The Isolation, Identification and Characterization of 

Endophytes of Sw m virgatum L.), itchgrass (Panicu

a Bioenergy Crop  

 

 

 

 

Francois Gagne‐Bourque

Master’s of science  

Department of Plant Science 

Faculty of Agricu mental Sciences ltural and Environ

McGill University  

Montr nada  eal, Quebec, Ca

October 2011 

 

 

 

 

 

A thesis t of the   submitted to McGill University in partial fulfillmen

requirements for the deg ee of Master’s of science r

 

 

 

 

 

 

©Copyright 2011 All rights reserved. 

ABSTRACT 

 

It  has  been  established  that  perennial  grasses  harbour  different  types  of 

endophytic  bacteria  and  fungi.  Switchgrass  (Panicum  vergatum  L.)  is 

identified  as  a  model  perennial  energy  crop.  This  study  was  conducted  to 

explore fungal and bacterial endophyte communities  inhabiting switchgrass 

cultivars  of  Quebec.  The  primary  focus  of  this  study  was  to  isolate  the 

endophytes,  and  provide  taxonomic  identifications  based  on  comparative 

analysis of ITS rDNA gene sequences. A total of 145 endophytes isolates were 

recovered (52 bacteria and 93 fungi) from whole plant samples collected at 

early vegetative, and full reproductive stages. Five and nine different taxa of 

bacteria  and  fungi  were  identified,  respectively.    We  evaluated  the 

antagonistic  activity  of  some  endophytes  against  several  fungal  pathogens 

and  selected  candidate  endophytes  for  future  introduction  into  commercial 

switchgrass cultivars for biomass enhancement.  We demonstrate the vertical 

transmission ability of some endophyte  from one switchgrass generation to 

the  next  using  species‐specific  primers.    Artificial  inoculation  of  young 

switchgrass seedlings with selected bacterial endophytes hold promise as a 

ethod of reinfection switchgrass seedlings.  m

 

 

 

 

 

i

Résumé  

Le  panic  érigé    (Panicum  vergatum  L.)  est  reconnu  comme  une  des 

plantes modèles pour la production de biomasse végétale.     Il est connu que 

la plupart des plantes vasculaires étudiées à ce jour sont colonisées par des 

champignons et bactéries endophyte.   Cette étude avait pour but d’explorer 

les communautés d’endophytes présentes dans différents cultivars de panic 

érigé  au  Québec,  pour  ensuite  isoler  les  endophytes  et  effectuer  leur 

identification  taxonomique  en  comparant  leur  séquence  ITS  rADN.    Nous 

avons  obtenu  un  total  de  145  isolats  (52  bactéries  et  93  champignons) 

enant de feuille de plante au stade végétative et au stade reproductive.   v

 

Une  fois  les  isolats  identifiés,  nous  avons  obtenu  cinq  différents 

groupes  taxonomiques  pour  les  bactéries  et  neuf  pour  les  champignons.   

Nous  avons  évalué  le  potentiel  antifongique  des  différents  endophytes 

bactériens,  avec  pour  objectif  d’identifier  les  candidats  potentiels  à  la  ré‐

inoculation  de  cultivar  de  panic  érigé  commercial  afin  augmenter  leur 

production de biomasse.   À  l’aide de séquences d’amorces spécifiques, nous 

avons pu démontrer la transmission verticale des endophytes. 

 

 

 

 

ii

ACKNOWLEDGMENTS I would  like to  thank my supervisor Dr. Suha  Jabaji  for all her  financial and 

moral  support  and  patience  during  my M.Sc  program.    She  taught  me  the 

scientific  thought  process  and  helped  me  edit  countless  times  different 

versions of my thesis.  I would also like to thank my advisory committee, Dr. 

Philippe  Seguin,  Department  of  Plant  Science,  McGill  University  and  Mr. 

Roger  Samson,  R.E.A.P.‐Canada,  Resource  Efficient  Agricultural  Production 

for  their  advice  and  assistance  during  my  studies.    Thanks  also  go  to  my 

fellow  labmates Dr.  Konstantinos Aliferis, Mamta Rani,  Rony  Chamoun  and 

Tanya  Copley  for  their  support,  assistance  and  patience.  I  would  like  to 

demonstrate my gratitude to Rony Chamoun for mentoring me all along my 

project. My parents Anne Gagné and Jean‐Louis Bourque for teaching me the 

work ethics  required to accomplish such work.  Thanks to my good friends, 

David, Louis‐Philippe, Matthew, Rosemarie and Raphaelle who kept me sane 

by helping me clearing my head at night.  I also would like to thank R.E.A.P.‐

Canada for providing me with different switchgrass cultivars and helping me 

in setting up the  field experimental  trials.   A special  thanks  to Ferme Caron 

for    contributing  space  to  set‐up my  field  trials.  I wish  to  acknowledge  the 

funding  agency  Le  Ministere  d’agriculture,  pecherie  et  alimentation  du 

Quebec  (MAPAQ)  for  making  this  work  possible.    Also  I  would  like  to 

acknowledge  the  support  of  the  FQRNT  Regroupement  Stratégique  Center, 

S.È.V.E.  for  contributing  towards  travel  cost  for  attending  scientific 

conferences.   

iii

 

Table of Contents 

Abstract………………………………………………..………………................... 

Résumé……………………

i 

…………………………………………………………. 

Acknowledgemen

ii 

ts…………………………………………………………… 

Table of Cont

iii

ents......................................................................................... 

List of Tables…

iv 

……………………………………………………………………  vi 

vList of Figures……….......……………………………………………………….. 

1.0 In

ii

troduction………………………………………………………………....  1 

1.1 Problem definition………………………………………………...  1 

1.2 Rational for research…………………………………………......  2 

1.3 Objective……………………………………………………………..... 

1.4 Hypotheses…

3 

………………………………………………………… 

2.0 Li

3 

terature review……………………………………………………...…. 

2.1 Switchgrass…………………………………………

5 

………………... 

2.1.1 Switchgrass as Biofuels feedstock………………… 

5 

5 

2.1.2 Switchgrass Cultivars used in North­Eastern 

States Québec and Ontario………………………………….. 

2.2 En tes of grasses……………………………

 

7 

dophy ……………… 

 Balansiaceous fungal endophytes ........

8 

2.2.1. ...............  10

2.2.2 Non­Balansiaceous fungal endophytes...............  11

2.3 Bacterial endophytes…………………………………………..… 

2.4 Beneficial roles of endophytes……

12

………………………….. 

2.4.1 Effects on Plant

14

 Physiology………………………….. 

2.4.2 Photosynthesis ……

15

…………………………………...… 

2.4.2 Drought resistance…………………………………...… 

14

17

iv

2.4.3 Resistance to herbivory…………………………….…  18

2.4.4 Reduction in disease occurrence……………..…… 

. 

19

22.5 Secondary metabolites……………………………………….…

2.6 Common technique for observation, isolation and 

characterization of endophyte…………………………………….. 

0

 

22

2.6.1. Histological staining and tissue observation...  

2.6.2 Surface sterilization.................................................... 

22

23

2.6.3 Maintenance and culture of isolated 

endophytes………………………………………………………… 

2.6.4 Detection ………………………………………………….. 

 

24

25

2.6.5 Identification using morphological 

parameters……………………………………………………...… 

2.6.6 Identificatio  

 

25

n using molecular markers..............

3.0 M

25

aterials and Methods…………………………………………………  27

3.1 Cultivars of switchgrass  ……………………………………….  27

3.2 Field sites and sample selection……………………………..  27

3.3 Sampling and plant sample processing …………………..  28

3.4 Efficacy of sterilization…………………………………………..  30

3.5 Isolation and maintenance of endophytes....................... 

....... 

30

33.6 Identification of fungal and bacterial isolates.........

3.7 Species‐specific primer design and phylogenetic 

.. 

1

analysis.................................................................................................

3.8 Detection of fungal and bacterial endophytes using 

 

33

PCR methods‐ plants and seeds................................................... 

 

33

33.9 Antagonistic study by dual culture method.................... 

3.10 Inoculation of switchgrass seedling with bacterial 

4

 

v

 

 

 

isolate and confirmation of the re‐isolated bacterial.........

4.0 Re

35

sults……………………………………………………………………...…..  37

34.1  Efficacy of sterilization………………………………………

4.2 Survey of Switchgrass endophytes and molecular 

.. 

….  7

identification......................................................................................

4.3 Detection of fungal and bacterial endophytes using 

............... 

 

37

PCR methods‐ plants and seeds....................................

4.4 Antagonistic property of endophytes and re‐ 

inoculatio

 

40

n of switchgrass with endophytes......................... 

5.0 Discussion……………

 

41

……………………………………………………….  42

6.0 Tables and figures………………………………………………………..  49

7.0 Conclusion……………………………………………………...……………. 

8.0 References……………………………………….........................................

62

  64

 

 

 

 

 

 

 

 

 

 

 

 

vi

 

List of Tables  

Table 4.1. List of isolated endophytes, specific and universal 

primers designed and used in polymerase chain reaction 

(PCR) assa …... ys……………………………………………………………………

Table 4.2. Molecular identification of bacterial and fungal 

endophytes from Panicum virgatum L. based on blastN 

queries in ………. 

   94

 NCBI……………………………………………………………

Table 4.3. Dual culture antagonistic experiment using 

different fungi…………………………………………………………………… 

   25

  54

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

vii

viii

List of Figures   

Figure 4.1. Distribution of fungal and bacterial endophytes 

across the   leaf tissues.……………………….. different cultivars and

Figure 4.2.  Antagonistic test of Pantoea ananatis and Bacillus 

subtilis aga ………... 

 

55

inst Rhizoctonia solani………………………………

Figure 4.3. Maximum likelihood phylogenic tree of all 

putative en .. 

 

65

dophytic bacteria……………………………………………….

Figure 4.4. Example of PCR detection of fungal and bacterial 

endophytes detection in different switchgrass cultivars using 

species‐spe ………………………. 

 

75

cific primers………………………………

Figure 4.5. PCR detection of Bacillus subtilis, Microbacterium 

testaceum and example of vertical transmission of the fungal 

ndophyte Epicoccum nigrum……………………………………………… 

 

 

95

e 

 

 

60

 

 

 

 

 

 

 

 

 

 

Chapter I Introduction 

1.1 Problem Definition

The  need  to  find  sustainable  alternatives  to  replace  increasingly  expensive  fossil 

fuels and to reduce greenhouse gas (GHG) emissions has peaked interest in biofuels around 

the world. Biofuel produced from renewable biological resources such as plant biomass and 

treated  municipal  and  industrial  wastes,  is  envisaged  as  being  part  of  the  solution.  For 

example, the Québec Energy Strategy for 2006‐2015 was established in order to reduce the 

consumption of  fossil  fuels  and promote  renewable  fuels.  In particular,  the use of  annual 

grains such as corn for biofuel production is discouraged in Québec and priority is given to 

energy  crops.  Perennial  energy  crops more  effectively  capture  and  store  solar  energy  as 

biomass through photosynthesis, increase the overall energy produced per hectar, and are 

productive  on marginal  farmland.    In  1985,  the  USA  began  a  5‐year  program  to  develop 

herbaceous  energy  crops.  Switchgrass  (Panicum  vergatum  L.)  was  identified  as  a  model 

herbaceous  energy  crop  species  (Samson,  1991).  Switchgrass  had  a  number  of  positive 

attributes  especially  being  a  productive  long‐lived perennial  crop with  high  resource  use 

efficiency and good adaptability to marginal soils (McLaughlin and Kszos, 2005). The first 

scientific  studies  in  Canada  on  switchgrass  were  subsequently  conducted  by  Resource 

Efficient  Agricultural  Production  (REAP)‐Canada  in  1991.  These  studies  proved  that 

switchgrass is well adapted to Québec and Ontario environment and productive in Quebec 

1

and  Ontario  (Samson,  1997),  and  that  it  has  an  excellent  energy  balance,  low  cost  of 

production  and  an  ability  to  increase  landscape  carbon  sequestration  and  an  ability  to 

increase landscape carbon (Donner and Kucharik, 2008).  Because of the above‐mentioned 

attributes,  more  efforts  focused  on  switchgrass  development  as  an  energy  crop  could 

benefit  Quebec’s  agriculture,  and  represent  a  new  source  of  income  for  Quebec  farmers. 

Already, 116 Quebec farms dedicate 816 hectars to switchgrass production, a 50% increase 

compared to what was planted in 2008 (REAP‐Canada, unpublished). The development of a 

national  capacity  to utilize perennial  herbaceous  crops,  including  the native prairie plant 

switchgrass,  as  biofuels  could  benefit  Quebec’s  agriculture  by  optimizing  productivity  on 

marginal farmland or degraded lands and by providing a new source of income for Quebec 

armers.  f

 

1.2 Rational for research

New  approaches  are  required  to  assess  and  improve  the  genetics  and  cultural 

management  of  the  crop  for  Quebec’s  marginal  farming  areas.  For  example,  perennial 

grasses  are  the  hosts  of  fungal  and  bacterial    endophytes  that  systemically  colonize  the 

roots or the above ground portions of grasses and their seeds (Ryan et all., 2008; Schulz and 

Boyle, 2005). The close  link between endophyte  fitness and  its host grass  is presumed  to 

align  the  interests  of  both  partners  towards  a  mutually  beneficial  cooperation.  The 

endophytes  gain  shelter,  nutrition,  and  dissemination  via  host  propagules,  and  can 

2

contribute an array of host fitness enhancements including imporvement of vigor,  leading 

to  superior  agronomic  qualities,  greater  drought  tolerance,  and  increased  resistance  to 

herbivory  and  also  against  pathogen.  (Clay,  1990;  Lodewyckx  et  al.,  2002;  Schulz  et  al., 

1993; Schulz et al., 2002). However, the importance and use of endophytes in switchgrass 

remains poorly understood. 

1.3 Hypotheses

The ob   jectives are supported by three hypotheses: 

I. Endogenous  endophytes  of  switchgrass  can  be  successfully  isolated    on  synthetic 

microbiological media. 

II. Endogenous endophytes can be detected in plantae using polymerase chain reaction 

(PCR) method. 

III. Switchgrass endophytes are transmitted from maternal plant to offspring via seeds. 

1.4 Objectives

The objectives were: 

Objective 1:   To study the distribution and  frequency of  fungal and bacterial endophytes 

in  switchgrass  cultivars  established  in  field  sites  across  in  southwestern 

region  of  Quebec,  followed  by  their  isolation  and  characterization  using 

accurate and sensitive detection methods. 

3

Objective 2:  To  establish  that    endophytes  are  inherited  by  host  offspring  in  a  vertical 

transmission mode via seeds. 

bjective 3:  To study the biological activity of selective isolated endophytes. O

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

4

 

 

 

Chapter II Literature Review 

2.1 Switchgrass

2.1.1 Switchgrass as biofuels feedstock

  Switchgrass (Panicum vergatum L.) is a perennial warm‐season (C4) grass native to 

the  grassland  of  North  America  (Lemus  et  al.,  2002).    Switchgrass  has  a  wide  native 

geographic range and has evolved into two ecotypes:  Lowland ecotypes are tetraploid, are 

characterized as vigorous, tall, thick‐stemmed and is adapted to wet conditions.  The upland 

ecotypes  are  hexaploid  or  octaploid  (Lemus  et  al.,  2002),  are  characterized  as  short, 

rhizomatous  and  thin‐stemmed,  and  are  adapted  to  drier  conditions.  Both  ectotypes  of 

switchgrass  offer  a  significant  opportunity  to  improve  agricultural  sustainability  as  they 

decrease erosion and improve water quality, when compared to row crops.  Highly eroded 

and will benefit the most from the perennial nature of switchgrass.   l

 

The  selection  of  switchgrass  as  a  biofuel  feedstock  is  based  on  several  significant 

attributes,  including  its  efficiency  in  mitigating  greenhouse  gases  (GHG)  emissions  by 

sequestering  large amounts of carbon  in  its extensive root system (Donner and Kucharik, 

2008), its high biomass mainly having a high concentration of lignin and cellulose, and low 

5

amounts  of  water,  nitrogen  and  ash  (Lemus  et  al.,  2002;  Samson,  1997;  Samson,  1991).  

Additionally, it has high productivity across a wide geographical range, superior suitability 

for  marginal  quantity  land,  low  water  and  nutrient  requirements  and  positive 

environmental  attributes.    Because  of  these  attributes,  research  projects  across  North 

America  and  Europe were  initiated  to  pin  point  important  new  information  on  the  yield 

potential  of  this  species  as  a  biofuel  crop.  Research  focused  on  evaluation  of  the  most 

promising  existing  varieties  in  regional  field  trials,  cultural  treatments  to  enhance  the 

establishment  and  growth  of  stands,  breeding  for  superior  yield,  identification  of 

physiological markers for assessing and promoting improved growth and development, and 

the development of tissue culture techniques for biotechnological improvement (Berdahl et 

al.,  2005; Casler  and Boe, 2003; Cassida et  al.,  2005; Elbersen et  al.,  2001b; Lee  and Boe, 

2005; Madakadze et al., 1999; Muir et al., 2001; Sanderson et al., 1999; Vogel et al., 2002).  

These  tasks  combined  the  interrelated  needs  of  realizing  maximum  near‐term 

requirements in productivity potential through cultural improvement and the longer‐term 

equirements for enhancing and protecting yield capacity.  r

 

In  the  USA,  development  in  switchgrass  is  mostly  aimed  for  cellulosic  ethanol 

production  (Bouton 2008)  in order  to displace  fossil  fuels,  thereby,  reducing expenditure 

on  imported  fuels.  While  in  Quebec  and  Ontario,  the  focus  has  been  more  on  agri‐fiber 

pellet  that  is  used  in  commercial  boilers  such  as  in  greenhouse  industries  (Samson  and 

6

Stamler, 2007). It  is estimated that these two provinces could produce 14 millions tons of 

switchgrass biomass  if 20 % of  crop  land and 40% of  forage  land would be  converted  to 

switchgrass production (Samson and Stamler, 2007).   This technology has the potential to 

produce  770–890%  more  net  energy  gain/ha  than  growing  grain  corn  for  ethanol. 

However, it remains substantially less efficient than direct combustion of energy grasses or 

corn silage biogass as means to produce energy from farmland. 

2.1.2 Switchgrass Cultivars used in North-Eastern States, Québec and Ontario

There  are  currently  20  different  switchgrass  cultivars  available  on  the market.    A 

great deal of effort  is  focused presently on breeding and creating new lines (Lemus et al., 

2002).    The most  widely  used  cultivars  in  North‐Eastern  America  and  recommended  by 

experts  is  Cave‐in‐Rock  (Lemus  et  al.,  2002).    Others  such  as  Sunburst,  Shelter  and 

Forestburg are also suitable cultivars for production in northern locations (Samson, 2007).   

 

Warm‐season grasses such as switchgrass are increasingly being cultivated in North 

America for summer forage and biomass production. The cooler temperatures and shorter 

growing seasons typical of Canadian production areas, are major limiting factors to warm‐

season grass production in these areas. Assessment of the morphological development and 

relationship of  growing degree‐days  (GDD)  to plant morphology  and  tiller  characteristics 

were  evaluated  in  nine  cultivars  of  switchgrass.    Cave‐in‐rock  switchgrass,  a  cultivar 

7

originating from Southern Illinois (Elbersen et al., 2001a) showed increases in tiller number 

and  had  the  highest  ground  cover  ratings  after  a  three‐  year  trial  conducted  in 

southwestern regions of Quebec,  thereby demonstrating  that  it  is well adapted to Quebec 

climate  and  soil  type  (Madakadze  et  al.,  1999).    The  cultivar  Blue  Jacket  is  an  upland 

ecotype  evolved  from  Sunburst,  a  cultivar  originated  in  South  Nebraska,  and  its  main 

advantage  over  other  cultivars  is  its  superior  seedling  vigor  due  to  heavy  seed  set.    This 

cultivar  is well  adapted  to  sandy  soils  and  low  rainfall  than Cave‐in‐Rock  (Boe  and Ross, 

1998).   Tecumseh switchgrass, an upland ecotype evolved from Summer which originated 

from South Dakota, well adapted to heavy soils, and requires a lot of precipitation (Elbersen 

et al., 2001a; Samsons, 2011). Finally, the cultivar Sand Lover is a population of switchgrass 

derived from cultivar NU 94‐2.  It is an upland ecotype.  This cultivar originated in Oklaoma 

and is well adapted to sandy soils and dry environments (Taliaferro, 2002). 

2.2 Endophytes of grasses

For  the  purpose  of  this  study,  the  term  endophytes  will  only  refer  to  bacteria  or 

fungi  that  establish  a  mutualism  or  commensalism  interaction  with  the  aerial  parts  of 

grasses.  Endophytes  are  present  in  the  spaces  that  run  parallel  to  the  long main  axis  of 

leaves and stem (Clay, 1990). These organisms have  the ability  to absorb  freely available 

nutrients  found  in  the  intercellular spaces or obtain  their nutrients  from the surrounding 

cells (Schulz and Boyle, 2005; Schulz et al., 1999).   

8

Endophytes  are microorganisms  that  inhabit  healthy  plant  tissues  during  at  least 

one  stage  of  a  grass  life  cycle,  and  do  not  cause  any  apparent  symptoms  of  disease  or 

negative effects. Presently, multiple studies have shown that several plant species are hosts 

to  a  great  deal  of  endophytic  biodiversity.  According  to  Schulz  and  Boyle  (2005),  some 

endophytic species can occur in unique ecological niches and may be sources for a variety 

of bioactive metabolites that may have great potential for pharmacological applications.  

 

Many  fungal  endophytes  are  seed‐borne  and  migrate  in  the  seed  during  seed 

germination.   On plants  that propagate vegetatively,  the endophytes use  the reproductive 

tissues as vector for the  infection in new plants.    In order to colonize non‐infected plants, 

the fungi gain access to host cells using infective specialized structures such as appressoria 

and haustoria that develop intracellularly.  They can also penetrate directly through the cell 

wall or enter through the stomata and the substomatal chambers (Schulz and Boyle, 2005) 

 

Grasses  and  fungi  have  a  long  history  of  symbiosis  ranging  in  a  continuum  from 

mutualisms  to  antagonisms  (Schulz  and  Boyle,  2005).  This  continuum  is  particularly 

evident  among  symbioses  involving  the  fungal  genus  Epichloë.    In  the  more  mutualistic 

symbiota,  the  Epichloë  endophytes  are  vertically  transmitted  via  host  seeds,  and  in  the 

more antagonistic symbiota they spread and suppress host seed set (Schardl et al., 2004).   

Generally,  the  endophytes  gain  shelter,  nutrition,  and  dissemination  via  host  propagules, 

9

and  can  contribute  to  host  fitness  enhancements  including  protection  against  insect  and 

vertebrate  herbivores,  enhancements  against  drought  tolerance  and  nutrient  status,  and 

improved  growth  particularly  of  the  roots.  Recent  advances  in  endophytes’  molecular 

biology  promise  to  shed  light  on  the  mechanisms  of  the  symbioses  and  host  benefits 

(Malinowski  and  Belesky,  2000;  Pavlo  et  al.,  2011).    For  example,  Pavlo  and  coworkers 

(2010)  applied  enzymatic  activity  and  Real‐Time  PCR  assays,  to  shed  light  on  some 

important plant mechanisms (e.g., ISR and SAR) for protection against pathogen and are up‐

regulated  by  the  presence  of  endophyte  (see  section  3.5).  Fungal  endophytes  can  be 

classified  into  three  different  ecological  groups:  the mycorrhizal  fungi,  the  balansiaceous 

and the non‐balansiacceous taxa.  Mycorrhizal associations will not be covered, as they are 

not the subjects of this research.  

2.2.1 Balansiaceous fungal endophytes

The  balansiaceous  or  ‘grass  endophytes’  is  a  group  of  closely  related  fungi  with 

specific  ecological  requirements  and  adaptations  that  are  different  from  other  fungal 

endophytes.  The  balansiaceous  endophytes  Epichloë  and  Balansia,  (Anamorphs: 

Neotyphodium  and  Ephelis,  respectively)  belong  to  the  Ascomycetes.    They  are  the most 

studied above ground endophytic  interactions because of  their ecological and economical 

impact. They grow systemically and intercellularly within all above ground plant organs of 

grasses,  rushes  and  sedges  (Schulz  and  Boyle,  2005).  They  are  dependent  on  nutrients 

10

present  in  the apoplast  for growth. A signal communicating system between the host and 

the plant  insures a perfect balance between the host and the endophyte virulence (Schulz 

and Boyle, 2005) with benefits  to both partners:  the  endophyte gains  access  to nutrients 

and  protection  from  abiotic  stress,  and  the  host  becomes  more  resistant  to  insect  or 

pathogen  attack  due  to  the  presence  of  alkaloids  or  the  production  of  chitinase  enzymes 

(Schulz and Boyle, 2005).  Many fungal endophytes are seed‐borne and migrate in the seed 

uring seed germination processes.  d

 

2.2.2 Non-Balansiaceous fungal endophytes

  In  contrast  to  balansiaceous  endophytes,  the  non‐balansiaceous  endophytes  are  a 

diverse  group  of  fungi  both  from  the  taxonomic  and  life‐history  strategy  point  of  view.  

These  fungi are Ascomycetes and can belong to any of  the  following genera: Acremonium, 

Alternaria,  Cladosporium,  Conithyrium,  Epicoccum,  Fusarium,  Geniculosporium,  Phoma, 

Pleospora. Colletotrichum, Guignardia, Phyllosticta, Pestalotiopsi, and Lophodermium.   They 

are found in all the organs and have been shown to be present in all sampled plants (Schulz 

and  Boyle,  2005).    Many  of  these  fungi  produce  an  array  of  secondary  metabolites  (for 

review Schultz et al. 2002) with varied biological activity (refer to section 4; Bashyal et al., 

2006; Suryanarayanan et al., 2009b).  

The  colonization  of  non‐balansiaceous  endophytes  can  be  localized  or  systemic.  

They  can  grow  intercellularly  or  intracellularly  and  form  different  types  of  interactions 

11

varying from non‐aggressive, mutualistic to pathogenic. The non‐balansiaceous endophyte 

composition population of a plant varies according to the tissues (root, stem, leaf, flower). 

The fungi are not obligate host specific; they have a certain level of adaptation to different 

hosts.   While others are more specific and can only be found in specific organs of specific 

plant (Schulz and Boyle, 2005).    

2.3 Bacterial endophytes

Endophytic  bacteria  have  been  found  in  virtually  every  plant  studied, where  they 

colonize  the  internal  of  their  host  plant  and  can  form  different  relationships  including 

symbiotic,  commensalistic,  mutualistic  and  trophobiotic  (Ryan  et  al.,  2008).    Most 

endophytes appear  to originate  from the rhizosphere or  the phyllosphere, however some 

may  be  transmitted  via  seeds.  They  are  able  to  colonize  the  internal  tissue  of  the  plant 

showing  no  external  sign  of  infection  or  negative  effect  on  their  host  (Schulz  and  Boyle, 

2005).  They  are  often  isolated  from  surface‐sterilized  tissues  or  extracted  from  internal 

plant parts. Both gram‐positive and gram‐negative bacterial endophytes have been isolated 

from several tissue types in numerous plant species.  However, several different endophytic 

bacteria  may  reside  within  a  single  plant  (Kobayashi  and  Palumbo,  2000).  These 

endophytes  either  remain  localized  at  their  entry  points  or  spread  to  other  parts  of  the 

plant (Hallmann et al., 1997).  

 

12

Bacterial endophytes cover a significant range of Gram‐positive and Gram‐negative 

bacteria  (Lodewyckx  et  al.,  2002).    Most  bacterial  endophytes  belong  to  Cellulomonas, 

Clavibacter,  Curtobacterium,  Bacillus,  Sphingomonas,  Pantoea,  Pseudomonas  and 

Microbacterium genera (Kang et al., 2007; Ryan et al., 2008; Thomas et al., 2007).  They will 

colonize  the  host  without  external  signs  of  infection  or  negative  effects  on  the  host 

(Rosenblueth  and  Martinez‐Romero,  2006).  Bacteria  from  the  same  genera  can  colonize 

both the roots and the aerial parts depending on the specificity of the host and the bacteria 

(Lodewyckx  et  al.,  2002).  Many  bacterial  endophytes  are  seed  borne.  On  plants  that 

propagate  vegetatively,  the  endophyte  can  use  the  reproductive  tissues  as  vector  for 

infecting  the  new  plant.    In  order  to  colonize  non‐infected  plant,  bacterial  endophytes 

secrete cellulolytic, pectinolytic, cell wall degrading (endogluconase and polygalacturonase) 

enzymes.    These  enzymes  are  useful  to  penetrate  the  host  (Rosenblueth  and  Martinez‐

Romero, 2006) . 

 

As with their fungal counterparts, bacterial endophytes also produce secondary

metabolites exhibiting antifungal and antibacterial properties. For example, fengycin,

bacillomycin D, Zwittermicin A, Iturin A, Surfactin are peptides with strong antimicrobial

activities and are produced by Bacillus spp (Athukorala et al., 2009; Ramarathnam et al., 2007).

 

13

Only  few  plants  have  ever  been  completely  studied  relative  to  their  endophytic 

biology.  Consequently,  the  opportunity  to  find  new  and  beneficial  endophytic 

icroorganisms among the diversity of plants indifferent ecosystems is considerable. m

 

2.4 Beneficial roles of endophytes

Generally,  endophytic  bacteria  and  fungi  can  promote  plant  growth  and  yield  and 

can act as biocontrol agents. Endophytes can also be beneficial to their host by producing a 

range of natural products that could be harnessed for potential use in medicine, agriculture 

or  industry  (Ryan  et  al.,  2008;  Schulz  and  Boyle,  2005;  Schulz  et  al.,  2002;  Schulz  et  al., 

1999).    In  addition,  it  has  been  shown  that  they  have  the  potential  to  remove  soil 

contaminants by enhancing phytoremediation and may play a role  in soil  fertility through 

phosphate  solubilization  and  nitrogen  fixation  (Ryan  et  al.,  2008).    There  is  increasing 

interest  in  developing  the  potential  biotechnological  applications  of  endophytes  for 

improving phytoremediation and the sustainable production of nonfood crops for biomass 

and biofuel production. 

2.4.1 Effects on Plant Physiology

Endophytes  are  known  to  have many  effects  on  their  hosts.    Infected  plants may 

produce more inflorescences and seeds than uninfected plants.  This can be explained by a 

14

greater vegetative vigor of  infected plants (Clay, 1990).   Seeds of some grass species (e.g., 

tall fescue and perennial ryegrass) germinate more rapidly and grow faster when infected 

by  an  endophyte.    Thus,  resulting  in  faster  growth  of  the  infected  seedling.    Fungal 

endophyte‐infected  seeds  contain  higher  concentrations  of  alkaloids,  which  may  explain 

this faster germination/growth rate.  The alkaloids concentration makes it less likely for the 

seed  to  be  eaten  by  vertebrates  and  invertebrates  plant  and  seed  feeders  (Clay,  1988).  

Grasses infected by endophytes have tillers that are more profuse and spread horizontally 

via  stolons  and  rhizomes  (Clay,  1990).  Enhanced  growth  rate  of  infected  plants was  also 

emonstrated with perennial ryegrass and purple nutsedge (Latch and Christensen, 1985).    d

 

2.4.2 Photosynthesis

Endophytes  influence  the  source  and  sink  mechanism  of  the  plant.    Experiments 

conducted  on  photosynthate  metabolism  reveal  that  endophytic  fungi  were  constantly 

transforming  plant  sucrose  into  sugar  alcohols  that  are  unavailable  to  the  plant  to 

metabolize (Smith et al., 1985).    If  the  level of photosynthetic activity of  the plant  is high, 

the  plant metabolism  in  charge  of  processing  the  outcome  of  the  photosynthesis  (sugar) 

cannot work fast enough.  Thus, there is a sucrose build up, which in turn will trigger a plant 

feedback inhibition mechanism, leading to reduction in photosynthetic activity.  Therefore, 

entophytic  fungi  prevent  the  feedback  inhibition  of  photosynthetic  rates,  allowing  higher 

photosynthetic rates and subsequently increase the average growth of the plant.  In the case 

15

of  root‐borne  endophytes,  siderophores  are  produced  that  can  increase  the  solubility  of 

utrient in the rhizosphere (Rosenblueth and Martinez‐Romero, 2006). n

 

 

2.4.2 Drought resistance

   Drought stress usually induces a series of adaptations in the plant, in order for it to 

survive.    These  adaptations  include  mechanisms  of  drought  avoidance,  tolerance,  and 

ecovery from drought.  Endophytic presence can impact theses different adaptations.   r

 

  Drought  avoidance  is  the  series  of  mechanisms  by  which  the  plant  attempts  to 

maintain  an  efficient  water  supply  to  above  ground  organs  or  conserving  water  during 

periods  of  soil  water  deficit.    A  good  way  to  improve  and maximize  water  uptake  is  by 

developing  a  deeper  and  denser  root  system.    Perennial  ryegrass,  tall  fescue,  meadow 

fescue  infected  by  fungal  endophytes  showed  an  increase  in  root  dry  matter,  root  hair 

length, and decrease  root diameter  (Malinowski and Belesky, 2000; Thomas et al., 2007). 

These  traits  increase  root  surface,  leading  to  increase  in water  and minerals  absorption.  

For example, Papaya infected by the bacterial endophytes Pantoea ananatis, Bacillus subtilis 

and Microbacterium esteraromaticum showed an increase in root development (Kang et al., 

2007;  Thomas  et  al.,  2007).  The  superior  root  system  is  a  simple  way  to  maximize  the 

uptake of available water in the soil, thus improving the drought capacity of the plant.  

16

 

Another drought avoidance technique is to reduce transpiration.  The stomata of Tall 

fescue  and  meadow  fescue  endophyte‐infected  plant  close  faster  under  water  stress 

conditions  than non‐infected plants  (Malinowski  et  al.,  1999; Turner,  1986). The  internal 

plant hormones balance has to be modified in order to influence the stress behaviour of the 

plant.   Of  interest  is  the presence of auxin, a major plant hormone  that  is  involved  in  the 

drought resistance signalling pathway (Chaves et al., 2009). Clay  (1990)  found  that auxin 

can  be  produced  by  the  endophyte  Balansia  epichloe.      Water  content  of  tiller  bases  in 

endophyte‐infected plants are maintained at higher levels than those in non‐infected plants 

during  drought  conditions.    This  may  be  due  to  a  greater  accumulation  of  solutes  in 

endophyte‐infected tissues. 

 

Drought tolerance is series of adaptations that enable the plant to withstand water 

deficits.  A good way to cope with drought is to have carbohydrate reserves used up during 

stress periods. An important part of drought tolerance adaptation is to be able to maintain 

normal  osmotic  pressure.    Accumulation  of  solutes  in  tissue  helps  maintain  the  turgor 

pressure,  which  in  turn  facilitates  physiological  and  biochemical  processes.    Endophyte‐

infected  plants  produce  a  number  of  these  solutes;  water‐soluble  sugars,  mannitol  and 

arabitols, proline and  loline    (Malinowski and Belesky, 2000). Endophyte‐  infected plants 

17

help maintaining cell wall elasticity in the same way as they do maintain osmotic pressure, 

which further help the biological processes.   

 

The  combination  of  drought  avoidance  and  tolerance mechanisms  determines  the 

natural potential of a plant to withstand drought.  Endophytes can play a key role on many 

of the different strategy used, thus increasing the drought tolerance of plant.   

2.4.3 Resistance to herbivory

  Endophytes  are  known  to  increase  resistance  to  herbivory  (Clay,  1990).  Several 

findings  showed  that  endophyte‐infected  plant  materials  reduce  feeding  and  egg  laying 

intensity of aphids, large milkweed bugs, and fall armyworms (Clay, 1988).  The endophyte‐

infected  plant  reduces  the  survival,  growth  and  developmental  rates  of  feeding  insects. 

These effects, are due to the presence of secondary metabolites, with insecticidal property, 

produced  in plant  tissues by  the endophytes  (Johnson et al., 1985; Suryanarayanan et al., 

2009a; Suryanarayanan et al., 2009b).   These secondary metabolites are often alkaloids in 

nature.  To name a few: the Ergots alkaloids like clavines, lysergic acid, ergopeptides are the 

cause of fescues toxicosis in grazing lifestock (Malinowski and Belesky, 2000).  Peramine is 

another  alkaloid  that  is  found  on  endophyte‐infected  grasses;  it  has  insect‐feeding 

deterrent properties, but in this cases does not impact mammalian herbivory (Malinowski 

and  Belesky,  2000).  Endophyte–infected  grasses  have  been  reported  to  be  also  more 

resistant  to  soil‐born  nematodes,  with  the  resistance  probably  attributable  to  alkaloids 

18

present in roots or secretion of phenolic‐like compounds into the rhizosphere (Malinowski 

nd Belesky, 2000).    a

 

2.4.4 Reduction in disease occurrence

  Numerous  reports  have  shown  that  endophytic  microorganisms  can  have  the 

capacity to control plant pathogens (Krishnamurthy and Gnanamanickam, 1997; Rodriguez 

Estrada et al., 2011), insects (Azevedo et al., 2000) and nematodes (Hallmann et al., 1997).  

In  some cases,  they can also accelerate  seedling emergence, promote plant establishment 

under adverse conditions (Chanway, 1997) and enhance plant growth (Bent and Chanway, 

998).  1

 

  It  is  believed  that  certain  endophytic  bacteria  trigger  a  phenomenon  known  as 

induced  systemic  resistance  (ISR),  which  is  phenotypically  similar  to  systemic‐acquired 

resistance (SAR) (van Loon et al., 1998). ISR is effective against different types of pathogens 

but differs from SAR in that the inducing bacterium does not cause visible symptoms on the 

host  plant  (van  Loon  et  al.,  1998).  Bacterial  endophytes  and  their  role  in  ISR  have  been 

reviewed  recently  by  Kloepper  &  Ryu  (2006).  Pavlo  et  al.  (2010)  demonstrated  that  the 

bacterial endophyte of potato, Pseudomonas spp. increased resistance toward the pathogen 

Pectobacterium  atrosepticum  by  priming  the  host’s  defense  responses.   With  the  help  of 

enzymatic  activity  assay  and  Real‐Time  PCR,  they  discovered  that  the  plant  antioxidant 

19

system  that  produces  superoxide  dismutase  (SOD),  catalase,  guaiacol  peroxidase  (GPOX) 

and ascorbate peroxidase (APX) was moderately activated as well as both the ISR and the 

SAR  pathway  by  the  presence  of  endophyte.    Reduced  nematode  populations  were 

associated with  endophyte  infection  in  tall  fescue,  both  in  pot  culture  and  in  field  trials 

(Pedersen et al., 1988; West et al., 1988).  Possible mechanisms by which endophytes could 

inhibit plant pathogens include competition for resources (Sturz et al., 2000), induction of 

generalized  defense  responses,  and  the  production  of  antimicrobial  compounds 

(Athukorala et al., 2009; Ramarathnam et al., 2007). 

2.5 Secondary metabolites

Endophytes have been shown to prevent disease development through endophyte‐

mediated de novo  synthesis of novel compounds and antifungal metabolites.  Investigation 

of the biodiversity of endophytic strains for novel metabolites may identity new drugs for 

ffective treatment of diseases in humans, plants and animals (Strobel et al., 2004) e

 

Most of  the  effects of  fungal  endophytes on  their hosts  can be  associated with  the 

production  of  secondary metabolites, more  specifically  alkaloids,  that  are  generally  host‐

specific and can be extracted from endophyte cultures outside the host (Clay, 1990; Schulz 

and Boyle, 2005; Suryanarayanan et al., 2009a; Suryanarayanan et al., 2009b). Alkaloids are 

defined  as  naturally  occurring  molecules  containing  nitrogen  atoms  (Clay,  1990).  It  has 

20

been shown that greater resistance to pathogens and predators  is usually associated with 

antimicrobial  metabolites  (Schulz  and  Boyle,  2005).  These  alkaloids  become  part  of  the 

plant  tissue  and  are  in  part  responsible  for  the  poisonings  of  grazer  animals  and  insect 

herbivore. Endophyte‐infected grasses contain a series of alkaloids not found in uninfected 

grasses.  

 

Generally, metabolites produced by endophytes can be isolated from pure culture  of 

endophytes. The balansiaceous endophytes produce diverse array of secondary metabolite, 

including peramine and lolines and the anti‐vertebrate alkaloids lolitrem B and ergovaline 

(Schulz  and  Boyle,  2005)  that  are  harmful  for  mammals.    While  the  non‐balansiaceous 

endophytes  are  known  to  produce  a  diversity  of  metabolites  that  are  known  to  have 

herbicidal  (e.g.,  brefeldin  A  produced  by  Aspergillus  clavatus),  anti‐bacterial  (e.g., 

pyrrocidine A and B produced by Acremonium zeae),  anti‐viral  (e.g., mellein produced by 

Penicillium  janzcewskii),  anti‐fungal  (e.g.,  pyrrocidine  A  and  B  produced  by  Acremonium 

zeae),  and  anti‐cancer  (  e.g.,  vincristine  produced  by  Fusarium  oxysporum)  properties 

(Bashyal  et  al.,  2006;  Suryanarayanan  et  al.,  2009b),  as  well  as  growth  promoting  with 

phytohormone properties (Schulz et al., 2002).  Thus, the fact that endophytes can produce 

secondary metabolites with biocidal properties make them attractive to the pharmaceutical 

industry (Schulz et al., 2002). 

 

21

  As with fungal endophytes, a number of low molecular weight compounds active at 

low concentrations against plant pathogenic fungi, animals and humans have been isolated 

from  bacterial  endophytes.  For  example,  the  peptides,  Fengycin,  Bacillomycin  D, 

Zwittermicin  A,  Iturin  A,  Surfactin  exhibit  a  strong  antimicrobial  activity  produced  by 

Bacillus  species.    An  exhaustive  list  of  antimicrobial  compounds  produced  by  different 

bacterial endophytes are described in Ryan et al. 2008. 

2.6 Common techniques for observation, isolation and characterization of endophyte

In  order  to  assess  the  viability  of  endophytes,  some  methods  exist  for  detection, 

identification and isolation of endophytes from  plant tissues.   

2.6.1. Histological staining and tissue observation.

  This technique involves observing the endophyte structures within the plant tissues 

using light microscopy.  It is not the ideal method for the detection of bacterial endophytes.  

The  recent  application  of  green  fluorescent  protein  (GFP)  for  tagging  bacterial  or  fungal 

endophyte is a more precise way to visualize the presence of the endophyte  in situ.   With 

the help of specific vectors,  it  is possible  to  introduce  the GFP gene  into other organisms.  

This  gene  produces  a  protein  when  exposed  to  blue  light  produces  a  bright  green 

fluorescent which can be visulaized using fluorescence microscopy to detect the presence of 

endophyte inside plant tissue.     Vectors   such as pHRGFPT, pHRGFPGU have been used to 

22

transform endophytic bacteria (Ramos et al., 2007; Rouws et al., 2010). Fungal endophytes 

can also be transformed using specific pPd‐EGF vector (Mukherjee et al., 2010).   

 

2.6.2 Surface sterilization

The host tissue is subjected to surface sterilization techniques followed by isolation 

of  the  endophytes  on  specific  synthetic  growth  medium.  The  most  common  procedure 

employs  a  surfactant  such  as  ethanol,  followed  by  a  sterilizing  agent,  such  as  sodium 

hypochlorite  (Schulz and Boyle, 2005).   The efficiency of  sterilization  is  confirmed by  the 

imprint  technique.   The  technique consists of  imprinting  the plant  tissue before and after 

sterilization on different growth media such as Malt Peptone Yeast Agar, Malt Extract Agar 

(MEA) (Arnold et al., 2000), Potato Dextrose Agar (PDA) (Latch and Christensen, 1985).  All 

these  media  support  the  growth  of  fungal  endophytes  and  are  often  amended  with 

antibiotics  in  order  to  prevent  bacterial  endophytes  growth  (Schulz  et  al.,  1999).    For 

bacterial  endophytes,  a  wide  range  of  media  are  used  for  growth;  Nutrient  Agar  (NA), 

Viande‐Levure  (Pavlo  et  al.,  2011)  or  Rice  extract Modified  Rennie  (RMR)  are  just  some 

examples  (Miyamoto  et  al.,  2004).   Once  successfully  isolated,  endophytes    are  then  sub‐

cultured, purified and maintained under controlled conditions for future applications.  

2.6.3 Maintenance and culture of isolated endophytes

23

Fungal endophytes growing from the leaf section after sterilization are sub‐cultured 

in  order  to  obtain  a  pure  culture,  using  the  same media  that  they  have  been  isolated  on 

(MEA and PDA amended with antibiotics).  The cultures are then incubated at 24° C.  Once 

the fungus covers approximately  ¾ of the plate, 5mm diameter punch holes are removed 

from  the  edge  of  the  colony  which  represents  the  younger  part  of  the  fungal  growth.  

Twenty plugs are place in a 2 ml sterile screw‐cap tube, and covered with a sterile solution 

of Glycerol at a concentration of 25%  (Kitamoto et al., 2002). The tubes are then frozen in 

liquid nitrogen and stored at ‐80°. 

 

  Bacterial endophytes require to pass through a series of 4 single colony isolations to 

ensure their purity. Pure bacterial colonies are grown on LB (1.0% tryptone (Difco, Texas), 

0.5%  Yeast  Extract  (Difco,  Texas),  1.0%  and  NaCl  for  18  hours.    An  aliquot  of  750 μl  of 

bacterial  solution  are  then  pipetted  into  a  2  ml  sterile  screw‐cap  tube  and  mixed  with 

sterile glycerol to obtain a 25% final glycerol solution. The tubes are then frozen in liquid 

nitrogen and stored at ‐80°C (Costa and Ferreira, 1991).   

2.6.4 Detection

Fungal  and  bacterial  endophytes  in  surface  sterilized  tissues  can  be  detected  by 

polymerase  chain  reaction methods  (PCR)  using  the  universal  primers    ITS  1  and  ITS  4 

encoding the ribosomal DNA space genes in fungi (Schulz and Boyle, 2005), or the 16sRNA 

24

and  ITS  16  (Miyamoto  et  al.,  2004)  encoding  a  spacer  section  in  the  ribosomal  DNA  of 

bacteria.  

2.6.5 Identification using morphological parameters

In  order  to  identify  the  endophytes,  different  techniques  can  be  used.    For  fungi, 

condiogenesis and spore morphology are both acceptable methods of classification (Arnold 

et al., 2000; Schulz and Boyle, 2005).   For  the   non‐sporulating  fungi,  the morpho‐species 

method  is  used.  This  method  is  based  on  the  observation  of  growth  and  morphological 

characteristic  (Arnold  et  al.,  2000).  Identification  of  bacterial  endophytes  can  be 

accomplished by morphological characteristics such as color, form, texture opacity  as well 

as gram staining (Zinniel et al., 2002).  

2.6.6 Identification using molecular markers

Molecular  techniques  such  as  the  polymerase  chain  reaction  (PCR)      has  proved 

powerful  in  detecting  DNA  of  symbionts  or  endophytes  that  can  not  be  cultured  and 

separated  from  their  co‐symbionts  (Haddad  et  al.,  1995).  Ribosomal  DNA  is  now widely 

employed  for estimating  the phylogenies of various organisms  followed by  sequencing of 

the  amplified  product  and  homology  comparison  using  Genbank  or  other  database  for 

dentification (Arnold et al., 2000; Chiang et al., 2001). i

 

25

The  primer  sequences  of  the  internal  transcribed  spacer    region  of  the  nuclear 

ribosomal  DNA  (Sessitsch  et  al.,  2004)  is  widely  used  for  resolving  phylogenetic 

relationships at the species or generic levels (White et al., 1990).   Employing phylogenetic 

analysis  is a common method for  fungal and bacterial endophyte  identification (Chiang et 

al., 2001; Larran et al., 2002; Mendes et al., 2007; Pavlo et al., 2011; Sun et al., 2008).  

26

Chapter III Materials and Methods 

3.1 Cultivars of Switchgrass

The cultivar, Cave-in-Rock originated from Southern  Illinois  and is the  most 

recommended  and  widely  used  cultivar  in  North‐Eastern  America  (Lemus  et  al.,  2002).  

Cave‐in‐Rock  evolved  in  a  humid  climate,  for  this  reason  it  is  well  adapted  to  wet 

environment.  Three other cultivars were also screened for the presence endophytes. Blue 

Jacket, an upland ecotype evolved from Sunburst and originated from South Nebraska (Boe 

and  Ross,  1998;  Samsons,  2011), Tecumseh,  another  upland  ecotype  that  evolved  from 

Summer and originated from South Dakota (Elbersen et al., 2001; Samsons, 2011), and Sand 

lover,  an  upland  ecotype  evolved  cultivar  NU  94‐2  which  originated  from  South  Dakota 

(Samsons, 2011; Taliaferro, 2002).   These  three  cultivars are well  adapted  to dry growth 

ondition.  c

 

3.2 Field sites and sample selection

Two  field  sites  in  Valleyfield,  Qc,  Canada  were  selected  for  switchgrass  (Panicum  

virgatum L.) collection. Field site 1 (45’ 16’ 29’’ N and 74° 4’2’’ W) was seeded in 1995 with 

cultivar Cave‐in‐Rock and received no  fertilizer amendments until 2006 after which, only 

27

50 kg N/ha was annually applied. Field site 2 (45’ 16’ 23’’ N and 74°0’59’’ W) was seeded in 

2006 with  cultivars  Sand  lover,  Tecumseh  and  Blue  Jacket  and  received  no  fertilizers  in 

2006 and 2007, but they received 50 kg /ha of N  in 2008 and 2009. Both field  sites were 

annually mowed in the fall and the material was baled in the spring.   

Seeds  from  switchgrass  plants  showing  the  best  agronomical  traits  from  the  4 

cultivars were collected on October 28, 2009 from both field sites, placed in envelopes and 

stored  in  the  dark  at  room  temperature.  A  portion  of  the  seeds  was  reserved  for  DNA 

extraction,  while  the  remaining  seeds  (912  seeds/cultivar)  were  planted  on  March  18th 

2010 in 38‐cells trays (Plant products Co. Ltd) containing 50 Pro‐Mix HP /50 Pro‐mix BX of 

potting mixture  from  of  Agro mix®  (Plant  products  Co.  Ltd)  ,  grown  in  a  greenhouse  at 

temperatures of 21°/19° day/night and under spring light conditions, and watered 3 times 

a week. Plant height was recorded after two months of growth.  The tallest 20 plants of each 

cultivar were selected, transplanted into larger pots (10‐cm diameter) containing the same 

substrate and  after one month, they were transferred into field site 2 in Valleyfield on June 

11th 2010.  Plots were designed as a grid pattern (8.25 m2), in which there is 50 cm between 

plants on each axis 

3.3 Sampling and plant sample processing

Plants were collected over two growing seasons in 2010 and 2011. At each sampling 

date  (September  2010  and  October  2010)  four  tillers  per  cultivar  originated  from  seed  

28

were  grown  and  collected  from  different  parts  of  the  field  and  GPS  coordinates  were 

recorded  and  used  for  subsequent  sampling.  Additionally,  tillers  of  25  Cave‐in‐Rock 

switchgrass  plants  were  collected  in  October  2011  from  the  oldest  and  established 

switchgrass field (Site 1). Leaves of eight (4 leaves per sampling date) asymptomatic plants 

(i.e.,  from seed grown switchgrass plants) of each cultivar were randomly sampled at two 

defined  growth  stages:  late  vegetative  stage  (i.e.,  the  leaf  at  the  upper  node)  and  at  full 

reproductive  stage  (i.e.,  the  flag  leaf)  in  the  months  of  September  and  October  2010, 

respectively.  A  total  of  25  flag  leaves  of  Cave‐in  Rock  from  the  established  field  were 

sampled. All samples were processed for bacterial and fungal endophytes. One leaf of each 

plant/cultivar/stage  was  sampled  and  immediately  stored  in  individual  Ziploc®  bags, 

ransported to the lab and processed within 48 hours.  t

 

Leaves  were  surface  sterilized  by  step‐wise  washing  in  99%  ethanol  for  1  min, 

rinsed in sterile water  for 1 min,  then  immersed  in a 5% solution of sodium hypochlorite 

for 5 min, followed by a rinse in sterilized water for 1 min then immersed in 99% ethanol 

for one min, and followed by three rinses (one min. each) in sterile distilled water (Schulz et 

al., 1993).  The grass leaf was then separated into leaf sheath and leaf blade using a sterile 

blade, and each were cut into several 1‐cm section pieces.  Sections from each tissue were 

plated onto Potato Dextrose Agar (PDA) and Malt Extract Agar (MEA) (Difco, Texas) at pH of 

5.6  and  6.0  respectively  amended  with  60  mg  l‐1  penicillin  G  +  80mg  l‐1  streptomycin 

29

sulphate  +  50 mg  l‐1  chloromphenicol  or  onto  Nutrient  Agar  (NA)  (BBL,  New‐York),  and 

incubated at 24°C in the dark for 4‐6 weeks. The remaining leaf sections were transferred 

into small tubes, immersed in liquid nitrogen and kept in a ‐800 C freezer for genomic DNA 

xtraction.   e

 

Seeds    (1  gram)  of    the  four  cultivars were  also  subjected  for  surface  sterilization 

method according Sauer and Burroughs (1986).  Briefly, seeds were soaked in 5% solution 

of  sodium hypochlorite  for 20 min. with  continuous  stirring using an  electromagnet. The 

seeds were subjected to three rinses of one min each in sterile distilled.   Seeds were ground 

with liquid nitrogen and stored at ‐80°C for DNA extraction. 

3.4 Efficacy of sterilization

The  efficiency  of  surface  sterilization  procedure  was  ascertained  following  the 

imprint method of Schulz et al. (1993). In each Petri dish, 3 segments/tissue prior and after 

surface sterilization were imprinted for 5‐10 seconds by carefully pressing the leaf sections 

onto  antibiotic  amended  PDA,  MEA  and  NA.  The  dishes  were  sealed  with  parafilm  and 

incubated at 24°C ± 2 C  for 4‐6 weeks  in dark.    If  there were microbes  appearing on  the 

imprinted culture plate after sterilization, the tissues were discarded. 

3.5 Isolation and maintenance of endophytes

30

Cultures  were  examined  regularly  for  emerging  fungal  and  bacterial  colonies.  

Emerging  fungal  colonies were  passed  through  two  rounds  of  sub‐culturing  on  the  same 

media  in  which  they  were  isolated  prior  to  long‐term  storage  method  according  to 

Kitamoto  et  al.  (2002).  Briefly,  20  plugs  (5 mm  in  diameter) were  taken  from  7  day‐old 

fungal cultures, placed into screw‐capped 2 ml tubes, covered with 25% solution of  sterile 

glycerol, immersed immediately in liquid nitrogen and stored at ‐80°C. Emerging bacterial 

colonies were also passed through 4 rounds of single colony isolation by streaking them on 

NA culture medium to ensure purity of the organism prior to long term storage according to 

the method of Costa and Ferreira (1991). Briefly, single colonies were grown on LB (1.0% 

tryptone; 0.5% Yeast Extract, and 1.0% NaCl) for 18 hours.  An aliquot of 750 μl of bacterial 

solution was placed in 2 ml sterile screw‐caped tube and mixed with 25% glycerol solution. 

The tubes were flash frozen in liquid nitrogen then stored at ‐80°C  

3.6 Identification of fungal and bacterial isolates

  Sporulating  fungi were  identified based on  colony morphology,  conidiosphore and 

conidia morphology (Ellis, 1971). Isolated endophyte that failed to sporulate were broadly 

grouped  by  their  macro‐morphological  characteristics.  For  bacterial  endophytes,  those 

were grouped on the basis of phenotypic characteristics, e.g., colony color and morphology, 

gram reaction staining (Steinbach and Shetty, 2001) and their antagonistic activity against 

selected  fungi.    All  fungal  groups  were  further  refined  and  identified  into  taxa  by  DNA 

31

cloning and sequencing of ITS regions. Bacterial strains that showed promising antagonistic 

activity  against  fungi  were  further  grouped  into  their  taxa  based  on  ITS  cloning  and 

equencing. s

 

For  further characterization of endophytes, 1x109 of bacterial cells were harvested 

for genomic DNA extraction of  test bacterial  strains grown  in LB broth  for 18 hours with 

QIAGEN DNeasy® Blood & Tissues kit.  Genomic DNA (100 mg) of test fungi grown on PDA 

covered with a cellophane membrane was extracted with QIAGEN DNeasy® Plant Mini kit 

and  following  the manufacturer’s  recommendations.    PCR  amplification  of  the  16S  rDNA 

gene  for bacterial endophytes and of  the  ITS  (ITS1, 5.8S,  ITS2) coding sequence of  fungal 

rDNA was  performed with  their  respective  universal  primer  set  (Table  1),  and was  PCR 

amplified by using 20 ng genomic bacterial or fungal DNA. The PCR primers were used to 

sequence the purified PCR products.  Briefly, 3 μl of the putative PCR products were cloned 

using  the  TOPO® TA‐cloning  Kit  (Invitrogen,  Carlsbad,  CA)  following  the manufacturer’s 

protocol.  Plasmid  DNA  was  purified  using  the  PureLink™  Quick  Plasmid  Miniprep  Kit 

(Invitrogen)  and  sent  for  sequencing  at  Genome Quebec  (Montreal,  QC).  Gene  sequences 

were manually inspected and edited into contigs using DNA sequence assembly using CAP3 

Sequence  Assembly  Program.  Sequences  were  then  subjected  to  Blastn  searches  against 

NCBI database. The  top 5 hits, with  the  lowest e‐value, were used to assign  identity.   The 

nucleotide sequences were deposited to GenBank public database (Table 1)   

32

 

3.7 Species-specific primer design and phylogenetic analysis

The most  similar  sequences of endophytic  fungi  and bacteria were  further aligned 

using ClustalW  software  in  SDSC Biology Workbench  (Subramaniam,  1998)  and  the non‐

conserved  regions were  used  to  design  specific  primers  for  each  endophytic  fungus  and 

bacterium.    Specific  primers  were  synthesized  by  Integrated  DNA  Technologies  Inc 

(Coralville, Iowa USA), and were tested against all fungi and bacteria to insure specificity.  

 

To construct phylogenetic trees for bacterial endophytes, the nucleotide sequence of 

each bacterial endophyte was aligned with sequences of selected known strains of bacteria 

using ClustalW software, and the trees for bacterial endophytes were built using MEGA 5.05 

software (Tamura et al., 2011). Maximum likelihood method was employed to infer the tree 

topology.    The  reliability  of  the  trees  was  tested  by  bootstrapping  1,000  replicates 

generated with a random seed.  

3.8 Detection of fungal and bacterial endophytes using PCR methods- plants and seeds

  Sterilized switchgrass plant tissues (i.e., sheaths and blades of leaf stages and seeds) 

were reduced to powder under liquid nitrogen using a mortar and pestle and subjected to 

DNA  extraction  extracted  using  the  Dneasy  Plant  Mini  kit  50  (GIAGEN®,  Ontario).  The 

33

presence  of  endophytes  within  switchgrass  tissues  was  confirmed  by  PCR  using  the 

GeneAmp® PCR System 9700 (Applied Biosystem, California).   Each amplification mixture 

contained 2.5μl of 10x PCR buffer (Fermantas ®, Ontario, Ontario), 2.5 μl of dNTP (2mM), 2 

μl of MgCl2  (15mM), 1.5 μl of each primer  (2mM), 0.5 U of Taq polymerase  (Fermantas®, 

Ontario),  and 8μl  of  template DNA  (5ng/μl)  in  a  total  volume of  25μl.    All  PCR  reactions 

were  run under  the  following  conditions:  one  cycle  of  initial  denaturation  at  94°C  for 10 

min.,  followed by 35 cycles of denaturation at 95°C for 45 s, annealing for 30 s at specific 

temperatures  (Table  1),  and  extension  at  72°C  for  45  s.  The  program  ended  with  an 

additional  7  min  and  additional  extension  at  72°C  followed  by  a  cool  down  to  4°C.  All 

primer sets were run with a positive control and a negative control containing no template 

DNA. All samples were run on a 1% agarose (Applied Biological Materials,  Inc., B.C., Cat # 

GO60‐2)  gel  electrophoresis  and  visualized  using  Gel  Logic  200  Imaging  system®  from 

Mendel under U.V. light. 

3.9 Antagonistic study by dual culture method

Twenty‐one  bacterial  endophyte  isolates  were  screened  for  antifungal  activity  by 

dual culture method against plant pathogenic fungi and biological control agents that were 

obtained  from  established  fungal  data  banks  and  from  collaborators  (Table  3).  Bacterial 

endophytes and test fungi were grown on PDA culture plates and incubated at 24°C. A 5mm 

diameter mycelial plug taken from the edge of actively‐growing test  fungus was placed  in 

34

the  middle  of  the  culture  plate  containing  15  ml  of  PDA.  A  10μl  aliquot  of  LB  broth 

containing  bacterial  of  suspension  with  a  concentration  of  105 CFU ml−1  was  aseptically 

deposited  on  both  sides  at  2.5 cm  from  test  fungus.  Simultaneously,  culture  plates 

inoculated with test fungi and the endophytes served as control.  All plates were allowed to 

grow at 24°C  in the dark  for 5 days. Three replicates were used for each test  fungus. The 

inhibitory effect on fungal growth was evaluated by development of an inhibition zone on 

either side of the test fungus and compared with control (fungus alone).   

3.10 Inoculation of switchgrass seedling with Bacterial endophyte isolate and

confirmation of the re-isolated bacteria.

To  test whether  bacterial  endophytes were  able  to  colonize  switchgrass,  bacterial 

isolates  were  introduced  into  seedling  grown  aseptically  under  controlled  conditions. 

Magenta® GA‐7 Plant Culture Boxes 3 x 3 x 4" (Magenta, Chicago III) containing 100 g of 

sand and vermiculite (50/50% v/v) were autoclaved for 1 h every 24 h for a period of 72 h. 

Twenty surface sterilized switchgrass seeds were seeded in each Magenta box and grown in 

a growth chamber at 22°C under a 12‐h/12‐h of light/dark cycle.  Each box received 5 ml of 

sterile‐distilled  water  at  seeding.    Bacterial  endophytes  were  grown  in  LB  broth  for  24 

hours  to  the mid‐log  phase,  pelleted  by  centrifugation,  washed  and  suspended  in  sterile 

distilled water.  After two weeks, plants were thinned down to 15 seedlings, which received 

35

5  ml  of  water  containing  105  CFU/ml  of  bacteria.    Switchgrass  seedlings  receiving 

autoclaved  distilled  water  served  as  control.    Putative  endophytes  Bacillus  subtilis  and 

Microbacterium  testacum  were  tested  alone  and  in  combination.    Plants  were  incubated 

further  for  another 2 weeks.    Four‐week‐old  seedlings were dipped  in  a  solution of  70% 

ethanol, rinsed in autoclaved‐distilled water, separated into roots and shoots, and subjected 

to DNA extraction using QIAGEN DNeasy® Plant Mini kit.  Using specific primers designed 

for  each  endophyte,  the  presence  of  endophytes  was  assessed  in  roots  and  shoots  of 

inoculated  and  non‐inoculated  switchgrass.    The  experiment was  replicated  8  times  and 

each replicate contained 15 plants.   

36

Chapter IV Results 

4.1 Efficacy of sterilization

The  surface  sterilization  protocol  was  a  critical  prerequisite  for  isolating  plant 

endophtyic  bacteria  and  fungi.  This  study  proved  that  the  surface  sterilization  protocol 

combined with  the  imprint  technique was  effective  in  removing  epiphytic organisms  and 

that  the  bacterial  and  fungal  isolated  strains  can  be  considered  to  be  true  endophytic 

organisms.  

4.2 Survey of Switchgrass endophytes and molecular identification

  Over the course of this study (2010 and 2011), 594 switchgrass leaf segments were 

incubated and the total number of culturable endophytes was 145 among which 93 strains 

were fungi and 52 strains were bacteria (Figures 1A‐B). The majority of the fungal (91%) 

and  bacterial  (73%)  endophytes  were  recovered  from  the  switchgrass  cultivar  Cave‐in‐

Rock.  Of  those,  80  fungal  and  26  bacterial  isolates  originated  from  old  stands  of  Cave  in 

37

Rock, followed by those recovered from Blue Jacket, while the remaining endophytes were 

distributed equally between Tecumseh and Sand Lover (Figures 4.1A‐4.1B).   Interestingly, 

irrespective of the cultivar or leaf type (i.e., vegetative or reproductive), 75 out of 93 fungal 

endophytes  originated  from  switchgrass  blades,  while  bacterial  endophytes were  almost 

qually distributed between the sheaths and the blades (Figures 4.1C‐1D). e

 

The  fungal  isolates were  grouped  into  9 morphogenic  groups  and were  identified 

into different taxa based on cloning and sequencing of amplified fragments (300‐700 bp) of 

the ITS region (Table 4.1). All  isolates showed a good homology ranging from 93 to 100% 

with other known sequences (Table 4.2) and partial sequence data for the 18s rDNA have 

been  deposited  in  the  GenBank  (NCBI)  nucleotide  sequences  data  base  library.    Data  for 

endophytic strains have been deposited under the following accession numbers (JN689341‐

JN689349).    The  fungi  (Table  4.2)  were  identified  as  Chaetomium  globosum  (Sordiales) 

Epicoccum  nigrum  (Dothideales),  Emericella  spp.  (Eurotiales),  Ascochyta  sp. 

(Sphaeropsidales), Penicillium resedanum (Eurotiales), Alternaria alternata (Pleosporales), 

Aspergillus versicolor (Eurotiales), Cladosporium tassiana (Mucorales), and Syncephalastrum 

racemosum  (Mucorales).  All  of  which  are  known  as  common  fungal  endophytes.    C. 

globosum,  E.  nigrum  and  Ascochyta  sp.  were  the  most  widely  isolated  strains  (data  not 

shown). 

 

38

Twenty‐two  of  the  bacterial  isolates  tested  gram‐positive  and  30  were  gram‐

negative. A total of twenty‐one strains of bacterial endophytes were randomly selected out 

of 52 isolated strains and tested for their antagonistic activities against selected pathogenic 

fungi  in  dual  culture  assays  (Figure  4.2).  Strains  showing  antagonistic  activity  were 

subsequently identified by cloning and sequencing the amplified fragment (1505 bp) using 

the  ITS  sequence  data.    Also,  two  additional  strains  that  did  not  exhibit  any  antagonistic 

activity  were  also  sequenced.  Partial  sequence  data  for  the  16s  rDNA  gene  have  been 

deposited  in  the  GenBank  (NCBI)  nucleotide  sequences  data  base  library.    Data  for 

endophytic strains have been deposited under the following accession numbers (JN689336‐

JN689340).   All were grouped  into 5 different  taxa  that shared high homology of 98‐99% 

with  other  known  sequences  (Table  4.2).  Bacterial  endophytes  were  identified  as 

Microbacterium  testaceum  (Gram‐positive;  Actinomycetales),  Curtobacterium 

flaccumfaciens (Gram‐positive; Actinomycetales), Pseudomonas fluorescens (Gram‐negative; 

Pseudomonadales),  Bacillus  subtilis  (Gram‐positive;  Bacillales)  and  Panteoa  ananatis 

(Gram‐negative;  Enterobacteriales),  with  the  latter  as  the  most  frequently  isolated 

endophyte (data not shown).  

 

Phylogeny  analysis  based  on  a  maximum  likelihood  with  a  bootstrap  analysis 

repeated 1000  times was performed on  the  identified using  the bacterial  16S  rRNA gene 

sequences.  The  analysis  revealed  a  good  homology.    For  example,  the  homology  value 

39

between  the  isolate  Panteoa  ananatis  JN689340  and  Pantoea  ananatis  GQ383910  from 

Genbank was 99%. The rooted maximum likelihood tree showed good bootstrap values at 

the nodes many of them above 70%, which demonstrate the most probable branching of the 

tree.  Each of the isolated endophyte clustered with a single group of species, which indicate 

the good identification of the organism.  

4.3 Detection of fungal and bacterial endophytes using PCR methods- plants and seeds

The presence of  the  identified endophytes  in  various  tissues  (leaves  and  seeds) of 

field‐grown  switchgrass  cultivars  was  confirmed  by  PCR  assays  using  species‐specific 

designed  primer  for  each  one  of  the  identified  endophytes.    The  presence  of  endophytes 

varied  with  cultivars  and  tissue  types.    The  bacterial  endophytes,  B.  subtilis  and  C. 

flaccumfactiens,  and  the  fungal  endophytes, E. nigrum, Ascochyta sp., S. racemosum  and P. 

resedanum were  detected  in  tissues  of  switchgrass  grown  from  seeds  collected  in  2009 

(Figure 4.4).   Others were detected  in one switchgrass cultivar only such as,  the bacterial 

endophytes M. testacum and the fungal endophytes C. globosum, A. versicolor  were found in 

Cave‐in  Rock  cultivar.    The  fungal  endophyte Emericella  sp. was  found  in  Tecumseh  and 

Blue  Jacket.    The  species‐specific  primer  sets  failed  to  detect  the  bacterial  endophytes: 

Pseudomonas  fluorescens,  Panteoa  ananatis  and  fungal  endophytes  A.  alternata  and 

Cladosporium  tassiana  in  field  switchgrass  although  they  successfully  amplified  the 

endophyets  when  grown  in  pure  culture  (Data  not  shown).    Interestingly,  vertical 

40

transmission of  the  following endophytes via seeds; B. subtilis, E. nigrum, Ascochyta sp., P. 

resedanum, and S. racemosum was confirmed in switchgrasss grown in 2010 and originated 

from seeds collected in 2009 (Figure 4.5D).  

4.4 Antagonistic property of endophytes and re- inoculation of switchgrass with

endophytes

Six  out  of  21  bacterial  strains  were  antagonistic  against  all  different  test  fungi. 

Antagonism towards the test fungi was recorded as inhibition zone developing during dual 

culture  and  ranging  from  1  mm  to  greater  than  3  mm  (Figures  4.2A  and  B;  Table  4.3).  

Bacillus subtilis  (strains B26 and B32) and P. fluorescens (strain B25) were effective against 

all  test  fungi,  followed  by  P.  ananatis  (strains  B45,  B46  and  B47)  that  was  antagonistic 

gainst selected test fungi. a

 

The presence of endophytes was successfully detected in roots and shoots of four-week-

old switchgrass inoculated singly (Figures 4.5A and 4.5B) or in combination with Bacillus

subtilis and Microbacterium testacum (Figures 4.5C). Absence of endophytes was confirmed in

non-inoculated switchgrass seedlings (Figures 4.5A and 4.5B).

41

42

 

Table 4.1. List of isolated endophytes, specific and universal primers designed and used in polymerase chain reaction (PCR) assays 

Targeted organism  Forward and reverse primer sequences  (5’ to 3’) 

Primer Tm(°C) 

PCR product size 

Genebank accession number for targeted gene 

Reference

Bacteria  

        

Microbacterium testaceum  CCCTATCGCATGGTGGCGAGTGTCCAAAGAGTTG  

60  836  JN689336  1

Curtobacterium flaccuxmfaciens 

CTGGCCGCATGGTCTACACCGACCACAAGGGGGC  

60  778  JN689337  1

Pseudomonas fluorescens  TGCATTCAAAACTGACTGAATCACACCGTGGTAACCG  

55  850  JN689338  2

Bacillus subtilis  CAAGTGCCGTTCAAATAGCTCTAGGATTGTCAGAGG  

60  650  JN689339  1

Pantoea ananatis  GTCTGATAGAAAGATAAAGACCGGTGGATGCCCTGGCA  

57  450 

 

JN689340 

 

3

Fungi  

   

Chaetomium globosum  TATGGAGGTGGATGCGAATACC AAACGCGTCAAAGGTTCCAA   

60  301   JN689341  4

Epicoccum nigrum  GCTGGCAATGGTGTTGGCAAAGGGCAATGCAAGGAAGACC 

65  355  JN689342  1

43

 

Emericella  sp.  GCTGGCAATGGTGTTGGCAAAGGGCAATGCAAGGAAGACC  

55    JN689343  5

Ascochyta sp.  CCGTATTGGTTACAAAGCGCCCGAGAGTTGTAGGCTTCTGTC  

57  425  JN689344  1

Penicillium resedanum  AGACAACCACAGGGGCTGCTCTGAACCCTGTCTGAAGTAAG  

56  373  JN689345  1

Alternaria alternata  CGAGGGTGACTACGTCTGGAAGCGCATCCTGCCCAGTTG  

65  97  

JN689346  6

Aspergillus versicolor  CTAACACTGTTGCTTCGGCGGGATACGCTCGAGGACCGGACAC  

66  363  JN689347  1

Cladosporium tassiana  TACTCCAATGGTTCTAATATTTTCCTCTCGGGTACCTAGACAGTATTTCTAGCCT  

68  123  JN689348  7

Syncephalastrum racemosum  GAAGACACTTAGCGCACGCACAGCGCAGGGCAATCATA    

64  273 

 

JN689349 

 

8

Universal primer  

   

Bacterial universal primers (1492f/27r) 

AGAGTTTGATCMTGGCTCAG GGTTACCTTGTTACGACT   

58  1465    9

Fungal universal primers (ITS1/4) 

TCCGTAGGTGAACCTTGCGGTCCTCCGCTTATTGATATGC 

58  650    10

44

45

 

Plant universal primer  CATTACAAATGCGATGCTCTTCTACCGATTTCGCCATATC  

55  300‐700    11

1. Present study; 2. Scarpellini, Franzetti et al. 2004; 3. Walcott, Gitaitis et al. 2002; 4. Hynes, Chaudhry et al. 

2006; 5. Matsuzawa, Tanaka et al. 2010; 6. Pavon, Gonzalez et al. 2010;  7. Qing‐Yin Zeng, Sven‐Olof Westermark 

et al. 2006; 8. I. Nyilasi and K. Krizsa ́n 2008; 9. Frank, Reich et al. 2008; 10. White et all, 1990; 11. Taberlet, 

Gielly et al. 1991 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 4.2. Molecular identification of bacterial and fungal endophytes from Panicum virgatum L. based on blastN queries in NCBI  Taxon  Switchgrass 

Cultivar Genbanck accession No. 

Closest blast match (Genbanck accession No.)  Query/reference ITS length (Similarity %) 

BACTERIA  

       

Curtobacterium flaccumfaciens 

Cave‐in‐Rock JN689336 Curtobacterium flaccumfaciens (AM410688)  1502/1504 (99)  

Pseudomonas fluorescens 

Cave‐in‐Rock JN689337 Pseudomonas fluorescens (DQ439976)  1476/1500 (98)  

Microbacterium testacum 

Cave‐in‐Rock JN689338 Microbacterium testacum (EU714365)  1455/1466 (99)  

Bacillus subtilis  Cave‐in‐Rock JN689339 Bacillus subtilis (HQ727971)  1502/1503 (99)  

Pantoea ananatis  Cave‐in‐Rock JN689340 

Pantoea ananatis (GQ383910)  1483/1490 (99)   

FUNGI  

 

46

 

Chaetomium globosum 

Cave‐in‐Rock JN689341 Chaetomium globosum (HQ529775)  575/576 (99)  

Epicoccum nigrum  Cave‐in‐Rock and Tecumseh 

JN689342 Epicoccum nigrum (FN868456)  576/576 (100)  

Emericella sp.  Cave‐in‐Rock JN689343 Emericella sp. (AB249015)  581/581 (100)  

Ascochyta sp.  Cave‐in‐Rock JN689344 Ascochyta hordei (HQ882800)  479/490 (98)  

Penicillium resedanum 

Cave‐in‐Rock JN689445 Penicillium resedanum (AF033398)  576/579 (99)  

Alternaria alternata  Cave‐in‐Rock JN689446 Alternaria alternata (JN618076)  423/423 (100)  

47

Aspergillus versicolor 

Cave‐in‐Rock JN689447 Aspergillus versicolor (AY373880)  568/569 (99)  

Cladosporium tassiana 

Tecumseh JN689348 Cladosporium cladosporioides (HQ380766)  548/548 (99)  

Syncephalastrum acemosum r

Cave‐in‐Rock JN689349 Syncephalastrum racemosum (HQ2855713)  303/326 (93)  

 

 

 

 

 

 

 

 

 

 

 

Table 4.3. Dual culture antagonistic experiment using different fungi 

Test fungus 

No inhibition; +, zone of inhib ion 1   3 mm ; ++, ne o nhib on o ore

th

it to    zo f i iti f m  

an 3 mm $ numbers in bracket represent the strain designation 

1. G. Lazarovits, Agriculture, Agri‐Food Canada, London, Ontario, Canada; 2. 

S. Neate, DPI, Queensland, Australia; 3. M.A. Cubeta, CIFR, North Carolina 

State University, NC, USA; 4. American Type Culture Collection (ATTC), 

Manassas, VA20108, USA.           

B4 B8 B25 B26 B32 B45 B46 B47$

Fusarium solani1  

‐  ‐  ++  ++  ++  ‐  ‐  ‐ 

B inucleate rhizoctonia 17072  ‐  ‐  + 

 

+ 

 

++ 

 

‐ 

+ 

+ 

+ 

+ 

+ Rhizoctonia solani3  

‐  ‐  ++ ++ ++ + + +

Trichoderma virens4  

‐  ‐  +  +  +  ‐ 

 

‐ 

 

‐ 

 Stachybotrytis elegens4  

‐  ‐  +  +  +  ++ ++ ++

Phytophtora infestans1  

‐ 

‐ 

‐ 

‐ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ Verticillium albo atrum1 

 

 

 

48

 

 

 

 

 

Fig.4.1. Distribution of  fungal and bacterial endophytes across  the different 

cultivars and leaf tissues. (A) Fungal isolates across the different cultivars (B) 

Bacterial  isolates  across  the  different  cultivar  (C)  Fungal  endophytes  in 

different leaf tissues (D) Bacterial endophytes in the different leaf tissues.    

49

Fig.4.2.    Antagonistic  test  of  (A) Pantoea  ananatis  and  (B) Bacillus  subtilis 

against Rhizoctonia  solani.    (A­1) R.  solani  ;  (A­2 and A­3) R.  solani  and P. 

ananatis;  (B­1)  Rhizoctonia  solani  alone;  (B­2  and B­3)  Rhizoctonia  solani 

and Bacillus subtilis. 

50

51

Fig.4.3.  Maximum  likelihood  phylogenic  tree  of  all  putative  endophytic 

bacteria. The tree based analysis of partial 16S rDNA sequences of bacterial 

isolates from switchgrass. Numbers above each node indicate percentage of 

confidence  levels  generated  from  1000  bootstrap  trees  and  the  GeneBank 

Accession numbers precede the species names. 

52

Fig. 4. Example of PCR detection of fungal (A) and bacterial (B) endophytes 

detection  in  different  switchgrass  cultivars  using  species‐specific  primers. 

(A) Ascochyta sp. and (B) Bacillus subtilis. 100 bp DNA ladder lanes 1, lanes 2 

Pure fungal genomic DNA of (A) Ascochyta or (B) Bacillus subtilis lanes 2, No 

template lanes 3, PCR on template isolated from leaves of Tecumseh lanes 4‐

7, Cave‐in‐Rock lanes 8‐11, Blue Jacket lanes 12‐15, Sand Lover lanes 16‐19, 

PCR  on  template  isolated  from  seeds  of  Tecumseh,  Cave‐in‐Rock  and  Blue 

Jacket, respectively lanes 20‐21. 

53

Fig. 5.  PCR detection of Bacillus  subtilis  (A), Microbacterium  testaceum  (B), 

the combination of both (C) recovered from colonized switchgrass seedlings. 

(D)  example  of  vertical  transmission  of  the  fungal  endophyte  Epicoccum 

nigrum.  (A)    100 bp DNA  ladder  lane 1,  Pure DNA of   B.  subtilis  lane 2, No 

template lane 3, DNA of non‐inoculated switchgrass seedlings lanes 4‐6, DNA 

of re‐inoculated switchgrass seedling with B. subtilis  lane 7, DNA from roots 

of  colonized  switchgrass  lane  8,  DNA  from  leaves  and  stems  of  colonized 

switchgrass  lane 9;  (B)    100 bp DNA  ladder  lane 1, DNA of  non‐inoculated 

switchgrass  seedlings  lane  2‐5,  DNA  from  roots  of  colonized M.  testaceum 

switchgrass  seedling  lanes 6‐7, DNA  from stems and  leaves of  colonized M. 

testaceum switchgrass lanes 8‐9, Pure genomic DNA of M. testaceum lane 10, 

No template lane 11; (C) 100 bp DNA ladder lane 1, Pure genomic DNA of B. 

subtilis  lane 2, No template lane 3, DNA from roots of colonized switchgrass 

with B.  subtilis and M.  testaceum and  tested with B.  subtilis  primers  lane 4, 

DNA from shoots of colonized switchgrass with B. subtilis and M.  testaceum 

switchgrass and tested with B. subtilis primers lane 5, pure genomic DNA of 

54

B.  subtilis  lane  6,  No  template  lane  7,  DNA  from  roots  of  colonized 

switchgrass with B. subtilis and M. testaceum switchgrass and tested with M. 

testaceum primers lane 8, DNA from shoots of colonized switchgrass with B. 

subtilis and M.  testaceum and  tested with M.  testaceum primers  lane 9;  (D) 

100  bp  DNA  ladder  lane  1,  Pure  genomic  DNA  of  E.  nigrum  lane  2,  No 

template lane 3, DNA of flag leaf collection from cultivar Cave‐in‐Rock line 4, 

collected seeds from cultivar Cave‐in‐Rock line 5, flag leaf from Cave‐in‐Rock 

grown from seed lane 6. 

55

Chapter V Discussion 

Endophytic  fungi  and  bacteria  are  ubiquitous  in  nature,  infecting 

virtually all plants  in both natural and  in agronomic ecosystems  (Hyde and 

Soytong,  2008;  Ryan  et  al.,  2008;  Schulz  and  Boyle,  2005).    Some  of  these 

likely  have  no  beneficial  effects  on  host  fitness  and  may  be  either  latent 

pathogens  or  saprophytes  that  remain  inactive  until  environmental  cues 

trigger  a  developmental  shift  for  the  fungus  or  bacteria  to  continue  its 

lifecycle. Others have been  repeatedly  isolated and described as  endophyte 

and  showed  to  be  beneficial  in  some  way  to  the  plant.  The  endophytes 

isolated  over  the  course  of  this  work  were  obtained  using  a  traditional 

method,  in which only  endophytes  that  can grow on microbiological media 

were  accounted  for which may  create  a  negative  bias  towards  endophytes 

that  are  slow  growing  or  that  can’t  grow  on  biological media.    In  order  to 

assess the full range of endophyte future work should incorporate techniques 

like DGGE or T‐RLFP (Bridge and Newsham, 2009; Duong et al., 2006).  As the 

over arching aim of this study is to identify endophyte species that could be 

introduced  into  elite  switchgrass  cultivars  for maximizing  their  utility  as  a 

bionergy crop, we focused on these endophytes that could be grown on pure 

culture and by using different media with different sources of carbon and pH, 

e believe to have countered as many as possible.  w

 

56

Our  research  goals were  to  survey  switchgrass  grown  in Quebec  for 

the  presence  of  endophytic  bacteria  and  fungi,  and  to  determine  their 

taxonomic  position.  Strategically,  in  order  to  cover  a  maximum  genetic 

diversity, we sampled leaves from old and well‐established stand as well as 

from recently established fields of four switchgrass cultivars having different 

genetic  background.    In  this  study,  we  demonstrated  that  a  wide  range  of 

fungal and bacterial species from 11 different taxa orders exist as endophytes 

in  switchgrass  cultivars.    Similarly,  other  researchers  have  reported  on  the 

isolation  of  indigenous  bacterial  endophytes  from  leaf  tissue  (Zinniel  et  al., 

2002) and fungal endophytes from leaf and root tissues (Ghimire et al., 2011) 

of switchgrass that naturally inhabits prairies. To the best of our knowledge, 

our  study  is  the  first  to  describe  both  indigenous  fungal  and  bacterial 

endophytes  from  elite  switchgrass  cultivars  produced  through  breeding.  

There appears to be significant variation in the types of indigenous fungi and 

bacteria  from  naturally  occurring  and  breeding  lines  of  switchgrass.    The 

only common fungal endophyte recovered from prairie switchgrass (Ghimire 

et  al.,  2011)  and  from  the  switchgrass  breeding  lines  (our  study)  was  A. 

alternata  and Ascochyta  sp.  (anamorph Didymella).  In  the  case  of  bacterial 

endophytes,  Curtobacterium  and Microbacterium  species  were  common  as 

they  were  recovered  endophytes  from  prairie  switcthgrass  (Zinniel  et  al., 

2002) and from the cultivars used in this study.  Several factors may explain 

these  differences,  including  cultivar  type,  plant  age  and  tissue  type  and 

seasonality (Clay, 1984; Ghimire et al., 2011) 

57

  

Some of the fungal genera to which our switchgrass isolates have been 

assigned  are  known  to  display  a  variety  of  interactions  with  plants.    For 

instance,  Alternaria  alternata  has  been  described  a  frequently  recovered 

endophyte (Guo et al., 2004) as well as a plant pathogen causing post‐harvest 

diseases  of  fruits  and  vegetables  (Tian  et  al.,  2011).  Another  fungal  genus, 

Cladosporium  exhibits  interactions  with  plants  ranging  from  facultative 

biotrophs  to  endophytes  and  epiphytes  (Wirsel  et  al.,  2001)  and  has  been 

reported  along with Aspergillus  versicolor  to  display  anti‐micorbial  activity 

against  several  human  pathogens  (Sette  et  al.,  2006).    We  are  currently 

investigating  these  isolates  in  details  to  establish  their  physiological 

capacities. 

Over  the  course  of  this  study,  endophytes  were  isolated  from  594 

switchgrass  leaf  segments with  the majority  (85%)  of  bacterial  and  fungal 

endophytes originating  from an old stand of Cave‐in‐Rock cultivar  that was 

established  sixteen  years  ago.  This  is  not  surprising  as  the  disparity  in  the 

number  of  isolates  per  cultivar  may  be  the  result  of  plant  age.  As  time  of 

exposure  to  endophyte  inoculum  increases,  plants  seem  to  accumulate  an 

increasing number of endophytes in their tissues. Because of this, older plant 

parts  may  harbor  more  and  diverse  populations  of  fungal  and  bacterial 

endophytes  than  younger  ones  (Arnold  and  Herre,  2003;  Clay,  1984). 

Another  plausible  explanation  for  increased  incidence  of  recovered 

endophytes  from  Cave‐in‐Rock  may  be  related  to  the  environmental 

58

conditions  favoring  the  incidence  of  endophytes.  It  has  been  shown  that 

humid and hot conditions are likely more conducive for increased incidence 

of  endophytes  than  arid  and  cold  conditions  (Arnold  and  Lutzoni,  2007; 

Sánchez Márquez et al., 2010).  Among the switchgrass cultivars used in this 

study,  cultivar  Cave‐in‐Rock  was  developed  in  humid  areas  of  southern 

Illinois, USA (Elbersen et al., 2001), and probably evolved to promote higher 

endophyte incidence as the plant under such such conditions have boundless 

access with fungal endophytes and pathogens.  

 

The findings of our study show that the distribution of fungal, but not 

bacterial  endophytes,  in different  leaf  parts was  substantially  unequal.   We 

were  able  to  isolate  significantly  more  fungal  strains  from  the  leaf  blade 

compared  to  the  leaf  sheath.  We  are  not  able  to  explain  this  observation, 

however  recent  studies  have  shown  that  the  extent  of  leaf  colonization  by 

fungal  endophytes  including  that  of  leaf  blades  varies  among  host  grasses 

and probably reflects  the stage of development of  the primordial  leaf when 

the  hyphae  become  established  (Christensen  and  Voise,  2009).    Also,  leaf 

colonization  by  fungal  endohoytes  is  related  to  the  timing  of  entry  of  the 

hyphae  into  developing  leaves  (Christensen  et  al.,  2000).    The  ligular  zone 

found just below the leaf blade lacks continuous intercellular spaces and acts 

as a physical barrier preventing the entry of hyphae into leaf blades (Hinton 

and Bacon, 1985).  Although in our study, changes in endophyte distribution 

over  time  was  not  addressed,  it  is  likely  that  leaf  blade  colonization  of 

59

switchgrass  by  fungal  endophytes  occurred  before  a  certain  stage  in  the 

development  of  the  ligular  zone.    Another  plausible  explanation  is  the 

difference in the nature of the tissues composing the leaf sheath and the leaf 

blade might explain the difference in the number of isolate.   The leaf sheath 

has  a  much  greater  content  of  lignified  tissues  than  the  leaf  blade 

(Rangasamy et al., 2009).  Lignified tissues are harder to penetrate for fungi 

and provide a natural plant protection, thus making it less hospitable for the 

endophytes (Raven et al., 2005). 

 

  The  dominant  taxa  recovered  from  switchgrass  reflect  an  unequal 

distribution of  isolate  richness among species.   This kind of  abundance has 

also been observed in other grasses (Sánchez Márquez et al., 2010; Wirsel et 

al.,  2001).    It  is  not  yet  clear whether  this  abundance  inequality  is method 

related,  that  is  selection  of  certain  taxa  by  the  cultivation method.  Several 

dominant taxa of Switchgrass endophytes also have been identified in other 

grasses  and  plants  of  other  families  implying  that  these  species  are  host‐

generalists.    Examples  of  these  taxa  are Epicoccum, Chaetomium, Ascochyta 

and Panteoa (Hashizume et al., 2010; Mano et al., 2007; Neubert et al., 2006; 

ánchez Márquez et al., 2010). S

 

  Our  results  demonstrated  that  the  five  different  recovered  taxa  of 

bacteria  from  switchgrass  are  also  associated  with  grasses  and  plants  as 

endophytes  (Lodewyckx  et  al.,  2002;  Zinniel  et  al.,  2002).    The  beneficial 

60

effects of bacterial endophytes on their host plants appear to occur through 

similar  mechanisms  described  for  plant‐growth  promoting  rhizobacteria 

(Lodewyckx  et  al.,  2002).  Plant  growth‐promoting  bacteria  can  affect  plant 

growth directly or indirectly. The direct promotion of plant growth by PGPR 

or  endophytes  such  as  Microbacterium  testaceum  and  Panteoa  ananatis 

(Thomas et al., 2007; Zinniel et al., 2002) for the most part, entails providing 

the  plant  with  a  compound  that  is  synthesized  by  the  bacterium  and  the 

uptake of certain nutrients from the environment. The indirect promotion of 

plant  growth  occurs  when  PGPR  or  endophytes  (e.g.,  Pseudomonas 

fluorescens,  Bacillus  subtilis,  Curtobacterium  flaccumfaciens,  and  Panteoa 

species)  decrease  or  prevent  the  deleterious  effects  of  one  or  more 

phytopathogenic organisms via  release of  antimicrobial metabolites  (Bacon 

t al., 2001; Landa et al., 2004; Mano et al., 2007; Thomas et al., 2007). e

 

Our  ITS‐sequence database  for  switchgrass‐associated  fungi was not 

only  the  basis  for  molecular  taxonomy  but  also  served  as  a  source  for 

designing  species‐specific  primers  for monitoring  individual  fungal  species 

within DNA isolated from leaves and seeds of switchgrass cultivars. We have 

applied this approach for tracking individual endophytes by PCR analysis in 

seeds  and  of  mixed  endophytes  reintroduced  into  switchgrass  seedlings. 

Seed‐borne  endophytes  can  provide  improved  vigor  to  switchgrass,  which 

could be most  important when establishing new switchgrass  stands.  In our 

study, the endophytes B. subtilis, E. nigrum, P. resedanum, S. racemosum were 

61

62

frequently detected in switchgrass seeds as well as plants grown in 2010 that 

originated from seeds collected in 2009.  These results demonstrate that the 

endophytes are carried by seeds as a viable propagule and can be vertically 

transmitted to the next generation of the host. The same type of transmission 

is found in common reed, corn, coffee and some native grasses (Bacon et al., 

001; Ernst et al., 2003; Vega et al., 2006) 2

 

  Endophytic  bacteria  inside  a  plant might  either  become  localized  at 

the  point  of  entry  or  spread  throughout  the  plant  (Hallmann  et  al.,  1997).  

These microorganisms reside within cells, in the intercellular space or in the 

vascular system (Hallmann et al., 1997) .  In our colonization experiments, B. 

subtilis  and M.  testaceum were  recovered  from  sterilized  roots,  and  leaves 

two weeks  after  inoculation  of  switchgrass  seedlings,  indicating  successful 

internal colonization within the roots and the leaves.   These results indicate 

that  the  endophytes  in  switchgrass  seedlings  moved  from  the  roots  and 

travelled upward  to  the  stem and  leaves. Our  results  concur with  previous 

findings, which also demonstrate the ability of B. subtilis endophytic strain to 

enter the roots and migrate in the upper stems and leaves of eggplants (Lin et 

l., 2009). a

 

Chapter VI Conclusion 

In  summary,  we  recovered  9  different  endophytic  fungi  and  5 

different  endophytic  bacteria  from  four  switchgrass  cultivars.    These 

endophytes were  identified using molecular  techniques. Our  findings are  in 

agreement  with  other  studies  that  the  recovered  identified  endophyte  are  

known endophytes in other plants, including perennial grasses. 

 

The  in‐vitro  dual‐culture  method  using  endophytic  bacteria,  

demonstrated their bioactivity potential against plant pathogenic fungi.  Our 

results  corroborate  the  finding  of  several  studies  which  show  the 

antagonistic activity of bacterial endophytes.   Thus, switchgrass endophytes 

represent a potential source of symbionts that can play an important role in 

switchgrass production. 

 

The  species‐specific  primers  that  we  have  developed  can  now  be 

applied  to  systematically  screen  samples  from  various  natural  habitats, 

locations,  and  seasons  in  order  to  reveal  putative  correlations  between 

switchgrass health and the switchgrass‐associated endophytes discovered in 

this study. 

 

The successful colonization of switchgrass with selected endophytes, 

either applied singly or  in combination suggests that they can be utilized in 

63

future applications such as delivery of degradative enzymes or antimicrobial 

metabolites for controlling diseases. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

64

Chapter VII References Arnold A.E., Herre E.A. (2003) Canopy cover and leaf age affect colonization 

by  tropical  fungal  endophytes:  Ecological  pattern  and  process  in 

Theobroma cacao (Malvaceae). Mycologia 95:388‐398.  

Arnold  A.E.,  Lutzoni  F.  (2007)  Diversity  and  host  range  of  foliar  fungal 

endophytes: Are tropical leaves biodiversity hotspots? Ecology 88:541‐

549.  

Arnold  A.E.,  Maynard  Z.,  Gilbert  G.S.,  Coley  P.D.,  Kursar  T.A.  (2000)  Are 

 tropical fungal endophytes hyperdiverse? Ecology Letters 3:267‐274. 

Athukorala  S.N.P.,  Fernando  W.G.D.,  Rashid  K.Y.  (2009)  Identification  of 

antifungal  antibiotics  of  Bacillus  species  isolated  from  different 

microhabitats  using  polymerase  chain  reaction  and MALDI‐TOF mass 

n u l  spectrometry. Canadia  Jo rna  of Microbiology 55:1021‐1032. 

Azevedo  J.L.,  Maccheroni  Jr.  W.,  Pereira  J.O.,  de  Araújo  W.L.  (2000) 

Endophytic  microorganisms:  a  review  on  insect  control  and  recent 

advances on  tropical plants. Electronic  Journal of Biotechnology 3:15‐

16. 

Bacon C.W., Yates  I.E., Hinton D.M., Meredith F.  (2001) Biological  control of 

Fusarium  moniliforme  in  maize.  Environmental  Health  Perspectives 

109:325‐332. 

Bashyal B.P., McLaughlin S.P., Gunatilaka A.A.L. (2006) Zinagrandinolides A‐C, 

cytotoxic  delta‐elemanolide‐type  sesquiterpene  lactones  from  Zinnia 

grandiflora. Journal of Natural Products 69:1820‐1822.  

65

Bent  E.,  Chanway  C.P.  (1998)  The  growth‐promoting  effects  of  a  bacterial 

endophyte on lodgepole pine are partially inhibited by the presence of 

other rhizobacteria. Canadian Journal of Microbiology 44:980‐988. 

Berdahl  J.D., Frank A.B., Krupinsky  J.M., Carr P.M., Hanson  J.D.,  Johnson H.A. 

(2005)  Biomass  yield,  phenology,  and  survival  of  diverse  switchgrass 

cultivars and experimental strains in western North Dakota. Agronomy 

Journal 97:549‐555. 

Boe A., Ross J.G. (1998) Registration of  'Sunburst' switchgrass. Crop Science 

38:540‐540. 

Bouton  J.  (2008)  Improvement of Switchgrass as a Bioenergy Crop. Genetic 

Improvement of Bioenergy Crops:309‐345.  

Bridge  P.D.,  Newsham  K.K.  (2009)  Soil  fungal  community  composition  at 

Mars  Oasis,  a  southern  maritime  Antarctic  site,  assessed  by  PCR 

amplification and cloning. Fungal Ecology 2:66‐74.  

Casler  M.D.,  Boe  A.R.  (2003)  Cultivar  X  environment  interactions  in 

switchgrass. Crop Science 43:2226‐2233. 

Cassida K.A., Muir  J.P., Hussey M.A., Read  J.C., Venuto B.C., Ocumpaugh W.R. 

(2005) Biofuel Component Concentrations and Yields of Switchgrass in 

South Central U.S. Environments. Crop Science 45:682‐692.  

Chanway C.P. (1997) Inoculation of tree roots with plant growth promoting 

soil bacteria: An emerging technology for reforestation. Forest Science 

43:99‐112. 

66

Chaves M.M., Flexas J., Pinheiro C. (2009) Photosynthesis under drought and 

salt  stress:  regulation mechanisms  from whole plant  to cell. Annals of 

Botany 103:551‐560.  

Chiang  Y.C.,  Chou  C.H.,  Lee  P.R.,  Chiang  T.Y.  (2001)  Detection  of  leaf‐

associated  fungi  based  on  PCR  and  nucleotide  sequence  of  the 

ribosomal  internal  transcribed  spacer  (ITS)  in  Miscanthus.  Botanical 

Bulletin of Academia Sinica 42:39‐44. 

Christensen M.J., Voise C.R. (2009) Tall Fescue – Endophyte Symbiosi, in: D. B. 

H. In H.A. Fribourg, and C.P. West (Ed.), Tall fescue for the twenty‐first 

centur, Agronomy Monograph, Southampton. pp. 251‐27. 

Christensen M.J., Simpson W.R., Al Samarra T. (2000) Infection of tall  fescue 

and  perennial  ryegrass  plants  by  combinations  of  different 

Neotyphodium  endophytes.  Mycological  Research  104:974‐978.  DOI: 

d nuoi: ll. 

Clay  K.  (1984)  The  effect  of  the  fungus  Atkinsonella­Hypoxylon 

(Clavicipitaceae)  on  the  reproductive‐system  and  demography  of  the 

grass Danthonia­Spicata. New Phytologist 98:165‐175. 

Clay  K.  (1988)  Fungal  endophytes  of  grasses  –  A  defensive  mutualism 

between plants and fungi.  Ecology 69:10‐16. 

Clay K. (1990) Fungal Endophytes of grasses.   Annual Review of Ecology and 

Systematics 21:275‐297. 

Costa  C.P.,  Ferreira  M.C.  (1991)  Presevation  of  Microorganisms‐  A  Review 

Revista De Microbiologia 22:263‐268. 

67

Donner S., Kucharik C.  (2008) Corn‐based ethanol production compromises 

goal of reducing nitrogen export by the Mississippi River. Proceedings 

of the National Academy of Sciences 105(11):4513‐4518.  

Duong  L.M.,  Jeewon  R.,  Lumyong  S.,  Hyde  K.D.  (2006)  DGGE  coupled  with 

ribosomal  DNA  gene  phylogenies  reveal  uncharacterized  fungal 

phylotypes. Fungal Diversity 23:121‐138. 

Elbersen  H.W.,  Christian  D.G.,  Bassem  N.E.,  Bacher  W.,  Sauerbeck  G., 

Alexopoulou E., Sharma N., Piscioneri  I., Visser P.d., Berg D.v.d.  (2001) 

Switchgrass Variety Choice In Europe. Aspects Appl. Bio 65:21–28. 

Ellis  M.B.  (1971)  Denatiaceous  hyphomycetes.  Comowealth  Mycological 

Institute Kew 608; 1‐25. 

Ernst M., Mendgen K.W., Wirsel S.G.R.  (2003) Endophytic  fungal mutualists: 

seed‐borne  Stagonospora  Spp.  enhance  reed  biomass  production  in 

0‐587.  axenic microcosms. Molecular Plant‐Microbe Interactions 16:58

Ghimire  S.R.,  Craven  K.D.  (2011)  Enhancement  of  Switchgrass  (Panicum 

virgatum  L.)  Biomass  Production  under  Drought  Conditions  by  the 

Ectomycorrhizal  Fungus  Sebacina  vermifera.  Applied  and 

Environmental Microbiology 77:7063‐7067.  

Ghimire S.R., Charlton N.D., Bell J.D., Krishnamurthy Y.L., Craven K.D. (2011) 

Biodiversity  of  fungal  endophyte  communities  inhabiting  switchgrass 

(Panicum  virgatum  L.)  growing  in  the  native  tallgrass  prairie  of 

northern Oklahoma. Fungal Diversity 47:19‐27.  

68

Guo L.D., Xu L., Zheng W.H., Hyde K.D. (2004) Genetic variation of Alternaria 

alternata,  an  endophytic  fungus  isolated  from  Pinus  tabulaeformis  as 

determined  by  random  amplified  microsatellites  (RAMS).  Fungal 

ty . Diversi  16:53‐65

Haddad  A.,  Camacho  F.,  Durand  P.,  Cary  S.C.  (1995)  Phylogenetic 

characterization  of  the  epibiotic  bacteria  associated  with  the 

hydrothermal  vent  Polychaete  Alvinella­pompejana.  Applied  and 

Environmental Microbiology 61:1679‐1687. 

Hallmann  J.,  Quadt‐Hallmann  A.,  Mahaffee  W.F.,  Kloepper  J.W.  (1997) 

Bacterial  endophytes  in  agricultural  crops.  Canadian  Journal  of 

Microbiology 43:895‐914.  

Hashizume Y., Fukuda K., Sahashi N.  (2010) Effects of summer temperature 

on  fungal  endophyte  assemblages  in  Japanese  beech  (Fagus  crenata) 

 leaves in pure beech stands. Botany 88:266‐274.  

Hinton  D.M.,  Bacon  C.W.  (1985)  The  distribution  and  ultrastructure  of  the 

hendop yte of toxic tall fescue. Canadian Journal of Botany 63:36‐42.  

Hyde  K.D.,  Soytong  K.  (2008)  The  fungal  endophyte  dilemma.  Fungal 

Diversity 33:163‐173. 

Johnson M.C., Dahlman D.L.,  Siegel M.R., Bush L.P.,  Latch G.C.M., Potter D.A., 

Varney  D.R.  (1985)  Insect  feeding  deterrents  in  Endophyte‐Infected 

Tall Fescue Applied and Environmental Microbiology 49:568‐571. 

69

Kang  S.H.,  Cho  H.S.,  Cheong  H.,  Ryu  C.M.,  Kim  J.F.,  Park  S.H.  (2007)  Two 

bacterial  entophytes  eliciting  both  plant  growth  promotion  and  plant 

defense on pepper (Capsicum annuum L.).  Journal of Microbiology and 

Biotechnology 17:96‐103. 

Kitamoto Y., Suzuki A., Shimada S., Yamanaka K. (2002) A new method for the 

preservation  of  fungus  stock  cultures  by  deep‐freezing.  Mycoscience 

43:0143‐0149. 

Kloepper J.W., Ryu C.‐M. (2006) Bacterial Endophytes as Elicitors of Induced 

Systemic Resistance 9:33‐55. 

Microbial  Root  Endophytes,  in:  B.  J.  E.  Schulz,  et  al.  (Eds.),  Springer  Berlin 

Heidelberg. pp. 33‐52. 

Kobayashi D.Y., Palumbo J.D. (2000) Bacterial endophytes and their effects on 

plants  and  uses  in  agriculture:  Dekker  (Ed.),  Microbial  endophytes, 

Marcel Dekker, New‐York . 199‐243 

Krishnamurthy  K.,  Gnanamanickam  S.S.  (1997)  Biological  control  of  sheath 

blight  of  rice:  Induction  of  systemic  resistance  in  rice  by  plant‐

3 . associated Pseudomonas spp. Current Science 72: 31‐334

Landa  B.B.,  Navas‐Cortes  J.A.,  Jimenez‐Diaz  R.M.  (2004)  Influence  of 

temperature  on  plant‐rhizobacteria  interactions  related  to  biocontrol 

potential  for suppression of  fusarium wilt of chickpea. Plant Pathology 

53:341‐352.  

70

Larran S., Perello A., Simon M.R., Moreno V. (2002) Isolation and analysis of 

endophytic  microorganisms  in  wheat  (Triticum  aestivum  L.)  leaves. 

World Journal of Microbiology & Biotechnology 18:683‐686.  

Latch  G.C.M.,  Christensen  M.J.  (1985)  Artifical  infection  of  grasses  with 

endophytes Annals of Applied Biology 107:17‐24. 

Lee D.K., Boe A.  (2005) Biomass production of  switchgrass  in central South 

Dakota. Crop Science 45:2583‐2590.  

Lemus  R.,  Brummer  E.C.,  Moore  K.J.,  Molstad  N.E.,  Burras  C.L.,  Barker  M.F. 

(2002)  Biomass  yield  and  quality  of  20  switchgrass  populations  in 

southern Iowa, USA. Biomass and Bioenergy 23:433‐442. 

Lin L., Qiao Y.S., Ju Z.Y., Ma C.W., Liu Y.H., Zhou Y.J., Dong H.S. (2009) Isolation 

and characterization of endophytic Bacillius subtilis Jaas ed1 antagonist 

of  eggplant  Verticillium  wilt.  Bioscience  Biotechnology  and 

Biochemistry 73:1489‐1493.  

Lodewyckx C., Vangronsveld J., Porteous F., Moore E.R.B., Taghavi S., Mezgeay 

M.,  van  der  Lelie  D.  (2002)  Endophytic  bacteria  and  their  potential 

applications. Critical Reviews in Plant Sciences 21:583‐606. 

Madakadze  I.C.,  Stewart  K.,  Peterson  P.R.,  Coulman  B.E.,  Smith  D.L.  (1999) 

Switchgrass  biomass  and  chemical  composition  for  biofuel  in  eastern 

Canada. Agronomy Journal 91:696‐701. 

Malinowski D.P., Belesky D.P. (2000) Adaptations of endophyte‐infected cool‐

season grasses to environmental stresses: Mechanisms of drought and 

mineral stress tolerance. Crop Science 40:923‐940. 

71

Mano  H.,  Tanaka  F.,  Nakamura  C.,  Kaga  H.,  Morisaki  H.  (2007)  Culturable 

endophytic  bacterial  flora  of  the  maturing  leaves  and  roots  of  rice 

plants  (Oryza  sativa)  cultivated  in  a  paddy  field.  Microbes  and 

nEnviro ments 22:175‐185. 

Mendes  R.,  Pizzirani‐Kleiner  A.A.,  Araujo  W.L.,  Raaijmakers  J.M.  (2007) 

Diversity of cultivated endophytic bacteria from sugarcane: Genetic and 

biochemical characterization of Burkholderia cepacia complex isolates. 

Applied and Environmental Microbiology 73:7259‐7267.  

Miyamoto  T.,  Kawahara  M.,  Minamisawa  K.  (2004)  Novel  endophytic 

nitrogen‐fixing clostridia from the grass Miscanthus sinensis as revealed 

by  terminal  restriction  fragment  length  polymorphism  analysis. 

Applied and Environmental Microbiology 70:6580‐6586. 

Muir  J.P.,  Sanderson  M.A.,  Ocumpaugh  W.R.,  Jones  R.M.,  Reed  R.L.  (2001) 

Biomass  production  of  'Alamo'  switchgrass  in  response  to  nitrogen, 

phosphorus, and row spacing. Agronomy Journal 93:896‐901. 

Mukherjee S., Dawe A.L., Creamer R. (2010) Development of a transformation 

system in the swainsonine producing, slow growing endophytic fungus, 

Undifilum  oxytropis.  Journal  of  Microbiological  Methods  81:160‐165. 

DOI: 10.1016/j.mimet.2010.02.015. 

Neubert K., Mendgen K., Brinkmann H., Wirsel S.G.R. (2006) Only a few fungal 

species  dominate  highly  diverse  mycofloras  associated  with  the 

common reed. Applied and Environmental Microbiology 72:1118‐1128. 

72

Pavlo A., Leonid O., Iryna Z., Natalia K., Maria P.A. (2011) Endophytic bacteria 

enhancing growth and disease resistance of potato (Solanum tuberosum 

L.). Biological Control 56:43‐49.  

Pedersen J.F., Rodriguezkabana R., Shelby R.A. (1988) Ryegrass cultivars and 

endophyte  in  Tall  Fescue  affect  nematodes  in  grass  and  succeding 

soybean.  Agronomy Journal 80:811‐814. 

Ramarathnam R., Bo S., Chen Y., Fernando W.G.D., Gao X., de Kievit T. (2007) 

Molecular  and biochemical  detection of  fengycin‐  and bacillomycin D‐

producing Bacillus spp., antagonistic to fungal pathogens of canola and 

h n o  o  5 ‐w eat. Ca adian J urnal f Microbiology 3:901 911.  

Ramos  H.J.O.,  Souza  E.M.,  Soares‐Ramos  J.R.L.,  Pedrosa  F.O.  (2007) 

Determination of bean nodule occupancy by Rhizobium tropici using the 

double  gfp  and  gusA  genetic markers  constitutively  expressed  from a 

new  broad‐host‐range  vector.  World  Journal  of  Microbiology  & 

Biotechnology 23:713‐717.  

Rangasamy M., Rathinasabapathi B., McAuslane H.J., Cherry R.H., Nagata R.T. 

(2009)  Role  of  leaf  sheath  lignification  and  anatomy  in  resistance 

against  southern  Chinch  bug  (Hemiptera:  Blissidae)  in  St. 

Augustinegrass. Journal of Economic Entomology 102:432‐439. 

Raven P.H., F. E.R., Eichhorn S.E. (2005) Biology of Plants. 7 ed. Sara Tenney, 

New‐York. 686 

73

Rodriguez Estrada A.E., Hegeman A., Corby Kistler H., May G. (2011) In vitro 

interactions  between  Fusarium  verticillioides  and  Ustilago  maydis 

through  real‐time  PCR  and  metabolic  profiling.  Fungal  genetics  and 

biology : FG & B 48:874‐85. 

Rosenblueth M., Martinez‐Romero E.  (2006) Bacterial endophytes and their 

interactions with  hosts. Molecular  Plant‐Microbe  Interactions  19:827‐

837.  

Rouws  L.F.M.,  Meneses  C.,  Guedes  H.V.,  Vidal  M.S.,  Baldani  J.I.,  Schwab  S. 

(2010) Monitoring the colonization of sugarcane and rice plants by the 

endophytic  diazotrophic  bacterium  Gluconacetobacter  diazotrophicus 

marked  with  gfp  and  gusA  reporter  genes.  Letters  in  Applied 

Microbiology 51:325‐330. 

Ryan R.P.,  Germaine K.,  Franks A.,  Ryan D.J.,  Dowling D.N.  (2008)  Bacterial 

endophytes: recent developments and applications. Fems Microbiology 

Letters 278:1‐9.  

Samson  R.  (1991)  Switchgrass:  A  living  solar  battery  for  the  prairies. 

Sustainable Farming:4‐8 

Samson R. (1997) Technology evaluation and development of short rotation 

forestry and switchgrass for energy production,  in: N. R. Canada (Ed.), 

Ottawa. pp. 218. 

Samson R., Stamler S.B. (2007) The emerging Agro‐Pellet industry in Canada 

in: REAP‐Canada (Ed.), REAP‐Canada Librairy, REAP‐Canada, Ste‐Anne‐

de‐Bellevue. 

74

Sánchez Márquez S., Bills G., Domínguez Acuña L., Zabalgogeazcoa  I.  (2010) 

Endophytic mycobiota of  leaves and roots of  the grass Holcus  lanatus. 

Fungal Diversity 41:115‐123.  

Sanchez‐Azofeifa  A.,  Oki  Y.,  Wilson  Fernandes  G.,  Ball  R.,  Gamon  J.  (2011) 

Relationships between endophyte diversity and leaf optical properties. 

07/s00468‐011‐059Trees ‐ Structure and Function:1‐9. DOI: 10.10 1‐5. 

Sanderson,  A.  M.,  Read,  C.  J.,  Read,  L.  R.  (1999)  Harvest  management  of 

switchgrass  for  biomass  feedstock  and  forage  production  American 

Society of Agronomy 91: 5‐10. 

Sauer D.B., Burroughs R.  (1986) Disinfection of  seed surfaces with Sodium‐

Hypochlorite. Phytopathology 76:745‐749.  

Schardl C.L., Leuchtmann A., Spiering M.J.  (2004) Symbioses of grasses with 

seedborne fungal endophytes. Annual Review of Plant Biology 55:315‐

340.  

Schulz B., Boyle C. (2005) The endophytic continuum. Mycological Research 

109:661‐686.  

Schulz B., Wanke U., Draeger S., Aust H.J. (1993) Endophytes from herbaceous 

plants  and  shrubs  ‐  Effectiveness  of  surface  sterilization  methods 

Mycological Research 97:1447‐1450. 

Schulz  B.,  Rommert  A.K.,  Dammann  U.,  Aust  H.J.,  Strack  D.  (1999)  The 

endophyte‐host  interaction:  a  balanced  antagonism?  Mycological 

Research 103:1275‐1283. 

75

Schulz  B.,  Boyle  C.,  Draeger  S.,  Rommert  A.K.,  Krohn  K.  (2002)  Endophytic 

fungi:  a  source  of  novel  biologically  active  secondary  metabolites. 

Mycological Research 106:996‐1004.  

Sessitsch A.,  Reiter  B.,  Berg  G.  (2004)  Endophytic  bacterial  communities  of 

field‐grown  potato  plants  and  their  plant‐growth‐promoting  and 

antagonistic abilities. Canadian Journal of Microbiology 50:239‐249.  

Sette  L.D.,  Passarini  M.R.Z.,  Delarmelina  C.,  Salati  F.,  Duarte  M.C.T.  (2006) 

Molecular  characterization  and  antimicrobial  activity  of  endophytic 

fungi  from  coffee  plants.  World  Journal  of  Microbiology  & 

  8 . Biotechnology 22:11 5‐1195  

Smith  K.T.,  Bacon  C.W.,  Luttrell  E.S.  (1985)  Reciprocal  translocation  of 

carbohydrates  between  host  and  fungus  in  Bahiagrasss  infected with 

Myciogenospora atramentosa. Phytopathology 75:407‐411. 

Steinbach W.J., Shetty A. (2001) Use of the diagnostic bacteriology laboratory: 

a  practical  review  for  the  clinician.  Postgraduate  Medical  Journal 

8  77:14 ‐156. 

Strobel  G.,  Daisy  B.,  Castillo  U.,  Harper  J.  (2004)  Natural  products  from 

endophytic microorganisms. Journal of Natural Products 67:257‐268.  

Sturz A.V., Christie B.R., Nowak J. (2000) Bacterial endophytes: Potential role 

in developing sustainable systems of crop production. Critical Reviews 

in Plant Sciences 19:1‐30.  

Subramaniam  S.  (1998)  The  biology Workbench‐‐a  seamless  database  and 

analysis environment for the biologist. Protein 32;1‐2 

76

Sun L., Qiu F., Zhang X., Dai X., Dong X., Song W. (2008) Endophytic bacterial 

diversity  in  rice  (Oryza  sativa  L.)  roots  estimated  by  16S  rDNA 

sequence analysis. Microbial Ecology 55:415‐424.  

Suryanarayanan  T.S.,  Thirumalai  E.,  Prakash  C.P.,  Rajulu  M.B.G., 

Thirunavukkarasu N. (2009a) Fungi from two forests of southern India: 

a comparative study of endophytes, phellophytes, and  leaf  litter  fungi. 

Canadian Journal of Microbiology 55:419‐426.  

Suryanarayanan  T.S.,  Thirunavukkarasu  N.,  Govindarajulu  M.B.,  Sasse  F., 

Jansen R., Murali  T.S.  (2009b) Fungal  endophytes  and bioprospecting. 

Fungal Biology Reviews 23:9‐19. 

Taliaferro C.M.  (2002) Breeding  and  selection  of  new Switchgrass  varieties 

for  increased biomass production,  in: U. S. D. o. E. O. o. Biomass (Ed.), 

Tennessee. 

Tamura  K.,  Peterson  D.,  Peterson  N.,  Stecher  G.,  Nei  M.,  Kumat  S.  (2011) 

MEGA5:  Molecular  Evolutionary  Genetics  Analysis  using  Maximum 

Likelihood, Evolutionary Distance,  and Maximum Parsimony Methods. 

Melecular Biology and Evolution. Doi:10.1093/molbev/msr121. 

Thomas  P.,  Kumari  S.,  Swarna  G.K.,  Gowda  T.K.S.  (2007)  Papaya  shoot  tip 

associated endophytic bacteria isolated from in vitro cultures and host‐

endophyte  interaction  in  vitro  and  in  vivo.  Canadian  Journal  of 

Microbiology 53:380‐390.  

77

Tian J., Ban X.Q., Zeng H., Huang B., He J.S., Wang Y.W. (2011) In vitro and in 

vivo  activity  of  essential  oil  from dill  (Anethum graveolens  L.)  against 

fungal spoilage of cherry tomatoes. Food Control 22:1992‐1999.  

Turner  N.C.  (1986)  Adaptation  to  water  deficites  ‐  A  changins  perspective 

Australian Journal of Plant Physiology 13:175‐190. 

Van Loon L.C., Bakker P., Pieterse C.M.J.  (1998) Systemic resistance induced 

b z c u ty rhi osphere ba teria. Ann al Review of Phy opathology 36:453‐483. 

Vega  F.E.,  Posada  F.,  Peterson  S.W.,  Gianfagna  T.J.,  Chaves  F.  (2006) 

Penicillium  species  endophytic  in  coffee  plants  and  Ochratoxin  A 

Production. Mycologia 98:31‐42. 

Vogel K.P., Brejda J.J., Walters D.T., Buxton D.R. (2002) Switchgrass biomass 

production  in  the  Midwest  USA:  Harvest  and  nitrogen  management 

A imer can Society of Agronomy 93: 413‐420 

West  C.P.,  Izekor  E.,  Oosterhuis  D.M.,  Robbins  R.T.  (1988)  The  effect  of 

Acremonium‐Coenophialum on the growth and nematode infestation in 

i 6Tall Fescue. Plant and So l 112:3‐ .  

White  I.R.,  Backhouse  D.  (2007)  Comparison  of  fungal  endophyte 

communities  in  the  invasive panicoid grass Hyparrhenia hirta  and  the 

native grass Bothriochloa macra. Australian  Journal of Botany 55:178‐

185.  

78

79

White  T.J.,  Bruns  T.,  Lee  S.,  Taylor  J.W.  (1990)  Amplification  and  direct 

sequencing of  fungal ribosomal RNA genes  for phylogenetics,  in: M. A. 

Innis, et al. (Eds.), PCR Protocols: A Guide to Methods and Applications, 

Academic Press Inc., New York. pp. 315‐322. 

Wirsel S.G.R., Leibinger W., Ernst M., Mendgen K. (2001) Genetic diversity of 

fungi closely associated with common reed. New Phytologist 149:589‐

598.  

Zinniel  D.K.,  Lambrecht  P.,  Harris  N.B.,  Feng  Z.,  Kuczmarski  D.,  Higley  P., 

Ishimaru  C.A.,  Arunakumari  A.,  Barletta  R.G.,  Vidaver  A.K.  (2002) 

Isolation  and  characterization  of  endophytic  colonizing  bacteria  from 

agronomic  crops  and  prairie  plants.  Applied  and  Environmental 

Microbiology 68:2198‐2208.