View
2
Download
0
Category
Preview:
Citation preview
1
Title: Phototropin 2 contributes to the chloroplast avoidance response at the 1
chloroplast-plasma membrane interface 2
3
Kazuhiro Ishishita1,*
, Takeshi Higa2, Hidekazu Tanaka
1, Shin-ichiro Inoue
3, Aeri Chung
1, 4
Tomokazu Ushijima4, Tomonao Matsushita
4, Toshinori Kinoshita
3, Masato Nakai
2, Masamitsu 5
Wada5, Noriyuki Suetsugu
6, Eiji Gotoh
4,*,† 6
7
1Graduate
School of Agriculture, Kyushu University, Fukuoka 819-0395, Japan 8
2Institute for Protein Research, Osaka University, Osaka 565-0871, Japan
9
3Graduate School of Sciences, Nagoya University, Aichi 464-8602, Japan 10
4Faculty of Agriculture, Kyushu University, Fukuoka 819-0395, Japan 11
5Graduate School of Science and Engineering, Tokyo Metropolitan University, Tokyo 192-0397, 12
Japan 13
6Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan 14
15
*These authors contributed equally to this work 16
†Address correspondence to eiji.gotoh@agr.kyushu-u.ac.jp 17
18
Author Contributions: 19
E.G., N.S., and M.W. conceptualized the research. E.G. and K.I. designed the study and performed 20
most of the experiments. T.H. and M.N. performed the immunoblot analysis of cell-fractionated 21
proteins. H.T. contributed to the light transmittance analysis. T.H. and A.C. contributed to the 22
microscopic analysis. S.I. analyzed the light-induced stomatal opening. N.S., T.U., and T.M. 23
Plant Physiology Preview. Published on March 19, 2020, as DOI:10.1104/pp.20.00059
Copyright 2020 by the American Society of Plant Biologists
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
2
generated the transgenic mutants. T.K. contributed to analytical tools. K.I., T.H., N.S., M. W., and 24
E.G. analyzed the data. N.S. and E.G. wrote the paper. All authors read and approved the 25
manuscript. 26
27
Running title: Phototropin2 functions on the chloroplasts 28
29
One sentence summary: Chloroplast-localized phototropin2 regulates the chloroplast avoidance 30
response and possibly stomatal opening. 31
32
Corresponding author: 33
Eiji Gotoh 34
Faculty of Agriculture, Kyushu University. 35
744 Motooka, Nishi-ku, Fukuoka 819-0395, JAPAN 36
TEL: +81-92-802-4650 37
FAX: +81-92-802-4650 38
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
3
Abstract 39
Blue-light-induced chloroplasts movements play an important role in maximizing light utilization for 40
photosynthesis in plants. Under a weak light condition, chloroplasts accumulate to the cell surface 41
to capture light efficiently (chloroplast accumulation response). Conversely, chloroplasts escape 42
from strong light and move to the side wall to reduce photodamage (chloroplast avoidance 43
response). The blue light receptor phototropin (phot) regulates these chloroplast movements and 44
optimizes leaf photosynthesis by controlling other responses as well as chloroplast movements. 45
Seed plants such as Arabidopsis thaliana have the phototropins phot1 and phot2. They 46
redundantly mediate phototropism, stomatal opening, leaf flattening, and the chloroplast 47
accumulation response. However, the chloroplast avoidance response is induced by strong blue 48
light and regulated primarily by phot2. Phototropins are localized mainly on the plasma membrane. 49
However, a substantial amount of phot2 resides on the chloroplast outer envelope. Therefore, 50
differentially localized phot2 might have different functions. To determine the functions of plasma 51
membrane- and chloroplast envelope-localized phot2, we tethered it to these structures with their 52
respective targeting signals. Plasma membrane-localized phot2 regulated phototropism, leaf 53
flattening, stomatal opening, and chloroplast movements. Chloroplast envelope-localized phot2 54
failed to mediate phototropism, leaf flattening, and the chloroplast accumulation response but 55
partially regulated the chloroplast avoidance response and stomatal opening. Based on the present 56
and previous findings, we propose that phot2 localized at the interface between the plasma 57
membrane and the chloroplasts is required for the chloroplast avoidance response and possibly for 58
stomatal opening as well. 59
60
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
4
Introduction 61
Plants recognize UV-B, blue, red, and far-red light with photoreceptor molecules (Kami et al., 2010; 62
Paik and Huq, 2019), i.e., a red/far-red photoreceptor phytochrome (Franklin and Quail, 2010), a 63
photolyase-like blue light (BL) receptor cryptochrome (Liu et al., 2016), a UV-B photoreceptor 64
UVR8 (Jenkins, 2017) and so on. These plant photoreceptors mediate light responses including 65
photomorphogenesis and photoperiodic flowering by regulating gene expression. They interact 66
with various transcription factors and activate or suppress them (Pham et al., 2018; Liu et al., 2016; 67
Liang et al., 2019). Most plant photoreceptors localize primarily in the nucleus or cytosol. 68
69
In contrast, the plant-specific BL photoreceptor known as phototropin (phot) is localized mainly on 70
the plasma membrane (Christie, 2007). It regulates BL responses without directly affecting gene 71
expression (Christie, 2007). Phototropins consist of two light-sensing LOV (light, oxygen, or 72
voltage) domains and a C-terminal serine/threonine kinase domain (Christie, 2007). Arabidopsis 73
thaliana has two phototropins, phot1 and phot2. BL-induced autophosphorylation is essential for 74
phototropin function (Christie et al., 1998; Inoue et al., 2008a; Inoue et al., 2011). They can 75
optimize photosynthetic activity and plant growth under fluctuating light conditions by regulating 76
various responses (Kasahara et al., 2002; Takemiya et al., 2005; Gotoh et al., 2018). Both phot1 77
and phot2 are functionally redundant in phototropism (Huala et al., 1997; Sakai et al., 2000, 2001), 78
the chloroplast accumulation response (Sakai et al., 2001), stomatal opening (Kinoshita et al., 79
2001), leaf flattening (Sakai et al., 2001; Sakamoto and Briggs, 2002), and leaf positioning (Inoue 80
et al., 2008b). However, phot1 has a relatively greater contribution to these responses under weak 81
light conditions (Suetsugu and Wada, 2013). Certain responses are regulated by phot1 or phot2 82
alone. Phot1 mediates rapid inhibition of hypocotyl growth (Folta and Spalding, 2001) and 83
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
5
high-fluence, BL-mediated mRNA destabilization (Folta and Kaufman, 2003). Phot2 regulates 84
chloroplast dark positioning (Suetsugu et al., 2005), chloroplast and nuclear avoidance responses 85
(Kagawa et al., 2001; Iwabuchi et al., 2007; Higa et al., 2014), and palisade cell development 86
(Kozuka et al., 2011). 87
88
Chloroplasts move towards weak light to optimize light capture (the chloroplast accumulation 89
response) (Gotoh et al., 2018). Conversely, they evade strong light in order to reduce 90
photodamage (the chloroplast avoidance response) (Kasahara et al., 2002). Only chloroplasts 91
directly irradiated with strong light exhibited avoidance movement (Kagawa and Wada, 1999, 92
Tsuboi and Wada, 2011), suggesting that phot2 is closely associated with chloroplasts or localized 93
on the plasma membrane near them. Although most phototropins are constitutively associated with 94
the plasma membrane, we previously showed that some Arabidopsis phototropins are localized on 95
the outer envelope of the chloroplast (Kong et al., 2013c). The amount of phot2 in the chloroplast 96
outer membrane is much higher than that of phot1 (Kong et al., 2013c). A single species of 97
phototropin of the liverwort Marchantia polymorpha (Mpphot) regulates chloroplast accumulation 98
and avoidance (Komatsu et al., 2014). It is localized on the chloroplast outer envelope and the 99
plasma membrane (Kodama, 2016). However, it has not yet been empirically demonstrated which 100
Arabidopsis phot2 (localized on the chloroplast or the plasma membrane) mediate the chloroplast 101
avoidance response and other phot-mediated responses such as phototropism, stomatal opening, 102
and leaf flattening. To solve this question, we produced transgenic plants in which phot2 was 103
tethered to the chloroplast outer envelope or the plasma membrane in the Arabidopsis phot1phot2 104
mutant background and observed phot-associated phenotypes in the transgenic plants. 105
106
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
6
Results 107
108
Generation of transgenic plants expressing plasma membrane- or chloroplast 109
envelope-anchored phot2 110
To reveal the functions of phot2 localized on the chloroplast outer membrane, we produced 111
transgenic Arabidopsis plants expressing phot2-green fluorescent protein (GFP) fusion protein 112
(phot2-GFP) targeted to the chloroplast outer membrane with the N-terminal, 47-amino-acid 113
sequence of OUTER ENVELOPE MEMBRANE PROTEIN 7 (OEP7; Lee et al., 2001; hereafter 114
named the CP-P2G lines) (Fig. 1A). This short sequence contains all of the domains required to 115
target the chloroplast outer membrane, including the transmembrane and C-terminal, positively 116
charged regions (Fig. 1A; Lee et al., 2001). We also generated transgenic plants expressing 117
wild-type phot2-GFP (hereafter named the P2G lines) as a control and plasma 118
membrane-anchored phot2-GFP (hereafter named the PM-P2G lines) (Fig. 1A). The phot2-GFP 119
protein of the PM-P2G lines contains a myristoylation sequence at the extreme N-terminus (Fig. 120
1A; Preuten et al., 2015). The PHOT2-GFP genes were expressed under the control of the PHOT2 121
native promoter in phot1phot2 double mutant plants that are phototropin null (Kinoshita et al., 2001; 122
Suetsugu et al., 2013). Two independent lines in each transgenic plant, P2G, PM-P2G and 123
CP-P2G, were selected for further analysis. We performed immunoblot analyses with PHOT2 124
antibody to verify the phot2-GFP protein levels in the selected lines. The ~120-kDa PHOT2 band 125
was detected in the wild type (WT) but not the phot1phot2 double mutant (Fig. 1B). In the P2G, 126
PM-P2G, and CP-P2G lines, bands of ~150 kDa representing the phot2-GFP protein were 127
detected. This finding was consistent with GFP fusion. The amounts of phot2-GFP proteins in the 128
selected P2G and CP-P2G plants were comparable with that of the WT plants. However, the 129
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
7
amounts of phot2-GFP in the PM-P2G lines were always lower than those of the P2G and CP-P2G 130
lines despite verification of multiple independent PM-P2G lines (Fig. 1B). 131
132
The subcellular localizations of phot2-GFP in the leaf mesophyll cells of P2G, PM-P2G, and 133
CP-P2G line were observed by confocal imaging. Time gating was used to eliminate chlorophyll 134
autofluorescence (Kodama, 2016). In our P2G transgenic plants, GFP fluorescence was found on 135
both the plasma membrane and the chloroplast outer envelope (Fig. 1C and Supplemental Fig. 136
S1). GFP fluorescence in the PM-P2G line was observed only on the plasma membrane (Fig. 1C). 137
Fluorescence in the PM-P2G line strongly coincided with that of propidium iodide that stains cell 138
boundaries (Supplemental Fig. S1). GFP fluorescence was observed on the vacuolar side of the 139
chloroplasts of the P2G line but not on those of the PM-P2G line (Fig. 1C and Supplemental Fig. 140
S1). Thus, phot2-GFP proteins in the PM-P2G line were not measurably targeted to the chloroplast 141
outer membrane. In CP-P2G transgenic plants, however, GFP fluorescence was detected 142
exclusively around the chloroplasts but not on the plasma membrane although punctate GFP 143
fluorescence that were not associated with chloroplasts were observed (Fig. 1C, Supplemental Fig. 144
S1, and Supplemental Fig. S2). Therefore, phot2-GFP proteins in the CP-P2G line are localized on 145
the chloroplast envelope. However, the localization pattern of phot2-GFP on the chloroplast 146
surface was somewhat different between P2G and CP-P2G transgenic plants. The phot2-GFP 147
fluorescence on the chloroplast surface was diffused in the P2G line, but was punctate in the 148
CP-P2G line (Fig. 1C and Supplemental Fig. S2) although we do not know what gave rise to this 149
difference. To determine phot2-GFP localization in each transgenic plant, we performed 150
immunoblot analyses on protein extracts obtained by cell fractionation (Fig. 1D). The plasma 151
membrane or chloroplast fractions were normalized with anti-H+-ATPASEs (AHA) (Hayashi et al., 152
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
8
2010) or anti-TRANSLOCONE AT THE OUTER ENVELOPE MEMBRANE OF CHLOROPLAST 153
159 (Toc159) (Kikuchi et al., 2006) polyclonal antibodies, respectively. Consistent with a previous 154
report (Kong et al., 2013c), phot2-GFP in P2G lines was enriched in the plasma membrane fraction 155
and was detected also in the chloroplast fraction. In the PM-P2G lines, phot2-GFP was also 156
enriched in the plasma membrane fraction and was hardly detected in the chloroplast fraction (Fig. 157
1D). In contrast, phot2-GFP was highly enriched in the CP-P2G chloroplast fraction but we could 158
not detect phot2-GFP in the plasma membrane fraction (Fig. 1D). 159
160
In summary, phot2-GFP was targeted to the plasma membranes and chloroplast outer envelopes 161
of PM-P2G and CP-P2G plants, respectively. 162
163
Blue light-induced phot2 protein autophosphorylation on the plasma membrane and the 164
chloroplast outer envelope 165
To determine whether the phot2-GFPs of the PM-P2G and CP-P2G lines function as BL-activated 166
kinases, we investigated BL-induced autophosphorylation of phot2-GFP proteins via BL-induced 167
electrophoretic mobility shift. BL-induced retardation in the mobility shift of phot2-GFP proteins was 168
observed in P2G, PM-P2G, and CP-P2G plants (Fig. 2). Thus, phot2-GFP of PM-P2G and CP-P2G 169
plants had normal autophosphorylation and kinase activity. This means that the phot2 on the 170
chloroplast outer membrane as well as on the plasma membrane can be autophosphorylated in 171
response to BL. 172
173
Plasma membrane-associated phot2 induced leaf flattening and biomass production 174
whereas chloroplast envelope-associated phot2 did not 175
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
9
We analyzed the localization of phot2-GFP in the leaf epidermal cells (Fig. 3A and Supplemental 176
Fig. S3) because phot2 in the epidermal tissues is required to regulate leaf flattening and 177
expansion (Kozuka et al., 2011). In the P2G lines, phot2-GFP localized on the plasma membranes 178
of the leaf epidermal cells and we could not detect any fluorescence of phot2-GFP around the 179
chloroplasts (Fig. 3A and Supplemental Fig. S3). In PM-P2G plants, phot2-GFP showed the 180
exclusive plasma-membrane localization. On the other hand, phot2-GFP in the CP-P2G lines 181
localized primarily around the chloroplasts (Fig. 3A and Supplemental Fig. S3). Furthermore, the 182
dot-like phot2-GFP structures not associated with chloroplasts were also observed in the CP-P2G 183
lines (Fig. 3A, arrow). 184
185
Under white light at 100-120 µmol m-2
s-1
, in the P2G and PM-P2G lines, the leaves were flat and 186
resembled those of the WT (Fig. 3B and Fig. 3C). Plant size in the P2G and PM-P2G lines was 187
much bigger than phot1phot2 double mutant plants but these lines were nonetheless smaller than 188
the WT (Fig. 3B and Fig. 3D). The size of P2G and PM-P2G plants was comparable with that of 189
phot1 mutant plants because the absence of phot1 in the P2G and PM-P2G lines could influence 190
plant size as reported previously (Takemiya et al., 2005; Inoue et al., 2008b). In contrast, CP-P2G 191
plants had curled leaves and lower biomass production than the WT, P2G, and PM-P2G lines, 192
similar to phot1phot2 mutants (Fig. 3B, Fig. 3C, and Fig. 3D). Our findings indicate that plasma 193
membrane-localized phot2, but not chloroplast-localized phot2, induced leaf flattening and 194
biomass production. 195
196
Plasma membrane-associated phot2 induced phototropism whereas chloroplast outer 197
membrane-associated phot2 did not 198
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
10
To investigate the role of differential phot2 localization in hypocotyl phototropism, we examined 199
subcellular phot2-GFP localization in the hypocotyl epidermal (Fig. 4A) and cotyledon palisade 200
(Supplemental Fig. S4) cells of 4-day-old etiolated transgenic seedlings. In Arabidopsis, etioplasts 201
in etiolated seedlings could be detectable by chlorophyll autofluorescence (Wang et al., 2013). In 202
the P2G lines, phot2-GFP was found on the plasma membrane and around the etioplast periphery. 203
Phot2-GFP in the PM-P2G lines exhibited the exclusive plasma-membrane localization in the 204
hypocotyl and cotyledon epidermal cells (Fig. 4A and Supplemental Fig. S4). For the CP-P2G lines, 205
phot2-GFP was detected around the etioplasts and in certain dot-like structures not associated with 206
chloroplasts (Fig. 4A, arrows; Supplemental Fig. S4). 207
208
We explored phototropism under 10 µmol m-2
s-1
unilateral BL wherein phot2 can mediate 209
phototropism in the absence of phot1 (Fig. 4B). The WT showed positive phototropism whereas 210
phot1phot2 mutants showed no phototropic responses. The P2G and PM-P2G plants were 211
positively phototropic and at the same level as the WT (Fig. 4B). In contrast, no phototropic 212
curvature was detected in CP-P2G plants (Fig. 4B). 213
214
Chloroplast outer membrane-associated phot2 partially induced stomatal opening 215
We investigated whether chloroplast-localized phot2 mediates the BL-dependent stomatal 216
opening. In the leaf epidermal guard cells of P2G plants, phot2-GFP was localized on the plasma 217
membrane and around the chloroplast outer envelope (Fig. 5A). phot2-GFP in a PM-P2G line was 218
exclusively localized on the guard cell plasma membranes. On the other hand, phot2-GFP in 219
CP-P2G plants was detected around the chloroplasts and in certain dot-like structures (Fig. 5A, 220
arrows) but not on the plasma membrane (Fig. 5A). These patterns of phot2-GFP were also 221
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
11
observed in the epidermal cells of leaves (Fig. 3A) and etiolated seedlings (Fig. 4A and 222
Supplemental Fig. S4). 223
224
The isolated leaf epidermis of transgenic plants was dark-adapted and irradiated either with red 225
light (RL) at 60 µmol m-2
s-1
or RL (50 µmol m-2
s-1
) plus BL (10 µmol m-2
s-1
). RL enhancement of 226
BL-dependent stomatal opening was observed in the WT and P2G plants but not in phot1phot2 227
mutants (Fig. 5B). BL-dependent stomatal opening was induced in the PM-P2G line to the same 228
extent as in the WT and P2G plants. However, CP-P2G plants exhibited weak but significant 229
BL-induced stomatal opening (Fig. 5B). RL irradiation alone did not induce stomatal opening in any 230
lines (Fig. 5B). Thus, plasma membrane-localized phot2 was sufficient to induce BL-dependent 231
stomatal opening but chloroplast outer membrane-localized phot2 also induced it. 232
233
Chloroplast outer membrane-associated phot2 induced the chloroplast avoidance 234
response 235
We examined whether chloroplast outer membrane-localized phot2 regulates BL-induced 236
chloroplast movements. Three-week-old plants were transferred to darkness, weak light, or strong 237
light and chloroplast distributions were observed under a confocal microscope (Fig. 6A). In P2G 238
and PM-P2G plants under darkness, chloroplasts accumulated on the cell bottoms. Under weak 239
BL, the chloroplasts were localized on the upper and lower periclinal walls. Under strong BL, the 240
chloroplasts localized on the side walls (Fig. 6A). Thus, phot2-GFP in P2G and PM-P2G lines 241
mediated chloroplast dark positioning, accumulation, and avoidance responses. In a CP-P2G line, 242
chloroplasts localized on the sidewalls under all light conditions. Therefore, the CP-P2G line was 243
defective in chloroplast dark positioning and accumulation response (Fig. 6A). However, it remains 244
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
12
to be determined whether phot2-GFP of the CP-P2G lines regulates the chloroplast avoidance 245
response. We examined under a confocal microscope the chloroplast avoidance response to 246
partial irradiation in the leaf palisade mesophyll cells (Fig. 6). In WT, phot1, P2G, and PM-P2G 247
plants, chloroplasts evaded the irradiated area as a result of the avoidance response (Fig. 6B, Fig. 248
6C, and Supplemental Fig. S5, left and middle panels). The chloroplast avoidance response in P2G 249
and PM-P2G plants was slightly greater than that in WT and phot1 plants although statistically 250
insignificant (Fig. 6D and Fig. 6E). In CP-P2G plants, chloroplasts also escaped from the irradiated 251
area (Fig. 6B, right panels) but much more slowly than they did in P2G and PM-P2G plants (Fig. 252
6C, Fig. 6D, and Fig. 6E). Upon induction of the chloroplast avoidance response, the total distance 253
traveled in 15 mins was shorter in the CP-P2G line than in P2G or PM-P2G plants (Fig. 6C and Fig. 254
6D). However, the avoidance response was never detected in phot1phot2 mutants (Fig. 6D, Fig. 255
6E, and Supplemental Fig. S5, right panels). Thus, phot2-GFP in the CP-P2G line partially rescued 256
the defect in the avoidance response in the phot1phot2 mutant. 257
We also assessed chloroplast movements by measuring light-induced transmittance changes (Fig. 258
7). In WT plants, weak light (1, 3, and 5 µmol m-2
s-1
) reduced leaf transmittance as a result of the 259
chloroplast accumulation response (Fig. 7A, Fig. 7B, and Fig. 7C). At 5 µmol m-2
s-1
, a biphasic 260
response was observed, i.e., initial transient increase in leaf transmittance and then the strong 261
decrease (Fig. 7C), indicative of a transient chloroplast avoidance. A biphasic response was more 262
prominent and the clear avoidance response was induced at 20 µmol m-2
s-1
(Fig. 7D). At more than 263
50 µmol m-2
s-1
, only the avoidance response was detectable and the response was saturated 264
between 100 and 300 µmol m-2
s-1
(Fig. 7E, Fig. 7F, and Fig. 7G). In the phot1 mutant (that has 265
phot2), the accumulation response was severely attenuated and the avoidance response was 266
induced with slightly reduced amplitude (Fig. 7). Partial defect in the avoidance response in the 267
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
13
phot1 mutant was reported also in other studies (Luesse et al., 2010; Sztatelman et al., 2016). No 268
detectable light-induced changes in leaf transmittance were observed in the phot1phot2 mutants 269
(Fig. 7), because of lack of light-induced chloroplast movements in the phot1phot2 mutants (Sakai 270
et al., 2001). Both P2G and PM-P2G plants basically showed similar chloroplast movements to 271
phot1 mutant plants although the accumulation response was weaker than that in the phot1 mutant 272
(Fig. 7). In CP-P2G plants, no chloroplast accumulation response was observed at any fluence rate 273
of blue light. However, the weak but significant avoidance response was observed at more than 20 274
µmol m-2
s-1
although the amplitude was less than that in P2G and PM-P2G plants (Fig. 7D, Fig. 7E, 275
Fig. 7F, and Fig. 7G). 276
277
Taken together, these results indicate that chloroplast outer membrane-localized phot2 certainly 278
induced the chloroplast avoidance response even though less effective than those in the plasma 279
membrane. 280
281
Discussion 282
283
Here, we showed that plasma membrane-localized phot2 suffices to mediate phot2-dependent 284
responses. Chloroplast outer membrane-localized phot2 mediates BL-dependent stomatal 285
opening and the chloroplast avoidance response. 286
287
Plasma membrane-anchored phot2 mediated all phot2-dependent responses 288
Phototropins are localized and function on the plasma membrane. By contrast, most plant 289
photoreceptors are function and localized in the nucleus or cytosol. Phototropins have no 290
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
14
transmembrane domain (Christie 2007). Plasma membrane-bound phototropins can be solubilized 291
with detergents or alkali solutions but not with chaotropic salt (Knieb et al., 2004; Kong et al., 292
2013b, 2013c). Therefore, phototropins are not integral membrane proteins. Moreover, 293
mechanisms other than electrostatic interaction and covalent bonding to integral compounds are 294
involved in the association of phototropins with the plasma membrane. Phototropin proteins are not 295
always localized on the plasma membrane. Blue light causes the release of phot1 to the cytosol 296
(Sakamoto and Briggs 2002; Wan et al., 2008) and the movement of phot2 to the Golgi apparatus 297
(Kong et al., 2006). The importance of phototropins in cytosol and in the Golgi was examined in 298
various ways. When the cytoplasmic phototropins were cleared through RL-mediated inhibition of 299
release of phot1 to cytosol (Han et al., 2008), tethering of phot1-GFP to the plasma membrane by 300
myristoylation or farnesylation (Preuten et al., 2015), and targeting phot2-GFP to the nucleus with a 301
nuclear localization signal (phot2-GFP-NLS) (Kong et al., 2013c), all examined 302
phototropin-mediated responses were normally induced, indicating that cytosolic phototropins are 303
dispensable for phototropin-mediated responses. Furthermore, analysis of domain swapping 304
between phot1 and phot2 revealed that targeting phot2 to the Golgi apparatus is not required for 305
the chloroplast avoidance response (Aihara et al., 2008). A chimeric phototropin consisting of 306
phot2 N-terminal light-sensing- and phot1 kinase domains could not move to the Golgi apparatus in 307
response to BL but could mediate the chloroplast avoidance response (Aihara et al., 2008). 308
Therefore, phototropins have virtually no function in the Golgi apparatus. 309
310
Our findings for the PM-P2G lines confirm that phototropins function primarily on the plasma 311
membrane (Fig. 8A). The PM-P2G lines were almost normal for all phot2-dependent responses 312
including phototropism, leaf flattening, plant biomass, stomatal opening, and chloroplast 313
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
15
accumulation and avoidance although slightly less phot2-GFP accumulated in the PM-P2G lines 314
relative to the other lines (Fig. 1 and Fig. 2). However, the amount of phot2-GFP on the plasma 315
membrane was comparable between the P2G and PM-P2G lines or higher in the PM-P2G lines 316
than those in the P2G lines (Fig. 1C, Fig. 1D, Fig. 3,Fig. 4, Fig. 5, Supplemental Fig. S1, 317
Supplemental Fig. S2, Supplemental Fig. S3, and Supplemental Fig. S4). That should be why 318
phot2-GFP in the PM-P2G lines efficiently rescued all examined phot2-mediated responses. 319
Preuten et al. (2015) showed that plasma membrane-anchored phot1-GFP mediated 320
phot1-dependent responses including phototropism, leaf flattening and positioning, and chloroplast 321
accumulation. Stomatal opening was not evaluated in that study. The plasma membrane is a major 322
site of phototropin signaling initiated in response to BL. Most phototropin-interacting proteins 323
essential for certain phototropin-mediated responses are also localized in the plasma membrane. 324
These include the BTB/POZ (for Broad-Complex, Tramtrack, and Bric-a-brac/POX virus and Zinc 325
finger)-domain proteins NON-PHOTOTROPIC HYPOCOTYL 3 (Motchoulski and Liscum, 1999), 326
ROOT PHOTOTROPISM 2 (Inada et al., 2004), NPH3/RPT2-LIKE (NRL) PROTEIN FOR 327
CHLOROPLAST MOVEMENT 1 (NCH1) (Suetsugu et al., 2016), the PHYTOCHROME KINASE 328
SUBSTRATE (PKS) proteins (Lariguet et al., 2006; de Carbonnel et al., 2010; Demarsy et al., 329
2012), and the auxin efflux carrier ATB-BINDING CASSETTE B 19 (ABCB19) (Christie et al., 330
2011). However, they do not participate in stomatal opening or the chloroplast avoidance response. 331
Moreover, no phototropin-interacting proteins on the plasma membrane have yet been associated 332
with these responses. Stomatal opening and the chloroplast avoidance response are mediated by 333
phot2-GFP in CP-P2G line. 334
335
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
16
How does chloroplast outer membrane-anchored phot2 promote BL-induced stomatal 336
opening? 337
phot2-GFP in control plant guard cells was localized on the plasma membrane and chloroplast 338
outer envelopes (Fig. 5A). We found that chloroplast outer membrane-anchored phot2 may be 339
partially involved in BL-induced stomatal opening (Fig. 5B and Fig. 8A). Phototropins mediate 340
stomatal opening by regulating the phosphorylation and activation of plasma membrane 341
H+-ATPase (PM-H
+-ATPase) (Kinoshita et al., 2001). Several signaling proteins downstream of 342
phototropins participate in PM-H+-ATPase activation including protein kinases BLUE LIGHT 343
SIGNALING1 (BLUS1) (Takemiya et al., 2013a) and BLUE LIGHT-DEPENDENT H+-ATPASE 344
PHOSPHORYLATION (BHP) (Hayashi et al., 2017), Protein phosphatase 1 (PP1) and PP1 345
REGULATORY SUBUNIT2-LIKE PROTEIN 1 (PRSL1) (Takemiya et al., 2006, 2013b). 346
Phototropins also regulate BL-induced suppression of the S-type anion channel in guard cells 347
(Marten et al., 2007). CONVERGENCE OF BLUE LIGHT AND CO2 1 (CBC1) is essential for 348
BL-induced suppression of the S-type anion channel along with its close homolog CBC2 (Hiyama 349
et al., 2017). These signaling components are localized in guard cell cytosols (Takemiya et al., 350
2006, 2013a, b; Hayashi et al., 2017; Hiyama et al., 2017). Thus, chloroplast outer 351
membrane-associated phot2 may induce signal transduction for phot-dependent stomatal opening 352
via these cytosolic components. We found dot-like phot2-GFP in the epidermal cells of leaves 353
(pavement and guard cells), cotyledons, and hypocotyls. They were not associated with 354
chloroplasts (Fig. 3,Fig. 4, Fig. 5, and Supplemental Fig. S4). These dot-like phot2-GFP might be 355
nonfunctional in leaf flattening, plant biomass production, or phototropism, because phot2-GFP in 356
the CP-P2G lines could not rescue these responses in the phot1phot2 mutant background (Fig. 3 357
and Fig. 4). On the other hand, we cannot rule out the possibility that the dot-like phot2-GFP could 358
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
17
mediate stomatal opening. Further analysis is required to establish how chloroplast outer 359
membrane-associated phototropins mediate BL-induced stomatal opening. 360
361
Phototropins at the interface between the chloroplasts and the plasma membrane may be 362
required for the chloroplast avoidance response 363
Previous photobiological and physiological analyses suggested that the chloroplast avoidance 364
response is mediated by phototropins localized on the chloroplast outer membrane or in the vicinity 365
of the chloroplasts (Kagawa and Wada, 1999; Tsuboi and Wada 2011). The chloroplast 366
accumulation response may be mediated by plasma membrane-localized phototropins because 367
chloroplasts can move to irradiated sites far from the chloroplasts. Moreover, phototropins may 368
generate transmissible signals mediating the chloroplast accumulation response (Tsuboi and 369
Wada 2010; Higa et al. 2017). In fact, in the PM-P2G lines both chloroplast accumulation and 370
avoidance responses could be induced but in the CP-P2G lines only the chloroplast avoidance 371
response was detected although it was relatively weak (Fig. 6 and Fig. 7). No phot2-GFP was 372
detected on the vacuolar sides of the PM-P2G chloroplasts or the CP-P2G plasma membranes 373
(Fig. 8A). It is, therefore, plausible that phot2 at the interface between the chloroplasts and the 374
plasma membrane is required for the chloroplast avoidance response (Fig. 8B). Chloroplast-actin 375
(cp-actin) filaments, which are necessary for photorelocation and positioning, are localized at the 376
interface between the chloroplasts and the plasma membrane (Kadota et al., 2009; Kong et al., 377
2013a). During chloroplast avoidance movements, phot2 is essential for the reorganization of the 378
cp-actin filaments (Kong et al., 2013a) with which chloroplasts are tightly bound to the plasma 379
membrane (Kadota et al, 2009; Suetsugu et al., 2010). Thus, both plasma membrane- (as in the 380
PM-P2G lines) and chloroplast-anchored phot2 (as in the CP-P2G lines) could function at the 381
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
18
interface between the chloroplasts and the plasma membrane to mediate the chloroplast 382
avoidance response. CHLOROPLAST UNUSUAL POSITIONING 1 (CHUP1), localized on the 383
chloroplast outer membrane (Oikawa et al., 2003, 2008), is required to generate and/or maintain 384
cp-actin filaments to control chloroplast movements and positioning (Oikawa et al., 2003; Kadota et 385
al., 2009). Overall, phot2 might mediate the chloroplast avoidance response at the interface. 386
Indeed, several chloroplast movement regulators including CHUP1 are phosphorylated under 387
strong light conditions (Boex-Fontvieille et al., 2014). Thus, phot2 might phosphorylate these 388
proteins at the interface to regulate the cp-actin filaments and the chloroplast avoidance response. 389
390
Our findings indicated that phot2 proteins at the interface between the chloroplasts and the plasma 391
membrane may be required for the chloroplast avoidance response. However, they do not explain 392
why phot1 cannot efficiently mediate this response even though phot1 localizes at the interface 393
between the chloroplasts and the plasma membrane. Thus, substrate specificity between phot1 394
and phot2 may also be necessary to determine the precise functions of these phototropins. Domain 395
swapping between phot1 and phot2 revealed that neither the N-terminal light-sensing- nor the 396
kinase domain determines the functional specificity of phot2 in chloroplast avoidance response 397
regulation (Aihara et al., 2008). Phot2 N/phot1 kinase and phot1 N/phot2 kinase chimeras 398
regulated the chloroplast avoidance response (Aihara et al., 2008). To elucidate the functional 399
difference between phot1 and phot2 in chloroplast avoidance response regulation, a more detailed 400
structure-function analysis is needed. 401
402
Materials and Methods 403
404
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
19
Plant materials and growth conditions 405
The Arabidopsis thaliana WT and phot1-5 phot2-1 mutant (Kinoshita et al. 2001) had a Col-gl1 406
background. phot1-5 phot2-1 is a null mutant for both phot1 and phot2 (Kinoshita et al. 2001; 407
Suetsugu et al., 2013). For most experiments, the seeds were sown on 0.75% (w/v) agar plates 408
containing Murashige and Skoog (MS) medium. The plants were incubated in a growth chamber 409
(CLE-303; TOMY Digital Biology Co. Ltd., Tokyo, Japan) at 22 ̊ C under continuous white light at 40 410
µmol m-2
s-1
. To measure biomass and leaf flattening, the plants were grown in soil in a growth 411
chamber (LPH-350S; NK Systems Ltd., Tokyo, Japan) at 22 ˚C and 55% relative humidity under 412
continuous white light at 120 µmol m-2
s-1
. 413
414
Plasmid construction and generation of transgenic lines 415
Full-length cDNA fragments of PHOT2 were amplified with the primers P2-Fw 416
(CCCtctagaATGGAGAGGCCAAGAGCCCCTC; XbaI site in lowercase) and P2-Rv 417
(AAAggtaccGAAGAGGTCAATGTCCAAGTCCGTAG; KpnI site in lowercase) from the vector 418
PHOT2pro:AtPHOT2-GFP:nosT/pRI 101-AN (Ishishita et al., 2016). 419
420
A recognition sequence for N-myristoyltransferase (Preuten et al., 2015) was added by PCR to the 421
5’-terminus of PHOT2 cDNA using the primers PM-P2-Fw 422
(AAAtctagaATGGAAATATGCATGAGTAGGATGGAGAGGCCAAGAGC; XbaI site in lowercase; 423
myristoylation sequence underlined) and P2-Rv. 424
425
The chloroplast outer membrane-targeting sequence of OUTER ENVELOPE MEMBRANE 426
PROTEIN 7 (OEP7) (Lee et al., 2001) was obtained by PCR using the primers CP-P2 Fw 427
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
20
(CCCtctagaATGGGAAAAACTTCGGGAGCGAA; XbaI site in lowercase) and CP-P2 Rv 428
(CTCTTGGCCTCTCCATGGGGTCTTTGGTTGG; 5’ sequence of PHOT2 cDNA underlined). The 429
PHOT2 fragment was obtained by PCR using the primers CP-P2 Fw2 430
(CCAACCAAAGACCCCATGGAGAGGCCAAGAG; 3’ sequence of OEP7 cDNA underlined) and 431
P2-Rv with template DNA from PHOT2 and OEP7 fragments. The latter two were fused by PCR 432
using the primers CP-P2 Fw and P2-Rv. All fragments were inserted into the XbaI/KpnI site of 433
GFP-NosT pBIN30 (Ushijima et al., 2017). A 3-kbp PHOT2 promoter region (-3,047 from the 434
PHOT2 start codon; Ishishita et al., 2016) was inserted into the NheI/XbaI site of the vectors. The 435
resulting binary vectors were introduced into Agrobacterium tumefaciens strain C58C1 (pMP90) 436
and transformed into the phot1-5 phot2-1 double mutant by the floral dip method (Clough and Bent, 437
1998). BASTA-resistant transgenic plants were selected. Homozygous T3 lines with a single 438
transgene were used in all subsequent experiments. 439
440
Immunoblot analysis 441
Rosette leaves of 3-week-old plants were homogenized in a buffer comprising 50 mM Tris-HCl (pH 442
7.5), 100 mM NaCl, 5 mM ethylenediaminetetraacetic acid (EDTA), 0.5% (v/v) Triton X-100, 1 mM 443
dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (Wako Pure Chemical Industries Ltd., 444
Osaka, Japan). Total proteins were used for sodium dodecyl sulfate polyacrylamide gel 445
electrophoresis and immunoblot analysis. PHOTOTROPIN 2 (PHOT2), GLYCERATE KINASE 446
(GLYK), H+-ATPASEs (AHA), and TRANSLOCONE AT THE OUTER ENVELOPE MEMBRANE 447
OF CHLOROPLAST 159 (Toc159) proteins were detected with anti-PHOT2- (Takemiya et al., 448
2005), anti-GLYK- (Ushijima et al., 2017), anti-AHA- (Hayashi et al., 2010), and anti-Toc159 449
polyclonal antibodies (Kikuchi et al., 2006), respectively. Phot2-GFP fusion proteins in Figure 3D 450
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
21
were detected with anti-GFP (no. 11814460001; Roche, Mannheim, Germany). In our experiment, 451
anti-Toc159 polyclonal antibodies detected mainly 86-kDa fragments of Toc159 that served as a 452
chloroplast marker (Kikuchi et al., 2006). 453
454
Isolation of plasma membrane and chloroplast envelope fractions 455
For the isolation of chloroplast envelope and plasma membrane fractions, mesophyll cell 456
protoplasts were isolated from the leaves of Arabidopsis transgenic plants using the 457
Tape-Arabidopsis Sandwich method (Wu et al., 2009). Protoplasts suspended in HS buffer (50 mM 458
HEPES-KOH, pH 7.5, and 330 mM sorbitol) with 0.1% (w/v) BSA and 0.1% (v/v) cOmplete 459
protease inhibitor cocktail (F. Hoffmann-La Roche Ltd., Basel, Switzerland) stock solution (1 tablet 460
dissolved in 1 ml of water) were ruptured through a nylon mesh (~10 μm) attached to the cut end of 461
a disposable syringe and then centrifuged at 4,000 g for 3 min. The pellets were used for the 462
isolation of the chloroplast envelope, and the supernatants were used for the isolation of the 463
plasma membrane fraction. The crude chloroplast pellets were resuspended in TE buffer (50 mM 464
Tricine-KOH, pH 7.5, and 2 mM EDTA) with 1 mM DTT and 0.1% (v/v) protease inhibitor cocktail 465
stock solution, and then chloroplasts were ruptured by freeze-thaw followed by homogenization in 466
a glass homogenizer after a three-fold dilution with TE buffer. Ruptured chloroplasts were overlaid 467
onto a step gradient, composed of 0.46 M and 1 M sucrose in TE buffer and centrifuged at 54,000 468
g for 2 h. Light green fractions collected from the step gradient were diluted five-fold with TE buffer 469
and centrifuged at 82,000g for 1 h. Precipitated chloroplast envelope fractions were dissolved in TE 470
buffer with 1 mM DTT, 0.1% (v/v) protease inhibitor cocktail stock solution, and 0.2% (v/v) 471
TritonX-100. The supernatants collected after the rupturing of protoplasts were centrifuged at 472
26,000g for 30 min. At the end of the run, the crude plasma membrane pellets were suspended in 473
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
22
HS buffer (pH 8.0) with 0.1% (v/v) protease inhibitor cocktail stock solution. Plasma membrane 474
fractions were purified by two-phase system (Larsson et al., 1994). The plasma 475
membrane-enriched upper phase solution was diluted three-fold with TE buffer with 1 mM DTT and 476
0.1% (v/v) protease inhibitor cocktail stock solution and then centrifuged at 82000g for 1 h. 477
Precipitated plasma membrane fractions were dissolved in TE buffer with 1 mM DTT, 0.1% (v/v) 478
protease inhibitor cocktail stock solution, and 0.2% (v/v) TritonX-100. 479
480
Light sources 481
Blue or red LEDs (ISL-150×150; CCS, Kyoto, Japan) were used in the analysis of phot2 482
autophosphorylation, phototropism, stomatal opening, and chloroplast movements. 483
484
Confocal microscopic analysis of phot2-GFP localization 485
Subcellular localization of the phot2-GFP fusion proteins was visualized by laser scanning confocal 486
microscopy (SP8; Leica Microsystems, Wetzlar, Germany). GFP fluorescence was measured by 487
the time gating method (gating time = 0.5–12 ns) to remove chlorophyll autofluorescence according 488
to a previous study (Kodama, 2016). A blue laser (laser power 15%) was used to induce the 489
chloroplast avoidance response. Propidium Iodide (PI) solution (Molecular Probes, Invitrogen., 490
Oregon, USA) was introduced into plants by deaeration to visualize the cell walls. Emission spectra 491
for chloroplast autofluorescence, GFP, and PI were measured at 488 nm. Excitation spectra for 492
chloroplast autofluorescence, GFP, and PI were measured at 620–685 nm, 490–550 nm, and 585–493
605 nm, respectively. 494
495
Measurement of the phototropic responses in the hypocotyls of etiolated seedlings 496
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
23
Seeds were sown on agar plates containing Murashige and Skoog (MS) medium (Sigma-Aldrich 497
Corp., St. Louis, MO, USA) solidified with 0.6% (w/v) agar. The seeds were stratified at 4 ˚C for 4 d. 498
The seedlings were grown vertically at 22 ˚C for 3 d in the dark. The resulting etiolated seedlings 499
were irradiated with unilateral BL of 10 µmol m-2
s-1
for 12 h. The irradiated seedlings were 500
photographed and their phototropic curvatures were measured with ImageJ 501
(http://imagej.nih.gov/ij; NIH, Bethesda, MD, USA). 502
503
Plant biomass and leaf flattening 504
Fresh weights were determined for the shoots of whole plants grown under continuous white light 505
at 100 µmol m-2
s-1
for 3 weeks. For leaf flattening, cross-sections of the leaves on 3-week-old 506
plants were photographed. 507
508
Blue light-induced stomatal opening 509
Blue light-dependent stomatal apertures were measured according to an earlier study (Inoue et al., 510
2008a). Fully expanded rosette leaves were harvested from dark-adapted 4-week-old plants. 511
Epidermal tissue fragments were isolated from the leaves and suspended in a basal reaction 512
mixture consisting of 5 mM 2-morpholinoethanesulfonic acid-bis-tris-propane (pH 6.5) (Wako Pure 513
Chemical Industries Ltd., Osaka, Japan), 50 mM KCl, and 0.1 mM CaCl2 under dim red light. The 514
epidermal fragments were either kept in the dark or irradiated with red light (RL; 50 µmol m-2
s-1
) 515
with or without BL (10 µmol m-2
s-1
) for 3 h. Stomatal images were obtained with a microscope 516
(TS100; Nikon, Tokyo, Japan). Stomatal apertures were measured with ImageJ. 517
518
Chloroplast photorelocation movement 519
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
24
To determine chloroplast intracellular localization, 3-week-old plants were irradiated with either 520
weak (3 µmol m-2
s-1
) or strong (50 µmol m-2
s-1
) blue light (BL) for 3 h to induce chloroplast 521
accumulation and avoidance responses, respectively. The leaves were fixed with 2.5% (v/v) 522
glutaraldehyde (Wako Pure Chemical Industries Ltd., Osaka, Japan). Cross-sections were 523
prepared with a vibrating microtome (VT1200 S; Leica Microsystems, Wetzlar, Germany). 524
Chloroplast distribution patterns were visualized with a laser scanning confocal microscope (FV10i; 525
Olympus, Tokyo, Japan). Projection images were constructed using z-stacks (FV10i; Olympus, 526
Tokyo, Japan). 527
Leaf transmittance was measured using a microplate reader Multiskan GO (Thermo Fisher, 528
Waltham, MA, USA) according to a previous report (Wada and Kong, 2011). The detached third 529
leaves from 3-week-old plants were placed on the solidified 1% (w/v) gellan gum in the 96-well 530
plastic plate and kept in the dark for more than 3 h. Then, samples were irradiated with BL at 1, 3, 5, 531
20, 50, 100, or 300 µmol m-2
s-1
. 532
533
Statistical analysis 534
Data were processed in Excel v. 2011 (Microsoft Corporation, Redmond, WA, USA) with the add-in 535
Statcel v. 3 (Yanai 2011). Comparisons between group means were performed with Student’s 536
t-test. Comparisons among three or more group means were made by one-way ANOVA followed 537
by the Tukey-Kramer multiple comparisons post hoc test. 538
539
ACCESSION NUMBERS 540
OEP7 (AT3G52420), PHOT2 (AT5G58140), PHOT1 (AT3G45780) 541
542
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
25
SUPPLEMENTAL DATA 543
The following supplemental materials are available. 544
Supplemental Figure S1. Detailed observation of the localization of phot2-GFP in the leaf 545
mesophyll cells. 546
547
Supplemental Figure S2. The localization of phot2-GFP on the chloroplast surface in the 548
mesophyll cells. 549
550
Supplemental Figure S3. Detailed observation of the localization of phot2-GFP in the leaf 551
epidermal tissues. 552
553
Supplemental Figure S4. The localization of phot2-GFP in the cotyledon palisade cells of 554
etiolated seedlings. 555
556
Supplemental Figure 5. Chloroplast avoidance response in the wild type (WT), phot1, and 557
phot1phot2 plants. 558
559
Acknowledgments 560
The authors thank Ryota Kiyabu, Jaewook Kim, and Bungo Shirouchi of Kyushu University, Japan 561
for their valuable discussions. The authors also thank Tomoyo Kusumoto, Yumi Ichikawa, Rika 562
Kunihiro of Kyushu University, Japan for their technical assistance. We thank the Center for 563
Advanced Instrumental and Educational Support of the Faculty of Agriculture, Kyushu University, 564
Japan for confocal microscopy. This work was supported in part by Grants-in-Aid for Scientific 565
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
26
Research (Nos. JP15K18713, JP18K14491, and JP19H04729 to E.G.; Nos. JP15KK0254 and 566
JP19K06721 to N.S.) from the Japan Society for the Promotion of Science. This work was also 567
funded by a Grant-in-Aid for a JSPS Research Fellow (No. JP17J06717 to T.H.) and research 568
grants from the Young Investigators of Kyushu University (to E.G.), the Ichimura Fundation for New 569
Technology (to E.G.), and the Ohsumi Frontier Science Foundation (to M.W.). 570
571
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
27
Figure Legends 572
573
Fig. 1. Targeted localization of phot2-GFP in the transgenic lines. (A) Outline of phot2-GFP 574
constructs. Protein structures of wild-type (phot2-GFP), plasma membrane-anchored 575
(PM-phot2-GFP), and chloroplast outer envelope-anchored phot2-GFP (CP-phot2-GFP) are 576
indicated. The yellow box in PM-phot2-GFP is a signal sequence for plasma membrane targeting. 577
The myristoylated glycine residue is colored red. The yellow box in CP-phot2-GFP is a 578
chloroplast-targeting sequence from Arabidopsis OUTER ENVELOPE MEMBRANE PROTEIN 7 579
(OEP7). A transmembrane region (underlined) and the C-terminal positively-charged region (italic) 580
are indicated. Scale bar = 100 amino acids (aa). (B) Western blot of phot2-GFP proteins using 581
anti-PHOT2 antibody. Wild type (WT) and phot1phot2 (p1p2) plants were positive and negative 582
controls, respectively. Twenty micrograms of total protein were extracted from 3-week-old plants. 583
Black and white arrowheads indicate phot2-GFP and endogenous phot2, respectively. Glycerate 584
kinase (GLYK) was the loading control. Molecular weight (kDa) is indicated at the left side. (C) 585
Subcellular localizations of phot2-GFP in leaf mesophyll cells of 3-week-old P2G, PM-P2G, and 586
CP-P2G plants. Green fluorescent protein (GFP) fluorescence (left panel), chlorophyll 587
auto-fluorescence (Chl; middle panel), and merged images of GFP and Chl (right panel) are 588
indicated. Arrows and arrowheads indicate the localizations of phot2-GFP on the plasma 589
membrane and the chloroplast outer envelope, respectively. Scale bar = 0.5 µm. (D) Immunoblot 590
analysis of cell fraction in transgenic plants. Protoplasts were prepared from fully expanding rosette 591
leaves of 3-week-old P2G (P2), PM-P2G (PM) and CP-P2G (CP) plants. Protoplast fractions were 592
ruptured physically, and further separated into plasma membrane and chloroplast envelope 593
fractions. Total proteins were obtained from all fractions. The loading volume in the protoplast 594
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
28
fraction and chloroplast envelope fraction or in the plasma membrane were determined based on 595
the protein accumulation level of Toc159 (86 kDa fragments) or AHA, respectively. 596
597
Fig. 2. Blue light-induced autophosphorylation of phot2-GFP proteins in P2G, PM-P2G, and 598
CP-P2G plants. Blue light-induced autophosphorylation of phot2-GFP proteins. Twenty 599
micrograms of total protein were extracted from dark-adapted (D) or blue light-irradiated (BL: 100 600
µmol m-2
s-1
for 1 min) plants for western blot. Black and white arrowheads indicate 601
blue-light-dependent autophosphorylated and dark-adapted phot2-GFP (right) or endogenous 602
phot2 (left), respectively. p1p2 indicates the phot1phot2 double mutant. Glycerate kinase (GLYK) 603
was the loading control. Molecular weight (kDa) is indicated at the left side. 604
605
Fig. 3. Plant growth and leaf flattening in P2G, PM-P2G, and CP-P2G plants. (A) Localization 606
of phot2 on the leaf epidermal tissue of transgenic plants. Fluorescence of green fluorescence 607
protein (GFP) and chlorophyll autofluorescence (Chl) are shown in green and red, respectively. In 608
Arabidopsis, immature epidermal cell plastids are referred to as chloroplasts as they are detectable 609
by chlorophyll autofluorescence (Higa et al., 2014; Barton et al., 2016). Merged images were 610
produced by stacking each image. Scale bar = 10 µm. Arrows indicate dot-like phot2-GFP proteins 611
not associated with chloroplasts in the CP-P2G lines. (B, C) Images of whole plants (B) and 612
detached leaves (C). Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic plants were 613
grown under continuous white light at 100 µmol m-2
s-1
for 3 weeks. Scale bar = 2 cm. (C) Leaf 614
flattening. Images of whole leaves (upper panels) and leaf cross-sections (lower panels) from 615
3-week-old plants grown under continuous white light at 120 µmol m-2
s-1
are shown. Scale bar = 1 616
cm. (D) Plant biomass production. Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic 617
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
29
plants were grown for 3 weeks under continuous white light at 100 µmol m-2
s-1
. Images are 618
representative samples. Data are means ± SD (n = 30). Different letters indicate significant 619
differences (Tukey’s test; P < 0.01). 620
621
Fig. 4. Blue light-induced phototropism in transgenic plants. (A) Localization of phot2 in the 622
hypocotyl epidermal cells of transgenic plants. Fluorescence of green fluorescence protein (GFP) 623
and chlorophyll (Chl) are shown in green and red, respectively. Merged images were produced by 624
stacking each image. Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts 625
in the CP-P2G lines. Scale bar = 10 µm. (B) Phototropism. Etiolated seedlings were irradiated with 626
unilateral blue light at 10 µmol m-2
s-1
for 12 h. Images below the graph are representative samples. 627
Data are means ± SE (n = 90). Different letters indicate significant differences (Tukey’s test; P < 628
0.01). 629
630
Fig. 5. Blue light-induced stomatal opening in the P2G, PM-P2G, and CP-P2G plants. (A) 631
Intracellular localization of phot2 in guard cells. Fluorescence of green fluorescence protein (GFP), 632
chlorophyll (Chl), and propidium iodide (PI) are shown in green, red, and white, respectively. 633
Merged images were produced by stacking each image. Insets are the enlarged images that show 634
the localization of phot2-GFP around the chloroplast in the P2G line (arrowheads). Arrows indicate 635
dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G line. Scale bar = 10 636
µm. (B) Blue light-induced stomatal opening in transgenic plants. Epidermal peels were irradiated 637
with red light (60 µmol m-2
s-1
) (RL) or red light (50 µmol m-2
s-1
) plus blue light (10 µmol m-2
s-1
) (RL 638
+ BL). Thirty stomata were measured per experiment. Measurements were repeated ≥ 3×. Data are 639
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
30
means of three independent experiments ± SE (n = 90). Asterisks indicate significant differences 640
between two groups (Student’s t-test; P < 0.001). 641
642
Fig. 6. Analysis of blue light-induced chloroplast avoidance movements with partial 643
irradiation. (A) Distribution of chloroplasts in the leaf palisade mesophyll cells in the transgenic 644
plants. Three-week-old plants were dark-adapted for one day (Dark) or irradiated with blue light at 645
3.0 (weak) or 50 (strong) µmol m-2
s-1
for 3 h. Images of the upper cell surface (surface) and cross 646
sections (cross) are shown. Scale bar = 20 µm. (B) The chloroplast avoidance response in the leaf 647
palisade mesophyll cells was induced by partial irradiation with a blue laser beam. Upper and lower 648
panels indicate chloroplast autofluorescence in the same view before and after partial irradiation 649
(about 3 min for the P2G and PM-P2G lines and about 8 min for the CP-P2G line), respectively. 650
Irradiated areas are indicated by white lines. (C) Tracking of chloroplast avoidance movement. 651
Image is the same as those in the upper panels of (B). Yellow and green lines indicate the center of 652
the path of chloroplast avoidance of blue light. (D and E) Chloroplast migration distance (D) and 653
chloroplast avoidance movement velocity (E) in WT, phot1, phot1phot2, P2G, PM-P2G, and 654
CP-P2G plants. Chloroplast avoidance response was induced by a strong microbeam. Data are 655
means ± SD (n = 8). Different letters indicate significant differences (Tukey-Kramer test; P < 0.01). 656
657
Fig. 7. Analysis of blue light-induced chloroplast movements through measurement of 658
changes in leaf transmittance. Blue light-induced chloroplast movements in WT, phot1, 659
phot1phot2, P2G, PM-P2G, and CP-P2G plants were tracked by measuring light-induced changes 660
in leaf transmittance. Detached leaves were dark-adapted for more than 3 h before the 661
measurement. After measurements of leaf transmittance in darkness for 30 min, the leaves were 662
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
31
irradiated with blue light at 1 (A), 3 (B), 5 (C), 20 (D), 50 (E), 100 (F), or 300 (G) µmol m-2
s-1
for 80 663
min from the timepoint indicated with a white arrow. WT and phot1 plants were used as a control. At 664
least 8 leaves were used per experiment and the experiments were repeated three times. Data are 665
means ± SE (n = 3) of biological triplicates. 666
667
Fig. 8. P2G, PM-P2G, and CP-P2G phenotypes. (A) Left schematics show localizations of 668
phot2-GFP in P2G, PM-P2G, and CP-P2G plants. Phot2-GFP was localized on the plasma 669
membrane (PM) and the outer envelopes of the chloroplasts (CP) indicated in red. Phot2-GFP was 670
localized on the plasma membrane in the PM-P2G lines and the chloroplast outer membrane in the 671
CP-P2G lines. Right panel shows phenotypic characterization for P2G, PM-P2G, and CP-P2G 672
plants. ++, wild-type responses; +, weak responses in the CP-P2G lines; -, no response (such as in 673
the phot1phot2 mutant). (B) Chloroplast avoidance response mediated by phot2 at the interface 674
between the chloroplasts and the plasma membrane is indicated by a brace bracket. Phot2 (and 675
phot1) on the plasma membrane regulate the chloroplast accumulation response. 676
677
References 678
Aihara, Y., Tabata, R., Suzuki, T., Shimazaki, K. and Nagatani, A. (2008) Molecular basis of the 679
functional specificities of phototropin 1 and 2. Plant J 56: 364-375. 680
Barton, K. A., Schattat, M. H., Jakob, T., Hause, G., Wilhelm, C., Mckenna, J. F., Máthé, C., 681
Runions, J., Van Damme, D. and Mathur, J. (2016) Epidermal pavement cells of Arabidopsis 682
have chloroplasts. Plant Physiol 171: 723-726 683
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
32
Boex-Fontvieille, E., Jossier, M., Davanture, M., Zivy, M., Hodges, M. and Tcherkez, G. (2014) 684
Differential protein phosphorylation regulates chloroplast movement in response to strong light 685
and darkness in Arabidopsis thaliana. Plant Mol Biol Rep 32: 987-1001 686
Christie, J.M. (2007) Phototropin blue-light receptors. Annu Rev Plant Biol 58: 21-45 687
Christie, J. M., Reymond, P., Powell, G. K., Bernasconi, P., Raibekas, A. A., Liscum, E. and Briggs, 688
W. R. (1998) Arabidopsis NPH1: A flavoprotein with the properties of a photoreceptor for 689
phototropism. Science 282:1698-1701. 690
Christie, J. M., Yang, H., Richter, G. L., Sullivan, S., Thomson, C.E., Lin, J., Titapiwatanakun, B., 691
Ennis, M., Kaiserli, E., Lee, O. R., Adamec, J., Peer, W. A. and Murphy, A. S. (2011) phot1 692
inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required for phototropism. 693
PLoS Biol 9: e1001076 694
Clough S. J. and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium-mediated 695
transformation of Arabidopsis thaliana. Plant J 16: 735-743 696
de Carbonnel, M., Davis, P., Roelfsema, M. R., Inoue, S., Schepens, I., Lariguet, P., Geisler, M., 697
Shimazaki, K., Hangarter, R. and Fankhauser, C. (2010) The 698
Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling 699
element that regulates leaf flattening and leaf positioning. Plant Physiol 152: 1391-1405 700
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
33
Demarsy, E., Schepens, I., Okajima, K., Hersch, M., Bergmann, S., Christie, J. M., Shimazaki, K., 701
Tokutomi, S. and Fankhauser, C. (2012) Phytochrome Kinase Substrate 4 is phosphorylated 702
by the phototropin 1 photoreceptor. EMBO J 31: 3457-3467 703
Franklin, K.A. and Quail, P.H. (2010) Phytochrome functions in Arabidopsis development. J Exp 704
Bot 61: 11-24 705
Folta, K.M. and Kaufman, L.S. (2003) Phototropin 1 is required for high-fluence blue-light-mediated 706
mRNA destabilization. Plant Mol Biol 51: 609-618 707
Folta, K.M. and Spalding, E.P. (2001) Unexpected roles for cryptochrome 2 and phototropin 708
revealed by high-resolution analysis of blue light-mediated hypocotyl growth inhibition. Plant J 709
26: 471-478 710
Gotoh, E., Suetsugu, N., Yamori, W., Ishishita, K., Kiyabu, R., Fukuda, M., Higa, T., Shirouchi, B. 711
and Wada, M. (2018) Chloroplast accumulation response enhances leaf photosynthesis and 712
plant biomass production. Plant Physiol 178: 1358-1369 713
Han, I. S., Tseng, T. S., Eisinger, W. and Briggs, W. R. (2008) Phytochrome A regulates the 714
intracellular distribution of phototropin 1-green fluorescent protein in Arabidopsis thaliana. 715
Plant Cell 20: 2835-2847 716
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
34
Hayashi, M., Inoue, S., Ueno, Y. and Kinoshita, T. (2017) A Raf-like protein kinase BHP mediates 717
blue light-dependent stomatal opening. Sci Rep 7: 45586 718
Hayashi, Y., Nakamura, S., Takemiya, A., Takahashi, Y., Shimazaki, K. and Kinoshita, T. (2010) 719
Biochemical characterization of in vitro phosphorylation and dephosphorylation of the plasma 720
membrane H+-ATPase. Plant Cell Physiol 51: 1186-1196 721
Higa, T., Hasegawa, S., Hayasaki, Y., Kodama, Y. and Wada, M. (2017) Temperature-dependent 722
signal transmission in chloroplast accumulation response. J Plant Research 130: 779-789 723
Higa, T., Suetsugu, N., Kong, SG. and Wada, M. (2014) Actin-dependent plastid movement is 724
required for motive force generation in directional nuclear movement in plants. Proc Natl Acad 725
Sci USA 111: 4327-4331 726
Hiyama, A., Takemiya, A., Munemasa, S., Okuma, E., Sugiyama, N., Tada, Y., Murata, T. and 727
Shimazaki, K. (2017) Blue light and CO2 signals converge to regulate light-induced stomatal 728
opening. Nat Commun 8: 1284 729
Huala, E., Oeller, P. W., Liscum, E., Han, I. S., Larsen, E. and Briggs, W. R. (1997) Arabidopsis 730
NPH1: A protein kinase with a putative redox-sensing domain. Science 278:2120-2123. 731
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
35
Inada, S., Ohgishi, M., Mayama, T., Okada, K. and Sakai, T. (2004) RPT2 is a signal transducer 732
involved in phototropic response and stomatal opening by association with phototropin 1 in 733
Arabidopsis thaliana. Plant Cell 16: 887-896 734
Inoue, S., Kinoshita, T., Matsumoto, M., Nakayama, K., Doi, M. and Shimazaki, K. (2008a) Blue 735
light-induced autophosphorylation of phototropin is a primary step for signaling. Proc Natl 736
Acad Sci USA 105: 5626-5631 737
Inoue, S., Kinoshita, T., Takemiya, A., Doi, M. and Shimazaki, K. (2008b) Leaf Positioning 738
of Arabidopsis in Response to Blue Light. Mol Plant 1: 15-26 739
Inoue, S., Matsushita, T., Tomokiyo, Y., Matsumoto, M., Nakayama, K., Kinoshita, T. and 740
Shimazaki, K. (2011) Functional analyses of the activation loop of phototropin 2 in 741
Arabidopsis. Plant Physiol 156: 117-128 742
Ishishita, K., Suetsugu, N., Hirose, Y., Higa, T., Doi, M., Wada, M., Matsushita, T. and Gotoh, E. 743
(2016) Functional characterization of blue-light-induced responses and PHOTOTROPIN 1 744
gene in Welwitschia mirabilis. J Plant Res 129: 175-187 745
Iwabuchi, K., Sakai, T. and Takagi, S. (2007) Blue light-dependent nuclear positioning in 746
Arabidopsis thaliana leaf cells. Plant Cell Physiol 48: 1291-1298 747
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
36
Jenkins, G. I. (2017) Photomorphogenic responses to ultraviolet-B light. Plant Cell Environ 40: 748
2544-2557 749
Kadota, A., Yamada, N., Suetsugu, N., Hirose, M., Saito, C., Shoda, K., Ichikawa, S., Kagawa, T., 750
Nakano, A. and Wada, M. (2009) Short actin-based mechanism for light-directed chloroplast 751
movement in Arabidopsis. Proc Natl Acad Sci USA 106: 13106–13111. 752
Kagawa, T., Sakai, T., Suetsugu, N., Oikawa, K., Ishiguro, S., Kato, T., Tabata, S., Okada, K. and 753
Wada, M. (2001) Arabidopsis NPL1: A phototropin homolog controlling the chloroplast 754
high-light avoidance response. Science 291:2138-2141 755
Kagawa, T. and Wada, M. (1999) Chloroplast-avoidance response induced by high-fluence blue 756
light in prothallial cells of the fern Adiantum capillus-veneris as analyzed by microbeam 757
irradiation. Plant Physiol 119:917-923 758
Kami, C., Lorrain, S., Hornitschek, P. and Fankhauser, C. (2010) Light-regulated plant growth and 759
development. Curr Top Dev Biol 91: 29-66 760
Kasahara, M., Kagawa, T., Oikawa, K., Suetsugu, N., Miyao, M and Wada, M. (2002) Chloroplast 761
avoidance movement reduces photodamage in plants. Nature 420: 829-832 762
Kikuchi, S., Hirohashi, T. and Nakai, M. (2006) Characterization of the preprotein translocon at the 763
outer envelope nembrane of chloroplasts by blue native PAGE. Plant Cell Physiol 47: 363-371 764
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
37
Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M. and Shimazaki, K. (2001) phot1 and 765
phot2 mediate blue light regulation of stomatal opening. Nature 414: 656-660 766
Knieb, E., Salomon, M. and Rüdiger, W. (2004) Tissue-specific and subcellular localization of 767
phototropin determined by immuno-blotting. Planta 218: 843-851 768
Kodama, Y. (2016) Time gating of chloroplast autofluorescence allows clearer fluorescence 769
imaging in Planta. PLoS One 11: e0152484. 770
Komatsu, A., Terai, M., Ishizaki, K., Suetsugu, N., Tsuboi, H., Nishihama, R., Yamato, K. T., Wada, 771
M. and Kohchi, T. (2014) Phototropin encoded by a single-copy gene mediates chloroplast 772
photorelocation movements in the liverwort Marchantia polymorpha. Plant Physiol 166: 773
411-427. 774
Kong, S. -G., Arai, Y., Suetsugu, N., Yanagida, M. and Wada, M. (2013a) Rapid severing and 775
motility of chloroplast-actin filaments are required for the chloroplast avoidance response in 776
Arabidopsis. Plant Cell 25: 572-590 777
Kong, S. -G., Kagawa, T., Wada, M. and Nagatani, A. (2013b) A C-terminal membrane association 778
domain of phototropin 2 is necessary for chloroplast movement. Plant Cell Physiol 54: 57-68 779
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
38
Kong, S. -G., Suetsugu, N., Kikuchi, S., Nakai, M., Nagatani, A. and Wada, M. (2013c) Both 780
phototropin 1 and 2 localize on the chloroplast outer membrane with distinct localization 781
activity. Plant Cell Physiol 54: 80-92 782
Kong, S. -G., Suzuki, T., Tamura, K., Mochizuki, N., Hara-Nishimura, I. and Nagatani, A. (2006) 783
Blue light-induced association of phototropin 2 with the Golgi apparatus. Plant J 45: 994-1005. 784
Kozuka, T., Kong, S. -G., Doi, M., Shimazaki, K. and Nagatani, A. (2011) Tissue-autonomous 785
promotion of palisade cell development by phototropin 2 in Arabidopsis. Plant Cell 786
23:3684-3695 787
Lariguet P, Schepens I, Hodgson D, Pedmale UV, Trevisan M, Kami C, de Carbonnel M, Alonso 788
JM, Ecker JR, Liscum E, Fankhauser C. (2006) PHYTOCHROME KINASE SUBSTRATE 1 is 789
a phototropin 1 binding protein required for phototropism. Proc Natl Acad Sci USA 103: 790
10134-10139 791
Larsson, C., Sommarin, M. and Widell, S. (1994) Isolation of highly purified plant plasma 792
membranes and separation of inside-out and right-side-out vesicles. Methods Enzymol 228: 793
451-469. 794
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
39
Lee, Y. J., Kim, D.H., Kim, Y. W. and Hwang, I. (2001) Identification of a signal that distinguishes 795
between the chloroplast outer envelope membrane and the endomembrane system in vivo. 796
Plant Cell 13: 2175-2190 797
Liang, T., Yang, Y. and Liu, H. (2019) Signal transduction mediated by the plant UV-B 798
photoreceptor UVR8. J Plant Res 221: 1247-1252 799
Liu, B., Yang, Z., Gomez, A., Liu, B., Lin, C. and Oka, Y. (2016) Signaling mechanisms of plant 800
cryptochromes in Arabidopsis thaliana. J Plant Res 129: 137-148 801
Luesse, D. R., DeBlasio, S. L. and Hangarter, R. P. (2010) Integration of phot1, phot2, and PhyB 802
signalling in light-induced chloroplast movements. J Exp Bot 61: 4387-4397 803
Marten, H., Hedrich, R. and Roelfsema, M. R. (2007) Blue light inhibits guard cell plasma 804
membrane anion channels in a phototropin-dependent manner. Plant J 50: 29-39 805
Motochoulski, A. and Liscum, E. (1999) Arabidopsis NPH3: A NPH1 photoreceptor-interacting 806
protein essential for phototropism. Science 286: 961-964 807
Oikawa, K., Kasahara, M., Kiyosue, T., Kagawa, T., Suetsugu, N., Takahashi, F., Kanegae, T., 808
Niwa, Y., Kadota, A. and Wada, M. (2003) CHLOROPLAST UNUSUAL POSITIONING is 809
essential for proper chloroplast positioning. Plant Cell 15: 2805-2815 810
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
40
Oikawa, K., Yamasato, A., Kong, S. G., Kasahara, M., Nakai, M., Takahashi, F., Ohura, Y., 811
Kagawa, T. and Wada, M. (2008) Chloroplast outer envelope protein CHUP1 is essential for 812
chloroplast anchorage to the plasma membrane and chloroplast movement. Plant Physiol 148: 813
829-842 814
Paik, I. and Huq, E (2019) Plant photoreceptors: Multi-functional sensory proteins and their 815
signaling networks. Semin Cell Dev Biol 92: 114-121 816
Pham, V. N., Kathare, P. K. and Huq, E. (2018) Phytochromes and phytochrome interacting factors. 817
Plant Physiol 176: 1025-1038 818
Preuten, T., Blackwood, L., Christie, J. M. and Fankhauser, C. (2015) Lipid anchoring of 819
Arabidopsis phototropin 1 to assess the functional significance of receptor internalization: 820
should I stay or should I go? New Phytol 206: 1038-1050 821
Sakai, T., Kagawa, T., Kasahara, M., Swartz, T.E., Christie, J.M., Briggs, W.R., Wada, M., and 822
Okada, K. (2001) Arabidopsis nph1 and npl1: blue light receptors that mediate both 823
phototropism and chloroplast relocation. Proc Natl Acad Sci USA 98: 6969–6974. 824
Sakai, T., Wada, T., Ishiguro, S. and Okada, K. (2000) RPT2: A signal transducer of the phototropic 825
response in Arabidopsis. Plant Cell 12: 225-236 826
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
41
Sakamoto, K. and Briggs, W. R. (2002) Cellular and subcellular localization of phototropin 1. Plant 827
Cell 14: 1723-1735 828
Suetsugu, N., Kagawa, T. and Wada, M. (2005) An auxilin-like J-domain protein, JAC1, regulates 829
phototropin-mediated chloroplast movement in Arabidopsis. Plant Physiol 139: 151-162 830
Suetsugu, N., Takemiya, A., Kong, S. -G., Higa, T., Komatsu, A., Shimazaki, K., Kohchi, T. and 831
Wada, M. (2016) RPT2/NCH1 subfamily of NPH3-like proteins is essential for 832
the chloroplast accumulation response in land plants. Proc Natl Acad Sci USA 113: 833
10424-10429 834
Suetsugu, N. Kong, S. -G., Kasahara, M. and Wada, M. (2013) Both LOV1 and LOV2 domains of 835
phototropin2 function as the photosensory domain for hypocotyl phototopic responses in 836
Arabidopsis thaliana (Brassicaceae). Am J Bot 100: 60-69 837
Suetsugu, N. and Wada, M. (2013) Evolution of three LOV blue light receptor families in green 838
plants and photosynthetic stramenopiles: phototropin, ZTL/FKF1/LKP2 and aureochrome. 839
Plant Cell Physiol 54: 8-23 840
Suetsugu, N., Yamada, N., Kagawa, T., Yonekura, H., Uyeda, T. Q., Kadota, A. and Wada, M. 841
(2010) Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis 842
thaliana. Proc Natl Acad Sci USA 107: 8860-8865 843
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
42
Sztatelman, 0., Łabuz, J., Hermanowicz, P., Banaś, A. K., Bażant, A., Zgłobicki, P, Aggarwal, C., 844
Nadzieja, M., Krzeszowiec, W., Strzałka, W. and Gabryś, H. (2016) Fine tuning chloroplast 845
movements through physical interactions between phototropins. J Exp Bot 67: 4963-4978 846
Takemiya, A., Inoue, S., Doi, M., Kinoshita, T. and Shimazaki, K. (2005) Phototropins promote 847
plant growth in response to blue light in low light environments. Plant Cell 17: 1120-1127 848
Takemiya, A., Kinoshita, T., Asanuma, M. and Shimazaki, K. (2006) Protein phosphatase 1 849
positively regulates stomatal opening in response to blue light in Vicia faba. Proc Natl Acad 850
Sci USA 103: 13549-13554 851
Takemiya, A., Sugiyama, N., Fujimoto, H., Tsutsumi, T., Yamauchi, S., Hiyama, A., Tada, Y., 852
Christie, J. M. and Shimazaki, K. (2013a) Phosphorylation of BLUS1 kinase by phototropins is 853
a primary step in stomatal opening. Nat Commun 4: 2094 854
Takemiya, A., Yamauchi, S., Yano, T., Ariyoshi, C. and Shimazaki, K.(2013b) Identification of a 855
regulatory subunit of protein phosphatase 1 which mediates blue light signaling for stomatal 856
opening. Plant Cell Physiol 54: 24-35 857
Tsuboi, H. and Wada, M. (2010) Speed of signal transfer in the chloroplast accumulation 858
response. J Plant Res 123: 381-390 859
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
43
Tsuboi, H. and Wada, M. (2011) Chloroplasts can move away in any direction to avoid strong light. 860
J Plant Res 124: 201-210 861
Ushijima, T., Hanada, K., Gotoh, E., Yamori, W., Kodama, Y., Tanaka, H., Kusano, M., Fukushima, 862
A., Tokizawa, M., Yamamoto, Y. Y., Tada, Y., Suzuki, Y. and Matsushita, M. (2017) Light 863
control protein localization through phytochrome-mediated alternative promoter selection. 864
Cell 171: 1316-1325 865
Wada, M. and Kong, S. -G. (2011) Analysis of chloroplast movement and relocation in 866
Arabidopsis. Methods Mol Biol 774: 215-234 867
Wan, Y.L., Eisinger, W., Ehrhardt, D., Kubitschek, U., Baluska, F. and Briggs, W. R. (2008) The 868
subcellular localization and blue-light induced movement of phototropin 1-GFP in etiolated 869
seedlings of Arabidopsis thaliana. Mol Plant 1:103-117 870
Wang, P., Zhang, J., Su, J., Wang, P., Liu, J., Liu, B., Feng, D., Wang, J. and Wang, H. (2013) The 871
chloroplast Min system functions differentially in two specific nongreen plastids in Arabidopsis 872
thaliana. Plos ONE 8: e71190 873
Wu, F. H., Shen, S. C., Lee, L. Y. and Lee, S. H. (2009) Tape-Arabidopsis Sandwich - a simpler 874
Arabidopsis protoplast isolation method. Nature Methods 5:16 875
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
44
Yanai, H. Statcel 3 – The useful add-in software forms on Excel (3rd ed). OMS, Tokyo, Japan. 876
(2011). 877
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 1. Targeted localization of phot2-GFP in the transgenic lines. (A) Outline of phot2-GFP constructs. Protein structures of wild-type (phot2-GFP), plasma membrane-anchored (PM-phot2-GFP), and chloroplast outer envelope-anchored phot2-GFP (CP-phot2-GFP) are indicated. The yellow box in PM-phot2-GFP is a signal sequence for plasma membrane targeting. The myristoylated glycine residue is colored red. The yellow box in CP-phot2-GFP is a chloroplast-targeting sequence from Arabidopsis OUTER ENVELOPE MEMBRANE PROTEIN 7 (OEP7). A transmembrane region (underlined) and the C-terminal positively-charged region (italic) are indicated. Scale bar = 100 amino acids (aa). (B) Western blot of phot2-GFP proteins using anti-PHOT2 antibody. Wild type (WT) and phot1phot2 (p1p2) plants were positive and negative controls, respectively. Twenty micrograms of total protein were extracted from 3-week-old plants. Black and white arrowheads indicate phot2-GFP and endogenous phot2, respectively. Glycerate kinase (GLYK) was the loading control. Molecular weight (kDa) is indicated at the left side. (C) Subcellular localizations of phot2-GFP in leaf mesophyll cells of 3-week-old P2G, PM-P2G, and CP-P2G plants. Green fluorescent protein (GFP) fluorescence (left panel), chlorophyll auto-fluorescence (Chl; middle panel), and merged images of GFP and Chl (right panel) are indicated. Arrows and arrowheads indicate the localizations of phot2-GFP on the plasma membrane and the chloroplast outer envelope, respectively. Scale bar = 0.5 µm. (D) Immunoblot analysis of cell fraction in transgenic plants. Protoplasts were prepared from fully expanding rosette leaves of 3-week-old P2G (P2), PM-P2G (PM) and CP-P2G (CP) plants. Protoplast fractions were ruptured physically, and further separated into plasma membrane and chloroplast envelope fractions. Total proteins were obtained from all fractions. The loading volume in the protoplast fraction and chloroplast envelope fraction or in the plasma membrane were determined based on the protein accumulation level of Toc159 (86 kDa fragments) or AHA, respectively.
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 2. Blue light-induced autophosphorylation of phot2-GFP proteins in P2G, PM-P2G, and CP-P2G plants. Blue light-induced autophosphorylation of phot2-GFP proteins. Twenty micrograms of total protein were extracted from dark-adapted (D) or blue light-irradiated (BL: 100 µmol m-2 s-1 for 1 min) plants for western blot. Black and white arrowheads indicate blue-light-dependent autophosphorylated and dark-adapted phot2-GFP (right) or endogenous phot2 (left), respectively. p1p2 indicates the phot1phot2 double mutant. Glycerate kinase (GLYK) was the loading control. Molecular weight (kDa) is indicated at the left side.
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 3. Plant growth and leaf flattening in P2G, PM-P2G, and CP-P2G plants. (A) Localization of phot2 on the leaf epidermal tissue of transgenic plants. Fluorescence of green fluorescence protein (GFP) and chlorophyll autofluorescence (Chl) are shown in green and red, respectively. In Arabidopsis, immature epidermal cell plastids are referred to as chloroplasts as they are detectable by chlorophyll autofluorescence (Higa et al., 2014; Barton et al., 2016). Merged images were produced by stacking each image. Scale bar = 10 µm. Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G lines. (B, C) Images of whole plants (B) and detached leaves (C). Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic plants were grown under continuous white light at 100 µmol m-2 s-1 for 3 weeks. Scale bar = 2 cm. (C) Leaf flattening. Images of whole leaves (upper panels) and leaf cross-sections (lower panels) from 3-week-old plants grown under continuous white light at 120 µmol m-2 s-1 are shown. Scale bar = 1 cm. (D) Plant biomass production. Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic plants were grown for 3 weeks under continuous white light at 100 µmol m-2 s-1. Images are representative samples. Data are means ± SD (n = 30). Different letters indicate significant differences (Tukey’s test; P < 0.01).
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 4. Blue light-induced phototropism in transgenic plants. (A) Localization of phot2 in the hypocotyl epidermal cells of transgenic plants. Fluorescence of green fluorescence protein (GFP) and chlorophyll (Chl) are shown in green and red, respectively. Merged images were produced by stacking each image. Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G lines. Scale bar = 10 µm. (B) Phototropism. Etiolated seedlings were irradiated with unilateral blue light at 10 µmol m-2 s-1 for 12 h. Images below the graph are representative samples. Data are means ± SE (n = 90). Different letters indicate significant differences (Tukey’s test; P < 0.01).
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 5. Blue light-induced stomatal opening in the P2G, PM-P2G, and CP-P2G plants. (A) Intracellular localization of phot2 in guard cells. Fluorescence of green fluorescence protein (GFP), chlorophyll (Chl), and propidium iodide (PI) are shown in green, red, and white, respectively. Merged images were produced by stacking each image. Insets are the enlarged images that show the localization of phot2-GFP around the chloroplast in the P2G line (arrowheads). Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G line. Scale bar = 10 µm. (B) Blue light-induced stomatal opening in transgenic plants. Epidermal peels were irradiated with red light (60 µmol m-2 s-1) (RL) or red light (50 µmol m-2 s-1) plus blue light (10 µmol m-2 s-1) (RL + BL). Thirty stomata were measured per experiment. Measurements were repeated ≥ 3×. Data are means of three independent experiments ± SE (n = 90). Asterisks indicate significant differences between two groups (Student’s t-test; P < 0.001).
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 6. Analysis of blue light-induced chloroplast avoidance movements with partial irradiation. (A) Distribution of chloroplasts in the leaf palisade mesophyll cells in the transgenic plants. Three-week-old plants were dark-adapted for one day (Dark) or irradiated with blue light at 3.0 (weak) or 50 (strong) µmol m-2 s-1 for 3 h. Images of the upper cell surface (surface) and cross sections (cross) are shown. Scale bar = 20 µm. (B) The chloroplast avoidance response in the leaf palisade mesophyll cells was induced by partial irradiation with a blue laser beam. Upper and lower panels indicate chloroplast autofluorescence in the same view before and after partial irradiation (about 3 min for the P2G and PM-P2G lines and about 8 min for the CP-P2G line), respectively. Irradiated areas are indicated by white lines. (C) Tracking of chloroplast avoidance movement. Image is the same as those in the upper panels of (B). Yellow and green lines indicate the center of the path of chloroplast avoidance of blue light. (D and E) Chloroplast migration distance (D) and chloroplast avoidance movement velocity (E) in WT, phot1, phot1phot2, P2G, PM-P2G, and CP-P2G plants. Chloroplast avoidance response was induced by a strong microbeam. Data are means ± SD (n = 8). Different letters indicate significant differences (Tukey-Kramer test; P < 0.01).
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 7. Analysis of blue light-induced chloroplast movements through measurement of changes in leaf transmittance. Blue light-induced chloroplast movements in WT, phot1, phot1phot2, P2G, PM-P2G, and CP-P2G plants were tracked by measuring light-induced changes in leaf transmittance. Detached leaves were dark-adapted for more than 3 h before the measurement. After measurements of leaf transmittance in darkness for 30 min, the leaves were irradiated with blue light at 1 (A), 3 (B), 5 (C), 20 (D), 50 (E), 100 (F), or 300 (G) µmol m-2 s-1 for 80 min from the timepoint indicated with a white arrow. WT and phot1 plants were used as a control. At least 8 leaves were used per experiment and the experiments were repeated three times. Data are means ± SE (n = 3) of biological triplicates.
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fig. 8. P2G, PM-P2G, and CP-P2G phenotypes. (A) Left schematics show localizations of phot2-GFP in P2G, PM-P2G, and CP-P2G plants. Phot2-GFP was localized on the plasma membrane (PM) and the outer envelopes of the chloroplasts (CP) indicated in red. Phot2-GFP was localized on the plasma membrane in the PM-P2G lines and the chloroplast outer membrane in the CP-P2G lines. Right panel shows phenotypic characterization for P2G, PM-P2G, and CP-P2G plants. ++, wild-type responses; +, weak responses in the CP-P2G lines; -, no response (such as in the phot1phot2 mutant). (B) Chloroplast avoidance response mediated by phot2 at the interface between the chloroplasts and the plasma membrane is indicated by a brace bracket. Phot2 (and phot1) on the plasma membrane regulate the chloroplast accumulation response.
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Parsed CitationsAihara, Y., Tabata, R., Suzuki, T., Shimazaki, K. and Nagatani, A. (2008) Molecular basis of the functional specificities of phototropin 1and 2. Plant J 56: 364-375.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Barton, K. A., Schattat, M. H., Jakob, T., Hause, G., Wilhelm, C., Mckenna, J. F., Máthé, C., Runions, J., Van Damme, D. and Mathur, J.(2016) Epidermal pavement cells of Arabidopsis have chloroplasts. Plant Physiol 171: 723-726
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Boex-Fontvieille, E., Jossier, M., Davanture, M., Zivy, M., Hodges, M. and Tcherkez, G. (2014) Differential protein phosphorylationregulates chloroplast movement in response to strong light and darkness in Arabidopsis thaliana. Plant Mol Biol Rep 32: 987-1001
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Christie, J.M. (2007) Phototropin blue-light receptors. Annu Rev Plant Biol 58: 21-45Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Christie, J. M., Reymond, P., Powell, G. K., Bernasconi, P., Raibekas, A. A., Liscum, E. and Briggs, W. R. (1998) Arabidopsis NPH1: Aflavoprotein with the properties of a photoreceptor for phototropism. Science 282:1698-1701.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Christie, J. M., Yang, H., Richter, G. L., Sullivan, S., Thomson, C.E., Lin, J., Titapiwatanakun, B., Ennis, M., Kaiserli, E., Lee, O. R.,Adamec, J., Peer, W. A. and Murphy, A. S. (2011) phot1 inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required forphototropism. PLoS Biol 9: e1001076
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Clough S. J. and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J 16: 735-743
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
de Carbonnel, M., Davis, P., Roelfsema, M. R., Inoue, S., Schepens, I., Lariguet, P., Geisler, M., Shimazaki, K., Hangarter, R. andFankhauser, C. (2010) The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element thatregulates leaf flattening and leaf positioning. Plant Physiol 152: 1391-1405
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Demarsy, E., Schepens, I., Okajima, K., Hersch, M., Bergmann, S., Christie, J. M., Shimazaki, K., Tokutomi, S. and Fankhauser, C. (2012)Phytochrome Kinase Substrate 4 is phosphorylated by the phototropin 1 photoreceptor. EMBO J 31: 3457-3467
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Franklin, K.A. and Quail, P.H. (2010) Phytochrome functions in Arabidopsis development. J Exp Bot 61: 11-24Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Folta, K.M. and Kaufman, L.S. (2003) Phototropin 1 is required for high-fluence blue-light-mediated mRNA destabilization. Plant MolBiol 51: 609-618
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Folta, K.M. and Spalding, E.P. (2001) Unexpected roles for cryptochrome 2 and phototropin revealed by high-resolution analysis ofblue light-mediated hypocotyl growth inhibition. Plant J 26: 471-478
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gotoh, E., Suetsugu, N., Yamori, W., Ishishita, K., Kiyabu, R., Fukuda, M., Higa, T., Shirouchi, B. and Wada, M. (2018) Chloroplastaccumulation response enhances leaf photosynthesis and plant biomass production. Plant Physiol 178: 1358-1369
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Han, I. S., Tseng, T. S., Eisinger, W. and Briggs, W. R. (2008) Phytochrome A regulates the intracellular distribution of phototropin 1-green fluorescent protein in Arabidopsis thaliana. Plant Cell 20: 2835-2847
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hayashi, M., Inoue, S., Ueno, Y. and Kinoshita, T. (2017) A Raf-like protein kinase BHP mediates blue light-dependent stomatal opening.Sci Rep 7: 45586 www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hayashi, Y., Nakamura, S., Takemiya, A., Takahashi, Y., Shimazaki, K. and Kinoshita, T. (2010) Biochemical characterization of in vitrophosphorylation and dephosphorylation of the plasma membrane H+-ATPase. Plant Cell Physiol 51: 1186-1196
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Higa, T., Hasegawa, S., Hayasaki, Y., Kodama, Y. and Wada, M. (2017) Temperature-dependent signal transmission in chloroplastaccumulation response. J Plant Research 130: 779-789
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Higa, T., Suetsugu, N., Kong, SG. and Wada, M. (2014) Actin-dependent plastid movement is required for motive force generation indirectional nuclear movement in plants. Proc Natl Acad Sci USA 111: 4327-4331
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hiyama, A., Takemiya, A., Munemasa, S., Okuma, E., Sugiyama, N., Tada, Y., Murata, T. and Shimazaki, K. (2017) Blue light and CO2signals converge to regulate light-induced stomatal opening. Nat Commun 8: 1284
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Huala, E., Oeller, P. W., Liscum, E., Han, I. S., Larsen, E. and Briggs, W. R. (1997) Arabidopsis NPH1: A protein kinase with a putativeredox-sensing domain. Science 278:2120-2123.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Inada, S., Ohgishi, M., Mayama, T., Okada, K. and Sakai, T. (2004) RPT2 is a signal transducer involved in phototropic response andstomatal opening by association with phototropin 1 in Arabidopsis thaliana. Plant Cell 16: 887-896
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Inoue, S., Kinoshita, T., Matsumoto, M., Nakayama, K., Doi, M. and Shimazaki, K. (2008a) Blue light-induced autophosphorylation ofphototropin is a primary step for signaling. Proc Natl Acad Sci USA 105: 5626-5631
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Inoue, S., Kinoshita, T., Takemiya, A., Doi, M. and Shimazaki, K. (2008b) Leaf Positioning of Arabidopsis in Response to Blue Light. MolPlant 1: 15-26
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Inoue, S., Matsushita, T., Tomokiyo, Y., Matsumoto, M., Nakayama, K., Kinoshita, T. and Shimazaki, K. (2011) Functional analyses of theactivation loop of phototropin 2 in Arabidopsis. Plant Physiol 156: 117-128
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ishishita, K., Suetsugu, N., Hirose, Y., Higa, T., Doi, M., Wada, M., Matsushita, T. and Gotoh, E. (2016) Functional characterization ofblue-light-induced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis. J Plant Res 129: 175-187
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Iwabuchi, K., Sakai, T. and Takagi, S. (2007) Blue light-dependent nuclear positioning in Arabidopsis thaliana leaf cells. Plant CellPhysiol 48: 1291-1298
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jenkins, G. I. (2017) Photomorphogenic responses to ultraviolet-B light. Plant Cell Environ 40: 2544-2557Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kadota, A., Yamada, N., Suetsugu, N., Hirose, M., Saito, C., Shoda, K., Ichikawa, S., Kagawa, T., Nakano, A. and Wada, M. (2009) Shortactin-based mechanism for light-directed chloroplast movement in Arabidopsis. Proc Natl Acad Sci USA 106: 13106–13111.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kagawa, T., Sakai, T., Suetsugu, N., Oikawa, K., Ishiguro, S., Kato, T., Tabata, S., Okada, K. and Wada, M. (2001) Arabidopsis NPL1: Aphototropin homolog controlling the chloroplast high-light avoidance response. Science 291:2138-2141
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kagawa, T. and Wada, M. (1999) Chloroplast-avoidance response induced by high-fluence blue light in prothallial cells of the fernAdiantum capillus-veneris as analyzed by microbeam irradiation. Plant Physiol 119:917-923
Pubmed: Author and Title www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Kami, C., Lorrain, S., Hornitschek, P. and Fankhauser, C. (2010) Light-regulated plant growth and development. Curr Top Dev Biol 91:29-66
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kasahara, M., Kagawa, T., Oikawa, K., Suetsugu, N., Miyao, M and Wada, M. (2002) Chloroplast avoidance movement reducesphotodamage in plants. Nature 420: 829-832
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kikuchi, S., Hirohashi, T. and Nakai, M. (2006) Characterization of the preprotein translocon at the outer envelope nembrane ofchloroplasts by blue native PAGE. Plant Cell Physiol 47: 363-371
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M. and Shimazaki, K. (2001) phot1 and phot2 mediate blue light regulation ofstomatal opening. Nature 414: 656-660
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Knieb, E., Salomon, M. and Rüdiger, W. (2004) Tissue-specific and subcellular localization of phototropin determined by immuno-blotting. Planta 218: 843-851
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kodama, Y. (2016) Time gating of chloroplast autofluorescence allows clearer fluorescence imaging in Planta. PLoS One 11: e0152484.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Komatsu, A., Terai, M., Ishizaki, K., Suetsugu, N., Tsuboi, H., Nishihama, R., Yamato, K. T., Wada, M. and Kohchi, T. (2014) Phototropinencoded by a single-copy gene mediates chloroplast photorelocation movements in the liverwort Marchantia polymorpha. PlantPhysiol 166: 411-427.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kong, S. -G., Arai, Y., Suetsugu, N., Yanagida, M. and Wada, M. (2013a) Rapid severing and motility of chloroplast-actin filaments arerequired for the chloroplast avoidance response in Arabidopsis. Plant Cell 25: 572-590
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kong, S. -G., Kagawa, T., Wada, M. and Nagatani, A. (2013b) A C-terminal membrane association domain of phototropin 2 is necessaryfor chloroplast movement. Plant Cell Physiol 54: 57-68
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kong, S. -G., Suetsugu, N., Kikuchi, S., Nakai, M., Nagatani, A. and Wada, M. (2013c) Both phototropin 1 and 2 localize on thechloroplast outer membrane with distinct localization activity. Plant Cell Physiol 54: 80-92
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kong, S. -G., Suzuki, T., Tamura, K., Mochizuki, N., Hara-Nishimura, I. and Nagatani, A. (2006) Blue light-induced association ofphototropin 2 with the Golgi apparatus. Plant J 45: 994-1005.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kozuka, T., Kong, S. -G., Doi, M., Shimazaki, K. and Nagatani, A. (2011) Tissue-autonomous promotion of palisade cell development byphototropin 2 in Arabidopsis. Plant Cell 23:3684-3695
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lariguet P, Schepens I, Hodgson D, Pedmale UV, Trevisan M, Kami C, de Carbonnel M, Alonso JM, Ecker JR, Liscum E, Fankhauser C.(2006) PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism. Proc Natl Acad Sci USA103: 10134-10139
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Larsson, C., Sommarin, M. and Widell, S. (1994) Isolation of highly purified plant plasma membranes and separation of inside-out andright-side-out vesicles. Methods Enzymol 228: 451-469.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee, Y. J., Kim, D.H., Kim, Y. W. and Hwang, I. (2001) Identification of a signal that distinguishes between the chloroplast outerenvelope membrane and the endomembrane system in vivo. Plant Cell 13: 2175-2190 www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liang, T., Yang, Y. and Liu, H. (2019) Signal transduction mediated by the plant UV-B photoreceptor UVR8. J Plant Res 221: 1247-1252Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu, B., Yang, Z., Gomez, A., Liu, B., Lin, C. and Oka, Y. (2016) Signaling mechanisms of plant cryptochromes in Arabidopsis thaliana. JPlant Res 129: 137-148
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Luesse, D. R., DeBlasio, S. L. and Hangarter, R. P. (2010) Integration of phot1, phot2, and PhyB signalling in light-induced chloroplastmovements. J Exp Bot 61: 4387-4397
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Marten, H., Hedrich, R. and Roelfsema, M. R. (2007) Blue light inhibits guard cell plasma membrane anion channels in a phototropin-dependent manner. Plant J 50: 29-39
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Motochoulski, A. and Liscum, E. (1999) Arabidopsis NPH3: A NPH1 photoreceptor-interacting protein essential for phototropism.Science 286: 961-964
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Oikawa, K., Kasahara, M., Kiyosue, T., Kagawa, T., Suetsugu, N., Takahashi, F., Kanegae, T., Niwa, Y., Kadota, A. and Wada, M. (2003)CHLOROPLAST UNUSUAL POSITIONING is essential for proper chloroplast positioning. Plant Cell 15: 2805-2815
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Oikawa, K., Yamasato, A., Kong, S. G., Kasahara, M., Nakai, M., Takahashi, F., Ohura, Y., Kagawa, T. and Wada, M. (2008) Chloroplastouter envelope protein CHUP1 is essential for chloroplast anchorage to the plasma membrane and chloroplast movement. PlantPhysiol 148: 829-842
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Paik, I. and Huq, E (2019) Plant photoreceptors: Multi-functional sensory proteins and their signaling networks. Semin Cell Dev Biol 92:114-121
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pham, V. N., Kathare, P. K. and Huq, E. (2018) Phytochromes and phytochrome interacting factors. Plant Physiol 176: 1025-1038Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Preuten, T., Blackwood, L., Christie, J. M. and Fankhauser, C. (2015) Lipid anchoring of Arabidopsis phototropin 1 to assess thefunctional significance of receptor internalization: should I stay or should I go? New Phytol 206: 1038-1050
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sakai, T., Kagawa, T., Kasahara, M., Swartz, T.E., Christie, J.M., Briggs, W.R., Wada, M., and Okada, K. (2001) Arabidopsis nph1 andnpl1: blue light receptors that mediate both phototropism and chloroplast relocation. Proc Natl Acad Sci USA 98: 6969–6974.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sakai, T., Wada, T., Ishiguro, S. and Okada, K. (2000) RPT2: A signal transducer of the phototropic response in Arabidopsis. Plant Cell12: 225-236
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sakamoto, K. and Briggs, W. R. (2002) Cellular and subcellular localization of phototropin 1. Plant Cell 14: 1723-1735Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Suetsugu, N., Kagawa, T. and Wada, M. (2005) An auxilin-like J-domain protein, JAC1, regulates phototropin-mediated chloroplastmovement in Arabidopsis. Plant Physiol 139: 151-162
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Suetsugu, N., Takemiya, A., Kong, S. -G., Higa, T., Komatsu, A., Shimazaki, K., Kohchi, T. and Wada, M. (2016) RPT2/NCH1 subfamily ofNPH3-like proteins is essential for the chloroplast accumulation response in land plants. Proc Natl Acad Sci USA 113: 10424-10429
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Suetsugu, N. Kong, S. -G., Kasahara, M. and Wada, M. (2013) Both LOV1 and LOV2 domains of phototropin2 function as thephotosensory domain for hypocotyl phototopic responses in Arabidopsis thaliana (Brassicaceae). Am J Bot 100: 60-69
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Suetsugu, N. and Wada, M. (2013) Evolution of three LOV blue light receptor families in green plants and photosyntheticstramenopiles: phototropin, ZTL/FKF1/LKP2 and aureochrome. Plant Cell Physiol 54: 8-23
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Suetsugu, N., Yamada, N., Kagawa, T., Yonekura, H., Uyeda, T. Q., Kadota, A. and Wada, M. (2010) Two kinesin-like proteins mediateactin-based chloroplast movement in Arabidopsis thaliana. Proc Natl Acad Sci USA 107: 8860-8865
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sztatelman, 0., Łabuz, J., Hermanowicz, P., Banaś, A. K., Bażant, A., Zgłobicki, P, Aggarwal, C., Nadzieja, M., Krzeszowiec, W., Strzałka,W. and Gabryś, H. (2016) Fine tuning chloroplast movements through physical interactions between phototropins. J Exp Bot 67: 4963-4978
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Takemiya, A., Inoue, S., Doi, M., Kinoshita, T. and Shimazaki, K. (2005) Phototropins promote plant growth in response to blue light inlow light environments. Plant Cell 17: 1120-1127
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Takemiya, A., Kinoshita, T., Asanuma, M. and Shimazaki, K. (2006) Protein phosphatase 1 positively regulates stomatal opening inresponse to blue light in Vicia faba. Proc Natl Acad Sci USA 103: 13549-13554
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Takemiya, A., Sugiyama, N., Fujimoto, H., Tsutsumi, T., Yamauchi, S., Hiyama, A., Tada, Y., Christie, J. M. and Shimazaki, K. (2013a)Phosphorylation of BLUS1 kinase by phototropins is a primary step in stomatal opening. Nat Commun 4: 2094
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Takemiya, A., Yamauchi, S., Yano, T., Ariyoshi, C. and Shimazaki, K.(2013b) Identification of a regulatory subunit of protein phosphatase1 which mediates blue light signaling for stomatal opening. Plant Cell Physiol 54: 24-35
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tsuboi, H. and Wada, M. (2010) Speed of signal transfer in the chloroplast accumulation response. J Plant Res 123: 381-390Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tsuboi, H. and Wada, M. (2011) Chloroplasts can move away in any direction to avoid strong light. J Plant Res 124: 201-210Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ushijima, T., Hanada, K., Gotoh, E., Yamori, W., Kodama, Y., Tanaka, H., Kusano, M., Fukushima, A., Tokizawa, M., Yamamoto, Y. Y.,Tada, Y., Suzuki, Y. and Matsushita, M. (2017) Light control protein localization through phytochrome-mediated alternative promoterselection. Cell 171: 1316-1325
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wada, M. and Kong, S. -G. (2011) Analysis of chloroplast movement and relocation in Arabidopsis. Methods Mol Biol 774: 215-234Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wan, Y.L., Eisinger, W., Ehrhardt, D., Kubitschek, U., Baluska, F. and Briggs, W. R. (2008) The subcellular localization and blue-lightinduced movement of phototropin 1-GFP in etiolated seedlings of Arabidopsis thaliana. Mol Plant 1:103-117
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang, P., Zhang, J., Su, J., Wang, P., Liu, J., Liu, B., Feng, D., Wang, J. and Wang, H. (2013) The chloroplast Min system functionsdifferentially in two specific nongreen plastids in Arabidopsis thaliana. Plos ONE 8: e71190
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wu, F. H., Shen, S. C., Lee, L. Y. and Lee, S. H. (2009) Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method.Nature Methods 5:16
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Yanai, H. Statcel 3 – The useful add-in software forms on Excel (3rd ed). OMS, Tokyo, Japan. (2011).Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Recommended