View
214
Download
0
Category
Preview:
Citation preview
AKADEMIN FÖR HÄLSA OCH ARBETSLIV Avdelningen för arbets- och folkhälsovetenskap
Growth and biodegradation by Sporidiobolales yeasts in vanillin-supplemented medium
Natalia González Gaarslev
2017
Examensarbete, G2E, 15 hp Biologi
Examensarbete i Biologi
Handledare: Sandra A. I. Wright
Examinator: Mikael Lönn
Summary
Studies of biodegradation in lignins by basidiomycetes yeasts show the conversion of lignin in various
degradation products among which vanillin, a valuable substance, suggested to be a strong inhibitor of
both fermentation and growth of yeasts, stands. Sporidiobolales yeasts used in these experiments were
aimed to be identified by their highly conserved ITS region as well as studied in vanillin-
supplemented medium through, vanillin-supplemented plates, TLC and Neubauer’s chamber to find
out which, among the several isolates tested, were the most resistant ones, understand how they take
up vanillin and how their growth is affected by the presence of the phenolic compound. Two strains
were identified as Rhodotorula babjevae. One of them, L4, together with LS22, Rhodosporidium
kratochvilovae, could withstand and biodegrade high concentrations of vanillin, producing
biodegradation products with Rf values similar to the ones know for vanillic acid and vanillyl alcohol.
Better growth in medium supplemented with small doses of vanillin was found, as well as disparity
among the same species and their metabolic features, therefore, herbicides resistance was suggested as
a reason for strains divergence. Further morphological-species comparison could also describe if there
exist a relation between them.
Resumen Estudios sobre la biodegradación de ligninas por levaduras basidiomicetes muestran la conversión de
lignina en distintos productos de degradación, entre los cuales se encuentra la vainillina, un fuerte
inhibidor de la fermentación y el crecimiento de levaduras. Las levaduras Sporidiobolales utilizadas en
estos experimentos han intentado ser identificadas a través de la región ETI, muy conservada, además
de estudiadas en medios suplementados con vainillina mediante placas suplementadas con vainillina,
CCF y cámara de Neubauer para averiguar cuáles son las cepas más resistentes, entender cómo
metabolizan la vainillina y cómo su crecimiento se ve afectado por la presencia de dicho compuesto.
Dos cepas fueron identificadas como Rhodotorula babjevae. Una de ellas, L4, junto con con la cepa
LS22, Rhodosporidium kratochvilovae, pudieron soportar y biodegradar elevadas concentraciones de
vainillina, originando productos de biodegradación con valores de Rf similares a los del ácido vanílico
y alcohol vanílico previamente conocidos. Se encontró un crecimiento mejor en medios
suplementados con pequeñas dosis de vainillina además de una disparidad entre mismas especies y sus
características metabólicas, así, herbicidas han sido sugeridos como una posible causa en dicha
divergencia. Una futura comparación morfología-especie podrá describir si existe relación entre
ambos.
Key words/Palabras clave: Sporobolomyces/Sporobolomyces, Vanillin/Vainillina,
Internal Transcribed Spacer (ITS)/Espaciador Transcribible Interno (ETI), Thin layer
chromatography (TLC)/Cromatografia en capa fina (CCF), Neubauer’s chamber/Cámara de
Neubauer.
1
Contents
Summary ........................................................................................................................... 2
1. Introduction .................................................................................................................. 2
1.1. Background ............................................................................................................ 2 1.1.1. Lignin, an abundant organic polymer in Earth ............................................... 2 1.1.2. Vanillin as a biodegradation product from lignin ........................................... 2 1.1.3. Biodegradation of vanillin by microorganisms .............................................. 3
1.1.4. Sporidiobolales yeasts .................................................................................... 3 1.1.5. Ecological uses of Sporidiobolales yeasts ...................................................... 4 1.1.6. Methods of identification of fungi .................................................................. 4
1.2. Aims, objectives .................................................................................................... 4
2. Materials and methods .................................................................................................. 5
2.1. Culture media ........................................................................................................ 5 2.1.1. Yeast extract-peptone-dextrose (YEPD) ........................................................ 5 2.1.2. Lilly-Barnet, LiBa (Lilly VG, 1951) .............................................................. 5
2.1.3. LiBa-Vanillin (VA) stock solution 0.1 M ...................................................... 5 2.2. Yeast collection ..................................................................................................... 5
2.3. Identification experiments ..................................................................................... 7 2.3.1. Genomic DNA extraction ............................................................................... 8 2.3.2. Polymerase chain reaction (PCR), amplification of ITS regions ................. 10
2.3.3. PCR product classification ........................................................................... 11 2.3.4. Purification of the PCR product gel bands ................................................... 11
2.3.5. Verification of an adequate amount of DNA in the samples ........................ 12 2.3.6. Preparation of sequencing samples .............................................................. 12
2.3.7. Sequencing ................................................................................................... 12 2.3.8. Identification ................................................................................................. 13
2.4. Vanillin resistance experiments ........................................................................... 13 2.4.1. Selection test of the most resistant isolates .................................................. 13
2.4.2. Vanillin resistance and degradation in liquid cultures ................................. 14 2.5. Yeast growth in vanillin supplemented medium ................................................. 15
2.5.1. Cell count in Neubauer’s chamber ............................................................... 16
3. Results ........................................................................................................................ 16
3.1. Identification experiments ................................................................................... 16 3.1.1. DNA extraction ............................................................................................ 16
3.1.2. PCR product ................................................................................................. 16 3.1.3. Gel elution and recovery of purified ITS fragments .................................... 18 3.1.4. Verification of required minimum concentration of template DNA ............ 18 3.1.5. Identification results ..................................................................................... 18
3.2. Vanillin experiment: selection of most vanillin resistant isolates ....................... 19 3.3. Vanillin biodegradation in liquid cultures, TLC results ...................................... 20 3.4. Vanillin resistance: Neubauer’s chamber results................................................. 22
4. Conclusions and discussion ........................................................................................ 23
5. References .................................................................................................................. 24
2
1. Introduction
1.1. Background
1.1.1. Lignin, an abundant organic polymer in Earth
Lignin is a high molecular weight three-dimensional macromolecule (Hedges & Mann,
1979), a complex heteropolymer (Campbell & Sederoff, 1996) synthesized in vascular
plants through the dehydrogenative polymerization of three cinnamyl alcohols: 4-
hydroxycinnamyl alcohol, coniferyl alcohol and synapyl alcohol (Boudet, et al., 1995) .
Lignin is the main structural component in plants secondary wall (Guo, et al., 2001)
being deposited in wall cells at the last stages of their differentiation (Boudet et al.,
1995). Besides mechanical support, lignin plays a significant role in both water
transport and defence in vascular plants (Campbell & Sederoff, 1996).
Vascular plants, mainly constituted of lignin, cellulose and hemicellulose (Demain, et
al., 2005) when dead, remain in the environment as lignocellulosic biomass, considered
a natural renewable resource due to its abundance (Demain et al., 2005). Lignin,
therefore, is one of the most abundant polymers in nature (Fengel & Wegener, 1984)
and due to its non-water solubility and optical inactivity, the study of its degradation is
very complicated (Fengel & Wegener, 1984).
Lignin is known to be very resistant to microbial degradation (Higuchi, 1990). Studies
of biodegradation in decayed wood lignins by whiterot basidiomycetes groups (Hata,
1966; Kirk & Chang, 1974) show the conversion of lignin in several degradation
products among which vanillin, considered a valuable substance, stands (Henderson,
1961; Higuchi, 1981; Zimmermann, 1990).
1.1.2. Vanillin as a biodegradation product from lignin
Vanillin (4-hydroxy-3-methoxybenzaldehyde), is the major component of natural
vanilla (Walton, et al., 2003), widely used for flavouring food, aromatise perfumes and
it can also intervene in pharmaceuticals synthesis (Voitl & Rohr, 2009). Considered a
valuable substance, vanillin can be synthetically produced from lignin, obtained from
the black liquor produced in Kraft processes in pulp and paper industry (da Silva et al.,
2009) and its scale production began in 1936 in the United States (Hocking, 1997).
3
1.1.1.1 Vanillin toxicity
Vegetal substances used as flavouring agents, like vanillin, are known to possess
antimicrobial activity, being suitable in products conservation (Beuchat & Golden,
1989; Jay & Rivers, 1984). Vanillin is an antimycotic substance (Beuchat & Golden,
1989) which can used in food preservation, reducing thus the addition of non-natural
preservatives.
Vanillin is known as a strong inhibitor of fermentation and growth of yeasts as it has
been studied in the fermentation of lignocellulose hydrolysates, in bioethanol
fermentation, and it acts in very low concentrations (Endo, et al., 2008).
1.1.3. Biodegradation of vanillin by microorganisms
Biodegradation of vanillin, among several wood hydrolysates, has been studied with the
basidiomycete fungus Trametes versicolor (Jönsson, et al., 1998) as well as with the
yeast Saccharomyces cerevisiae, a good resistant to inhibitory compounds (Palmqvist,
et al., 1998).
Clostridium methoxybenzovorans sp., an anaerobic, spore-forming bacterium has also
shown to be a good degrader of methoxylated aromatic compounds (Mechichi et al.,
1999).
The tolerance of vanillin by the yeast Rhodosporidium toruloides, a Sporidiobolales
yeast, has been studied, providing novel mutant strains to optimize biofuel production
from lignocellulosic biomass (Qi et al., 2014).
In this project, the behaviour in vanillin-supplemented medium of red coloured yeasts
belonging to the class Uredinomycetes, order Sporidiobolales is studied.
1.1.4. Sporidiobolales yeasts
Sporidiobolales order belongs to Puccinimycotina subphylum, in Basidiomycota
division and pertains to Uredinomycetes class, including the genera Rhodotorula p.p.,
Sporidiobolus, Sporobolomyces p.p. and Rhodosporidium (Sampaio, et al, 2003).
Sporidiobolales yeasts or “red yeasts”, named due to their production of carotenoid
pigments, which provide them of a characteristic colour (Kurtzman, et al., 2011), can be
easily cultivated and are worldwide distributed (Aime et al., 2006).
Thirty-nine strains of basidiomycetes red yeasts in their asexual unicellular state
(Sampaio et al., 2003), belonging to a larger collection created at the Department of
Plant Pathology at the University of Molise in 2008 (Palmgren, L., 2009), are used to
carry out this project. The strains had undergone preliminary investigations based on its
4
morphological characterization as well as their study as biocontrol agents of fungal
pathogens of plants and fruits (Castoria, et al., 2003; Castoria et al., 2005; Lima, et al.,
1998).
1.1.5. Ecological uses of Sporidiobolales yeasts
Sporidobolales yeasts have a wide range of usages such as: studies in tarball
(weathering of crude oil in marine environments) degradation (Shinde, et al, 2017), their
usage as biocontrol agents of fungal pathogens of plants and fruits (Castoria et al., 2003;
Castoria et al., 2005; Lima et al., 1998), carotenoid production (Yurkov, et al., 2008) for
colorants in animal feed, ubiquinone q10 production for antioxidants (Yurkov et al.,
2008) and vanillin biodegradation studies (Qi et al., 2014) for environmental cleaning.
1.1.6. Methods of identification of fungi
Fungi, even though they are the second largest kingdom of eukaryotic life (Blackwell,
2011) have not a primary DNA barcode marker. The internal transcribed spacer (ITS)
region seems to be the DNA region with the highest probability of success in
identification in the broadest range of (Schoch et al., 2012).
Internal transcribed spacer (ITS) region is has two variable non-coding regions nested
within the rRNA repeat between the 5.8S subunit and genes of the large rRNA subunit
(Gardes & Bruns, 1993). Features such as the amount of base pairs, between 600 and
800 when using primers ITS5 and ITS4 (White, et al., 1990), or the fact that it is a very
conserved sequence within species (Scorzetti, et al., 2002) make them a perfect target to
be amplified with “universal primers” (White et al., 1990). ITS regions are a
convenient region for molecular identification of fungi (White et al., 1990). Several
studies have demonstrated the variability of ITS regions according to morphological
distinction in fungal species (Gardes, et al., 1991; Gardes & Bruns, 1993).
1.2. Aims, objectives
This project has two main objectives. The first one is to test 39 different strains of
yeasts belonging to the order Sporidiobolales searching for the most resistant ones
growing in increasing concentrations of vanillin. The ones that grow better are selected
to study how they take up vanillin during their development, both through the yeast
growth and vanillin biodegradation pathway. The second objective aims accomplish and
5
optimize several genomic experiments to identify the tested yeasts which can be
reproduced to identify more Sporidiobolales yeasts.
2. Materials and methods
2.1. Culture media
2.1.1. Yeast extract-peptone-dextrose (YEPD)
YEPD is a rich medium for yeast growth. Two different variants have been used, liquid
YEPD with glycerol, to prepare samples for a frozen backup, liquid YEPD to grow the
strains before the DNA extraction process and solid YEPD, with agar in a concentration
of the 2%, for petri dishes. To prepare one litre the solution contains 3.0 g Yeast extract,
10 g peptone of casein, 10 g D-glucose and 20 g bacteriological agar.
2.1.2. Lilly-Barnet, LiBa (Lilly VG, 1951)
LiBa medium is a minimum growth medium developed to study fungi strains features
such as carbon nutrition and physiology, concluding that structural variation and
configuration of carbon molecules compounds affect to the way in which fungi utilize
them (Lilly VG, 1951). In the present study, the amount of the different compounds
integrating the medium vary from the original formula as follows, containing in one
litre: 10.32 g of D-glucose, 2.0 g of L-asparagine, 1.0 g of KH₂PO₄, 0.5 g MgSO₄ x
7H₂O, 2 x 10-3 g of FeSO₄ x 7H₂O, 8,7 mg ZnSO₄ x 7 H2O, 4x10-6 mg MnSO₄ x H₂O,
4x10⁴ mg biotin and 4x10-4 mg thiamine
LiBa medium was used as liquid LiBa but also as semisolid LiBa (2% agar) on petri
dishes.
2.1.3. LiBa-Vanillin (VA) stock solution 0.1 M
A stock of LiBa-VA 0.1 M was used in all the vanillin-supplemented experiments to
adjust concentrations of LiBa-VA 1 mM, LiBa-VA 5 mM and LiBa-VA 10 mM. To
prepare 10 ml of stock solution, 0.512 g of vanillin were necessary.
2.2. Yeast collection
Concrete strains (Table 1) belonging to the collection created in 2008 in of University
of Molise (Palmgren, L., 2009) were selected due to their not reliable identification in a
first attempt. For this reason, some of them have a species name between quotation
6
marks (“ ”). The execution and optimization of this experiments will lead to a
forthcoming identification of the isolates.
The yeast strains used in this project were sampled from different vegetal species in
different climatic zones in central-southern Italy: Larino, Isole Tremiti, Campomarino,
Petacciato, Castel San Vincenzo and Portocannone (Curtis F, et al., 2009; Curtis, et al.,
2009; de Curtis et al., 2010). All the isolates were conserved in 40% glycerol YEPD at -
80 ºC.
Table1: Collection and reference strains: locations and plants where the different strains were sampled strain numbers, collection
number designated in Italy and the number assigned to the tubes in the frozen backup in Sweden. The table cells highlighted with a
light grey background indicate the reference strains.
Italian number Strain number Plant of origin Place isolated Frozen number
1 L2 Unknown Unknown F37
3 L4 Unknown Unknown F2
13 L105 Malus domestica Larino F3
36 L151 Ficus carica Larino F1
37 L153 Olea europea Larino F32
38 L154 Olea europea Larino F4
39 L155 Olea europea Larino F5
40 L156 Olea europea Larino F6
42 L160 Olea europea Larino F38
47a L166A Malus domestica Larino F7
52 L177 Malus domestica Larino F39
58 L200 Ficus carica Larino F8
60 L206 Ficus carica Larino F35
62 L209 Prunus persica Isole Tremiti F9
67 L215 Prunus persica Isole Tremiti F10
74 L234 Unknown Unknown F11
79 L241 Rosmarinus
officinalis
Molise coastal F12
114 L384 Ficus carica Isole Tremiti F36
118 L388 Unknown Unknown F31
119 L389 Unknown Unknown F13
194 L212 Unknown Unknown F17
195 L400 Unknown Unknown F18
196 L411 Olea europea Isole Tremiti F19
83”70” L249 Prunus armeniaca Portocannone F20
87 L257 Pistacia sp. Molise coastal F21
88 L268 Euphorbia paralias Campomarino F22
89 L269 Euphorbia paralias Campomarino F23
98 L359 Crithmum maritimum Isole Tremiti F24
116 L386 Ficus carica Isole Tremiti F34
123 “Rhodotorula sp.” Unknown Unknown F25
124 “Erytrhobasidium
hasegawianum”
Asparagus acutifolia Isole tremiti F26
“104” L393 Unknown Unknown F27
“105” L394 Asparagus acutifolia Isole tremiti F28
156 L452 Malus domestica Castel San Vincenzo F29
7
185 L-76-2* Olea europea Larino F33
187 LS11* F30
188 LS22* Solanum tuberosum Venfaro F14
189 LS28* F15
190 Sporobolomyces sp. * F16
All the strains indicated with an asterisk (“*”) were studied before and some of them
took part in published experiments. They were used as reference strains.
Sporobolomyces roseus / Sporidiobolus sp*. is the isolate L-76-2* in the collection of
the Dipartimento A.A.A. dell‟Università degli Studi del Molise”, it was isolated from
potato surface (Wright, S. A. I., personal communication).
Rhodosporidium kratochvilovae is the isolate LS11* in the collection of the
Dipartimento A.A.A. dell‟Università degli Studi del Molise”, it was isolated from olive
leaves (Lima et al., 1998), and it is an efficient biocontrol agent against common post-
harvest pathogenic fungi (Castoria et al., 2003; Castoria et al., 2005; Lima et al., 1998)
and an in vitro degrader of the mycotoxin patulin (Castoria et al., 2005). Studies of the
phenotypic and genetic heterogeneity of the isolate R. kratochvilovae, have led to a
reclassification of the isolate LS11 from Rhodotorula glutinis to R. kratochvilovae
(Castoria et al., 2011).
Rhodosporidium kratochvilovae is the isolate LS22* in the collection of the
Dipartimento A.A.A. dell‟Università degli Studi del Molise”, it was isolated from olive
leaves (Wright, S. A. I., personal communication).
Cryptococcus laurentii is the isolate LS28* in the collection of the Dipartimento A.A.A.
dell‟Università degli Studi del Molise”, it was isolated from Annurca apples (Lima et
al., 1998) and it is an efficient biocontrol agent with antagonist activity against B.
cinerea and P. expansum in injured apples stored at 3ºC and 20ºC (Lima et al., 1998;
Lima, de Curtis, Castoria, & De Cicco, 2003).
The strain called Sporobolomyces sp.* in the table is strain IAM 13481 (Valerio, et al.,
2008).
2.3. Identification experiments
DNA barcoding is a rapid developing alternative in species identification, being
nowadays a critical tool in fungal taxonomy (Harrington et al., 2014). The target for the
DNA barcoding was the internal transcriber sequence (ITS) region. The results were
supported by GenBank database of the US National Centre for Biotechnology
8
Information (NCBI) using the Basic Local Alignment Search Tool (BLAST). Barcoding
projects are of high value for documenting fungal diversity.
To identify the isolates, several experiments, such as DNA extraction, Polymerase
Chain Reaction and agarose gel electrophoresis and their optimization were carried out
in these pigmented yeasts, which we know on beforehand belong to order
Sporidiobolales of the class Urediniomycetes (Gadanho & Sampaio, 2005).
2.3.1. Genomic DNA extraction
To study molecular systematics of any organism, high quality DNA is required
(Aljanabi & Martinez, 1997). A genomic extraction was completed according to the
protocol developed by Hoffman, C. in 2001 (Hoffman, 2001) with specific
modifications. One loopful of a single colony of each strain (grown for 24h in a YEPD
petri dish) was grown in 5 ml liquid YEPD in a 50 ml falcon tube in a horizontal shaker
overnight, at room temperature and 2300 rpm. The shaking allows cells survival
enabling them to reach the surface and take the O2 from the environment, fundamental
for them to grow. After 24 h, the tube was centrifuged 5 minutes at 4000 revolutions per
minute (rpm), the supernatant discarded, and the pellet transferred to an 1,5 ml
Eppendorf tube. The tube was frozen for 30 min at -80 ºC, in this step, the cell
membranes break due to the mechanical stress caused by the congelation. Subsequently
the cells were resuspended in 0,5 mL TENTS buffer (extraction buffer 10 mM Tris HCl
pH 7,5, 1 mM EDTA pH 8, 100 mM NaCl, 2% Triton X-100 and 1% SDS) to recover
the cell conditions avoiding DNA damage. All buffers containing a detergent, in this
case, Sodium-Dodecyl-Sulphate (SDS) lysate the nucleus releasing the DNA.
The mixture was transferred to a new autoclaved Eppendorf tube containing the
equivalent of 0.2 ml of acid washed glass beads. Later 0.5 ml of phenol-chloroform-
amylalcohol (25:24:1) were added to the mixture which was afterwards bead-beated for
15 min in a tabletop bead shaker. Phenol-chloroform-amylalcohol solutions denature the
proteins, this, together with the mechanical stress caused by the glass beads and the
shaking will divide the solution in an aquose phase (in the upper part of the Eppendorf)
containing the DNA, and an organic phase, containing the phenolic and cell residua. On
the next step of the DNA extraction cells were frozen for 30 min at -80 ºC, bead-beated
other 30 min in a tabletop bead shaker and finally spun at 13000 rpm at room
temperature (RT) for 10 min.
9
The aqueous phase (which contains the DNA) was transferred to new autoclaved
Eppendorf tubes and 0.4 ml of isopropanol were added. Isopropanol helps to precipitate
the DNA re-establishing its three-dimensional structure. The DNA was precipitated by
rocking and spin at 4 ºC at 13000 rpm for 20 minutes and subsequently washed with
EtOH 70% (which also precipitates the DNA). Finally, the DNA pellet was dissolved in
0.2 ml double distilled MilliQ water (ddH20 MilliQ) and stored at -20 ºC.
2.3.1.1. RNAse treatment
For the procurement of a purer DNA sample, an RNAse treatment was included adding
30 µl of 1 mg/ml DNase-free RNase, which after mixture with the sample was
incubated 5 minutes at 37 ºC. Later, 10 µl of 4 M ammonium acetate and 1 ml of 100%
ethanol were included in the mixture and mixed by inversion to reprecipitate the nucleic
acid. Finally, the tubes were micro-centrifuged 3 minutes at high speed and RT, the
supernatant discarded and after the DNA pellet had dryed, this one was resuspended in
100 µl Tris-EDTA (TE) buffer.
2.3.1.2. Verification of DNA’s extraction succeed
All DNA samples had to be checked after their setting up to find out if the DNA
extraction was successful. Agarose electrophoresis can accomplish this commitment,
enabling to see the migration of a charged molecule with high resolution (Lehrach, et
al., under the influence of an electric field (Lima Pastrana, 2011).
The prepared agarose gels, after sample loading, were submerged in a tampon with pH
8, knowing that DNA molecules have negative charge in mediums with a pH higher
than 5, and that therefore they will migrate to the positive pole (Lima Pastrana, 2011).
Each gel contained a concentration of 0,7% in agarose and was prepared mixing 0.35
grams of agarose with 50 ml of 100X Tris-Acetate-EDTA (TAE) buffer. To dissolve the
agarose in the buffer, short periods of microwaving were necessary (around 30
seconds). After dissolving, the solution was poured in the electrophoresis tray, already
prepared with the wells comb. It takes about 30 minutes to cool down, then, the comb is
removed and the gel tray is ready to be introduced in the electrophoresis bucket. The
bucket was filled with 100 X TAE buffer covering the wells before the samples were
pipetted, avoiding so the removal of the samples from the wells.
Each sample had a volume of 20 µl, consisting of 16 µl autoclaved MilliQ H2O, 1 µl of
DNA sample (the one obtained after the DNA extraction) and 3 µl of a loading buffer,
to make the mixture heavier enabling the samples migration to the positive pole in the
gel. A molecular weight ladder containing fragments of DNA with a known number of
10
base pairs (bp) and known concentration was included for the interpretations of the
results. After closing the bucket, the electrical current was turned on for two hours at 70
mV.
GelGreen™, a safer alternative to Ethidium Bromide and SYBR dyes was used to stain
the gel dissolving 30 µl of the staining solution in 100 ml of MilliQ H2O in a bucket.
One hour after the submergence of the gel in the staining solution, its content was
revealed in a UV light lamp.
2.3.2. Polymerase chain reaction (PCR), amplification of ITS regions
Polymerase chain reaction, also known as PCR, is a method consisting on the
exponential amplification through a three-step cycling process (Schochetman, et al.,
1988) of a nucleic acid, or nucleotide sequences, in vitro. When amplifying a sequence,
the ends must be known in sufficient detail to synthesize oligonucleotides that can
hybridize it and initiate the reaction (Mullis & Faloona, 1987). Two synthetic oligos are
necessary to work as primers, annealing at either end of the targeted nucleotide
sequence to amplify in opposite directions orientation. After a proper annealing of the
primers, the functioning of a DNA polymerase in multiple rounds of denaturation
(opening the double helix), annealing and 3’ extension leads to an exponential
amplification of the target sequence (Ho, Hunt, Horton, Pullen, & Pease, 1989). Primers
ITS5 and ITS4 were used and their corresponding sequences are: ITS 5:
GGAAGTAAAAGTCGTAACAAGG, ITS 5: GGAAGTAAAAGTCGTAACAAGG
(White et al., 1990).
2.3.2.1. Reagents
Polymerase chain reactions were carried out using the Platinum™ Taq Green Hot Start
DNA Polymerase (Invitrogen™) with several modifications in the manufacturer
specifications (Perkin Elmer Cetus). 100 µl of PCR reaction sample were prepared for
each strain as follows: first, a master mix was prepared with 12.5 µl of 10 X Green PCR
buffer, which contains among other substances Tris, that regulates the reaction pH,
affecting the activity and fidelity of the enzyme and KCl, which increments the enzyme
activity (Johnson, 2000; Schochetman et al., 1988), 2.5 µl MgCl2, 2.5 µl of 10 mM
dNTP mix (dNTPs need Mg2+ to bind) and 0.5 µl of Platinum™ Taq DNA Polymerase.
An insufficient amount of Mg2+ affects the DNA polymerase by stopping its reaction
while its excess causes non-specific reactions (Johnson, 2000). Afterwards, 2.5 µl of
both ITS5 and ITS4 primers were added in a concentration of 10 mM (they were firstly
11
diluted from 100 mM), mixed together with the master mix ,72 µl of autoclaved and
filter sterilized MilliQ H20 and 5 µl of the DNA sample previously prepared in the DNA
extraction.
The 100 µl were divided in two small autoclaved Eppendorf tubes, having so each strain
two PCR products.
2.3.2.2. Generation of PCR products
50 µl PCR samples were introduced in a thermal cycler to incubate the reactions. Even
though the company had specifications, modifications on the times and temperatures of
the cycles were necessary for the circumstances of the modified mixture. The thermal
cycler was programmed for 35 cycles. First an initial denaturation at 94 ºC for 5 minutes
was necessary, then, in each cycle a denature stage occurred at 94 ºC for 1 minute (due
to de length of the sequence aimed to be replicated, this is, around 700bp), after, the
anneal phase was carried out at 61.5 ºC (being this the optimal temperature for the
primers to operate) for 30 secs and the extension stage took place at 72º for 50 seconds.
Finally, the sample was hold at 4º indefinitely.
2.3.3. PCR product classification
Agarose gel electrophoresis can clear up the size (in bp) of the ITS fragments obtained
in the PCR, determining if the PCR has been successful and has replicated the target
fragment of the DNA molecule. The size of the bands belonging to the PCR samples
can be defined by the proportional relation of the mobility of the sample in the gel and
the empirical logarithm of its size (Lehrach et al., 1977). A ladder with standards of
concentration and fragments size was necessary to set a calibration line in which the
band migration of each strain PCR ITS fragment was extrapolated, thus, determining
the fragment size. In this experiment, the ladder used was ZR 100 bp DNA Marker™
aiming to find the same or very similar fragment sizes in the PRC products as the PCR
is expected to replicate the same sequence considered to length between 600-700 bp
(White et al., 1990).
2.3.4. Purification of the PCR product gel bands
When the PCR product was considered to have the appropriate concentration, the next
step was to purify the bands in the gel containing our target sequence, cleaning possible
remaining PCR components. GenElute™ Gel Extraction Kit was the kit used and the
fragment of interest was extracted from the agarose gel in a slice, deposited inside an
12
Eppendorf tube containing a silica binding column and dissolved and cleaned with
products from the kit through several centrifugations. Our target, the ITS fragment, was
expected to get stuck in the silica binding column and it only be released in the last step
of the protocol, when releasing the clean sequence from the silica column.
2.3.5. Verification of an adequate amount of DNA in the samples
Before shipping the samples to the sequencing firm, it was important to know
approximately the concentration of the eluted samples to fulfil the sequencing company
requirements.
To the achievement of this task, new agarose gels were prepared and several
measurements were made in photographs taken from these gels to estimate the
concentration of the ITS region in the purified tubes. In the photographs, the luminance
of the bands was measured. To estimate the concentration of a band, a luminance value
is given to the molecular weight markers with known concentration, 600 bp, 26 ng and
700 pb, 24 ng. An average of both luminance and concentration values of the two ladder
bands was used to calculate the concentration of the sample bands because the expected
ITS regions were expected to appear between 600 bp and 700 bp. The calculation
procedure was a simple proportion of luminance-concentration. For making a more
accurate experiment, each luminance value was an average of 3 luminance values
measured along the gel band.
2.3.6. Preparation of sequencing samples
After measuring the concentrations of the purified ITS region, the samples were
prepared to be sent to LIGHTRUN tube, a sequencing PCR fragments company which
uses Sanger light-speed methodology. The sample requirements were related to the
concentration of the DNA template, between 20 ng and 80 ng, and its amount, minimum
5 µl, as well as the primer’s amount and concentration, 5 µl in concentrations of 5 µM
for each primer, ITS4 and ITS5.
2.3.7. Sequencing
Sequencing samples arrived three working days after the shipping. They came with the
analysed sequence in three different kind of files: .seq (the sequence), .ab1 (the
electropherogram) and .fas (for a FASTA DNA-program).
13
2.3.8. Identification
The sequences were analysed and edited by using the package DNAStar®, making
alignments and visually correcting the sequences by using the software MegAlign™.
For the identification, the obtained sequences were compared with those known of all
yeast species available at the GenBank database of the US National Centre for
Biotechnology Information (NCBI). For this task, the Basic Local Alignment Search
Tool (BLAST) available at http:// www.ncbi.nlm.nih.gov was used.
2.4. Vanillin resistance experiments
Several Sporidiobolales strains were tested in diverse minimum medium to study their
reaction to different concentrations of vanillin. The growth of a strain in a medium with
a higher concentration of this phenolic compound would make the strain to be
considered as good degrader of vanillin and therefore, object of study in liquid culture
experiments, studying its capacity for biodegrading vanillin aiming to understand a bit
better its biodegradation pathway.
2.4.1. Selection test of the most resistant isolates
In a first screening experiment, the 39 isolates were tested together with an isolate
belonging to another yeast collection, FMYD002 (Nehvonen, C., 2017) already used for
some vanillin tests. A total of 40 strains were imprinted and transferred from YEPD-
agar petri dishes to several LiBa-agar petri dishes (20 colonies per plate) with different
concentrations with replica prong. The experiment had two variants, one consisted on
transferring the colonies grown for 48h in YEPD-agar plates to LiBa-agar plates with
concentrations of LiBa-VA 0 mM, LiBa-VA 1 mM , LiBa-VA 5 mM and LiBa-VA 10
mM all at the same time. The second variant of this experiment, consists on the
transference of the colonies in order of increasing concentration from one plate to
another only after their growth was evident. Thus, the not vanillin resistant strains were
ruled out leading to the permanence of the best candidates withstanding high
concentrations of vanillin.
2.4.1.1. Solid culture media preparation
LiBa-agar plates are prepared mixing a stock of LiBa with autoclaved MilliQ H2O
containing agar up to a 2 %. Different amounts of vanillin stock solution (0.1 M) were
added to the flask containing LiBa-agar after pouring the plates. The flask contained
320 ml and each plate 20 ml of the medium, starting from LiBa-agar, and continuing in
14
crescent concentrations of vanillin order (1 mM, 5 mM and 10 mM). From each
concentration four plates were prepared making a total of sixteen plates.
Single colonies of the strains were cultivated with toothpicks in regular YEPD-agar
plates following the pattern of the replica prong to make the transference easier.
2.4.2. Vanillin resistance and degradation in liquid cultures
The strains that showed more resistance in the solid cultures were selected to grow in
the same vanillin concentrations (0 mM, 1 mM, 5 mM and 10 mM) in liquid LiBa
cultures, extracting samples in certain timepoints.
2.4.2.1. Experiment setup
Before starting the proper experiment, a preculture to set the concentration of the main
experiment was necessary. A loopful of the selected strain was grown in 40 ml of liquid
LiBa for 24 h. Afterwards, the number of cells was measured and each flask of the
experiment set at a concentration of 6 x 106 CFU/ml. The experiment consisted of eight
flasks, four flasks containing 60 ml of LiBa and concentrations of 0 mM, 1 mM, 5 mM
and 10 mM of vanillin and a cell concentration of 6 x 106 CFU/ml of the selected yeast
strain taken from the preculture, and other four containing the same concentrations of
vanillin but without the yeast, this is, controls. The flasks stayed 192 hours in a circular
shaker at 230 rpm and 25 ºC (in a sterile environment) and six timepoints were
established at 0, 12, 24, 36, 48 and 196 h to collect samples aiming to see how the yeast
degrade the supplemented vanillin in each medium.
2.4.2.2. Sample collection
At each timepoint, two millilitres of each flask were extracted and transferred to
Eppendorf tubes, spin at 4000rpm for 5 minutes and filter sterilized with a syringe. Each
sample was kept in the freezer at -20 ºC and defrosted to prepare a thin layer
chromatography
2.4.2.3. Thin layer chromatography (TLC)
Thin layer chromatography is a separation technique used in qualitative analysis of
compounds. TLC enables to monitor the progress of a reaction, the number of
components in a mixture, and it also gives an idea of the sample’s purity (Hess, 2007).
This technique has two phases, a stationary phase consisting on a silica slab coated on
aluminium and a glass chamber in which the back of the slab lays, and a mobile phase,
the eluent, made of a mixture of toluene, ethyl acetate and formic acid (4:5:1).
Capillarity is the principle of this methodology allowing the migration of the eluent and
15
the compounds upwards in the silica slab (Hahn-Deinstrop, 2007). Each compound has
a different affinity and polarity which affects the migration speed and the separation of
the compounds. Less polar compounds migrate further upwards while polar compounds
stick the polar silica slab, reducing the migrating speed. Usually TLC experiments take
80 min and the elution must be stopped before reaching the top of the silica slab. After,
the TLC can be studied under UV light or MBTH staining.
2.4.2.3.1. Sample preparation
Each sample for the TLC was taken from the frozen samples that were collected from
the main culture flasks. The samples were transferred to glass tubes and adjusted to pH
2 with HCl 1 M. For 2 ml, 800 µl of ethyl acetate were added dividing the mixture in
two phases, an organic phase constituted by the ethyl acetate and an inorganic phase
consisting of the LiBa medium. The samples were centrifuged for 5 min at 5000 rpm
and during the spin the compounds stick to the ethyl acetate. 500 µl of the organic phase
were extracted, transferred to small glass tubes, and dried with gaseous N2 (this step
takes around 15 min). Once the samples dried, 20 µl of ethyl acetate were added to the
tube resuspending the compounds. The 20 µl samples and 10 μl standards of vanillin 10
X (5 mM), vanillyl alcohol 10 X (5 mM) and vanillic acid 5 X (10 mM) were pippeted
in the silica slab in small doses, using a hair dryer to dry each drop before adding the
next. After the TLC plate was introduced in the chamber with the eluent. The standards
were chosen to help identifying the vanillin degradation sub-products providing
guidance in the staining contrast and travel distance of the stationary phases on the TLC
plates.
2.4.2.3.2. Treatment of the data
When revealed, the chromatography showed the compounds at different heights, this
migration distance is a signature of every compound found in the sample (Hahn-
Deinstrop, 2007). The data were treated using the retention factor (Rf) values of each
sub-product, consisting on the distance travelled by the sample over the distance
travelled by the eluent (solvent front).
2.5. Yeast growth in vanillin supplemented medium
The isolates were expected to struggle growing as the vanillin concentration increases
due to the known fact that vanillin is an inhibitor in yeasts growth at small
concentrations (Endo et al., 2008).
16
2.5.1. Cell count in Neubauer’s chamber
Haemocytometers enable cells counting. Neubauer’s chamber consist of a thick crystal
plaque divided in three sections. In the central section, a quadrangular grid is engraved
containing two counting areas, each of them divided in nine squares of 1 mm square
each. To prepare the samples, 20µl of each flask were extracted at the same timepoints
as the TLC samples, diluted in 180µl of LiBa, and 10 µl were added to 10 µl of
methylene blue. 10 µl of each sample were pippeted in the chamber, covered with a
glass slide and observed at 40x in the microscope. Neubauer’s chamber formula is:
𝑐𝑒𝑙𝑙 𝑐𝑜𝑛𝑐𝑒𝑛𝑡𝑟𝑎𝑡𝑖𝑜𝑛 =𝑐𝑒𝑙𝑙𝑠 𝑛𝑢𝑚𝑏𝑒𝑟 𝑥 10000
(𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑠𝑞𝑢𝑎𝑟𝑒𝑠 𝑥 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛)
Where “10000” is the area of each big square:
• 0,1cm x 0,1cm = 0,01cm2 (area of a square)
• 0,01cm2 x 0,01cm (depth) = 0,0001cm3
Neubauer’s chamber is also used to measure the cell concentration from the preculture.
3. Results
3.1. Identification experiments
The main aim was to optimize and find out the correct proportions of chemicals in the
different steps of the identification of yeast strains. The experiments were successful
and can be replicated.
3.1.1. DNA extraction
A first attempt of DNA extraction was done, unfortunately, with an outdated phenol. In
a second try all the samples succeeded in the DNA extraction. Nevertheless, the samples
were not as clean as aimed, therefore an RNAse treatment was included in the protocol.
Due to the immense size of DNA molecules, the samples did not migrate much down in
the gel. All in all, the gels showed a successful DNA extraction, and therefore the
experiments of DNA fingerprinting were carried out.
3.1.2. PCR product
After all the cycles in the thermal cycler were completed, the PCR product was checked
through an agarose gel. The gel results proved the PCR to be successful. An analysis of
the band sizes and migrations was performed to assure that all the ITS fragments
17
replicated in the PCR had a similar base pairs (bp) amount, this is, that all the fragments
have an approximate size (Table2-3).
Table 2-3: sizes of PCR products and migration distance after amplification of genomic DNA with primers ITS4 and ITS5.
A) Strains of the culture collection
strain L2 L4 L105 L151 L153 L154 L155 L156 L160 L166A L177 L200
Migration (mm) 30 30 30 30 29 29 30 29 29 29 30 30
Fragments size (bp) 625 625 625 625 675 675 625 675 675 675 625 625
L206 L209 L215 L234 L241 L384 L388 L389 “E.hasegawianum” L393
30 30 30 29 31 30 30 30 30 31
625 625 625 675 600 625 625 625 625 600
L212 L400 L411 L249 L257 L268 L269 L359 L386 “Rhodotorula sp.” L452 L394
30 30 30 30 30 30 31 30 31 31 30 30
625 625 625 625 625 625 600 625 600 600 625 625
B) Reference strains
strain LS11 L-76-2 LS22 LS28 “Sporobolomyces sp.
Migration (mm) 30 30 31 33 24
Fragments size (bp) 625 625 600 500 1000
Ladder fragments size (bp) 19 22 24 25 26 28 31 33 35 38
Migration (mm) 1500 1200 1000 900 800 700 600 500 400 300
Figure 1: PCR product: analysis of the proportional relation between the sample migration through the gel and the size of the
fragments.
20
22
24
26
28
30
32
34
450
550
650
750
850
950
1050
L2
L4
L10
5L
15
1L
15
3L
15
4L
15
5L
15
6L
16
0L
16
6A
L17
7L
20
0L
20
6L
20
9L
21
5L
23
4L
24
1L
38
4L
38
8L
38
9L
-76
-2L
S22
LS
28
“S. R
ose
us”
L21
2L
40
0L
41
1L
24
9L
25
7L
26
8L
26
9L
35
9L
38
6“R
ho
do
toru
la s
p.”
“Ery
trh
ob
asid
iu…
L39
3L
39
4L
45
2L
S11
Mig
rati
on
(m
m)
Fra
gm
ents
siz
e (b
p)
PCR product analysis
Fragments size (bp) Migration (mm)
18
The analysis of the band sizes and band migration (Figure 1, Table 2-3), showed that
all the culture collection strains have ITS fragments of the expected amount of bp (600-
800bp).
3.1.3. Gel elution and recovery of purified ITS fragments
After the purification and elution of the ITS regions extracted from gel slices, the
concentration of the template DNA vas determined through luminance measurements of
the bands to fulfil the requirements (20-80 ng/µl) of the sequencing company
(LightRun). Due to a lack of time, not all the samples reached this stage in the path to
sequencing.
3.1.4. Verification of required minimum concentration of template DNA
The ITS regions of strains L4 and L105 showed the highest concentration in PCR
product and therefore were selected to be shipped to the sequence company. During the
gel elution process, DNA losses could reach a 50%, so the concentration of the samples
was checked after the elution. Three luminance measurements were made for each band
and an average value (Table 4) was be used to relate luminance with concentration.
Table 4: Luminance values (Nits) average of the template DNA measured in gels run after the gel elution
Luminance measures 1st 2nd 3rd Average
L4 155 155 155 155
L105 155 156 155 155,33
L151 112 113 112 112,33
Ladder 700 146 145 146 145,67
Ladder 600 145 145 145 145
Table 5: Luminance-concentration relation. The concentration of the fixed average ladder was 25 ng/µl and the luminance 145,33
Nits and the results come from the direct proportion existing between luminance and onncentration.
Strains and ladders Luminance (Nits) Concentration (ng/µl)
L4 155 26,66
L105 155,3333333 26,72
L151 112,33 19,32
600-700 ladder 145,33 25
Luminance and concentration are directly proportional values (Table 5). The estimated
value for the samples was higher than the minimum required and therefore the samples
were prepared and sent to the company.
3.1.5. Identification results
Positive sequencing results were obtained from the company for both strains. Among
the diverse results found in a preliminary analysis it was possible to confirm that both
strains belong to the species Rhodotorula babjevae as their closest match was the strain
19
CBS-322 in the CBS culture collection, designated as Rhodotorula babjevae (Vu et al.,
2016).
3.2. Vanillin experiment: selection of most vanillin resistant isolates
As shown in Figure 2, in the experiment in which the strains were transferred with a
replica prong from YEPD plates simultaneously to the different concentrations of LiBa-
VA and grown for 48 hours, all the strains show growth in LiBa and LiBa-VA 1 mM
plates, while no growth is noticed in the LiBa-VA 5 mM and LiBa-VA10 mM plates.
The gradual transference experiment showed more hopeful results (Figure 2) as in
LiBa-VA 5 mM plates, after many hours, Rhodotorula babjevae (strain L4) and
Rhodosporidium kratochvilovae (strain LS22) grew. In LiBa 10 mM, only strain L4
grew. The two strains, due to their capacity to withstand higher concentrations of
vanillin were chosen to be studied in liquid LiBa-VA experiments, the biodegradation
pathway of vanillin and how the strains growth was affected in its different
concentrations.
48 h cultures Growth after gradual transfer to increasing
concentrations of vanillin (VA)
A
B
B
C
D
D
7 days growth
5 days growth
10 days growth
20
Figure 2: growth of red yeasts on Lilly Barnet (LiBa) medium supplemented with: (A) LiBa without VA; (B) LiBa + 1 mM VA;
LiBa + 5 mM VA; and (D) LiBa + 10 mM VA. The plates in the left column refer to a simultaneous transference of the yeasts grown in YEPD for 24 hours directly to all the plates with the different concentrations and grown for 48 h. In the right column, the
colonies were only transferred to an increasing concentration after they grew in the plate. Numbers in the plates refer to the strain
names (see Table 1).
3.3. Vanillin biodegradation in liquid cultures, TLC results
Vanillin biodegradation was studied through TLC plates running each strain samples
collected at 0, 12, 24, 36, 48 and 192 hours from the 4 different flasks containing the
liquid cultures with LiBa, LiBa-VA 1 mM, LiBa-VA 5 mM and LiBa-VA 10 mM and
the Rf of the revealed compounds was measured (Table 6), finding eight different
intermediaries in this cultivation process.
Table 6: Compounds revealed in TLC plates and their corresponding Rf value for Rhodotorula babjevae and Rhodosporidium
kratochvilovae..
Vanillin Comp. Y Comp. A Comp. X Comp. B Comp. C Comp. D Comp. E
Rf 0,8 0,74 0,67 0,65 0,64 0,62 0,58 0,49
For both, Rhodotorula babjevae and Rhodosporidium kratochvilovae the TLC results
showed degradation products of LiBa medium which were obviated (compounds A, B,
C, D and E).
Rhodotorula babjevae, (Figure 3) at concentrations of LiBa-VA 1 mM showed the
consumption of all the vanillin by the yeast in the first 12 hours. At time 0 had already
started degrading vanillin in compound X, which has the same Rf value as the standard
of vanillyl alcohol used. Once the vanillin disappeared the remaining compounds,
compound X and compound Y (with a Rf value similar to the one obtained in the
vanillic acid standard), were stable until 48 hours, and after 192 hours only compound
X remained. At concentrations of vanillin 5 mM, and 10 mM vanillin and compound X
were present during the 192 hours, in LiBa-VA 5 mM, compound Y appeared at 48
hours and remained even after 192 hours while in LiBa-VA 10 mM, compound X
appeared at 48 hours and at 192 hours it was already gone.
5 days growth
10 days growth
D 16 days growth
21
Figure 3: Biodegradation products of vanillin by Rhodotorula babjevae in LiBa, LiBa-VA 1 mM, LiBa-VA 5 mM and LiBa-VA 10
mM
In the TLC results for strain Rhodosporidium kratochvilovae, Figure 4, it was assumed
that at concentrations of vanillin 1 mM, all the medium was consumed by the yeast
during the first 24 hours due to the lack of products after 36 hours. At time 0, only
vanillin appeared and after 12 hours it had already been transformed in compound Y
and compound X, which disappeared after 24 hours. At concentrations of vanillin 5
mM, and 10 mM, vanillin stayed during the 192 hours, compound X disappeared after
192 hours and compound Y, formed at 36 hours, remained until the end of the
experiment in vanillin 5 mM flask while in vanillin 10 mM it was already consumed at
192 hours.
Figure 4: Biodegradation products of vanillin by Rhodosporidium kratochvilovae in LiBa, LiBa-VA 1 mM, LiBa-VA 5 mM and
LiBa-VA 10 mM
0
0,2
0,4
0,6
0,8
1
0 L
iBa-
VA
1 m
M
12
LiB
a-V
A 1
mM
24
LiB
a 1
mM
36
LiB
a-V
A 1
mM
48
LiB
a-V
A 1
mM
19
2 L
iBa-
VA
1 m
M
0 L
iBa-
VA
5 m
M
12
LiB
a-V
A 5
mM
24
LiB
a-V
A 5
mM
36
LiB
a-V
A 5
mM
48
LiB
a-V
A 5
mM
19
2 L
iBa-
VA
5 m
M
0 L
iBa-
VA
10 m
M
12
LiB
a-V
A 1
0 m
M
24
LiB
a-V
A 1
0 m
M
36
LiB
a-V
A 1
0 m
M
48
LiB
a-V
A 1
0 m
M
19
2 L
iBa-
VA
10
mM
Rf
Time (h)
Rhodotorula babjevae: vanillin biodegradation products
Vanillin Compound Y Compound X
0
0,2
0,4
0,6
0,8
1
0 L
iBa-
VA
1 m
M
12
LiB
a-V
A 1
mM
24
LiB
a 1
mM
36
LiB
a-V
A 1
mM
48
LiB
a-V
A 1
mM
19
2 L
iBa-
VA
1 m
M
0 L
iBa-
VA
5 m
M
12
LiB
a-V
A 5
mM
24
LiB
a-V
A 5
mM
36
LiB
a-V
A 5
mM
48
LiB
a-V
A 5
mM
19
2 L
iBa-
VA
5 m
M
0 L
iBa-
VA
10 m
M
12
LiB
a-V
A 1
0 m
M
24
LiB
a-V
A 1
0 m
M
36
LiB
a-V
A 1
0 m
M
48
LiB
a-V
A 1
0 m
M
19
2 L
iBa-
VA
10
mM
Rf
Time (h)
Rhodosporidium kratochvilovae: vanillin biodegradation products
Vanillin Compound Y Compound X
22
3.4. Vanillin resistance: Neubauer’s chamber results
To measure the resistance of the yeast to different concentrations of vanillin, the cell
growth was measured in six timepoints (0, 12, 24, 36, 48 and 192 hours).
Figure 5: growth of Rhodotorula babjevae in cultures with different concentrations of VA for 192 hours
As shown in Figure 5, Rhodotorula babjevae showed a better average growth in a LiBa
medium supplemented with 1 mM vanillin than it did in LiBa. This indicates that
probably small doses of vanillin can nutritive for the strain, enhancing its growth. Even
though, at 36 hours the growth was excellent, afterwards it started to decrease until 192
hours (unlike in LiBa medium in which the strain kept growing at 192 hours). In the
beginning the strain seemed to struggle to grow in the medium until it could benefit
from it. In concentrations of vanillin 5 mM the growth was very poor and after 48 hours
the cells started their apoptosis and in concentrations of vanillin 10 mM the strain didn’t
grow until 36 hours and after it died.
Figure 6: growth of Rhodosporidium kratochvilovae in cultures with different concentrations of VA for 192 hours
Rhodosporidium kratochvilovae showed different results in its growth (Figure 6). In
LiBa medium, the strain grew until 36 hours and after that the cells concentration
0
10
20
30
40
0 1 2 2 4 3 6 4 8 1 9 2CF
U/m
l (i
n x
10
6sc
ale)
Time (h)
Growth of Rhodotorula babjevae in different VA
concentrat ions
LiBa LiBa-Va 1 mM LiBa-VA 5 mM LiBa-VA 10 mM
0
10
20
30
40
50
60
70
0 1 2 2 4 3 6 4 8 1 9 2CF
U/m
l (i
n x
10
6sc
ale)
Time (h)
Growth of Rhodosporidium kratochvi lovae in different
VA concentrat ions
LiBa LiBa-Va 1 mM LiBa-VA 5 mM LiBa-VA 10 mM
23
started to decrease unlike it happened with Rhodotorula babjevae. In vanillin 1 mM
supplemented medium the strain reached its peak of growth after 2 hours and after that
it seemed like it had consumed all the medium due to its vast decrease in cell
concentration. At concentrations of vanillin 5 and 10 mM the strain progressively
reduces the number of cells, as it happens with strain L4.
4. Conclusions and discussion
The results obtained in the identification study show that the performed and optimized
experiments work for obtaining a clean ITS sequence, this means that the rest of the
strains which were selected for these experiments and that have not been identified yet,
can be identified reproducing these experiments.
The fact that the two identified strains belong to the same species (Rhodotorula
babjevae) and one withstands high concentrations of vanillin while the other one does
not opens a question mark for the rest of the strains, does the location of collection of
the sample has an influence in the species variation regarding vanillin biodegradation? It
seems like a possibility as strain LS11, Rhodosporidium kratochvilovae, a good
biodegrador of patulin (Castoria et al., 2005) is not resistant to vanillin, while, LS22,
also Rhodosporidium kratochvilovae, sampled from potatos does biodegrade vanillin.
This opens a second question mark, does the resistance to vanillin can be a consequence
of the usage of herbicides? Also, morphological studies can take place to find out if a
genomic identification would match with a morphological characterization distribution
of the isolates.
The strain Rhodosporidium dibovatum has been studied and documented as capable of
growing in the presence of vanillin (Luque et al., 2016) also, it was one of the strains
with the most similar ITS region to the one in Rhodotorula babjevae when the sequence
was introduced in the NCBI database. A futher study could consist on a classification of
ITS regions similarity and the capacity of the microorganisms withstandig vanillin.
Even though, exceptions were found such as the disparity between the ITS region length
found in Sprobolomyces sp. and L-76-2 which belong to the same species. It could be
due to inespecific amplifications during the PCR.
It can be concluded that strains L4, Rhodotorula babjevae, and LS22, Rhodosporidium
kratochvilovae were the two best strains growing in LiBa medium supplemented with
increasing concentrations of vanillin. Strain L4 in liquid cultures of LiBa-VA 1 mM,
consumed the medium more slowly than strain LS22, and that all in all, both of them
24
soon or later produce the same biodegradation products from vanillin, with Rf values
similar to the ones for vanillic acid and vanillyl alcohol.
It is also remarkable the influence of small doses of vanillin in the growth of yeasts,
concretely in strain LS22 once the vanillin is already degraded (1 mM VA) not only the
subproducts are consumed, what is more, if the results of Figure 6 are contrasted to the
results in Figure 4, it is possible to appreciate that the time in which the cells start to die
correspond to the time in which the biodegradation products are consumed. Studies
performed with strain FMYD002 (Nehvonen, C., 2017) also showed better growth
patterns supplementing the medium with 1 mM VA than only growing the yeast with
LiBa.
5. References
Aime, M. C., Matheny, P. B., Henk, D. A., Frieders, E. M., Nilsson, R. H., Piepenbring,
M., Hibbett, D. (2006). An overview of the higher level classification of
pucciniomycotina based on combined analyses of nuclear large and small subunit
rDNA sequences. Mycologia, 98(6), 896-905.
Aljanabi, S. M., & Martinez, I. (1997). Universal and rapid salt-extraction of high
quality genomic DNA for PCR-based techniques. Nucleic Acids Research, 25(22),
Beuchat, L. R., & Golden, D. A. (1989). Antimicrobials occurring naturally in foods.
Food Technology (USA),
Blackwell, M. (2011). The fungi: 1, 2, 3 ... 5.1 million species? American Journal of
Botany, 98(3), 426-438. doi:10.3732/ajb.1000298 [doi]
Boudet, A., Lapierre, C., & Grima‐Pettenati, J. (1995). Biochemistry and molecular
biology of lignification. New Phytologist, 129(2), 203-236.
Campbell, M. M., & Sederoff, R. R. (1996). Variation in lignin content and composition
Plant Physiology, 110(1), 3-13. doi:110/1/3 [pii]
Castoria, R., Caputo, L., De Curtis, F., & De Cicco, V. (2003). Resistance of
postharvest biocontrol yeasts to oxidative stress: A possible new mechanism of
action. Phytopathology, 93(5), 564-572.
Castoria, R., Mannina, L., Durán-Patrón, R., Maffei, F., Sobolev, A. P., De Felice, D.
V., Wright, S. A. (2011). Conversion of the mycotoxin patulin to the less toxic
desoxypatulinic acid by the biocontrol yeast rhodosporidium kratochvilovae strain
LS11. Journal of Agricultural and Food Chemistry, 59(21), 11571-11578.
25
Castoria, R., Morena, V., Caputo, L., Panfili, G., De Curtis, F., & De Cicco, V. (2005).
Effect of the biocontrol yeast rhodotorula glutinis strain LS11 on patulin
accumulation in stored apples. Phytopathology, 95(11), 1271-1278.
Curtis F, D., Castoria, R., Palmgren, L., Ianiri, G., & Wright, S. (2009). Origin of plant-
associated pink yeasts influences their biodiversity, biocontrol efficacy and ability
to degrade patulin. XV convegno nazionale società italiana di patologia vegetale.
Journal of Plant Pathology, 91(S4)
Curtis F, D., Palmgren, L., & Castoria, R. (2009). Plant-associated pink yeasts:
Isolation, characterization and screening for biocontrol ability. FEMS 2009, 3rd
Congress of European Microbiologist.
da Silva, E. B., Zabkova, M., Araújo, J., Cateto, C., Barreiro, M., Belgacem, M., &
Rodrigues, A. (2009). An integrated process to produce vanillin and lignin-based
polyurethanes from kraft lignin. Chemical Engineering Research and Design,
87(9), 1276-1292.
de Curtis, F., Quici, R., Ianiri, G., Palmgren, L., De Cicco, V., Castoria, R., & Wright,
S. (2010). The influence of yeast origin and identity on modes of biodegradation of
patulin by basidiomycetous pink yeasts. XVI convegno nazionale SI pa. V., 14-17
settembre 2010, florence, italy. Journal of Plant Pathology, 92(S4)
Demain, A. L., Newcomb, M., & Wu, J. H. (2005). Cellulase, clostridia, and ethanol.
Microbiology and Molecular Biology Reviews : MMBR, 69(1), 124-154.
Endo, A., Nakamura, T., Ando, A., Tokuyasu, K., & Shima, J. (2008). Genome-wide
screening of the genes required for tolerance to vanillin. Biotechnology for
Biofuels, 1(1), 3.
Fengel, D., & Wegener, G. (1984). Wood: Chemistry, ultrastructure, reactions. Walter
De Gruyter, 613, 1960-1982.
Gadanho, M., & Sampaio, J. P. (2005). Occurrence and diversity of yeasts in the mid-
atlantic ridge hydrothermal fields near the azores archipelago. Microbial Ecology,
50(3), 408-417.
Gardes, M., & Bruns, T. D. (1993). ITS primers with enhanced specificity for
basidiomycetes‐application to the identification of mycorrhizae and rusts.
Molecular Ecology, 2(2), 113-118.
Gardes, M., White, T. J., Fortin, J. A., Bruns, T. D., & Taylor, J. W. (1991).
Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by
26
amplification of nuclear and mitochondrial ribosomal DNA. Canadian Journal of
Botany, 69(1), 180-190.
Guo, D., Chen, F., Inoue, K., Blount, J. W., & Dixon, R. A. (2001). Downregulation of
caffeic acid 3-O-methyltransferase and caffeoyl CoA 3-O-methyltransferase in
transgenic alfalfa. impacts on lignin structure and implications for the biosynthesis
of G and S lignin. The Plant Cell, 13(1), 73-88.
Hahn-Deinstrop, E. (2007). Applied thin-layer chromatography John Wiley & Sons.
Harrington, A. H., Bigott, A. F., Anderson, B. W., Boone, M. J., Brick, S. M., delSol, J.
F., Willyard, A. M. (2014). (2014). Sampling local fungal diversity in an
undergraduate laboratory using DNA barcoding, journal of the arkansas academy
of science: Vol. 68 , article 12.
Hata, K. (1966). Investigations on lignins and lignification XXXIII. studies on lignins
isolated from spruce wood decayed by poria subacida BII. Holzforschung-
International Journal of the Biology, Chemistry, Physics and Technology of Wood,
20(5), 142-147.
Hedges, J. I., & Mann, D. C. (1979). The characterization of plant tissues by their lignin
oxidation products. Geochimica Et Cosmochimica Acta, 43(11), 1803-1807.
Henderson, M. E. (1961). The metabolism of aromatic compounds related to lignin by
some hyphomycetes and yeast-like fungi of soil. Microbiology, 26(1), 155-165.
Hess, A. V. I. (2007). Digitally enhanced thin-layer chromatography: An inexpensive,
new technique for qualitative and quantitative analysis. J.Chem.Educ, 84(5), 842.
Higuchi, T. (1981). Biosynthesis of lignin. Plant carbohydrates II (pp. 194-224)
Springer.
Higuchi, T. (1990). Lignin biochemistry: Biosynthesis and biodegradation. Wood
Science and Technology, 24(1), 23-63.
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., & Pease, L. R. (1989). Site-directed
mutagenesis by overlap extension using the polymerase chain reaction. Gene,
77(1), 51-59.
Hocking, M. B. (1997). Vanillin: Synthetic flavoring from spent sulfite liquor.
J.Chem.Educ, 74(9), 1055.
Hoffman, C. S. (2001). Preparation of yeast DNA. Current Protocols in Molecular
Biology, , 13.11. 1-13.11. 4.
Jay, J. M., & Rivers, G. M. (1984). Antimicrobial activity of some food flavoring
compounds. Journal of Food Safety, 6(2), 129-139.
27
Johnson, J. R. (2000). Development of polymerase chain reaction-based assays for
bacterial gene detection. Journal of Microbiological Methods, 41(3), 201-209.
Jönsson, L., Palmqvist, E., Nilvebrant, N., & Hahn-Hägerdal, B. (1998). Detoxification
of wood hydrolysates with laccase and peroxidase from the white-rot fungus
trametes versicolor. Applied Microbiology and Biotechnology, 49(6), 691-697.
Kirk, T. K., & Chang, H. (1974). Decomposition of lignin by white-rot fungi. I.
isolation of heavily degraded lignins from decayed spruce. Holzforschung-
International Journal of the Biology, Chemistry, Physics and Technology of Wood,
28(6), 217-222.
Kurtzman, C., Fell, J. W., & Boekhout, T. (2011). The yeasts: A taxonomic study
Elsevier.
Lehrach, H., Diamond, D., Wozney, J. M., & Boedtker, H. (1977). RNA molecular
weight determinations by gel electrophoresis under denaturing conditions, a critical
reexamination. Biochemistry, 16(21), 4743-4751.
Lilly VG, B. H. (Ed.). (1951). Physiology of the fungi. McGraw-Hill, New York, NY:
McGraw-Hill.
Lima Pastrana, B. (2011). Identificacion de mycobacterium bovis mediante pcr en
muestras de exudado nasal en vacas positivas a tuberculosis.
Lima, G., de Curtis, F., Castoria, R., & de Cicco, V. (1998). Activity of the yeasts
cryptococcus laurentii and rhodotorula glutinis against post-harvest rots on
different fruits. Biocontrol Science and Technology, 8(2), 257-267.
Lima, G., De Curtis, F., Castoria, R., & De Cicco, V. (2003). Integrated control of apple
postharvest pathogens and survival of biocontrol yeasts in semi-commercial
conditions. European Journal of Plant Pathology, 109(4), 341-349.
Luque, L., Orr, V. C., Chen, S., Westerhof, R., Oudenhoven, S., van Rossum, G.,
Rehmann, L. (2016). Lipid accumulation from pinewood pyrolysates by
rhodosporidium diobovatum and chlorella vulgaris for biodiesel production.
Bioresource Technology, 214, 660-669.
Mechichi, T., Labat, M., Patel, B. K., Woo, T. H., Thomas, P., & Garcia, J. (1999).
Clostridium methoxybenzovorans sp. nov., a new aromatic o-demethylating
homoacetogen from an olive mill wastewater treatment digester. International
Journal of Systematic and Evolutionary Microbiology, 49(3), 1201-1209.
Nehvonen, C., (2017). A study of the microbial biodegradation of a lignin monomer.
Master thesis, 49.
28
Mullis, K. B., & Faloona, F. A. (1987). [21] specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction. Methods in Enzymology, 155, 335-350.
Palmgren, L., (2009). Plant associated Pink Yeasts in central Italy: isoltation and
characterisation. Master thesis, 30.
Palmqvist, E., Galbe, M., & Hahn-Hägerdal, B. (1998). Evaluation of cell recycling in
continuous fermentation of enzymatic hydrolysates of spruce with saccharomyces
cerevisiae and on-line monitoring of glucose and ethanol. Applied Microbiology
and Biotechnology, 50(5), 545-551.
Qi, F., Kitahara, Y., Wang, Z., Zhao, X., Du, W., & Liu, D. (2014). Novel mutant
strains of rhodosporidium toruloides by plasma mutagenesis approach and their
tolerance for inhibitors in lignocellulosic hydrolyzate. Journal of Chemical
Technology and Biotechnology, 89(5), 735-742.
Sampaio, J. P., Gadanho, M., Bauer, R., & Weiß, M. (2003). Taxonomic studies in the
microbotryomycetidae: Leucosporidium golubevii sp. nov., leucosporidiella gen.
nov. and the new orders leucosporidiales and sporidiobolales. Mycological
Progress, 2(1), 53-68.
Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. L., Levesque, C. A.,
Fungal Barcoding Consortium Author List. (2012). Nuclear ribosomal internal
transcribed spacer (ITS) region as a universal DNA barcode marker for fungi.
Proceedings of the National Academy of Sciences of the United States of America
Schochetman, G., Ou, C., & Jones, W. K. (1988). Polymerase chain reaction. The
Journal of Infectious Diseases, 158(6), 1154-1157.
Scorzetti, G., Fell, J. W., Fonseca, A., & Statzell-Tallman, A. (2002). Systematics of
basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal
transcribed spacer rDNA regions. FEMS Yeast Research, 2(4), 495-517.
Shinde, V. L., Suneel, V., & Shenoy, B. D. (2017). Diversity of bacteria and fungi
associated with tarballs: Recent developments and future prospects. Marine
Pollution Bulletin,
Valerio, E., Gadanho, M., & Sampaio, J. P. (2008). Reappraisal of the sporobolomyces
roseus species complex and description of sporidiobolus metaroseus sp. nov.
International Journal of Systematic and Evolutionary Microbiology, 58(3), 736-
741.
29
Voitl, T., & Rohr, P. R. v. (2009). Demonstration of a process for the conversion of
kraft lignin into vanillin and methyl vanillate by acidic oxidation in aqueous
methanol. Industrial & Engineering Chemistry Research, 49(2), 520-525.
Vu, D., Groenewald, M., Szöke, S., Cardinali, G., Eberhardt, U., Stielow, B., Boekhout,
T. (2016). DNA barcoding analysis of more than 9 000 yeast isolates contributes to
quantitative thresholds for yeast species and genera delimitation. Studies in
Mycology, 85, 91-105.
Walton, N. J., Mayer, M. J., & Narbad, A. (2003). Vanillin. Phytochemistry, 63(5), 505-
515.
White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A
Guide to Methods and Applications, 18(1), 315-322.
Yurkov, A., Vustin, M., Tyaglov, B., Maksimova, I., & Sineokiy, S. (2008). Pigmented
basidiomycetous yeasts are a promising source of carotenoids and ubiquinone Q
10. Microbiology, 77(1), 1-6.
Zimmermann, W. (1990). Degradation of lignin by bacteria. Journal of Biotechnology,
13(2-3), 119-130.
Recommended