathways activated by stress and inflammation. Physiol. Rev. 81: 807–869.
Lawlor MA, Alessi DR. (2001). PKB/Akt: a key mediator of cell proliferation, survival and
insulin responses? J. Cell Sci. 114: 2903-2910.
Le SS, Loucks FA, Udo H, Richardson-Burns S, Phelps RA, Bouchard RJ, Barth H, Aktories K, Tyler KL, Kandel ER, Heidenreich KA, Linseman DA. (2005). Inhibition of
Rac GTPase triggers a c-Jun- and Bim-dependent mitochondrial apoptotic cascade in
cerebellar granule neurons. J. Neurochem. 94: 1025-1039.
Lee JH, Koh H, Kim M, Park J, Lee SY, Lee S, Chung J. (2005). JNK pathway mediates
apoptotic cell death induced by tumor suppressor LKB1 in Drosophila. Cell Death Differ.
Lee JC, Laydon JT, McDonnell PC, Gallagher TF, Kumar S, Green D, McNulty D, Blumenthal MJ, Heys JR, Landvatter SW et al. (1994). A protein kinase involved in the
regulation of inflammatory cytokine biosynthesis. Nature 372: 739–746.
Lee W, Mitchell P, Tijan R. (1987). Purified transcription factor AP-1 interacts with TPA-
inducible enhancer elements. Cell. 49: 741-52.
Leevers SJ, Vanhaesebroeck B, Waterfield MD. (1999). Signalling through
phosphoinositide 3-kinases: the lipids take centre stage. Curr. Opin. Cell Biol. 11:219-225.
Le-Niculescu H, Bonfoco E, Kasuya Y, Claret FX, Green DR, Karin M. (1999) Withdrawal
of survival factors results in activation of the JNK pathway in neuronal cells leading to Fas
ligand induction and cell death. Mol. Cell. Biol. 19: 751–763.
Lewis TS, Shapiro PS, Ahn NG. (1998). Signal transduction through MAP kinase cascades.
Adv. Cancer Res. 74:49–139.
132
Bibliografía
Li MH, Jang JH, Surh YJ. (2005). Nitric oxide induces apoptosis via AP-1-driven
upregulation of COX-2 in rat pheochromocytoma cells. Free Radic. Biol. Med. 39: 890-899.
Li W, Cui Y, Kushner SA, Brown RA, Jentsch JD, Frankland PW, Cannon TD, Silva AJ. (2005). The HMG-CoA reductase inhibitor lovastatin reverses the learning and attention
deficits in a mouse model of neurofibromatosis type 1. Curr. Biol. 15: 1961-1967.
Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. (1997).
Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an
apoptotic protease cascade. Cell. 91: 479–489.
Li S, Sonenberg N, Gingras AC, Peterson M, Avdulov S, Polunovsky VA, Bitterman PB. (2002). Translational control of cell fate: availability of phosphorylation sites on translational
repressor 4E-BP1 governs its proapoptotic potency. Mol. Cell Biol. 22: 2853-2861.
Li S, Takasu T, Perlman DM, Peterson MS, Burrichter D, Avdulov S, Bitterman PB, Polunovsky VA (2003). Translational factor eIF4E rescues cells from Myc-dependent
apoptosis by inhibiting cytocrome c release. J Biol Chem 278: 3015-3022.
Li S, Perlman DM, Peterson MS, Burrichter D, Avdulov S, Polunovsky VA, Bitterman PB. (2004). Translation initiation factor 4E blocks endoplasmic reticulum-mediated apoptosis.
J. Biol. Chem. 279: 21312-21317.
Liu B, Fang M, Lu Y, Mills GB and Fan Z. (2001). Involvement of JNK-mediated pathway in
EGF-mediated protection against paclitaxel-induced apoptosis in SiHa human cervical
cancer cells. Br. J. Cancer. 85: 303–311.
Lonze BE, Ginty DD. (2002). Function and regulation of CREB family transcription factors in
the nervous system. Neuron. 35: 605– 623.
Lorenzo MJ, Gish GD, Houghton C, Stonehouse TJ, Pawson T, Ponder BAJ, Smith DP. (1997). RET alternate splicing influences the interaction of activated RET with the SH2 and
PTB domains of Shc, and the SH2 domains of Grb2. Oncogene. 14: 763-771.
Mabuchi T, Kitagawa K, Kuwabara K, Takasawa K, Ohtsuki T, Xia Z, Storm D, Yanagihara T, Hori M, Matsumoto M. (2001). Phosphorylation of cAMP response element-
binding protein in hippocampal neurons as a protective response after exposure to glutamate
in vitro and ischemia in vivo. J. Neurosci. 21: 9204 –9213.
Macara IG, Lounsbury KM, Richards SA, Mckiernan C, Bar-Sagi D. (1996). The ras
superfamily of GTPases. FASEB J. 10: 625-630.
Maltese WA, Volpe JJ. (1979). Developmental changes in the distribution of 3-hydroxy-3-
methylglutaryl coenzyme A reductase among subcellular fractions of rat brain. J. Neurochem.
33: 107-115.
Marks N, Berg MJ. (1999). Recent advances on neuronal caspases in development and
neurodegeneration. Neurochem. Int. 35: 195-200.
133
Bibliografía Marte BM, Downward J. (1997). PKB/Akt: connecting phosphoinositide 3-Kinase to cell
survival and beyond. Trends Biochem. Sci. 22: 355-358.
Matsuzawa A, Ichijo, H. (2001). Molecular mechanisms of the decision between life and
death: regulation of apoptosis by apoptosis signal-regulating kinase 1. J. Biochem. 130: 1–8.
Matthies H Jr, Schulz S, Hollt V, Krug M. (1997). Inhibition by compactin demonstrates a
requirement of isoprenoid metabolism for long-term potentiation in rat hippocampal slices.
Neuroscience. 79: 341-346.
Matzno S, Yasuda S, Juman S, Yamamoto Y, Nagareya-Ishida N, Tazuya-Murayama K, Nakabayashi T, Matsuyama K. (2005). Statin-induced apoptosis linked with membrane
farnesylated Ras small G protein depletion, rather than geranylated Rho protein. J. Pharm.
Pharmacol. 57: 1475-1484.
Mauch DH, Nagler K, Schumacher S, Goritz C, Muller EC, Otto A, Pfrieger FW. (2001).
CNS synaptogenesis promoted by glia-derived cholesterol. Science. 294: 1354– 1357.
McDonald PH, Chow CW, Miller WE, Laporte SA, Field ME, Lin FT, Davis RJ, Lefkowitz RJ. (2000). Beta-arrestin 2: a receptor-regulated MAPK scaffold for the activation of JNK3. Science. 290: 1574–1577.
McGuire TF, Corey SJ, Sebti SM. (1993). Lovastatin inhibits platelet-derived growth factor
(PDGF) stimulation of phosphatidylinositol 3-kinase activity as well as association of p85
subunit to tyrosine-phosphorylated PDGF receptor. J. Biol. Chem. 268: 22227–22230.
McGuire TF, Xu XQ, Corey SJ, Romero GG, Sebti SM. (1994). Lovastatin disrupts early
events in insulin signaling: a potential mechanism of lovastatin’s anti-mitogenic activity.
Biochem. Biophys. Res. Commun. 204: 399–406.
McGuire TF, Qian Y, Vogt A, Hamilton AD, Sebti SM. (1996). Platelet-derived growth
factor receptor tyrosine phosphorylation requires protein geranylgeranylation but not
farnesylation. J. Biol. Chem. 271: 27402–27407.
McMahon LP, Choi KM, Lin TA, Abraham RT, Lawrence JC. (2002). The rapamycin-
binding domain governs substrate selectivity by the mammalian target of rapamycin. Mol.
Cell. Biol. 22: 7428-7438.
Medema RH, Kops GJ, Bos JL, Burgering BM. (2000). AFX-like Forkhead transcription
factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature. 404: 782-
787.
Melchert RB, Liu H, Granberry MC, Kennedy RH. (2001). Lovastatin inhibits
phenylephrine-induced ERK activation and growth of cardiac. Cardiovasc. Toxicol.1: 237–
252.
Merry DE, Korsmeyer SJ. (1997). Bcl-2 gene family in the nervous system. Annu. Rev.
Neurosci. 20: 245–267.
134
Bibliografía
Metzstein MM, Stanfield GM, Horvitz HR. (1998). Genetics of programmed cell death in C.
elegans: past, present and future. Trends Genet. 14: 410–416.
Michikawa M, Yanagisawa K. (1999). Inhibition of cholesterol production but not of
nonsterol isoprenoid products induces neuronal cell death. J. Neurochem. 72: 2278-2285.
Miura S, Matsuo Y, Saku K. (2004). Simvastatin suppresses coronary artery endotelial tube
formation by disrupting Ras/Raf/ERK signaling. Atherosclerosis. 175:235-243.
Mielke K, Herdegen T. (2000). JNK and p38 stress kinases-degenerative effectors of signal-
transduction-cascades in the nervous system. Prog. Neurobiol. 61: 45–60.
Morooka T, Nishida E. (1998). Requirement of p38 mitogen activated protein kinase for
neuronal differentiation in PC12 cells. J. Biol. Chem. 273: 24285–24288.
Mossman T. (1983). Rapid colorimetric assay for cellular growth and survival: Application to
proliferation and cytotoxicity assays. J. Immunol. 65: 55-63.
Muñoz A, Wrighton C, Seliger B, Bernal J, Beug H. (1993). Thyroid hormone receptor/c-
erbA: Control of commitment and differentiation in the neuronal / chromaffin progenitor line
PC12. J. Cell Biol. 121: 423-438.
Murata M, Peranen J, Schreiner R, Wieland F, Kurzchalia TV, Simons K. (1995).
VIP21/caveolin is a cholesterol-binding protein. Proc. Natl. Acad. Sci. U S A. 92: 10339-
10343.
Nakagawa H, Mutoh T, Kumano T, Kuriyama M. (1998). HMG-CoA reductase inhibitor-
induced L6 myoblast cell death: involvement of the phosphatidylinositol 3-kinase pathway.
FEBS Letters. 438: 289-292.
Nakazawa T, Tamai M, Mori N. (2002). Brain-derived neurotrophic factor prevents
axotomized retinal ganglion cell death through MAPK and PI3K signaling pathways. Invest.
Ophthalmol. Vis. Sci. 43: 3319–3326.
Negre-Aminou P, van Vliet AK, van Erck M, van Thiel GC, van Leeuwen RE, Cohen LH. (1997). Inhibition of proliferation of human smooth muscle cells by various HMG-CoA
reductase inhibitors: comparison with other human cell types. Biochim. Biophys. Acta. 1345:
259–268.
Nishida S, Matsuoka H, Tsubaki M, Tanimori Y, Yanae M, Fujii Y, Iwaki M. (2005).
Mevastatin induces apoptosis in HL60 cells dependently on decrease in phosphorylated
ERK. Mol. Cell. Biochem. 269: 109-114.
Nishina H, Nakagawa K, Azuma N, Katada T. (2003). Activation mechanism and
physiological roles of stress-activated protein kinase/c-Jun NH2-terminal kinase in
mammalian cells. J. Biol. Regul. Homeost. Agents. 17: 295-302.
Oh HL, Seok JY, Kwon CH, Kang SK, Kim YK. (2006). Role of MAPK in ceramide-induced
cell death in primary cultured astrocytes from mouse embryonic brain. Neurotoxicology. 27:
31-38.
135
Bibliografía Okuno S, Saito A, Hayashi T, Chan PH. (2004). The c-Jun N-terminal protein kinase
signaling pathway mediates Bax activation and subsequent neuronal apoptosis through
interaction with Bim after transient focal cerebral ischemia. J. Neurosci. 24: 7879-7887.
Oliver FJ, de la Rubia G, Rolli V, Ruiz-Ruiz MC, de Murcia G, Murcia JM. (1998).
Importante of poly (ADP-ribose) polymerase and its cleavage in apoptosis. Lesson from an
uncleavable mutant. J. Biol. Chem. 273: 33533-33539.
Omoigui S. (2005). Cholesterol synthesis is the trigger and isoprenoid dependent
interleukin-6 mediated inflammation is the common causative factor and therapeutic target
for atherosclerotic vascular disease and age-related disorders including osteoporosis and
type2 diabetes. Med. Hypotheses. 65: 559-569.
Ono K, Han J. (2000). The p38 signal transduction pathway: activation and function. Cell
Signal. 12: 1–13.
Opitz JM, De la Cruz F. (1994). Cholesterol metabolism in the RSH/Smith-Lemli-Opitz
syndrome: Summary o an NICHD conference. Am. J. Med. Genet. 50: 326-338.
O’Reilly LA, Cullen L, Visvader J, Lindeman GJ, Print C, Bath ML, Huang DCS, Strasser A. (2000). The proapoptotic BH3-only protein Bim is expressed in hematopoietic, epithelial,
neuronal, and germ cells. Am. J. Pathol. 157: 449–461.
Otsuki T, Sakaguchi H, Hatayama T, Fujii T, Tsujioka T, Sugihara T, Takata A, Hyodoh F, Eto M. (2004). Effects of an HMG-CoA reductase inhibitor, simvastatin, on human
myeloma cells. Oncol. Rep. 11: 1053-1058.
Padayatty SJ, Marcelli M, Shao TC, Cunningham GR. (1997). Lovastatin-induced
apoptosis in prostate stromal cells. J. Clin. Endocrinol. Metab. 82: 1434-1439.
Palmada M, Kanwal S, Rutkoski NJ, Gufstafson-Brown C, Johnson RS, Wisdom R, Carter BD. (2002). c-jun is essential for sympathetic neuronal death induced by NGF
withdrawal but not by p75 activation. J. Cell Biol. 158: 453–461.
Panaretou C, Domin J, Cockcroft S, Waterfield MD. (1997). Characterization of p150, an
adaptor protein for the human phosphatidylinositol (PtdIns) 3-kinase. J. Biol. Chem. 272:
2477– 2485.
Patapoutian A, Reichardt L. (2001). Trk receptors: mediators of neurotrophin action. Curr.
Opin. Neurobiol. 11: 272–280.
Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH. (2001). Mitogen-activated protein (MAP) kinase pathways: regulation and
physiological functions. Endocrinol. Rev. 22: 153–183.
Pérez-Sala D, Mollinedo F. (1994). Inhibition of isoprenoid biosynthesis induces apoptosis
in human promielocytic HL-60 cells. Biochem. Biophys. Res. Commun. 199: 1209-1215.
Polunovsky VA, Rosenwald IB, Tan AT, White J, Chiang L, Sonenberg N, Bitterman PB (1996). Translational control of programmed cell death: eukaryotic translation initiation factor
136
Bibliografía
4E blocks apoptosis in growth-factor-restricted fibroblasts with physiologically expressed o
deregulated Myc. Mol Cell Biol 16: 6573-6581.
Ponting C, Benjamin D. (1996). A novel family of Ras-binding domains. Trends Biochem.
Sci. 21: 422-425.
Porcile C, Stanzione S, Piccioli P, Bajetto A, Barbero S, Bisaglia M, Bonavia R, Florio T, Schettini G. (2003). Pyrrolidinedithiocarbamate induces apoptosis in cerebellar granule
cells: involvement of AP-1 and MAP kinases. Neurochem. Int. 43: 31-38.
Porras A, Zuluaga S, Black E, Valladares A, Alvarez AM, Ambrosino C, Benito M, Nebreda AR. (2004). P38 alpha mitogen-activated protein kinase sensitizes cells to
apoptosis induced by different stimuli. Mol Biol Cell. 15: 922–933.
Porter JA, Young KE, Beachy PA. (1996). Cholesterol modification of hedgehog signaling
proteins in animal development. Science. 274: 255-259.
Prasad R, Giri S, Nath N, Singh I, Singh AK. (2005). Inhibition of phosphoinositide 3
kinase-Akt (protein kinase B)-nuclear factor-kappa B pathway by lovastatin limits endothelial-
monocyte cell interaction. J. Neurochem. 94: 204-214.
Pronk GJ, Bos JL. (1994). The role of p21ras in receptor tyrosine kinase signalling. Biochim
Biophys Acta. 1198: 131–47.
Putcha GV, Le S, Frank S, Besirli CG, Clark K, Chu B, Alix S, Youle RJ, LaMarche A, Maroney AC, Johnson Jr. EM. (2003). JNK-mediated BIM phosphorylation potentiates
BAX-dependent apoptosis. Neuron. 38: 899–914.
Quilliam LA, Mueller H, Bohl BP, Prossnitz V, Sklar LA, Der CJ, Bokoch GM. (1991). Rap1A is a substrate for cyclic AMP-dependent protein kinase in human neutrophils. J
Immunol. 147: 1628-1635. Rabelo FL, Ropert C, Ramos MG, Bonjardim CA, Gazzinelli RT, Alvarez-Leite JI. (2003).
Inhibition of ERK1/2 and CREB phosphorylation by caspase-dependent mechanism
enhances apoptosis in fibrosarcoma cell line treated with butyrate. Biochem. Biophys. Res.
Comm. 303: 968-972.
Raff MC, Barres BA, Burne JF, Coles HS, Ishizaki Y, Jacobson MD. (1993). Programmed
cell death and the control of cell survival: lessons from the nervous system. Science. 262:
695-700.
Raiteri M, Arnaboldi L, McGeady P, Gelb MH, Verri D, Tabliabue C, Quarato P, Ferraboschi P, Santaniello E, Paoletti R, Fumagalli R, Corsini A. (1997).
Pharmacological control of the mevalonate pathway: effect on arterial smooth muscle cell
proliferation. J. Pharmacol. Exp. Ther. 281: 1144-1153.
Rameh LE, Chen CS, Cantley LC. (1995). Phosphatidylinositol (3,4,5)P3 interacts with SH2
domains and modulates PI 3-kinase association with tyrosine-phosphorylated proteins. Cell.
83: 821-830.
137
Bibliografía Rameh LE, Arvidsson A, Carraway KL 3rd, Couvillon AD, Rathbun G, Crompton A, VanRenterghem B, Czech MP, Ravichandran KS, Burakoff SJ, Wang DS, Chen CS, Cantley LC. (1997). A comparative analysis of the phosphoinositide binding specificity of
pleckstrin homology domains. J. Biol. Chem. 272: 22059-22066.
Rameh LE, Cantley LC. (1999). The role of phosphoinositide 3-kinase lipid products in cell
function. J. Biol. Chem. 274: 8347-8350.
Rando RR. (1996). Chemical biology of protein isoprenylation/methylation. Biochim.
Biophys. Acta. 1300: 5–16.
Repasky GA, Chenette EJ, Der CJ. (2004). Renewing the conspiracy theory debate : does
Raf function alone to mediate Ras oncogenesis?. Trends Cell Biol. 14: 639-647.
Reynolds CH, Utton MA, Gibb GM, Yates A, Anderton BH. (1997). Stress-activated
protein kinase/c-jun N-terminal kinase phosphorylates tau protein. J. Neurochem. 68: 1736-
1744.
Rodgers EE, Theibert AB. (2002). Functions of PI 3-kinase in development of the nervous
system. Int. J. Dev. Neurosci. 20:187-197.
Rodríguez-Viciana P, Warne PH, Vanhaesebroeck B, Waterfiled MD, Downward J. (1996). Activation of phosphoinositide 3-kinase by interaction with Ras and by point mutation.
EMBO J. 15: 2442-2451.
Rouse J, Cohen P, Trigon S, Morange M, Alonso-Llamazares A, Zamanillo D, Hunt T, Nebreda AR. (1994). A novel kinase cascade triggered by stress and heat shock that
stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins. Cell. 78:
1027-1037.
Roux PP, Blenis J. (2004). ERK and p38 MAPK-Activated Protein Kinases: a Family of
Protein Kinases with Diverse Biological Finctions. Microb.Mol.Biol.Rev. 68.2: 320-344.
Sabapathy K, Hu Y, Kallunki T, Schreiber M, David JP, Jochum W, Wagner EF, Karin M. (1999). JNK2 is required for eficient T-cell activation and apoptosis but not for normal
lymphocyte development. Curr. Biol. 9: 116-125.
Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. (2005). Phosphorylation and regulation
of Akt/PKB by the Rictor-mTOR complex. Science. 307: 1098–1101.
Saunders JW Jr. (1966). Death in embryonic systems. Science. 154: 604-612.
Schafer C, Ross SE, Bragado MJ, Groblewski GE, Ernst SA, Williams JA. (1998). A role
for the p38 mitogen-activated protein kinase/Hsp 27 pathway in cholecystokinin-induced
changes in the actin cytoskeleton in rat pancreatic acini. J. Biol. Chem. 273: 24173-24180.
Scheid MP , Woodgett JR. (2003). Unravelling the activation mechanisms of protein kinase
B/Akt. FEBS Lett. 546: 108-112.
Schmid R, Pruitt W, Maness P. (2000). A MAP kinase-signaling pathway mediates neurite
outgrowth on L1 and requires Src-dependent endocytosis. J. Neurosci. 20: 4177–4188.
138
Bibliografía
Schmidt RA, Schneider CJ, Glomset JA. (1984). Evidence for post-translational
incorporation of a product of mevalonic acid into Swiss 3T3 cell proteins. J. Biol. Chem. 259:
10175-10180.
Schroeter H, Boyd CS, Ahmed R, Spencer JP, Duncan RF, Rice-Evans C, Cadenas E. (2003). c-Jun N-terminal kinase (JNK)-mediated modulation of brain mitochondria function:
new target proteins for JNK signalling in mitochondrion-dependent apoptosis. Biochem. J.
372: 359–369.
Schulz JG, Bosel J, Stoeckel M, Megow D, Dirnagl U, Endres M. (2004). HMG-CoA
reductase inhibition causes neurite loss by interfering with geranylgeranylpyrophosphate
synthesis. J. Neurochem. 89: 24-32.
Schubert KM, Scheid MP, Duronio V. (2000) Ceramide inhibits protein kinase B/Akt by
promoting dephosphorylation of serine 473. J Biol Chem 275: 13330-13335.
Segarra J, Balenci L, Drenth T, Maina F, Lamballe F. (2006). Combined Signaling through
ERK, PI3K/AKT, and RAC1/p38 Is Required for Met-triggered Cortical Neuron Migration. J.
Biol. Chem. 281: 4771-4778.
Shields JM, Pruitt K, McFall A, Shaub A, Der CJ. (2000). Understanding Ras: 'it ain't over
'til it's over'. Trends Cell Biol. 10:147-154.
Shimoke K, Yamagishi S, Yamada M, Ikeuchi T, Hatanaka H. (1999). Inhibition of
phosphatidylinositol 3-kinase activity elevates c-Jun N-terminal kinase activity in apoptosis of
cultured cerebellar granule neurons. Brain. Res. Dev. Brain. Res. 112: 245-253.
Singer CA, Figueroa-Masot XA, Batchelor RH, Dorsa DM. (1999). The mitogen-activated
protein kinase pathway mediates estrogen neuroprotection after glutamate toxicityin primaryc
ortical neurons. J. Neurosci. 19: 2455–2463.
Skaletz-Rorowski A, Muller JG, Kroke A, Waltenberger J, Pulawski E, Pinkernell K, Breithardt G. (2001). Lovastatin blocks basis fibroblast growth factor-induced mitogen-
activated protein kinase signalling in coronary smooth muscle cells via phosphatase
inhibition. Eur. J. Cell Biol. 80: 207-212.
Smart EJ, Ying YS, Conrad PA, Anderson RG. (1994). Caveolin moves from caveolae to
the Golgi apparatus in response to cholesterol oxidation. J. Cell. Biol. 127: 1185-1197.
Spady DK, Dietschy JM. (1983). Sterol synthesis in vivo in 18 tissues of the squirrell
monkey, guinea pig, rabbit, hamster and rat. J. Lipids Res. 24: 303-315.
Stancu C, Sima A. (2001). Statins: mechanism of action and effects. J. Cell. Mol. Med. 5:
378-387.
Stromberg T, Dimberg A, Hammarberg A, Carlson K, Osterborg A, Nilsson K, Jernberg-Wiklund H. (2004). Rapamycin sensitizes multiple myeloma cells to apoptosis
induced by dexamethasone. Blood. 103: 3138-3147.
139
Bibliografía Sturgill TW, Ray LB, Erikson E, Maller JL. (1998). Insulin-stimulated MAP-2 kinase
phosphorylates and activates ribosomal protein S6 kimase II. Nature. 334: 715-718.
Sugiura S, Kitagawa K, Omura-Matsuoka E, Sasaki T, Tanaka S, Yagita Y, Matsushita K, Storm DR, Hori M. (2004). CRE-mediated gene transcription in the peri-infarct area after
focal cerebral ischemia in mice. J. Neurosci. Res. 75: 401-407.
Takai Y, Kaibuchi K, Kikuchi A, Kawata M. (1992). Small GTP-binding proteins. Int. Rev.
Cytol. 133: 187-230.
Takata R, Fukasawa S, Hara T, Nakajima H, Yamashina A, Yanase N, Mizuguchi J. (2004). Cerivastatin-induced apoptosis of human aortic smooth muscle cells through partial
inhibition of basal activation of extracellular signal-regulated kinases Cardiovasc. Pathol. 13:
41-48.
Takeda K, Hatai T, Hamazaki TS, Nishitoh H, Saitoh M, Ichijo, H. (2000). Apoptosis
signal-regulating kinase 1 (ASK1) induces neuronal differentiation and survival of PC12 cells.
J. Biol. Chem. 275: 9805–9813.
Takeda K, Ichijo H. (2002). Neuronal p38 MAPK signalling: an emerging regulator of cell
fate and function in the nervous system. Genes Cells. 7. 1099-1011.
Tanaka T, Tatsuno I, Uchida D, Moroo I, Morio H, Nakamura S, Noguchi Y, Yasuda T, Kitagawa M, Saito Y, Hirai A. (2000). Geranylgeranyl-pirophosphate, an isoprenoid of
mevalonate cascade, is a critical compound for rat primary cultured cortical neurons to
protect the cell death induced by 3-hydroxy-3-methylglutaryl-CoA reductase inhibition. J.
Neurosci. 20: 2852-2859.
Toker A. (2000). Protein kinases as mediators of phosphoinositide 3-kinase signaling. Mol.
Pharmacol. 57: 652–658.
Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN, Flavell RA, Davis RJ. (2000). Requirement of JNK for stress-induced activation of the
cytochrome c-mediated death pathway. Science. 288: 870–874.
Triscari J, Marckowitz JS, McGovern MW. (1993). Pravastatin and lovastatin in
cerebrospinal fluid. Clin. Neuropharmacol. 16: 559-560.
Valjent E, Caboche J, Vanhoutte P. (2001). Mitogen-activated proteinn kinase/extracellular
siganl-regulated kinase induced gene regulation in brain: a molecular substrate for learning
and memory? Mol. Neurobiol. 23: 83-99.
Vanhaesebroeck B, Leevers SJ, Panayotou G, Waterfield MD. (1997). Phosphoinositide
3-kinases: a conserved family of signal transducers. Trends Biochem. Sci. 22: 267-272
Vanhaesebroeck B, Alessi DR. (2000). The PI3-K-PDK1 connection: more than just a road
to PKB. Biochem. J. 346: 561–576
Vgontzas AN, Kales A, Bixler EO, Manfredi RL, Tyson KL. (1991). Effects of lovastatin
and pravastatin on sleep efficiency and sleep stages. Clin. Pharmacol. Ther. 50: 730-737.
140
Bibliografía
Vivanco I, Sawyers CL. (2002). The phosphatidylinositol 3-Kinase AKT pathway in human
cancer. Nat. Rev. Cancer. 2: 489-501.
Wada T, Penninger JM. (2004). Mitogen-activated protein kinases in apoptosis regulation.
Oncogene. 23: 2838-2849.
Waddick KG, Uckun FM. (1998). Innovative Treatment Programs Against Cancer. Ras
oncoprotein as a molecular target. Biochem. Pharmacol. 56: 1411-1426.
Wang XS, Diener K, Manthey CL, Wang S, Rosenzweig B, Bray J, Delaney J, Cole CN, Chan-Hui PY, Mantlo N, Lichenstein HS, Zukowski M, Yao Z. (1997). Molecular cloning
and characterization of a novel p38 mitogen-activated protein kinase. J. Biol. Chem. 272:
23668–23674.
Wang M, Kong Q, Gonzalez FA, Sun G, Erb L, Seye C, Weisman GA. (2005). P2Y
nucleotide receptor interaction with alpha integrin mediates astrocyte migration. J.
Neurochem. 95:630-640.
Wang X, Li W, Williams M, Terada N, Alessi DR, Proud CG. (2001). Regulation of
elongation factor 2 kinase by p90(RSK1) and p70 S6 kinase. EMBO J. 20: 4370-4379.
Wang L, Piguet AC, Schmidt K, Tordjmann T, Dufour JF. (2005). Activation of CREB by
tauroursodeoxycholic acid protects cholangiocytes from apoptosis induced by mTOR
inhibition. Hepatology. 41: 1241-1251.
Weiss RH, Ramirez A, Joo A. (1999). Short term pravastatin mediates growth inhibition and
apoptosis, independently of Ras, via the signalling proteins p27Kip1 and PI3 kinase. J Am.
Soc Nephrol. 10: 1880-1890.
Wen P, Locker J. (1994). A novel hepatocytic transcription factor that binds the alpha-
fetoprotein promoter-linked coupling element. Mol. Cell Biol. 14, 6616-26.
Wendel HG, De Stanchina E, Fridman JS, Malina A, Ray S, Kogan S, Cordon-Cardo C, Pelletier J, Lowe SW. (2004). Survival signalling by Akt and eIF4E in oncogenesis and
cancer therapy. Nature. 428: 332-337.
Werlen G, Hausmann B, Naeher D, Palmer E. (2003). Signaling life and death in the
thymus: timing is everything. Science. 299: 1859–1863.
Weston CR, Balmanno K, Chalmers C, Hadfield K, Molton SA, Ley R. Wagner EF, Cook SJ. (2003). Activation of ERK1/2 by deltaRaf-1:ER* represses Bim expression independently
of the JNK or PI3K pathways. Oncogene. 22: 1281–1293.
Widlak P, Garrard WT. (2005). Discovery, regulation, and action of the major apoptotic
nucleases DFF40/CAD and endonuclease G. J. Cell. Biochem. 94: 1078-1087. Willaime-Morawek S, Brami-Cherrier K, Mariani J, Caboche J, Brugg B. (2003). C-Jun
N-terminal kinases/c-Jun and p38 pathways cooperate in ceramide-induced neuronal
apoptosis. Neuroscience.119: 387-397.
141
Bibliografía Willumsen BM, Christensen A, Hubbert NL, Papageorege AG, Lowry DR. (1984) The
p21 ras C-terminus is required for transformation and membrane association. Nature 310:
583–586. Wisdom R, Johnson RS, Moore C. (1999). c-Jun regulates cell cycle progression and
apoptosis by distinct mechansims. EMBO J. 18: 188-197.
Wolfrum S, Dendorfer A, Schutt M, Weidtmann B, Heep A, Tempel K, Klein HH, Dominiak P, Richardt G. (2004). Simvastatin acutely reduces myocardial reperfusion injury
in vivo by activating the phosphatidylinositide 3-kinase/Akt pathway. J. Cardiovasc.
Pharmacol. 44: 348-355.
Wolozin B, Kellman W, Ruosseau P, Celesia GG, Siegel G. (2000). Decreased
prevalence of Alzheimer disease associated with 3-hydroxy-3-methyglutaryl coenzyme A
reductase inhibitors. Arch. Neurol. 57. 1439– 1443.
Woltman AM, van der Kooij SW, Coffer PJ, Offringa R, Daha MR, van Kooten C. (2003).
Rapamycin specifically interferes with GM-CSF signaling in human dendritic cells, leading to
apoptosis via increased p27KIP1 expression. Blood. 101: 1439-1445.
Wood K, Sarnecki C, Roberts TM, Blenis J. (1992). c-Ras mediates nerve growth factor
receptor modulation of three signal-transducing protein kinases: MAP kinase, Raf-1 and
RSK. Cell. 68:1041–1050.
Wu J, Wong WW, Khosravi F, Minden MD, Penn LZ. (2004). Blocking the Raf/MEK/ERK
pathway sensitizes acute myelogenous leukaemia cells to lovastatin-induced apoptosis.
Cancer Res. 64: 6461-6468.
Wyllie AH, Kerr JFR, Curie AR. (1981). Cell death : the significance of apoptosis. Int. Rev.
Cytol. 68:251-305.
Wyllie AH. (1988). ISI Atlas of Science: Inmunology. pp. 192-196.
Wymann MP, Pirola L. (1998). Structure and function of phosphoinositide 3-kinases.
Biochim. Biophys. Acta. 1436: 127-150.
Wymann MP, Zvelebil M, Laffargue M. (2003). Phosphoinositide 3-kinase signalling- which
way to target?. Trends Pharmacol. Sci. 24: 366-376
Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg, ME. (1995). Opposing effects of
ERK and JNK-p38 MAP kinases on apoptosis. Science. 270: 1326-1331.
Xu XQ, McGuire TF, Blaskovich MA, Sebti SM, Romero G. (1996). Lovastatin inhibits the
stimulation of mitogen-activated protein kinase by insulin in HIRcB fibroblasts. Arch.
Biochem. Biophys. 326: 233–237.
Yanagisawa M, Nakashima K, Takeda K, Ochiai W, Takizawa T, Ueno M, Takizawa M, Shibuya H, Taga T. (2001). Inhibition of BMP2-induced, TAK1 kinase-mediated neurite
outgrowth by Smad6 and Smad7. Genes Cells 6: 1091–1099.
142
Bibliografía
143
Yang SR, Cho SD, Ahn NS, Jung JW, Park JS, Jo EH, Hwang JW, Kim SH, Lee BH, Kang KS, Lee YS. (2005). The role of p38 MAP kinase and c-Jun N-terminal protein kinase
signaling in the differentiation and apoptosis of immortalized neural stem cells. Mutat. Res.
579: 47-57.
Yang DD, Kuan CY, Whitmarsh AJ, Rincon M, Zheng TS, Davis RJ, Rakic P, Flavell RA. (1997). Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the
Jnk3 gene. Nature. 389. 865–870.
Yao R, Cooper GM. (1995). Requirement for phosphatidylinositol 3-kinase in the prevention
of apoptosis by nerve growth factor. Science 279: 673-674.
Yee AS, Paulson EK, McDevitt MA, Rieger-Christ K, Summerhayes I, Berasi Sp, Kim J, Huang CY, Shang X. (2004). The Hbp1 transcriptional repressor and the p38 MAP kinase:
unlikely partners in G1 regulation and tumor suppression. Gene. 336: 1-13.
Yosimichi G, Nakanishi T, Nishida T, Hattori T, Takano-Yamamoto T, Takigawa M. (2001). CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated
protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal
regulated kinase (ERK). Eur. J. Biochem. 268: 6058–6065.
Yuan J, Yankner B. (2000). Apoptosis in the nervous system. Nature. 407: 802–809.
Zhang W, Liu HT. (2002). MAPK signal pathways in the regulation of cell proliferation in
mammalian cells. Cell Res. 12:9-18.
Zhong WB, Liang YC, Wang CY, Chang TC, Lee WS. (2005). Lovastatin suppresses
invasiveness of anaplastic thyroid cancer cells by inhibiting Rho geranylgeranylation and
RhoA/ROCK signaling. Endocr. Relat. Cancer. 12: 615-629.
Zhong WB, Wang CY, Chang TC, Lee WS. (2003). Lovastatin induces apoptosis of
anaplastic thyroid cancer cells via inhibition of protein geranylgeranylation and de novo
protein synthesis. Endocrinology. 144: 3852-3859.
Zhu W, Bijur GN, Styles NA, Li X. (2004). Regulation of FOXO3a by brain-derived
neurotrophic factor in differentiated human SH-SY5Y neuroblastoma cells. Brain Res. Mol.
126: 45–56.
Zhu J.-H, Kulich SM, Oury TD, Chu CT. (2002a). Cytoplasmic aggregates of
phosphorylated extracellular signalregulated kinase in Lewy body diseases. Am. J. Pathol.
161. 2087–2098.
Zhu X, Lee HG, Raina AK, Perry G, Smith MA. (2002b). The role of mitogen-activated
protein kinase pathways in Alzheimer’s disease. Neurosignals. 11: 270–281.
Zou H, Henzel WJ, Liu X, Lutschg A, Wang X. (1997). Apaf-1, a human protein
homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of
caspase-3. Cell. 90: 405–413.