Phototropin 2 contributes to the chloroplast …...2020/03/19 · 99 and avoidance (Komatsu et al., 2014). It is localized on the chloroplast outer envelope and the It is localized

1

Title: Phototropin 2 contributes to the chloroplast avoidance response at the 1

chloroplast-plasma membrane interface 2

3

Kazuhiro Ishishita1,＊

, Takeshi Higa2, Hidekazu Tanaka

1, Shin-ichiro Inoue

3, Aeri Chung

1, 4

Tomokazu Ushijima4, Tomonao Matsushita

4, Toshinori Kinoshita

3, Masato Nakai

2, Masamitsu 5

Wada5, Noriyuki Suetsugu

6, Eiji Gotoh

4,＊,† 6

7

1Graduate

School of Agriculture, Kyushu University, Fukuoka 819-0395, Japan 8

2Institute for Protein Research, Osaka University, Osaka 565-0871, Japan

9

3Graduate School of Sciences, Nagoya University, Aichi 464-8602, Japan 10

4Faculty of Agriculture, Kyushu University, Fukuoka 819-0395, Japan 11

5Graduate School of Science and Engineering, Tokyo Metropolitan University, Tokyo 192-0397, 12

Japan 13

6Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan 14

15

＊These authors contributed equally to this work 16

†Address correspondence to [email protected] 17

18

Author Contributions: 19

E.G., N.S., and M.W. conceptualized the research. E.G. and K.I. designed the study and performed 20

most of the experiments. T.H. and M.N. performed the immunoblot analysis of cell-fractionated 21

proteins. H.T. contributed to the light transmittance analysis. T.H. and A.C. contributed to the 22

microscopic analysis. S.I. analyzed the light-induced stomatal opening. N.S., T.U., and T.M. 23

Plant Physiology Preview. Published on March 19, 2020, as DOI:10.1104/pp.20.00059

Copyright 2020 by the American Society of Plant Biologists

www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

generated the transgenic mutants. T.K. contributed to analytical tools. K.I., T.H., N.S., M. W., and 24

E.G. analyzed the data. N.S. and E.G. wrote the paper. All authors read and approved the 25

manuscript. 26

27

Running title: Phototropin2 functions on the chloroplasts 28

29

One sentence summary: Chloroplast-localized phototropin2 regulates the chloroplast avoidance 30

response and possibly stomatal opening. 31

32

Corresponding author: 33

Eiji Gotoh 34

Faculty of Agriculture, Kyushu University. 35

744 Motooka, Nishi-ku, Fukuoka 819-0395, JAPAN 36

TEL: +81-92-802-4650 37

FAX: +81-92-802-4650 38



3

Abstract 39

Blue-light-induced chloroplasts movements play an important role in maximizing light utilization for 40

photosynthesis in plants. Under a weak light condition, chloroplasts accumulate to the cell surface 41

to capture light efficiently (chloroplast accumulation response). Conversely, chloroplasts escape 42

from strong light and move to the side wall to reduce photodamage (chloroplast avoidance 43

response). The blue light receptor phototropin (phot) regulates these chloroplast movements and 44

optimizes leaf photosynthesis by controlling other responses as well as chloroplast movements. 45

Seed plants such as Arabidopsis thaliana have the phototropins phot1 and phot2. They 46

redundantly mediate phototropism, stomatal opening, leaf flattening, and the chloroplast 47

accumulation response. However, the chloroplast avoidance response is induced by strong blue 48

light and regulated primarily by phot2. Phototropins are localized mainly on the plasma membrane. 49

However, a substantial amount of phot2 resides on the chloroplast outer envelope. Therefore, 50

differentially localized phot2 might have different functions. To determine the functions of plasma 51

membrane- and chloroplast envelope-localized phot2, we tethered it to these structures with their 52

respective targeting signals. Plasma membrane-localized phot2 regulated phototropism, leaf 53

flattening, stomatal opening, and chloroplast movements. Chloroplast envelope-localized phot2 54

failed to mediate phototropism, leaf flattening, and the chloroplast accumulation response but 55

partially regulated the chloroplast avoidance response and stomatal opening. Based on the present 56

and previous findings, we propose that phot2 localized at the interface between the plasma 57

membrane and the chloroplasts is required for the chloroplast avoidance response and possibly for 58

stomatal opening as well. 59

60



4

Introduction 61

Plants recognize UV-B, blue, red, and far-red light with photoreceptor molecules (Kami et al., 2010; 62

Paik and Huq, 2019), i.e., a red/far-red photoreceptor phytochrome (Franklin and Quail, 2010), a 63

photolyase-like blue light (BL) receptor cryptochrome (Liu et al., 2016), a UV-B photoreceptor 64

UVR8 (Jenkins, 2017) and so on. These plant photoreceptors mediate light responses including 65

photomorphogenesis and photoperiodic flowering by regulating gene expression. They interact 66

with various transcription factors and activate or suppress them (Pham et al., 2018; Liu et al., 2016; 67

Liang et al., 2019). Most plant photoreceptors localize primarily in the nucleus or cytosol. 68

69

In contrast, the plant-specific BL photoreceptor known as phototropin (phot) is localized mainly on 70

the plasma membrane (Christie, 2007). It regulates BL responses without directly affecting gene 71

expression (Christie, 2007). Phototropins consist of two light-sensing LOV (light, oxygen, or 72

voltage) domains and a C-terminal serine/threonine kinase domain (Christie, 2007). Arabidopsis 73

thaliana has two phototropins, phot1 and phot2. BL-induced autophosphorylation is essential for 74

phototropin function (Christie et al., 1998; Inoue et al., 2008a; Inoue et al., 2011). They can 75

optimize photosynthetic activity and plant growth under fluctuating light conditions by regulating 76

various responses (Kasahara et al., 2002; Takemiya et al., 2005; Gotoh et al., 2018). Both phot1 77

and phot2 are functionally redundant in phototropism (Huala et al., 1997; Sakai et al., 2000, 2001), 78

the chloroplast accumulation response (Sakai et al., 2001), stomatal opening (Kinoshita et al., 79

2001), leaf flattening (Sakai et al., 2001; Sakamoto and Briggs, 2002), and leaf positioning (Inoue 80

et al., 2008b). However, phot1 has a relatively greater contribution to these responses under weak 81

light conditions (Suetsugu and Wada, 2013). Certain responses are regulated by phot1 or phot2 82

alone. Phot1 mediates rapid inhibition of hypocotyl growth (Folta and Spalding, 2001) and 83



5

high-fluence, BL-mediated mRNA destabilization (Folta and Kaufman, 2003). Phot2 regulates 84

chloroplast dark positioning (Suetsugu et al., 2005), chloroplast and nuclear avoidance responses 85

(Kagawa et al., 2001; Iwabuchi et al., 2007; Higa et al., 2014), and palisade cell development 86

(Kozuka et al., 2011). 87

88

Chloroplasts move towards weak light to optimize light capture (the chloroplast accumulation 89

response) (Gotoh et al., 2018). Conversely, they evade strong light in order to reduce 90

photodamage (the chloroplast avoidance response) (Kasahara et al., 2002). Only chloroplasts 91

directly irradiated with strong light exhibited avoidance movement (Kagawa and Wada, 1999, 92

Tsuboi and Wada, 2011), suggesting that phot2 is closely associated with chloroplasts or localized 93

on the plasma membrane near them. Although most phototropins are constitutively associated with 94

the plasma membrane, we previously showed that some Arabidopsis phototropins are localized on 95

the outer envelope of the chloroplast (Kong et al., 2013c). The amount of phot2 in the chloroplast 96

outer membrane is much higher than that of phot1 (Kong et al., 2013c). A single species of 97

phototropin of the liverwort Marchantia polymorpha (Mpphot) regulates chloroplast accumulation 98

and avoidance (Komatsu et al., 2014). It is localized on the chloroplast outer envelope and the 99

plasma membrane (Kodama, 2016). However, it has not yet been empirically demonstrated which 100

Arabidopsis phot2 (localized on the chloroplast or the plasma membrane) mediate the chloroplast 101

avoidance response and other phot-mediated responses such as phototropism, stomatal opening, 102

and leaf flattening. To solve this question, we produced transgenic plants in which phot2 was 103

tethered to the chloroplast outer envelope or the plasma membrane in the Arabidopsis phot1phot2 104

mutant background and observed phot-associated phenotypes in the transgenic plants. 105

106



6

Results 107

108

Generation of transgenic plants expressing plasma membrane- or chloroplast 109

envelope-anchored phot2 110

To reveal the functions of phot2 localized on the chloroplast outer membrane, we produced 111

transgenic Arabidopsis plants expressing phot2-green fluorescent protein (GFP) fusion protein 112

(phot2-GFP) targeted to the chloroplast outer membrane with the N-terminal, 47-amino-acid 113

sequence of OUTER ENVELOPE MEMBRANE PROTEIN 7 (OEP7; Lee et al., 2001; hereafter 114

named the CP-P2G lines) (Fig. 1A). This short sequence contains all of the domains required to 115

target the chloroplast outer membrane, including the transmembrane and C-terminal, positively 116

charged regions (Fig. 1A; Lee et al., 2001). We also generated transgenic plants expressing 117

wild-type phot2-GFP (hereafter named the P2G lines) as a control and plasma 118

membrane-anchored phot2-GFP (hereafter named the PM-P2G lines) (Fig. 1A). The phot2-GFP 119

protein of the PM-P2G lines contains a myristoylation sequence at the extreme N-terminus (Fig. 120

1A; Preuten et al., 2015). The PHOT2-GFP genes were expressed under the control of the PHOT2 121

native promoter in phot1phot2 double mutant plants that are phototropin null (Kinoshita et al., 2001; 122

Suetsugu et al., 2013). Two independent lines in each transgenic plant, P2G, PM-P2G and 123

CP-P2G, were selected for further analysis. We performed immunoblot analyses with PHOT2 124

antibody to verify the phot2-GFP protein levels in the selected lines. The ~120-kDa PHOT2 band 125

was detected in the wild type (WT) but not the phot1phot2 double mutant (Fig. 1B). In the P2G, 126

PM-P2G, and CP-P2G lines, bands of ~150 kDa representing the phot2-GFP protein were 127

detected. This finding was consistent with GFP fusion. The amounts of phot2-GFP proteins in the 128

selected P2G and CP-P2G plants were comparable with that of the WT plants. However, the 129



7

amounts of phot2-GFP in the PM-P2G lines were always lower than those of the P2G and CP-P2G 130

lines despite verification of multiple independent PM-P2G lines (Fig. 1B). 131

132

The subcellular localizations of phot2-GFP in the leaf mesophyll cells of P2G, PM-P2G, and 133

CP-P2G line were observed by confocal imaging. Time gating was used to eliminate chlorophyll 134

autofluorescence (Kodama, 2016). In our P2G transgenic plants, GFP fluorescence was found on 135

both the plasma membrane and the chloroplast outer envelope (Fig. 1C and Supplemental Fig. 136

S1). GFP fluorescence in the PM-P2G line was observed only on the plasma membrane (Fig. 1C). 137

Fluorescence in the PM-P2G line strongly coincided with that of propidium iodide that stains cell 138

boundaries (Supplemental Fig. S1). GFP fluorescence was observed on the vacuolar side of the 139

chloroplasts of the P2G line but not on those of the PM-P2G line (Fig. 1C and Supplemental Fig. 140

S1). Thus, phot2-GFP proteins in the PM-P2G line were not measurably targeted to the chloroplast 141

outer membrane. In CP-P2G transgenic plants, however, GFP fluorescence was detected 142

exclusively around the chloroplasts but not on the plasma membrane although punctate GFP 143

fluorescence that were not associated with chloroplasts were observed (Fig. 1C, Supplemental Fig. 144

S1, and Supplemental Fig. S2). Therefore, phot2-GFP proteins in the CP-P2G line are localized on 145

the chloroplast envelope. However, the localization pattern of phot2-GFP on the chloroplast 146

surface was somewhat different between P2G and CP-P2G transgenic plants. The phot2-GFP 147

fluorescence on the chloroplast surface was diffused in the P2G line, but was punctate in the 148

CP-P2G line (Fig. 1C and Supplemental Fig. S2) although we do not know what gave rise to this 149

difference. To determine phot2-GFP localization in each transgenic plant, we performed 150

immunoblot analyses on protein extracts obtained by cell fractionation (Fig. 1D). The plasma 151

membrane or chloroplast fractions were normalized with anti-H+-ATPASEs (AHA) (Hayashi et al., 152



8

2010) or anti-TRANSLOCONE AT THE OUTER ENVELOPE MEMBRANE OF CHLOROPLAST 153

159 (Toc159) (Kikuchi et al., 2006) polyclonal antibodies, respectively. Consistent with a previous 154

report (Kong et al., 2013c), phot2-GFP in P2G lines was enriched in the plasma membrane fraction 155

and was detected also in the chloroplast fraction. In the PM-P2G lines, phot2-GFP was also 156

enriched in the plasma membrane fraction and was hardly detected in the chloroplast fraction (Fig. 157

1D). In contrast, phot2-GFP was highly enriched in the CP-P2G chloroplast fraction but we could 158

not detect phot2-GFP in the plasma membrane fraction (Fig. 1D). 159

160

In summary, phot2-GFP was targeted to the plasma membranes and chloroplast outer envelopes 161

of PM-P2G and CP-P2G plants, respectively. 162

163

Blue light-induced phot2 protein autophosphorylation on the plasma membrane and the 164

chloroplast outer envelope 165

To determine whether the phot2-GFPs of the PM-P2G and CP-P2G lines function as BL-activated 166

kinases, we investigated BL-induced autophosphorylation of phot2-GFP proteins via BL-induced 167

electrophoretic mobility shift. BL-induced retardation in the mobility shift of phot2-GFP proteins was 168

observed in P2G, PM-P2G, and CP-P2G plants (Fig. 2). Thus, phot2-GFP of PM-P2G and CP-P2G 169

plants had normal autophosphorylation and kinase activity. This means that the phot2 on the 170

chloroplast outer membrane as well as on the plasma membrane can be autophosphorylated in 171

response to BL. 172

173

Plasma membrane-associated phot2 induced leaf flattening and biomass production 174

whereas chloroplast envelope-associated phot2 did not 175



9

We analyzed the localization of phot2-GFP in the leaf epidermal cells (Fig. 3A and Supplemental 176

Fig. S3) because phot2 in the epidermal tissues is required to regulate leaf flattening and 177

expansion (Kozuka et al., 2011). In the P2G lines, phot2-GFP localized on the plasma membranes 178

of the leaf epidermal cells and we could not detect any fluorescence of phot2-GFP around the 179

chloroplasts (Fig. 3A and Supplemental Fig. S3). In PM-P2G plants, phot2-GFP showed the 180

exclusive plasma-membrane localization. On the other hand, phot2-GFP in the CP-P2G lines 181

localized primarily around the chloroplasts (Fig. 3A and Supplemental Fig. S3). Furthermore, the 182

dot-like phot2-GFP structures not associated with chloroplasts were also observed in the CP-P2G 183

lines (Fig. 3A, arrow). 184

185

Under white light at 100-120 µmol m-2

s-1

, in the P2G and PM-P2G lines, the leaves were flat and 186

resembled those of the WT (Fig. 3B and Fig. 3C). Plant size in the P2G and PM-P2G lines was 187

much bigger than phot1phot2 double mutant plants but these lines were nonetheless smaller than 188

the WT (Fig. 3B and Fig. 3D). The size of P2G and PM-P2G plants was comparable with that of 189

phot1 mutant plants because the absence of phot1 in the P2G and PM-P2G lines could influence 190

plant size as reported previously (Takemiya et al., 2005; Inoue et al., 2008b). In contrast, CP-P2G 191

plants had curled leaves and lower biomass production than the WT, P2G, and PM-P2G lines, 192

similar to phot1phot2 mutants (Fig. 3B, Fig. 3C, and Fig. 3D). Our findings indicate that plasma 193

membrane-localized phot2, but not chloroplast-localized phot2, induced leaf flattening and 194

biomass production. 195

196

Plasma membrane-associated phot2 induced phototropism whereas chloroplast outer 197

membrane-associated phot2 did not 198



10

To investigate the role of differential phot2 localization in hypocotyl phototropism, we examined 199

subcellular phot2-GFP localization in the hypocotyl epidermal (Fig. 4A) and cotyledon palisade 200

(Supplemental Fig. S4) cells of 4-day-old etiolated transgenic seedlings. In Arabidopsis, etioplasts 201

in etiolated seedlings could be detectable by chlorophyll autofluorescence (Wang et al., 2013). In 202

the P2G lines, phot2-GFP was found on the plasma membrane and around the etioplast periphery. 203

Phot2-GFP in the PM-P2G lines exhibited the exclusive plasma-membrane localization in the 204

hypocotyl and cotyledon epidermal cells (Fig. 4A and Supplemental Fig. S4). For the CP-P2G lines, 205

phot2-GFP was detected around the etioplasts and in certain dot-like structures not associated with 206

chloroplasts (Fig. 4A, arrows; Supplemental Fig. S4). 207

208

We explored phototropism under 10 µmol m-2

s-1

unilateral BL wherein phot2 can mediate 209

phototropism in the absence of phot1 (Fig. 4B). The WT showed positive phototropism whereas 210

phot1phot2 mutants showed no phototropic responses. The P2G and PM-P2G plants were 211

positively phototropic and at the same level as the WT (Fig. 4B). In contrast, no phototropic 212

curvature was detected in CP-P2G plants (Fig. 4B). 213

214

Chloroplast outer membrane-associated phot2 partially induced stomatal opening 215

We investigated whether chloroplast-localized phot2 mediates the BL-dependent stomatal 216

opening. In the leaf epidermal guard cells of P2G plants, phot2-GFP was localized on the plasma 217

membrane and around the chloroplast outer envelope (Fig. 5A). phot2-GFP in a PM-P2G line was 218

exclusively localized on the guard cell plasma membranes. On the other hand, phot2-GFP in 219

CP-P2G plants was detected around the chloroplasts and in certain dot-like structures (Fig. 5A, 220

arrows) but not on the plasma membrane (Fig. 5A). These patterns of phot2-GFP were also 221



11

observed in the epidermal cells of leaves (Fig. 3A) and etiolated seedlings (Fig. 4A and 222

Supplemental Fig. S4). 223

224

The isolated leaf epidermis of transgenic plants was dark-adapted and irradiated either with red 225

light (RL) at 60 µmol m-2

s-1

or RL (50 µmol m-2

s-1

) plus BL (10 µmol m-2

s-1

). RL enhancement of 226

BL-dependent stomatal opening was observed in the WT and P2G plants but not in phot1phot2 227

mutants (Fig. 5B). BL-dependent stomatal opening was induced in the PM-P2G line to the same 228

extent as in the WT and P2G plants. However, CP-P2G plants exhibited weak but significant 229

BL-induced stomatal opening (Fig. 5B). RL irradiation alone did not induce stomatal opening in any 230

lines (Fig. 5B). Thus, plasma membrane-localized phot2 was sufficient to induce BL-dependent 231

stomatal opening but chloroplast outer membrane-localized phot2 also induced it. 232

233

Chloroplast outer membrane-associated phot2 induced the chloroplast avoidance 234

response 235

We examined whether chloroplast outer membrane-localized phot2 regulates BL-induced 236

chloroplast movements. Three-week-old plants were transferred to darkness, weak light, or strong 237

light and chloroplast distributions were observed under a confocal microscope (Fig. 6A). In P2G 238

and PM-P2G plants under darkness, chloroplasts accumulated on the cell bottoms. Under weak 239

BL, the chloroplasts were localized on the upper and lower periclinal walls. Under strong BL, the 240

chloroplasts localized on the side walls (Fig. 6A). Thus, phot2-GFP in P2G and PM-P2G lines 241

mediated chloroplast dark positioning, accumulation, and avoidance responses. In a CP-P2G line, 242

chloroplasts localized on the sidewalls under all light conditions. Therefore, the CP-P2G line was 243

defective in chloroplast dark positioning and accumulation response (Fig. 6A). However, it remains 244



12

to be determined whether phot2-GFP of the CP-P2G lines regulates the chloroplast avoidance 245

response. We examined under a confocal microscope the chloroplast avoidance response to 246

partial irradiation in the leaf palisade mesophyll cells (Fig. 6). In WT, phot1, P2G, and PM-P2G 247

plants, chloroplasts evaded the irradiated area as a result of the avoidance response (Fig. 6B, Fig. 248

6C, and Supplemental Fig. S5, left and middle panels). The chloroplast avoidance response in P2G 249

and PM-P2G plants was slightly greater than that in WT and phot1 plants although statistically 250

insignificant (Fig. 6D and Fig. 6E). In CP-P2G plants, chloroplasts also escaped from the irradiated 251

area (Fig. 6B, right panels) but much more slowly than they did in P2G and PM-P2G plants (Fig. 252

6C, Fig. 6D, and Fig. 6E). Upon induction of the chloroplast avoidance response, the total distance 253

traveled in 15 mins was shorter in the CP-P2G line than in P2G or PM-P2G plants (Fig. 6C and Fig. 254

6D). However, the avoidance response was never detected in phot1phot2 mutants (Fig. 6D, Fig. 255

6E, and Supplemental Fig. S5, right panels). Thus, phot2-GFP in the CP-P2G line partially rescued 256

the defect in the avoidance response in the phot1phot2 mutant. 257

We also assessed chloroplast movements by measuring light-induced transmittance changes (Fig. 258

7). In WT plants, weak light (1, 3, and 5 µmol m-2

s-1

) reduced leaf transmittance as a result of the 259

chloroplast accumulation response (Fig. 7A, Fig. 7B, and Fig. 7C). At 5 µmol m-2

s-1

, a biphasic 260

response was observed, i.e., initial transient increase in leaf transmittance and then the strong 261

decrease (Fig. 7C), indicative of a transient chloroplast avoidance. A biphasic response was more 262

prominent and the clear avoidance response was induced at 20 µmol m-2

s-1

(Fig. 7D). At more than 263

50 µmol m-2

s-1

, only the avoidance response was detectable and the response was saturated 264

between 100 and 300 µmol m-2

s-1

(Fig. 7E, Fig. 7F, and Fig. 7G). In the phot1 mutant (that has 265

phot2), the accumulation response was severely attenuated and the avoidance response was 266

induced with slightly reduced amplitude (Fig. 7). Partial defect in the avoidance response in the 267



13

phot1 mutant was reported also in other studies (Luesse et al., 2010; Sztatelman et al., 2016). No 268

detectable light-induced changes in leaf transmittance were observed in the phot1phot2 mutants 269

(Fig. 7), because of lack of light-induced chloroplast movements in the phot1phot2 mutants (Sakai 270

et al., 2001). Both P2G and PM-P2G plants basically showed similar chloroplast movements to 271

phot1 mutant plants although the accumulation response was weaker than that in the phot1 mutant 272

(Fig. 7). In CP-P2G plants, no chloroplast accumulation response was observed at any fluence rate 273

of blue light. However, the weak but significant avoidance response was observed at more than 20 274

µmol m-2

s-1

although the amplitude was less than that in P2G and PM-P2G plants (Fig. 7D, Fig. 7E, 275

Fig. 7F, and Fig. 7G). 276

277

Taken together, these results indicate that chloroplast outer membrane-localized phot2 certainly 278

induced the chloroplast avoidance response even though less effective than those in the plasma 279

membrane. 280

281

Discussion 282

283

Here, we showed that plasma membrane-localized phot2 suffices to mediate phot2-dependent 284

responses. Chloroplast outer membrane-localized phot2 mediates BL-dependent stomatal 285

opening and the chloroplast avoidance response. 286

287

Plasma membrane-anchored phot2 mediated all phot2-dependent responses 288

Phototropins are localized and function on the plasma membrane. By contrast, most plant 289

photoreceptors are function and localized in the nucleus or cytosol. Phototropins have no 290



14

transmembrane domain (Christie 2007). Plasma membrane-bound phototropins can be solubilized 291

with detergents or alkali solutions but not with chaotropic salt (Knieb et al., 2004; Kong et al., 292

2013b, 2013c). Therefore, phototropins are not integral membrane proteins. Moreover, 293

mechanisms other than electrostatic interaction and covalent bonding to integral compounds are 294

involved in the association of phototropins with the plasma membrane. Phototropin proteins are not 295

always localized on the plasma membrane. Blue light causes the release of phot1 to the cytosol 296

(Sakamoto and Briggs 2002; Wan et al., 2008) and the movement of phot2 to the Golgi apparatus 297

(Kong et al., 2006). The importance of phototropins in cytosol and in the Golgi was examined in 298

various ways. When the cytoplasmic phototropins were cleared through RL-mediated inhibition of 299

release of phot1 to cytosol (Han et al., 2008), tethering of phot1-GFP to the plasma membrane by 300

myristoylation or farnesylation (Preuten et al., 2015), and targeting phot2-GFP to the nucleus with a 301

nuclear localization signal (phot2-GFP-NLS) (Kong et al., 2013c), all examined 302

phototropin-mediated responses were normally induced, indicating that cytosolic phototropins are 303

dispensable for phototropin-mediated responses. Furthermore, analysis of domain swapping 304

between phot1 and phot2 revealed that targeting phot2 to the Golgi apparatus is not required for 305

the chloroplast avoidance response (Aihara et al., 2008). A chimeric phototropin consisting of 306

phot2 N-terminal light-sensing- and phot1 kinase domains could not move to the Golgi apparatus in 307

response to BL but could mediate the chloroplast avoidance response (Aihara et al., 2008). 308

Therefore, phototropins have virtually no function in the Golgi apparatus. 309

310

Our findings for the PM-P2G lines confirm that phototropins function primarily on the plasma 311

membrane (Fig. 8A). The PM-P2G lines were almost normal for all phot2-dependent responses 312

including phototropism, leaf flattening, plant biomass, stomatal opening, and chloroplast 313



15

accumulation and avoidance although slightly less phot2-GFP accumulated in the PM-P2G lines 314

relative to the other lines (Fig. 1 and Fig. 2). However, the amount of phot2-GFP on the plasma 315

membrane was comparable between the P2G and PM-P2G lines or higher in the PM-P2G lines 316

than those in the P2G lines (Fig. 1C, Fig. 1D, Fig. 3，Fig. 4, Fig. 5, Supplemental Fig. S1, 317

Supplemental Fig. S2, Supplemental Fig. S3, and Supplemental Fig. S4). That should be why 318

phot2-GFP in the PM-P2G lines efficiently rescued all examined phot2-mediated responses. 319

Preuten et al. (2015) showed that plasma membrane-anchored phot1-GFP mediated 320

phot1-dependent responses including phototropism, leaf flattening and positioning, and chloroplast 321

accumulation. Stomatal opening was not evaluated in that study. The plasma membrane is a major 322

site of phototropin signaling initiated in response to BL. Most phototropin-interacting proteins 323

essential for certain phototropin-mediated responses are also localized in the plasma membrane. 324

These include the BTB/POZ (for Broad-Complex, Tramtrack, and Bric-a-brac/POX virus and Zinc 325

finger)-domain proteins NON-PHOTOTROPIC HYPOCOTYL 3 (Motchoulski and Liscum, 1999), 326

ROOT PHOTOTROPISM 2 (Inada et al., 2004), NPH3/RPT2-LIKE (NRL) PROTEIN FOR 327

CHLOROPLAST MOVEMENT 1 (NCH1) (Suetsugu et al., 2016), the PHYTOCHROME KINASE 328

SUBSTRATE (PKS) proteins (Lariguet et al., 2006; de Carbonnel et al., 2010; Demarsy et al., 329

2012), and the auxin efflux carrier ATB-BINDING CASSETTE B 19 (ABCB19) (Christie et al., 330

2011). However, they do not participate in stomatal opening or the chloroplast avoidance response. 331

Moreover, no phototropin-interacting proteins on the plasma membrane have yet been associated 332

with these responses. Stomatal opening and the chloroplast avoidance response are mediated by 333

phot2-GFP in CP-P2G line. 334

335



16

How does chloroplast outer membrane-anchored phot2 promote BL-induced stomatal 336

opening? 337

phot2-GFP in control plant guard cells was localized on the plasma membrane and chloroplast 338

outer envelopes (Fig. 5A). We found that chloroplast outer membrane-anchored phot2 may be 339

partially involved in BL-induced stomatal opening (Fig. 5B and Fig. 8A). Phototropins mediate 340

stomatal opening by regulating the phosphorylation and activation of plasma membrane 341

H+-ATPase (PM-H

+-ATPase) (Kinoshita et al., 2001). Several signaling proteins downstream of 342

phototropins participate in PM-H+-ATPase activation including protein kinases BLUE LIGHT 343

SIGNALING1 (BLUS1) (Takemiya et al., 2013a) and BLUE LIGHT-DEPENDENT H+-ATPASE 344

PHOSPHORYLATION (BHP) (Hayashi et al., 2017), Protein phosphatase 1 (PP1) and PP1 345

REGULATORY SUBUNIT2-LIKE PROTEIN 1 (PRSL1) (Takemiya et al., 2006, 2013b). 346

Phototropins also regulate BL-induced suppression of the S-type anion channel in guard cells 347

(Marten et al., 2007). CONVERGENCE OF BLUE LIGHT AND CO2 1 (CBC1) is essential for 348

BL-induced suppression of the S-type anion channel along with its close homolog CBC2 (Hiyama 349

et al., 2017). These signaling components are localized in guard cell cytosols (Takemiya et al., 350

2006, 2013a, b; Hayashi et al., 2017; Hiyama et al., 2017). Thus, chloroplast outer 351

membrane-associated phot2 may induce signal transduction for phot-dependent stomatal opening 352

via these cytosolic components. We found dot-like phot2-GFP in the epidermal cells of leaves 353

(pavement and guard cells), cotyledons, and hypocotyls. They were not associated with 354

chloroplasts (Fig. 3，Fig. 4, Fig. 5, and Supplemental Fig. S4). These dot-like phot2-GFP might be 355

nonfunctional in leaf flattening, plant biomass production, or phototropism, because phot2-GFP in 356

the CP-P2G lines could not rescue these responses in the phot1phot2 mutant background (Fig. 3 357

and Fig. 4). On the other hand, we cannot rule out the possibility that the dot-like phot2-GFP could 358



17

mediate stomatal opening. Further analysis is required to establish how chloroplast outer 359

membrane-associated phototropins mediate BL-induced stomatal opening. 360

361

Phototropins at the interface between the chloroplasts and the plasma membrane may be 362

required for the chloroplast avoidance response 363

Previous photobiological and physiological analyses suggested that the chloroplast avoidance 364

response is mediated by phototropins localized on the chloroplast outer membrane or in the vicinity 365

of the chloroplasts (Kagawa and Wada, 1999; Tsuboi and Wada 2011). The chloroplast 366

accumulation response may be mediated by plasma membrane-localized phototropins because 367

chloroplasts can move to irradiated sites far from the chloroplasts. Moreover, phototropins may 368

generate transmissible signals mediating the chloroplast accumulation response (Tsuboi and 369

Wada 2010; Higa et al. 2017). In fact, in the PM-P2G lines both chloroplast accumulation and 370

avoidance responses could be induced but in the CP-P2G lines only the chloroplast avoidance 371

response was detected although it was relatively weak (Fig. 6 and Fig. 7). No phot2-GFP was 372

detected on the vacuolar sides of the PM-P2G chloroplasts or the CP-P2G plasma membranes 373

(Fig. 8A). It is, therefore, plausible that phot2 at the interface between the chloroplasts and the 374

plasma membrane is required for the chloroplast avoidance response (Fig. 8B). Chloroplast-actin 375

(cp-actin) filaments, which are necessary for photorelocation and positioning, are localized at the 376

interface between the chloroplasts and the plasma membrane (Kadota et al., 2009; Kong et al., 377

2013a). During chloroplast avoidance movements, phot2 is essential for the reorganization of the 378

cp-actin filaments (Kong et al., 2013a) with which chloroplasts are tightly bound to the plasma 379

membrane (Kadota et al, 2009; Suetsugu et al., 2010). Thus, both plasma membrane- (as in the 380

PM-P2G lines) and chloroplast-anchored phot2 (as in the CP-P2G lines) could function at the 381



18

interface between the chloroplasts and the plasma membrane to mediate the chloroplast 382

avoidance response. CHLOROPLAST UNUSUAL POSITIONING 1 (CHUP1), localized on the 383

chloroplast outer membrane (Oikawa et al., 2003, 2008), is required to generate and/or maintain 384

cp-actin filaments to control chloroplast movements and positioning (Oikawa et al., 2003; Kadota et 385

al., 2009). Overall, phot2 might mediate the chloroplast avoidance response at the interface. 386

Indeed, several chloroplast movement regulators including CHUP1 are phosphorylated under 387

strong light conditions (Boex-Fontvieille et al., 2014). Thus, phot2 might phosphorylate these 388

proteins at the interface to regulate the cp-actin filaments and the chloroplast avoidance response. 389

390

Our findings indicated that phot2 proteins at the interface between the chloroplasts and the plasma 391

membrane may be required for the chloroplast avoidance response. However, they do not explain 392

why phot1 cannot efficiently mediate this response even though phot1 localizes at the interface 393

between the chloroplasts and the plasma membrane. Thus, substrate specificity between phot1 394

and phot2 may also be necessary to determine the precise functions of these phototropins. Domain 395

swapping between phot1 and phot2 revealed that neither the N-terminal light-sensing- nor the 396

kinase domain determines the functional specificity of phot2 in chloroplast avoidance response 397

regulation (Aihara et al., 2008). Phot2 N/phot1 kinase and phot1 N/phot2 kinase chimeras 398

regulated the chloroplast avoidance response (Aihara et al., 2008). To elucidate the functional 399

difference between phot1 and phot2 in chloroplast avoidance response regulation, a more detailed 400

structure-function analysis is needed. 401

402

Materials and Methods 403

404



19

Plant materials and growth conditions 405

The Arabidopsis thaliana WT and phot1-5 phot2-1 mutant (Kinoshita et al. 2001) had a Col-gl1 406

background. phot1-5 phot2-1 is a null mutant for both phot1 and phot2 (Kinoshita et al. 2001; 407

Suetsugu et al., 2013). For most experiments, the seeds were sown on 0.75% (w/v) agar plates 408

containing Murashige and Skoog (MS) medium. The plants were incubated in a growth chamber 409

(CLE-303; TOMY Digital Biology Co. Ltd., Tokyo, Japan) at 22 ̊ C under continuous white light at 40 410

µmol m-2

s-1

. To measure biomass and leaf flattening, the plants were grown in soil in a growth 411

chamber (LPH-350S; NK Systems Ltd., Tokyo, Japan) at 22 ˚C and 55% relative humidity under 412

continuous white light at 120 µmol m-2

s-1

. 413

414

Plasmid construction and generation of transgenic lines 415

Full-length cDNA fragments of PHOT2 were amplified with the primers P2-Fw 416

(CCCtctagaATGGAGAGGCCAAGAGCCCCTC; XbaI site in lowercase) and P2-Rv 417

(AAAggtaccGAAGAGGTCAATGTCCAAGTCCGTAG; KpnI site in lowercase) from the vector 418

PHOT2pro:AtPHOT2-GFP:nosT/pRI 101-AN (Ishishita et al., 2016). 419

420

A recognition sequence for N-myristoyltransferase (Preuten et al., 2015) was added by PCR to the 421

5’-terminus of PHOT2 cDNA using the primers PM-P2-Fw 422

(AAAtctagaATGGAAATATGCATGAGTAGGATGGAGAGGCCAAGAGC; XbaI site in lowercase; 423

myristoylation sequence underlined) and P2-Rv. 424

425

The chloroplast outer membrane-targeting sequence of OUTER ENVELOPE MEMBRANE 426

PROTEIN 7 (OEP7) (Lee et al., 2001) was obtained by PCR using the primers CP-P2 Fw 427



20

(CCCtctagaATGGGAAAAACTTCGGGAGCGAA; XbaI site in lowercase) and CP-P2 Rv 428

(CTCTTGGCCTCTCCATGGGGTCTTTGGTTGG; 5’ sequence of PHOT2 cDNA underlined). The 429

PHOT2 fragment was obtained by PCR using the primers CP-P2 Fw2 430

(CCAACCAAAGACCCCATGGAGAGGCCAAGAG; 3’ sequence of OEP7 cDNA underlined) and 431

P2-Rv with template DNA from PHOT2 and OEP7 fragments. The latter two were fused by PCR 432

using the primers CP-P2 Fw and P2-Rv. All fragments were inserted into the XbaI/KpnI site of 433

GFP-NosT pBIN30 (Ushijima et al., 2017). A 3-kbp PHOT2 promoter region (-3,047 from the 434

PHOT2 start codon; Ishishita et al., 2016) was inserted into the NheI/XbaI site of the vectors. The 435

resulting binary vectors were introduced into Agrobacterium tumefaciens strain C58C1 (pMP90) 436

and transformed into the phot1-5 phot2-1 double mutant by the floral dip method (Clough and Bent, 437

1998). BASTA-resistant transgenic plants were selected. Homozygous T3 lines with a single 438

transgene were used in all subsequent experiments. 439

440

Immunoblot analysis 441

Rosette leaves of 3-week-old plants were homogenized in a buffer comprising 50 mM Tris-HCl (pH 442

7.5), 100 mM NaCl, 5 mM ethylenediaminetetraacetic acid (EDTA), 0.5% (v/v) Triton X-100, 1 mM 443

dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (Wako Pure Chemical Industries Ltd., 444

Osaka, Japan). Total proteins were used for sodium dodecyl sulfate polyacrylamide gel 445

electrophoresis and immunoblot analysis. PHOTOTROPIN 2 (PHOT2), GLYCERATE KINASE 446

(GLYK), H+-ATPASEs (AHA), and TRANSLOCONE AT THE OUTER ENVELOPE MEMBRANE 447

OF CHLOROPLAST 159 (Toc159) proteins were detected with anti-PHOT2- (Takemiya et al., 448

2005), anti-GLYK- (Ushijima et al., 2017), anti-AHA- (Hayashi et al., 2010), and anti-Toc159 449

polyclonal antibodies (Kikuchi et al., 2006), respectively. Phot2-GFP fusion proteins in Figure 3D 450



21

were detected with anti-GFP (no. 11814460001; Roche, Mannheim, Germany). In our experiment, 451

anti-Toc159 polyclonal antibodies detected mainly 86-kDa fragments of Toc159 that served as a 452

chloroplast marker (Kikuchi et al., 2006). 453

454

Isolation of plasma membrane and chloroplast envelope fractions 455

For the isolation of chloroplast envelope and plasma membrane fractions, mesophyll cell 456

protoplasts were isolated from the leaves of Arabidopsis transgenic plants using the 457

Tape-Arabidopsis Sandwich method (Wu et al., 2009). Protoplasts suspended in HS buffer (50 mM 458

HEPES-KOH, pH 7.5, and 330 mM sorbitol) with 0.1% (w/v) BSA and 0.1% (v/v) cOmplete 459

protease inhibitor cocktail (F. Hoffmann-La Roche Ltd., Basel, Switzerland) stock solution (1 tablet 460

dissolved in 1 ml of water) were ruptured through a nylon mesh (~10 μm) attached to the cut end of 461

a disposable syringe and then centrifuged at 4,000 g for 3 min. The pellets were used for the 462

isolation of the chloroplast envelope, and the supernatants were used for the isolation of the 463

plasma membrane fraction. The crude chloroplast pellets were resuspended in TE buffer (50 mM 464

Tricine-KOH, pH 7.5, and 2 mM EDTA) with 1 mM DTT and 0.1% (v/v) protease inhibitor cocktail 465

stock solution, and then chloroplasts were ruptured by freeze-thaw followed by homogenization in 466

a glass homogenizer after a three-fold dilution with TE buffer. Ruptured chloroplasts were overlaid 467

onto a step gradient, composed of 0.46 M and 1 M sucrose in TE buffer and centrifuged at 54,000 468

g for 2 h. Light green fractions collected from the step gradient were diluted five-fold with TE buffer 469

and centrifuged at 82,000g for 1 h. Precipitated chloroplast envelope fractions were dissolved in TE 470

buffer with 1 mM DTT, 0.1% (v/v) protease inhibitor cocktail stock solution, and 0.2% (v/v) 471

TritonX-100. The supernatants collected after the rupturing of protoplasts were centrifuged at 472

26,000g for 30 min. At the end of the run, the crude plasma membrane pellets were suspended in 473



22

HS buffer (pH 8.0) with 0.1% (v/v) protease inhibitor cocktail stock solution. Plasma membrane 474

fractions were purified by two-phase system (Larsson et al., 1994). The plasma 475

membrane-enriched upper phase solution was diluted three-fold with TE buffer with 1 mM DTT and 476

0.1% (v/v) protease inhibitor cocktail stock solution and then centrifuged at 82000g for 1 h. 477

Precipitated plasma membrane fractions were dissolved in TE buffer with 1 mM DTT, 0.1% (v/v) 478

protease inhibitor cocktail stock solution, and 0.2% (v/v) TritonX-100. 479

480

Light sources 481

Blue or red LEDs (ISL-150×150; CCS, Kyoto, Japan) were used in the analysis of phot2 482

autophosphorylation, phototropism, stomatal opening, and chloroplast movements. 483

484

Confocal microscopic analysis of phot2-GFP localization 485

Subcellular localization of the phot2-GFP fusion proteins was visualized by laser scanning confocal 486

microscopy (SP8; Leica Microsystems, Wetzlar, Germany). GFP fluorescence was measured by 487

the time gating method (gating time = 0.5–12 ns) to remove chlorophyll autofluorescence according 488

to a previous study (Kodama, 2016). A blue laser (laser power 15%) was used to induce the 489

chloroplast avoidance response. Propidium Iodide (PI) solution (Molecular Probes, Invitrogen., 490

Oregon, USA) was introduced into plants by deaeration to visualize the cell walls. Emission spectra 491

for chloroplast autofluorescence, GFP, and PI were measured at 488 nm. Excitation spectra for 492

chloroplast autofluorescence, GFP, and PI were measured at 620–685 nm, 490–550 nm, and 585–493

605 nm, respectively. 494

495

Measurement of the phototropic responses in the hypocotyls of etiolated seedlings 496



23

Seeds were sown on agar plates containing Murashige and Skoog (MS) medium (Sigma-Aldrich 497

Corp., St. Louis, MO, USA) solidified with 0.6% (w/v) agar. The seeds were stratified at 4 ˚C for 4 d. 498

The seedlings were grown vertically at 22 ˚C for 3 d in the dark. The resulting etiolated seedlings 499

were irradiated with unilateral BL of 10 µmol m-2

s-1

for 12 h. The irradiated seedlings were 500

photographed and their phototropic curvatures were measured with ImageJ 501

(http://imagej.nih.gov/ij; NIH, Bethesda, MD, USA). 502

503

Plant biomass and leaf flattening 504

Fresh weights were determined for the shoots of whole plants grown under continuous white light 505

at 100 µmol m-2

s-1

for 3 weeks. For leaf flattening, cross-sections of the leaves on 3-week-old 506

plants were photographed. 507

508

Blue light-induced stomatal opening 509

Blue light-dependent stomatal apertures were measured according to an earlier study (Inoue et al., 510

2008a). Fully expanded rosette leaves were harvested from dark-adapted 4-week-old plants. 511

Epidermal tissue fragments were isolated from the leaves and suspended in a basal reaction 512

mixture consisting of 5 mM 2-morpholinoethanesulfonic acid-bis-tris-propane (pH 6.5) (Wako Pure 513

Chemical Industries Ltd., Osaka, Japan), 50 mM KCl, and 0.1 mM CaCl2 under dim red light. The 514

epidermal fragments were either kept in the dark or irradiated with red light (RL; 50 µmol m-2

s-1

) 515

with or without BL (10 µmol m-2

s-1

) for 3 h. Stomatal images were obtained with a microscope 516

(TS100; Nikon, Tokyo, Japan). Stomatal apertures were measured with ImageJ. 517

518

Chloroplast photorelocation movement 519


http://imagej.nih.gov/ij


24

To determine chloroplast intracellular localization, 3-week-old plants were irradiated with either 520

weak (3 µmol m-2

s-1

) or strong (50 µmol m-2

s-1

) blue light (BL) for 3 h to induce chloroplast 521

accumulation and avoidance responses, respectively. The leaves were fixed with 2.5% (v/v) 522

glutaraldehyde (Wako Pure Chemical Industries Ltd., Osaka, Japan). Cross-sections were 523

prepared with a vibrating microtome (VT1200 S; Leica Microsystems, Wetzlar, Germany). 524

Chloroplast distribution patterns were visualized with a laser scanning confocal microscope (FV10i; 525

Olympus, Tokyo, Japan). Projection images were constructed using z-stacks (FV10i; Olympus, 526

Tokyo, Japan). 527

Leaf transmittance was measured using a microplate reader Multiskan GO (Thermo Fisher, 528

Waltham, MA, USA) according to a previous report (Wada and Kong, 2011). The detached third 529

leaves from 3-week-old plants were placed on the solidified 1% (w/v) gellan gum in the 96-well 530

plastic plate and kept in the dark for more than 3 h. Then, samples were irradiated with BL at 1, 3, 5, 531

20, 50, 100, or 300 µmol m-2

s-1

. 532

533

Statistical analysis 534

Data were processed in Excel v. 2011 (Microsoft Corporation, Redmond, WA, USA) with the add-in 535

Statcel v. 3 (Yanai 2011). Comparisons between group means were performed with Student’s 536

t-test. Comparisons among three or more group means were made by one-way ANOVA followed 537

by the Tukey-Kramer multiple comparisons post hoc test. 538

539

ACCESSION NUMBERS 540

OEP7 (AT3G52420), PHOT2 (AT5G58140), PHOT1 (AT3G45780) 541

542



25

SUPPLEMENTAL DATA 543

The following supplemental materials are available. 544

Supplemental Figure S1. Detailed observation of the localization of phot2-GFP in the leaf 545

mesophyll cells. 546

547

Supplemental Figure S2. The localization of phot2-GFP on the chloroplast surface in the 548

mesophyll cells. 549

550

Supplemental Figure S3. Detailed observation of the localization of phot2-GFP in the leaf 551

epidermal tissues. 552

553

Supplemental Figure S4. The localization of phot2-GFP in the cotyledon palisade cells of 554

etiolated seedlings. 555

556

Supplemental Figure 5. Chloroplast avoidance response in the wild type (WT), phot1, and 557

phot1phot2 plants. 558

559

Acknowledgments 560

The authors thank Ryota Kiyabu, Jaewook Kim, and Bungo Shirouchi of Kyushu University, Japan 561

for their valuable discussions. The authors also thank Tomoyo Kusumoto, Yumi Ichikawa, Rika 562

Kunihiro of Kyushu University, Japan for their technical assistance. We thank the Center for 563

Advanced Instrumental and Educational Support of the Faculty of Agriculture, Kyushu University, 564

Japan for confocal microscopy. This work was supported in part by Grants-in-Aid for Scientific 565



26

Research (Nos. JP15K18713, JP18K14491, and JP19H04729 to E.G.; Nos. JP15KK0254 and 566

JP19K06721 to N.S.) from the Japan Society for the Promotion of Science. This work was also 567

funded by a Grant-in-Aid for a JSPS Research Fellow (No. JP17J06717 to T.H.) and research 568

grants from the Young Investigators of Kyushu University (to E.G.), the Ichimura Fundation for New 569

Technology (to E.G.), and the Ohsumi Frontier Science Foundation (to M.W.). 570

571



27

Figure Legends 572

573

Fig. 1. Targeted localization of phot2-GFP in the transgenic lines. (A) Outline of phot2-GFP 574

constructs. Protein structures of wild-type (phot2-GFP), plasma membrane-anchored 575

(PM-phot2-GFP), and chloroplast outer envelope-anchored phot2-GFP (CP-phot2-GFP) are 576

indicated. The yellow box in PM-phot2-GFP is a signal sequence for plasma membrane targeting. 577

The myristoylated glycine residue is colored red. The yellow box in CP-phot2-GFP is a 578

chloroplast-targeting sequence from Arabidopsis OUTER ENVELOPE MEMBRANE PROTEIN 7 579

(OEP7). A transmembrane region (underlined) and the C-terminal positively-charged region (italic) 580

are indicated. Scale bar = 100 amino acids (aa). (B) Western blot of phot2-GFP proteins using 581

anti-PHOT2 antibody. Wild type (WT) and phot1phot2 (p1p2) plants were positive and negative 582

controls, respectively. Twenty micrograms of total protein were extracted from 3-week-old plants. 583

Black and white arrowheads indicate phot2-GFP and endogenous phot2, respectively. Glycerate 584

kinase (GLYK) was the loading control. Molecular weight (kDa) is indicated at the left side. (C) 585

Subcellular localizations of phot2-GFP in leaf mesophyll cells of 3-week-old P2G, PM-P2G, and 586

CP-P2G plants. Green fluorescent protein (GFP) fluorescence (left panel), chlorophyll 587

auto-fluorescence (Chl; middle panel), and merged images of GFP and Chl (right panel) are 588

indicated. Arrows and arrowheads indicate the localizations of phot2-GFP on the plasma 589

membrane and the chloroplast outer envelope, respectively. Scale bar = 0.5 µm. (D) Immunoblot 590

analysis of cell fraction in transgenic plants. Protoplasts were prepared from fully expanding rosette 591

leaves of 3-week-old P2G (P2), PM-P2G (PM) and CP-P2G (CP) plants. Protoplast fractions were 592

ruptured physically, and further separated into plasma membrane and chloroplast envelope 593

fractions. Total proteins were obtained from all fractions. The loading volume in the protoplast 594



28

fraction and chloroplast envelope fraction or in the plasma membrane were determined based on 595

the protein accumulation level of Toc159 (86 kDa fragments) or AHA, respectively. 596

597

Fig. 2. Blue light-induced autophosphorylation of phot2-GFP proteins in P2G, PM-P2G, and 598

CP-P2G plants. Blue light-induced autophosphorylation of phot2-GFP proteins. Twenty 599

micrograms of total protein were extracted from dark-adapted (D) or blue light-irradiated (BL: 100 600

µmol m-2

s-1

for 1 min) plants for western blot. Black and white arrowheads indicate 601

blue-light-dependent autophosphorylated and dark-adapted phot2-GFP (right) or endogenous 602

phot2 (left), respectively. p1p2 indicates the phot1phot2 double mutant. Glycerate kinase (GLYK) 603

was the loading control. Molecular weight (kDa) is indicated at the left side. 604

605

Fig. 3. Plant growth and leaf flattening in P2G, PM-P2G, and CP-P2G plants. (A) Localization 606

of phot2 on the leaf epidermal tissue of transgenic plants. Fluorescence of green fluorescence 607

protein (GFP) and chlorophyll autofluorescence (Chl) are shown in green and red, respectively. In 608

Arabidopsis, immature epidermal cell plastids are referred to as chloroplasts as they are detectable 609

by chlorophyll autofluorescence (Higa et al., 2014; Barton et al., 2016). Merged images were 610

produced by stacking each image. Scale bar = 10 µm. Arrows indicate dot-like phot2-GFP proteins 611

not associated with chloroplasts in the CP-P2G lines. (B, C) Images of whole plants (B) and 612

detached leaves (C). Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic plants were 613

grown under continuous white light at 100 µmol m-2

s-1

for 3 weeks. Scale bar = 2 cm. (C) Leaf 614

flattening. Images of whole leaves (upper panels) and leaf cross-sections (lower panels) from 615

3-week-old plants grown under continuous white light at 120 µmol m-2

s-1

are shown. Scale bar = 1 616

cm. (D) Plant biomass production. Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic 617



29

plants were grown for 3 weeks under continuous white light at 100 µmol m-2

s-1

. Images are 618

representative samples. Data are means ± SD (n = 30). Different letters indicate significant 619

differences (Tukey’s test; P < 0.01). 620

621

Fig. 4. Blue light-induced phototropism in transgenic plants. (A) Localization of phot2 in the 622

hypocotyl epidermal cells of transgenic plants. Fluorescence of green fluorescence protein (GFP) 623

and chlorophyll (Chl) are shown in green and red, respectively. Merged images were produced by 624

stacking each image. Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts 625

in the CP-P2G lines. Scale bar = 10 µm. (B) Phototropism. Etiolated seedlings were irradiated with 626

unilateral blue light at 10 µmol m-2

s-1

for 12 h. Images below the graph are representative samples. 627

Data are means ± SE (n = 90). Different letters indicate significant differences (Tukey’s test; P < 628

0.01). 629

630

Fig. 5. Blue light-induced stomatal opening in the P2G, PM-P2G, and CP-P2G plants. (A) 631

Intracellular localization of phot2 in guard cells. Fluorescence of green fluorescence protein (GFP), 632

chlorophyll (Chl), and propidium iodide (PI) are shown in green, red, and white, respectively. 633

Merged images were produced by stacking each image. Insets are the enlarged images that show 634

the localization of phot2-GFP around the chloroplast in the P2G line (arrowheads). Arrows indicate 635

dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G line. Scale bar = 10 636

µm. (B) Blue light-induced stomatal opening in transgenic plants. Epidermal peels were irradiated 637

with red light (60 µmol m-2

s-1

) (RL) or red light (50 µmol m-2

s-1

) plus blue light (10 µmol m-2

s-1

) (RL 638

+ BL). Thirty stomata were measured per experiment. Measurements were repeated ≥ 3×. Data are 639



30

means of three independent experiments ± SE (n = 90). Asterisks indicate significant differences 640

between two groups (Student’s t-test; P < 0.001). 641

642

Fig. 6. Analysis of blue light-induced chloroplast avoidance movements with partial 643

irradiation. (A) Distribution of chloroplasts in the leaf palisade mesophyll cells in the transgenic 644

plants. Three-week-old plants were dark-adapted for one day (Dark) or irradiated with blue light at 645

3.0 (weak) or 50 (strong) µmol m-2

s-1

for 3 h. Images of the upper cell surface (surface) and cross 646

sections (cross) are shown. Scale bar = 20 µm. (B) The chloroplast avoidance response in the leaf 647

palisade mesophyll cells was induced by partial irradiation with a blue laser beam. Upper and lower 648

panels indicate chloroplast autofluorescence in the same view before and after partial irradiation 649

(about 3 min for the P2G and PM-P2G lines and about 8 min for the CP-P2G line), respectively. 650

Irradiated areas are indicated by white lines. (C) Tracking of chloroplast avoidance movement. 651

Image is the same as those in the upper panels of (B). Yellow and green lines indicate the center of 652

the path of chloroplast avoidance of blue light. (D and E) Chloroplast migration distance (D) and 653

chloroplast avoidance movement velocity (E) in WT, phot1, phot1phot2, P2G, PM-P2G, and 654

CP-P2G plants. Chloroplast avoidance response was induced by a strong microbeam. Data are 655

means ± SD (n = 8). Different letters indicate significant differences (Tukey-Kramer test; P < 0.01). 656

657

Fig. 7. Analysis of blue light-induced chloroplast movements through measurement of 658

changes in leaf transmittance. Blue light-induced chloroplast movements in WT, phot1, 659

phot1phot2, P2G, PM-P2G, and CP-P2G plants were tracked by measuring light-induced changes 660

in leaf transmittance. Detached leaves were dark-adapted for more than 3 h before the 661

measurement. After measurements of leaf transmittance in darkness for 30 min, the leaves were 662



31

irradiated with blue light at 1 (A), 3 (B), 5 (C), 20 (D), 50 (E), 100 (F), or 300 (G) µmol m-2

s-1

for 80 663

min from the timepoint indicated with a white arrow. WT and phot1 plants were used as a control. At 664

least 8 leaves were used per experiment and the experiments were repeated three times. Data are 665

means ± SE (n = 3) of biological triplicates. 666

667

Fig. 8. P2G, PM-P2G, and CP-P2G phenotypes. (A) Left schematics show localizations of 668

phot2-GFP in P2G, PM-P2G, and CP-P2G plants. Phot2-GFP was localized on the plasma 669

membrane (PM) and the outer envelopes of the chloroplasts (CP) indicated in red. Phot2-GFP was 670

localized on the plasma membrane in the PM-P2G lines and the chloroplast outer membrane in the 671

CP-P2G lines. Right panel shows phenotypic characterization for P2G, PM-P2G, and CP-P2G 672

plants. ++, wild-type responses; +, weak responses in the CP-P2G lines; -, no response (such as in 673

the phot1phot2 mutant). (B) Chloroplast avoidance response mediated by phot2 at the interface 674

between the chloroplasts and the plasma membrane is indicated by a brace bracket. Phot2 (and 675

phot1) on the plasma membrane regulate the chloroplast accumulation response. 676

677

References 678

Aihara, Y., Tabata, R., Suzuki, T., Shimazaki, K. and Nagatani, A. (2008) Molecular basis of the 679

functional specificities of phototropin 1 and 2. Plant J 56: 364-375. 680

Barton, K. A., Schattat, M. H., Jakob, T., Hause, G., Wilhelm, C., Mckenna, J. F., Máthé, C., 681

Runions, J., Van Damme, D. and Mathur, J. (2016) Epidermal pavement cells of Arabidopsis 682

have chloroplasts. Plant Physiol 171: 723-726 683



32

Boex-Fontvieille, E., Jossier, M., Davanture, M., Zivy, M., Hodges, M. and Tcherkez, G. (2014) 684

Differential protein phosphorylation regulates chloroplast movement in response to strong light 685

and darkness in Arabidopsis thaliana. Plant Mol Biol Rep 32: 987-1001 686

Christie, J.M. (2007) Phototropin blue-light receptors. Annu Rev Plant Biol 58: 21-45 687

Christie, J. M., Reymond, P., Powell, G. K., Bernasconi, P., Raibekas, A. A., Liscum, E. and Briggs, 688

W. R. (1998) Arabidopsis NPH1: A flavoprotein with the properties of a photoreceptor for 689

phototropism. Science 282:1698-1701. 690

Christie, J. M., Yang, H., Richter, G. L., Sullivan, S., Thomson, C.E., Lin, J., Titapiwatanakun, B., 691

Ennis, M., Kaiserli, E., Lee, O. R., Adamec, J., Peer, W. A. and Murphy, A. S. (2011) phot1 692

inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required for phototropism. 693

PLoS Biol 9: e1001076 694

Clough S. J. and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium-mediated 695

transformation of Arabidopsis thaliana. Plant J 16: 735-743 696

de Carbonnel, M., Davis, P., Roelfsema, M. R., Inoue, S., Schepens, I., Lariguet, P., Geisler, M., 697

Shimazaki, K., Hangarter, R. and Fankhauser, C. (2010) The 698

Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling 699

element that regulates leaf flattening and leaf positioning. Plant Physiol 152: 1391-1405 700



33

Demarsy, E., Schepens, I., Okajima, K., Hersch, M., Bergmann, S., Christie, J. M., Shimazaki, K., 701

Tokutomi, S. and Fankhauser, C. (2012) Phytochrome Kinase Substrate 4 is phosphorylated 702

by the phototropin 1 photoreceptor. EMBO J 31: 3457-3467 703

Franklin, K.A. and Quail, P.H. (2010) Phytochrome functions in Arabidopsis development. J Exp 704

Bot 61: 11-24 705

Folta, K.M. and Kaufman, L.S. (2003) Phototropin 1 is required for high-fluence blue-light-mediated 706

mRNA destabilization. Plant Mol Biol 51: 609-618 707

Folta, K.M. and Spalding, E.P. (2001) Unexpected roles for cryptochrome 2 and phototropin 708

revealed by high-resolution analysis of blue light-mediated hypocotyl growth inhibition. Plant J 709

26: 471-478 710

Gotoh, E., Suetsugu, N., Yamori, W., Ishishita, K., Kiyabu, R., Fukuda, M., Higa, T., Shirouchi, B. 711

and Wada, M. (2018) Chloroplast accumulation response enhances leaf photosynthesis and 712

plant biomass production. Plant Physiol 178: 1358-1369 713

Han, I. S., Tseng, T. S., Eisinger, W. and Briggs, W. R. (2008) Phytochrome A regulates the 714

intracellular distribution of phototropin 1-green fluorescent protein in Arabidopsis thaliana. 715

Plant Cell 20: 2835-2847 716



34

Hayashi, M., Inoue, S., Ueno, Y. and Kinoshita, T. (2017) A Raf-like protein kinase BHP mediates 717

blue light-dependent stomatal opening. Sci Rep 7: 45586 718

Hayashi, Y., Nakamura, S., Takemiya, A., Takahashi, Y., Shimazaki, K. and Kinoshita, T. (2010) 719

Biochemical characterization of in vitro phosphorylation and dephosphorylation of the plasma 720

membrane H+-ATPase. Plant Cell Physiol 51: 1186-1196 721

Higa, T., Hasegawa, S., Hayasaki, Y., Kodama, Y. and Wada, M. (2017) Temperature-dependent 722

signal transmission in chloroplast accumulation response. J Plant Research 130: 779-789 723

Higa, T., Suetsugu, N., Kong, SG. and Wada, M. (2014) Actin-dependent plastid movement is 724

required for motive force generation in directional nuclear movement in plants. Proc Natl Acad 725

Sci USA 111: 4327-4331 726

Hiyama, A., Takemiya, A., Munemasa, S., Okuma, E., Sugiyama, N., Tada, Y., Murata, T. and 727

Shimazaki, K. (2017) Blue light and CO2 signals converge to regulate light-induced stomatal 728

opening. Nat Commun 8: 1284 729

Huala, E., Oeller, P. W., Liscum, E., Han, I. S., Larsen, E. and Briggs, W. R. (1997) Arabidopsis 730

NPH1: A protein kinase with a putative redox-sensing domain. Science 278:2120-2123. 731



35

Inada, S., Ohgishi, M., Mayama, T., Okada, K. and Sakai, T. (2004) RPT2 is a signal transducer 732

involved in phototropic response and stomatal opening by association with phototropin 1 in 733

Arabidopsis thaliana. Plant Cell 16: 887-896 734

Inoue, S., Kinoshita, T., Matsumoto, M., Nakayama, K., Doi, M. and Shimazaki, K. (2008a) Blue 735

light-induced autophosphorylation of phototropin is a primary step for signaling. Proc Natl 736

Acad Sci USA 105: 5626-5631 737

Inoue, S., Kinoshita, T., Takemiya, A., Doi, M. and Shimazaki, K. (2008b) Leaf Positioning 738

of Arabidopsis in Response to Blue Light. Mol Plant 1: 15-26 739

Inoue, S., Matsushita, T., Tomokiyo, Y., Matsumoto, M., Nakayama, K., Kinoshita, T. and 740

Shimazaki, K. (2011) Functional analyses of the activation loop of phototropin 2 in 741

Arabidopsis. Plant Physiol 156: 117-128 742

Ishishita, K., Suetsugu, N., Hirose, Y., Higa, T., Doi, M., Wada, M., Matsushita, T. and Gotoh, E. 743

(2016) Functional characterization of blue-light-induced responses and PHOTOTROPIN 1 744

gene in Welwitschia mirabilis. J Plant Res 129: 175-187 745

Iwabuchi, K., Sakai, T. and Takagi, S. (2007) Blue light-dependent nuclear positioning in 746

Arabidopsis thaliana leaf cells. Plant Cell Physiol 48: 1291-1298 747



36

Jenkins, G. I. (2017) Photomorphogenic responses to ultraviolet-B light. Plant Cell Environ 40: 748

2544-2557 749

Kadota, A., Yamada, N., Suetsugu, N., Hirose, M., Saito, C., Shoda, K., Ichikawa, S., Kagawa, T., 750

Nakano, A. and Wada, M. (2009) Short actin-based mechanism for light-directed chloroplast 751

movement in Arabidopsis. Proc Natl Acad Sci USA 106: 13106–13111. 752

Kagawa, T., Sakai, T., Suetsugu, N., Oikawa, K., Ishiguro, S., Kato, T., Tabata, S., Okada, K. and 753

Wada, M. (2001) Arabidopsis NPL1: A phototropin homolog controlling the chloroplast 754

high-light avoidance response. Science 291:2138-2141 755

Kagawa, T. and Wada, M. (1999) Chloroplast-avoidance response induced by high-fluence blue 756

light in prothallial cells of the fern Adiantum capillus-veneris as analyzed by microbeam 757

irradiation. Plant Physiol 119:917-923 758

Kami, C., Lorrain, S., Hornitschek, P. and Fankhauser, C. (2010) Light-regulated plant growth and 759

development. Curr Top Dev Biol 91: 29-66 760

Kasahara, M., Kagawa, T., Oikawa, K., Suetsugu, N., Miyao, M and Wada, M. (2002) Chloroplast 761

avoidance movement reduces photodamage in plants. Nature 420: 829-832 762

Kikuchi, S., Hirohashi, T. and Nakai, M. (2006) Characterization of the preprotein translocon at the 763

outer envelope nembrane of chloroplasts by blue native PAGE. Plant Cell Physiol 47: 363-371 764



37

Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M. and Shimazaki, K. (2001) phot1 and 765

phot2 mediate blue light regulation of stomatal opening. Nature 414: 656-660 766

Knieb, E., Salomon, M. and Rüdiger, W. (2004) Tissue-specific and subcellular localization of 767

phototropin determined by immuno-blotting. Planta 218: 843-851 768

Kodama, Y. (2016) Time gating of chloroplast autofluorescence allows clearer fluorescence 769

imaging in Planta. PLoS One 11: e0152484. 770

Komatsu, A., Terai, M., Ishizaki, K., Suetsugu, N., Tsuboi, H., Nishihama, R., Yamato, K. T., Wada, 771

M. and Kohchi, T. (2014) Phototropin encoded by a single-copy gene mediates chloroplast 772

photorelocation movements in the liverwort Marchantia polymorpha. Plant Physiol 166: 773

411-427. 774

Kong, S. -G., Arai, Y., Suetsugu, N., Yanagida, M. and Wada, M. (2013a) Rapid severing and 775

motility of chloroplast-actin filaments are required for the chloroplast avoidance response in 776

Arabidopsis. Plant Cell 25: 572-590 777

Kong, S. -G., Kagawa, T., Wada, M. and Nagatani, A. (2013b) A C-terminal membrane association 778

domain of phototropin 2 is necessary for chloroplast movement. Plant Cell Physiol 54: 57-68 779



38

Kong, S. -G., Suetsugu, N., Kikuchi, S., Nakai, M., Nagatani, A. and Wada, M. (2013c) Both 780

phototropin 1 and 2 localize on the chloroplast outer membrane with distinct localization 781

activity. Plant Cell Physiol 54: 80-92 782

Kong, S. -G., Suzuki, T., Tamura, K., Mochizuki, N., Hara-Nishimura, I. and Nagatani, A. (2006) 783

Blue light-induced association of phototropin 2 with the Golgi apparatus. Plant J 45: 994-1005. 784

Kozuka, T., Kong, S. -G., Doi, M., Shimazaki, K. and Nagatani, A. (2011) Tissue-autonomous 785

promotion of palisade cell development by phototropin 2 in Arabidopsis. Plant Cell 786

23:3684-3695 787

Lariguet P, Schepens I, Hodgson D, Pedmale UV, Trevisan M, Kami C, de Carbonnel M, Alonso 788

JM, Ecker JR, Liscum E, Fankhauser C. (2006) PHYTOCHROME KINASE SUBSTRATE 1 is 789

a phototropin 1 binding protein required for phototropism. Proc Natl Acad Sci USA 103: 790

10134-10139 791

Larsson, C., Sommarin, M. and Widell, S. (1994) Isolation of highly purified plant plasma 792

membranes and separation of inside-out and right-side-out vesicles. Methods Enzymol 228: 793

451-469. 794



39

Lee, Y. J., Kim, D.H., Kim, Y. W. and Hwang, I. (2001) Identification of a signal that distinguishes 795

between the chloroplast outer envelope membrane and the endomembrane system in vivo. 796

Plant Cell 13: 2175-2190 797

Liang, T., Yang, Y. and Liu, H. (2019) Signal transduction mediated by the plant UV-B 798

photoreceptor UVR8. J Plant Res 221: 1247-1252 799

Liu, B., Yang, Z., Gomez, A., Liu, B., Lin, C. and Oka, Y. (2016) Signaling mechanisms of plant 800

cryptochromes in Arabidopsis thaliana. J Plant Res 129: 137-148 801

Luesse, D. R., DeBlasio, S. L. and Hangarter, R. P. (2010) Integration of phot1, phot2, and PhyB 802

signalling in light-induced chloroplast movements. J Exp Bot 61: 4387-4397 803

Marten, H., Hedrich, R. and Roelfsema, M. R. (2007) Blue light inhibits guard cell plasma 804

membrane anion channels in a phototropin-dependent manner. Plant J 50: 29-39 805

Motochoulski, A. and Liscum, E. (1999) Arabidopsis NPH3: A NPH1 photoreceptor-interacting 806

protein essential for phototropism. Science 286: 961-964 807

Oikawa, K., Kasahara, M., Kiyosue, T., Kagawa, T., Suetsugu, N., Takahashi, F., Kanegae, T., 808

Niwa, Y., Kadota, A. and Wada, M. (2003) CHLOROPLAST UNUSUAL POSITIONING is 809

essential for proper chloroplast positioning. Plant Cell 15: 2805-2815 810



40

Oikawa, K., Yamasato, A., Kong, S. G., Kasahara, M., Nakai, M., Takahashi, F., Ohura, Y., 811

Kagawa, T. and Wada, M. (2008) Chloroplast outer envelope protein CHUP1 is essential for 812

chloroplast anchorage to the plasma membrane and chloroplast movement. Plant Physiol 148: 813

829-842 814

Paik, I. and Huq, E (2019) Plant photoreceptors: Multi-functional sensory proteins and their 815

signaling networks. Semin Cell Dev Biol 92: 114-121 816

Pham, V. N., Kathare, P. K. and Huq, E. (2018) Phytochromes and phytochrome interacting factors. 817

Plant Physiol 176: 1025-1038 818

Preuten, T., Blackwood, L., Christie, J. M. and Fankhauser, C. (2015) Lipid anchoring of 819

Arabidopsis phototropin 1 to assess the functional significance of receptor internalization: 820

should I stay or should I go? New Phytol 206: 1038-1050 821

Sakai, T., Kagawa, T., Kasahara, M., Swartz, T.E., Christie, J.M., Briggs, W.R., Wada, M., and 822

Okada, K. (2001) Arabidopsis nph1 and npl1: blue light receptors that mediate both 823

phototropism and chloroplast relocation. Proc Natl Acad Sci USA 98: 6969–6974. 824

Sakai, T., Wada, T., Ishiguro, S. and Okada, K. (2000) RPT2: A signal transducer of the phototropic 825

response in Arabidopsis. Plant Cell 12: 225-236 826



41

Sakamoto, K. and Briggs, W. R. (2002) Cellular and subcellular localization of phototropin 1. Plant 827

Cell 14: 1723-1735 828

Suetsugu, N., Kagawa, T. and Wada, M. (2005) An auxilin-like J-domain protein, JAC1, regulates 829

phototropin-mediated chloroplast movement in Arabidopsis. Plant Physiol 139: 151-162 830

Suetsugu, N., Takemiya, A., Kong, S. -G., Higa, T., Komatsu, A., Shimazaki, K., Kohchi, T. and 831

Wada, M. (2016) RPT2/NCH1 subfamily of NPH3-like proteins is essential for 832

the chloroplast accumulation response in land plants. Proc Natl Acad Sci USA 113: 833

10424-10429 834

Suetsugu, N. Kong, S. -G., Kasahara, M. and Wada, M. (2013) Both LOV1 and LOV2 domains of 835

phototropin2 function as the photosensory domain for hypocotyl phototopic responses in 836

Arabidopsis thaliana (Brassicaceae). Am J Bot 100: 60-69 837

Suetsugu, N. and Wada, M. (2013) Evolution of three LOV blue light receptor families in green 838

plants and photosynthetic stramenopiles: phototropin, ZTL/FKF1/LKP2 and aureochrome. 839

Plant Cell Physiol 54: 8-23 840

Suetsugu, N., Yamada, N., Kagawa, T., Yonekura, H., Uyeda, T. Q., Kadota, A. and Wada, M. 841

(2010) Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis 842

thaliana. Proc Natl Acad Sci USA 107: 8860-8865 843



42

Sztatelman, 0., Łabuz, J., Hermanowicz, P., Banaś, A. K., Bażant, A., Zgłobicki, P, Aggarwal, C., 844

Nadzieja, M., Krzeszowiec, W., Strzałka, W. and Gabryś, H. (2016) Fine tuning chloroplast 845

movements through physical interactions between phototropins. J Exp Bot 67: 4963-4978 846

Takemiya, A., Inoue, S., Doi, M., Kinoshita, T. and Shimazaki, K. (2005) Phototropins promote 847

plant growth in response to blue light in low light environments. Plant Cell 17: 1120-1127 848

Takemiya, A., Kinoshita, T., Asanuma, M. and Shimazaki, K. (2006) Protein phosphatase 1 849

positively regulates stomatal opening in response to blue light in Vicia faba. Proc Natl Acad 850

Sci USA 103: 13549-13554 851

Takemiya, A., Sugiyama, N., Fujimoto, H., Tsutsumi, T., Yamauchi, S., Hiyama, A., Tada, Y., 852

Christie, J. M. and Shimazaki, K. (2013a) Phosphorylation of BLUS1 kinase by phototropins is 853

a primary step in stomatal opening. Nat Commun 4: 2094 854

Takemiya, A., Yamauchi, S., Yano, T., Ariyoshi, C. and Shimazaki, K.(2013b) Identification of a 855

regulatory subunit of protein phosphatase 1 which mediates blue light signaling for stomatal 856

opening. Plant Cell Physiol 54: 24-35 857

Tsuboi, H. and Wada, M. (2010) Speed of signal transfer in the chloroplast accumulation 858

response. J Plant Res 123: 381-390 859



43

Tsuboi, H. and Wada, M. (2011) Chloroplasts can move away in any direction to avoid strong light. 860

J Plant Res 124: 201-210 861

Ushijima, T., Hanada, K., Gotoh, E., Yamori, W., Kodama, Y., Tanaka, H., Kusano, M., Fukushima, 862

A., Tokizawa, M., Yamamoto, Y. Y., Tada, Y., Suzuki, Y. and Matsushita, M. (2017) Light 863

control protein localization through phytochrome-mediated alternative promoter selection. 864

Cell 171: 1316-1325 865

Wada, M. and Kong, S. -G. (2011) Analysis of chloroplast movement and relocation in 866

Arabidopsis. Methods Mol Biol 774: 215-234 867

Wan, Y.L., Eisinger, W., Ehrhardt, D., Kubitschek, U., Baluska, F. and Briggs, W. R. (2008) The 868

subcellular localization and blue-light induced movement of phototropin 1-GFP in etiolated 869

seedlings of Arabidopsis thaliana. Mol Plant 1:103-117 870

Wang, P., Zhang, J., Su, J., Wang, P., Liu, J., Liu, B., Feng, D., Wang, J. and Wang, H. (2013) The 871

chloroplast Min system functions differentially in two specific nongreen plastids in Arabidopsis 872

thaliana. Plos ONE 8: e71190 873

Wu, F. H., Shen, S. C., Lee, L. Y. and Lee, S. H. (2009) Tape-Arabidopsis Sandwich - a simpler 874

Arabidopsis protoplast isolation method. Nature Methods 5:16 875



44

Yanai, H. Statcel 3 – The useful add-in software forms on Excel (3rd ed). OMS, Tokyo, Japan. 876

(2011). 877



Fig. 1. Targeted localization of phot2-GFP in the transgenic lines. (A) Outline of phot2-GFP constructs. Protein structures of wild-type (phot2-GFP), plasma membrane-anchored (PM-phot2-GFP), and chloroplast outer envelope-anchored phot2-GFP (CP-phot2-GFP) are indicated. The yellow box in PM-phot2-GFP is a signal sequence for plasma membrane targeting. The myristoylated glycine residue is colored red. The yellow box in CP-phot2-GFP is a chloroplast-targeting sequence from Arabidopsis OUTER ENVELOPE MEMBRANE PROTEIN 7 (OEP7). A transmembrane region (underlined) and the C-terminal positively-charged region (italic) are indicated. Scale bar = 100 amino acids (aa). (B) Western blot of phot2-GFP proteins using anti-PHOT2 antibody. Wild type (WT) and phot1phot2 (p1p2) plants were positive and negative controls, respectively. Twenty micrograms of total protein were extracted from 3-week-old plants. Black and white arrowheads indicate phot2-GFP and endogenous phot2, respectively. Glycerate kinase (GLYK) was the loading control. Molecular weight (kDa) is indicated at the left side. (C) Subcellular localizations of phot2-GFP in leaf mesophyll cells of 3-week-old P2G, PM-P2G, and CP-P2G plants. Green fluorescent protein (GFP) fluorescence (left panel), chlorophyll auto-fluorescence (Chl; middle panel), and merged images of GFP and Chl (right panel) are indicated. Arrows and arrowheads indicate the localizations of phot2-GFP on the plasma membrane and the chloroplast outer envelope, respectively. Scale bar = 0.5 µm. (D) Immunoblot analysis of cell fraction in transgenic plants. Protoplasts were prepared from fully expanding rosette leaves of 3-week-old P2G (P2), PM-P2G (PM) and CP-P2G (CP) plants. Protoplast fractions were ruptured physically, and further separated into plasma membrane and chloroplast envelope fractions. Total proteins were obtained from all fractions. The loading volume in the protoplast fraction and chloroplast envelope fraction or in the plasma membrane were determined based on the protein accumulation level of Toc159 (86 kDa fragments) or AHA, respectively.



Fig. 2. Blue light-induced autophosphorylation of phot2-GFP proteins in P2G, PM-P2G, and CP-P2G plants. Blue light-induced autophosphorylation of phot2-GFP proteins. Twenty micrograms of total protein were extracted from dark-adapted (D) or blue light-irradiated (BL: 100 µmol m-2 s-1 for 1 min) plants for western blot. Black and white arrowheads indicate blue-light-dependent autophosphorylated and dark-adapted phot2-GFP (right) or endogenous phot2 (left), respectively. p1p2 indicates the phot1phot2 double mutant. Glycerate kinase (GLYK) was the loading control. Molecular weight (kDa) is indicated at the left side.



Fig. 3. Plant growth and leaf flattening in P2G, PM-P2G, and CP-P2G plants. (A) Localization of phot2 on the leaf epidermal tissue of transgenic plants. Fluorescence of green fluorescence protein (GFP) and chlorophyll autofluorescence (Chl) are shown in green and red, respectively. In Arabidopsis, immature epidermal cell plastids are referred to as chloroplasts as they are detectable by chlorophyll autofluorescence (Higa et al., 2014; Barton et al., 2016). Merged images were produced by stacking each image. Scale bar = 10 µm. Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G lines. (B, C) Images of whole plants (B) and detached leaves (C). Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic plants were grown under continuous white light at 100 µmol m-2 s-1 for 3 weeks. Scale bar = 2 cm. (C) Leaf flattening. Images of whole leaves (upper panels) and leaf cross-sections (lower panels) from 3-week-old plants grown under continuous white light at 120 µmol m-2 s-1 are shown. Scale bar = 1 cm. (D) Plant biomass production. Wild type (WT), phot1 (p1), phot1phot2 (p1p2), and transgenic plants were grown for 3 weeks under continuous white light at 100 µmol m-2 s-1. Images are representative samples. Data are means ± SD (n = 30). Different letters indicate significant differences (Tukey’s test; P < 0.01).



Fig. 4. Blue light-induced phototropism in transgenic plants. (A) Localization of phot2 in the hypocotyl epidermal cells of transgenic plants. Fluorescence of green fluorescence protein (GFP) and chlorophyll (Chl) are shown in green and red, respectively. Merged images were produced by stacking each image. Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G lines. Scale bar = 10 µm. (B) Phototropism. Etiolated seedlings were irradiated with unilateral blue light at 10 µmol m-2 s-1 for 12 h. Images below the graph are representative samples. Data are means ± SE (n = 90). Different letters indicate significant differences (Tukey’s test; P < 0.01).



Fig. 5. Blue light-induced stomatal opening in the P2G, PM-P2G, and CP-P2G plants. (A) Intracellular localization of phot2 in guard cells. Fluorescence of green fluorescence protein (GFP), chlorophyll (Chl), and propidium iodide (PI) are shown in green, red, and white, respectively. Merged images were produced by stacking each image. Insets are the enlarged images that show the localization of phot2-GFP around the chloroplast in the P2G line (arrowheads). Arrows indicate dot-like phot2-GFP proteins not associated with chloroplasts in the CP-P2G line. Scale bar = 10 µm. (B) Blue light-induced stomatal opening in transgenic plants. Epidermal peels were irradiated with red light (60 µmol m-2 s-1) (RL) or red light (50 µmol m-2 s-1) plus blue light (10 µmol m-2 s-1) (RL + BL). Thirty stomata were measured per experiment. Measurements were repeated ≥ 3×. Data are means of three independent experiments ± SE (n = 90). Asterisks indicate significant differences between two groups (Student’s t-test; P < 0.001).



Fig. 6. Analysis of blue light-induced chloroplast avoidance movements with partial irradiation. (A) Distribution of chloroplasts in the leaf palisade mesophyll cells in the transgenic plants. Three-week-old plants were dark-adapted for one day (Dark) or irradiated with blue light at 3.0 (weak) or 50 (strong) µmol m-2 s-1 for 3 h. Images of the upper cell surface (surface) and cross sections (cross) are shown. Scale bar = 20 µm. (B) The chloroplast avoidance response in the leaf palisade mesophyll cells was induced by partial irradiation with a blue laser beam. Upper and lower panels indicate chloroplast autofluorescence in the same view before and after partial irradiation (about 3 min for the P2G and PM-P2G lines and about 8 min for the CP-P2G line), respectively. Irradiated areas are indicated by white lines. (C) Tracking of chloroplast avoidance movement. Image is the same as those in the upper panels of (B). Yellow and green lines indicate the center of the path of chloroplast avoidance of blue light. (D and E) Chloroplast migration distance (D) and chloroplast avoidance movement velocity (E) in WT, phot1, phot1phot2, P2G, PM-P2G, and CP-P2G plants. Chloroplast avoidance response was induced by a strong microbeam. Data are means ± SD (n = 8). Different letters indicate significant differences (Tukey-Kramer test; P < 0.01).



Fig. 7. Analysis of blue light-induced chloroplast movements through measurement of changes in leaf transmittance. Blue light-induced chloroplast movements in WT, phot1, phot1phot2, P2G, PM-P2G, and CP-P2G plants were tracked by measuring light-induced changes in leaf transmittance. Detached leaves were dark-adapted for more than 3 h before the measurement. After measurements of leaf transmittance in darkness for 30 min, the leaves were irradiated with blue light at 1 (A), 3 (B), 5 (C), 20 (D), 50 (E), 100 (F), or 300 (G) µmol m-2 s-1 for 80 min from the timepoint indicated with a white arrow. WT and phot1 plants were used as a control. At least 8 leaves were used per experiment and the experiments were repeated three times. Data are means ± SE (n = 3) of biological triplicates.



Fig. 8. P2G, PM-P2G, and CP-P2G phenotypes. (A) Left schematics show localizations of phot2-GFP in P2G, PM-P2G, and CP-P2G plants. Phot2-GFP was localized on the plasma membrane (PM) and the outer envelopes of the chloroplasts (CP) indicated in red. Phot2-GFP was localized on the plasma membrane in the PM-P2G lines and the chloroplast outer membrane in the CP-P2G lines. Right panel shows phenotypic characterization for P2G, PM-P2G, and CP-P2G plants. ++, wild-type responses; +, weak responses in the CP-P2G lines; -, no response (such as in the phot1phot2 mutant). (B) Chloroplast avoidance response mediated by phot2 at the interface between the chloroplasts and the plasma membrane is indicated by a brace bracket. Phot2 (and phot1) on the plasma membrane regulate the chloroplast accumulation response.



Parsed CitationsAihara, Y., Tabata, R., Suzuki, T., Shimazaki, K. and Nagatani, A. (2008) Molecular basis of the functional specificities of phototropin 1and 2. Plant J 56: 364-375.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Barton, K. A., Schattat, M. H., Jakob, T., Hause, G., Wilhelm, C., Mckenna, J. F., Máthé, C., Runions, J., Van Damme, D. and Mathur, J.(2016) Epidermal pavement cells of Arabidopsis have chloroplasts. Plant Physiol 171: 723-726


Boex-Fontvieille, E., Jossier, M., Davanture, M., Zivy, M., Hodges, M. and Tcherkez, G. (2014) Differential protein phosphorylationregulates chloroplast movement in response to strong light and darkness in Arabidopsis thaliana. Plant Mol Biol Rep 32: 987-1001


Christie, J.M. (2007) Phototropin blue-light receptors. Annu Rev Plant Biol 58: 21-45Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Christie, J. M., Reymond, P., Powell, G. K., Bernasconi, P., Raibekas, A. A., Liscum, E. and Briggs, W. R. (1998) Arabidopsis NPH1: Aflavoprotein with the properties of a photoreceptor for phototropism. Science 282:1698-1701.


Christie, J. M., Yang, H., Richter, G. L., Sullivan, S., Thomson, C.E., Lin, J., Titapiwatanakun, B., Ennis, M., Kaiserli, E., Lee, O. R.,Adamec, J., Peer, W. A. and Murphy, A. S. (2011) phot1 inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required forphototropism. PLoS Biol 9: e1001076


Clough S. J. and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J 16: 735-743


de Carbonnel, M., Davis, P., Roelfsema, M. R., Inoue, S., Schepens, I., Lariguet, P., Geisler, M., Shimazaki, K., Hangarter, R. andFankhauser, C. (2010) The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element thatregulates leaf flattening and leaf positioning. Plant Physiol 152: 1391-1405


Demarsy, E., Schepens, I., Okajima, K., Hersch, M., Bergmann, S., Christie, J. M., Shimazaki, K., Tokutomi, S. and Fankhauser, C. (2012)Phytochrome Kinase Substrate 4 is phosphorylated by the phototropin 1 photoreceptor. EMBO J 31: 3457-3467


Franklin, K.A. and Quail, P.H. (2010) Phytochrome functions in Arabidopsis development. J Exp Bot 61: 11-24Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Folta, K.M. and Kaufman, L.S. (2003) Phototropin 1 is required for high-fluence blue-light-mediated mRNA destabilization. Plant MolBiol 51: 609-618


Folta, K.M. and Spalding, E.P. (2001) Unexpected roles for cryptochrome 2 and phototropin revealed by high-resolution analysis ofblue light-mediated hypocotyl growth inhibition. Plant J 26: 471-478


Gotoh, E., Suetsugu, N., Yamori, W., Ishishita, K., Kiyabu, R., Fukuda, M., Higa, T., Shirouchi, B. and Wada, M. (2018) Chloroplastaccumulation response enhances leaf photosynthesis and plant biomass production. Plant Physiol 178: 1358-1369


Han, I. S., Tseng, T. S., Eisinger, W. and Briggs, W. R. (2008) Phytochrome A regulates the intracellular distribution of phototropin 1-green fluorescent protein in Arabidopsis thaliana. Plant Cell 20: 2835-2847


Hayashi, M., Inoue, S., Ueno, Y. and Kinoshita, T. (2017) A Raf-like protein kinase BHP mediates blue light-dependent stomatal opening.Sci Rep 7: 45586 www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from

Copyright © 2020 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Aihara%2C Y%2E%2C Tabata%2C R%2E%2C Suzuki%2C T%2E%2C Shimazaki%2C K%2E and Nagatani%2C A%2E %282008%29 Molecular basis of the functional specificities of phototropin 1 and 2%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Aihara,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular basis of the functional specificities of phototropin 1 and 2&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular basis of the functional specificities of phototropin 1 and 2&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Aihara,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Barton%2C K%2E A%2E%2C Schattat%2C M%2E H%2E%2C Jakob%2C T%2E%2C Hause%2C G%2E%2C Wilhelm%2C C%2E%2C Mckenna%2C J%2E F%2E%2C M�th�%2C C%2E%2C Runions%2C J%2E%2C Van Damme%2C D%2E and Mathur%2C J%2E %282016%29 Epidermal pavement cells of Arabidopsis have chloroplasts%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Barton,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Epidermal pavement cells of Arabidopsis have chloroplasts&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Epidermal pavement cells of Arabidopsis have chloroplasts&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Barton,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Boex%2DFontvieille%2C E%2E%2C Jossier%2C M%2E%2C Davanture%2C M%2E%2C Zivy%2C M%2E%2C Hodges%2C M%2E and Tcherkez%2C G%2E %282014%29 Differential protein phosphorylation regulates chloroplast movement in response to strong light and darkness in Arabidopsis thaliana%2E Plant Mol Biol Rep&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Boex-Fontvieille,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Differential protein phosphorylation regulates chloroplast movement in response to strong light and darkness in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Differential protein phosphorylation regulates chloroplast movement in response to strong light and darkness in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Boex-Fontvieille,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Christie%2C J%2EM%2E %282007%29 Phototropin blue%2Dlight receptors%2E Annu Rev Plant Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Christie,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropin blue-light receptors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropin blue-light receptors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Christie,&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Christie%2C J%2E M%2E%2C Reymond%2C P%2E%2C Powell%2C G%2E K%2E%2C Bernasconi%2C P%2E%2C Raibekas%2C A%2E A%2E%2C Liscum%2C E%2E and Briggs%2C W%2E R%2E %281998%29 Arabidopsis NPH1%3A A flavoprotein with the properties of a photoreceptor for phototropism%2E Science&dopt=abstract


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Christie,&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Christie%2C J%2E M%2E%2C Yang%2C H%2E%2C Richter%2C G%2E L%2E%2C Sullivan%2C S%2E%2C Thomson%2C C%2EE%2E%2C Lin%2C J%2E%2C Titapiwatanakun%2C B%2E%2C Ennis%2C M%2E%2C Kaiserli%2C E%2E%2C Lee%2C O%2E R%2E%2C Adamec%2C J%2E%2C Peer%2C W%2E A%2E and Murphy%2C A%2E S%2E %282011%29 phot1 inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required for phototropism%2E PLoS Biol 9%3A e&dopt=abstract


https://scholar.google.com/scholar?as_q=phot1 inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required for phototropism.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=phot1 inhibition of ABCB19 primes lateral auxin fluxes in the shoot apex required for phototropism.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Christie,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Clough S%2E J%2E and Bent%2C A%2E F%2E %281998%29 Floral dip%3A a simplified method for Agrobacterium%2Dmediated transformation of Arabidopsis thaliana%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Clough&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Clough&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=de Carbonnel%2C M%2E%2C Davis%2C P%2E%2C Roelfsema%2C M%2E R%2E%2C Inoue%2C S%2E%2C Schepens%2C I%2E%2C Lariguet%2C P%2E%2C Geisler%2C M%2E%2C Shimazaki%2C K%2E%2C Hangarter%2C R%2E and Fankhauser%2C C%2E %282010%29 The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element that regulates leaf flattening and leaf positioning%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=de&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element that regulates leaf flattening and leaf positioning&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element that regulates leaf flattening and leaf positioning&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=de&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Demarsy%2C E%2E%2C Schepens%2C I%2E%2C Okajima%2C K%2E%2C Hersch%2C M%2E%2C Bergmann%2C S%2E%2C Christie%2C J%2E M%2E%2C Shimazaki%2C K%2E%2C Tokutomi%2C S%2E and Fankhauser%2C C%2E %282012%29 Phytochrome Kinase Substrate 4 is phosphorylated by the phototropin 1 photoreceptor%2E EMBO J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Demarsy,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochrome Kinase Substrate 4 is phosphorylated by the phototropin 1 photoreceptor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochrome Kinase Substrate 4 is phosphorylated by the phototropin 1 photoreceptor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Demarsy,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Franklin%2C K%2EA%2E and Quail%2C P%2EH%2E %282010%29 Phytochrome functions in Arabidopsis development%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Franklin,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochrome functions in Arabidopsis development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochrome functions in Arabidopsis development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Franklin,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Folta%2C K%2EM%2E and Kaufman%2C L%2ES%2E %282003%29 Phototropin 1 is required for high%2Dfluence blue%2Dlight%2Dmediated mRNA destabilization%2E Plant Mol Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Folta,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropin 1 is required for high-fluence blue-light-mediated mRNA destabilization&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropin 1 is required for high-fluence blue-light-mediated mRNA destabilization&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Folta,&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Folta%2C K%2EM%2E and Spalding%2C E%2EP%2E %282001%29 Unexpected roles for cryptochrome 2 and phototropin revealed by high%2Dresolution analysis of blue light%2Dmediated hypocotyl growth inhibition%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Folta,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Unexpected roles for cryptochrome 2 and phototropin revealed by high-resolution analysis of blue light-mediated hypocotyl growth inhibition&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Unexpected roles for cryptochrome 2 and phototropin revealed by high-resolution analysis of blue light-mediated hypocotyl growth inhibition&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Folta,&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Gotoh%2C E%2E%2C Suetsugu%2C N%2E%2C Yamori%2C W%2E%2C Ishishita%2C K%2E%2C Kiyabu%2C R%2E%2C Fukuda%2C M%2E%2C Higa%2C T%2E%2C Shirouchi%2C B%2E and Wada%2C M%2E %282018%29 Chloroplast accumulation response enhances leaf photosynthesis and plant biomass production%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gotoh,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast accumulation response enhances leaf photosynthesis and plant biomass production&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast accumulation response enhances leaf photosynthesis and plant biomass production&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gotoh,&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Han%2C I%2E S%2E%2C Tseng%2C T%2E S%2E%2C Eisinger%2C W%2E and Briggs%2C W%2E R%2E %282008%29 Phytochrome A regulates the intracellular distribution of phototropin 1%2Dgreen fluorescent protein in Arabidopsis thaliana%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Han,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochrome A regulates the intracellular distribution of phototropin 1-green fluorescent protein in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochrome A regulates the intracellular distribution of phototropin 1-green fluorescent protein in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Han,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1



Hayashi, Y., Nakamura, S., Takemiya, A., Takahashi, Y., Shimazaki, K. and Kinoshita, T. (2010) Biochemical characterization of in vitrophosphorylation and dephosphorylation of the plasma membrane H+-ATPase. Plant Cell Physiol 51: 1186-1196


Higa, T., Hasegawa, S., Hayasaki, Y., Kodama, Y. and Wada, M. (2017) Temperature-dependent signal transmission in chloroplastaccumulation response. J Plant Research 130: 779-789


Higa, T., Suetsugu, N., Kong, SG. and Wada, M. (2014) Actin-dependent plastid movement is required for motive force generation indirectional nuclear movement in plants. Proc Natl Acad Sci USA 111: 4327-4331


Hiyama, A., Takemiya, A., Munemasa, S., Okuma, E., Sugiyama, N., Tada, Y., Murata, T. and Shimazaki, K. (2017) Blue light and CO2signals converge to regulate light-induced stomatal opening. Nat Commun 8: 1284


Huala, E., Oeller, P. W., Liscum, E., Han, I. S., Larsen, E. and Briggs, W. R. (1997) Arabidopsis NPH1: A protein kinase with a putativeredox-sensing domain. Science 278:2120-2123.


Inada, S., Ohgishi, M., Mayama, T., Okada, K. and Sakai, T. (2004) RPT2 is a signal transducer involved in phototropic response andstomatal opening by association with phototropin 1 in Arabidopsis thaliana. Plant Cell 16: 887-896


Inoue, S., Kinoshita, T., Matsumoto, M., Nakayama, K., Doi, M. and Shimazaki, K. (2008a) Blue light-induced autophosphorylation ofphototropin is a primary step for signaling. Proc Natl Acad Sci USA 105: 5626-5631


Inoue, S., Kinoshita, T., Takemiya, A., Doi, M. and Shimazaki, K. (2008b) Leaf Positioning of Arabidopsis in Response to Blue Light. MolPlant 1: 15-26


Inoue, S., Matsushita, T., Tomokiyo, Y., Matsumoto, M., Nakayama, K., Kinoshita, T. and Shimazaki, K. (2011) Functional analyses of theactivation loop of phototropin 2 in Arabidopsis. Plant Physiol 156: 117-128


Ishishita, K., Suetsugu, N., Hirose, Y., Higa, T., Doi, M., Wada, M., Matsushita, T. and Gotoh, E. (2016) Functional characterization ofblue-light-induced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis. J Plant Res 129: 175-187


Iwabuchi, K., Sakai, T. and Takagi, S. (2007) Blue light-dependent nuclear positioning in Arabidopsis thaliana leaf cells. Plant CellPhysiol 48: 1291-1298


Jenkins, G. I. (2017) Photomorphogenic responses to ultraviolet-B light. Plant Cell Environ 40: 2544-2557Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kadota, A., Yamada, N., Suetsugu, N., Hirose, M., Saito, C., Shoda, K., Ichikawa, S., Kagawa, T., Nakano, A. and Wada, M. (2009) Shortactin-based mechanism for light-directed chloroplast movement in Arabidopsis. Proc Natl Acad Sci USA 106: 13106–13111.


Kagawa, T., Sakai, T., Suetsugu, N., Oikawa, K., Ishiguro, S., Kato, T., Tabata, S., Okada, K. and Wada, M. (2001) Arabidopsis NPL1: Aphototropin homolog controlling the chloroplast high-light avoidance response. Science 291:2138-2141


Kagawa, T. and Wada, M. (1999) Chloroplast-avoidance response induced by high-fluence blue light in prothallial cells of the fernAdiantum capillus-veneris as analyzed by microbeam irradiation. Plant Physiol 119:917-923

Pubmed: Author and Title www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Hayashi%2C M%2E%2C Inoue%2C S%2E%2C Ueno%2C Y%2E and Kinoshita%2C T%2E %282017%29 A Raf%2Dlike protein kinase BHP mediates blue light%2Ddependent stomatal opening%2E Sci Rep&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hayashi,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A Raf-like protein kinase BHP mediates blue light-dependent stomatal opening.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A Raf-like protein kinase BHP mediates blue light-dependent stomatal opening.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hayashi,&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Hayashi%2C Y%2E%2C Nakamura%2C S%2E%2C Takemiya%2C A%2E%2C Takahashi%2C Y%2E%2C Shimazaki%2C K%2E and Kinoshita%2C T%2E %282010%29 Biochemical characterization of in vitro phosphorylation and dephosphorylation of the plasma membrane H%2B%2DATPase%2E Plant Cell Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hayashi,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Biochemical characterization of in vitro phosphorylation and dephosphorylation of the plasma membrane H+-ATPase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Biochemical characterization of in vitro phosphorylation and dephosphorylation of the plasma membrane H+-ATPase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hayashi,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Higa%2C T%2E%2C Hasegawa%2C S%2E%2C Hayasaki%2C Y%2E%2C Kodama%2C Y%2E and Wada%2C M%2E %282017%29 Temperature%2Ddependent signal transmission in chloroplast accumulation response%2E J Plant Research&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Higa,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Temperature-dependent signal transmission in chloroplast accumulation response&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Temperature-dependent signal transmission in chloroplast accumulation response&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Higa,&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Higa%2C T%2E%2C Suetsugu%2C N%2E%2C Kong%2C SG%2E and Wada%2C M%2E %282014%29 Actin%2Ddependent plastid movement is required for motive force generation in directional nuclear movement in plants%2E Proc Natl Acad Sci USA&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Higa,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Actin-dependent plastid movement is required for motive force generation in directional nuclear movement in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Actin-dependent plastid movement is required for motive force generation in directional nuclear movement in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Higa,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Hiyama%2C A%2E%2C Takemiya%2C A%2E%2C Munemasa%2C S%2E%2C Okuma%2C E%2E%2C Sugiyama%2C N%2E%2C Tada%2C Y%2E%2C Murata%2C T%2E and Shimazaki%2C K%2E %282017%29 Blue light and CO2 signals converge to regulate light%2Dinduced stomatal opening%2E Nat Commun&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hiyama,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light and CO2 signals converge to regulate light-induced stomatal opening.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light and CO2 signals converge to regulate light-induced stomatal opening.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hiyama,&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Huala%2C E%2E%2C Oeller%2C P%2E W%2E%2C Liscum%2C E%2E%2C Han%2C I%2E S%2E%2C Larsen%2C E%2E and Briggs%2C W%2E R%2E %281997%29 Arabidopsis NPH1%3A A protein kinase with a putative redox%2Dsensing domain%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Huala,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Huala,&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Inada%2C S%2E%2C Ohgishi%2C M%2E%2C Mayama%2C T%2E%2C Okada%2C K%2E and Sakai%2C T%2E %282004%29 RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin 1 in Arabidopsis thaliana%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Inada,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin 1 in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin 1 in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Inada,&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Inoue%2C S%2E%2C Kinoshita%2C T%2E%2C Matsumoto%2C M%2E%2C Nakayama%2C K%2E%2C Doi%2C M%2E and Shimazaki%2C K%2E %282008a%29 Blue light%2Dinduced autophosphorylation of phototropin is a primary step for signaling%2E Proc Natl Acad Sci USA&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Inoue,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light-induced autophosphorylation of phototropin is a primary step for signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light-induced autophosphorylation of phototropin is a primary step for signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Inoue,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Inoue%2C S%2E%2C Kinoshita%2C T%2E%2C Takemiya%2C A%2E%2C Doi%2C M%2E and Shimazaki%2C K%2E %282008b%29 Leaf Positioning of Arabidopsis in Response to Blue Light%2E Mol Plant&dopt=abstract


https://scholar.google.com/scholar?as_q=Leaf Positioning of Arabidopsis in Response to Blue Light&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Leaf Positioning of Arabidopsis in Response to Blue Light&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Inoue,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Inoue%2C S%2E%2C Matsushita%2C T%2E%2C Tomokiyo%2C Y%2E%2C Matsumoto%2C M%2E%2C Nakayama%2C K%2E%2C Kinoshita%2C T%2E and Shimazaki%2C K%2E %282011%29 Functional analyses of the activation loop of phototropin 2 in Arabidopsis%2E Plant Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Functional analyses of the activation loop of phototropin 2 in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Functional analyses of the activation loop of phototropin 2 in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Inoue,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Ishishita%2C K%2E%2C Suetsugu%2C N%2E%2C Hirose%2C Y%2E%2C Higa%2C T%2E%2C Doi%2C M%2E%2C Wada%2C M%2E%2C Matsushita%2C T%2E and Gotoh%2C E%2E %282016%29 Functional characterization of blue%2Dlight%2Dinduced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis%2E J Plant Res&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ishishita,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Functional characterization of blue-light-induced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Functional characterization of blue-light-induced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ishishita,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Iwabuchi%2C K%2E%2C Sakai%2C T%2E and Takagi%2C S%2E %282007%29 Blue light%2Ddependent nuclear positioning in Arabidopsis thaliana leaf cells%2E Plant Cell Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Iwabuchi,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light-dependent nuclear positioning in Arabidopsis thaliana leaf cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light-dependent nuclear positioning in Arabidopsis thaliana leaf cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Iwabuchi,&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Jenkins%2C G%2E I%2E %282017%29 Photomorphogenic responses to ultraviolet%2DB light%2E Plant Cell Environ&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jenkins,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Photomorphogenic responses to ultraviolet-B light&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Photomorphogenic responses to ultraviolet-B light&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jenkins,&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kadota%2C A%2E%2C Yamada%2C N%2E%2C Suetsugu%2C N%2E%2C Hirose%2C M%2E%2C Saito%2C C%2E%2C Shoda%2C K%2E%2C Ichikawa%2C S%2E%2C Kagawa%2C T%2E%2C Nakano%2C A%2E and Wada%2C M%2E %282009%29 Short actin%2Dbased mechanism for light%2Ddirected chloroplast movement in Arabidopsis%2E Proc Natl Acad Sci USA 106%3A 13106%26%23x&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kadota,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Short actin-based mechanism for light-directed chloroplast movement in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Short actin-based mechanism for light-directed chloroplast movement in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kadota,&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kagawa%2C T%2E%2C Sakai%2C T%2E%2C Suetsugu%2C N%2E%2C Oikawa%2C K%2E%2C Ishiguro%2C S%2E%2C Kato%2C T%2E%2C Tabata%2C S%2E%2C Okada%2C K%2E and Wada%2C M%2E %282001%29 Arabidopsis NPL1%3A A phototropin homolog controlling the chloroplast high%2Dlight avoidance response%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kagawa,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kagawa,&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kagawa%2C T%2E and Wada%2C M%2E %281999%29 Chloroplast%2Davoidance response induced by high%2Dfluence blue light in prothallial cells of the fern Adiantum capillus%2Dveneris as analyzed by microbeam irradiation%2E Plant Physiol&dopt=abstract


Google Scholar: Author Only Title Only Author and Title

Kami, C., Lorrain, S., Hornitschek, P. and Fankhauser, C. (2010) Light-regulated plant growth and development. Curr Top Dev Biol 91:29-66


Kasahara, M., Kagawa, T., Oikawa, K., Suetsugu, N., Miyao, M and Wada, M. (2002) Chloroplast avoidance movement reducesphotodamage in plants. Nature 420: 829-832


Kikuchi, S., Hirohashi, T. and Nakai, M. (2006) Characterization of the preprotein translocon at the outer envelope nembrane ofchloroplasts by blue native PAGE. Plant Cell Physiol 47: 363-371


Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M. and Shimazaki, K. (2001) phot1 and phot2 mediate blue light regulation ofstomatal opening. Nature 414: 656-660


Knieb, E., Salomon, M. and Rüdiger, W. (2004) Tissue-specific and subcellular localization of phototropin determined by immuno-blotting. Planta 218: 843-851


Kodama, Y. (2016) Time gating of chloroplast autofluorescence allows clearer fluorescence imaging in Planta. PLoS One 11: e0152484.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Komatsu, A., Terai, M., Ishizaki, K., Suetsugu, N., Tsuboi, H., Nishihama, R., Yamato, K. T., Wada, M. and Kohchi, T. (2014) Phototropinencoded by a single-copy gene mediates chloroplast photorelocation movements in the liverwort Marchantia polymorpha. PlantPhysiol 166: 411-427.


Kong, S. -G., Arai, Y., Suetsugu, N., Yanagida, M. and Wada, M. (2013a) Rapid severing and motility of chloroplast-actin filaments arerequired for the chloroplast avoidance response in Arabidopsis. Plant Cell 25: 572-590


Kong, S. -G., Kagawa, T., Wada, M. and Nagatani, A. (2013b) A C-terminal membrane association domain of phototropin 2 is necessaryfor chloroplast movement. Plant Cell Physiol 54: 57-68


Kong, S. -G., Suetsugu, N., Kikuchi, S., Nakai, M., Nagatani, A. and Wada, M. (2013c) Both phototropin 1 and 2 localize on thechloroplast outer membrane with distinct localization activity. Plant Cell Physiol 54: 80-92


Kong, S. -G., Suzuki, T., Tamura, K., Mochizuki, N., Hara-Nishimura, I. and Nagatani, A. (2006) Blue light-induced association ofphototropin 2 with the Golgi apparatus. Plant J 45: 994-1005.


Kozuka, T., Kong, S. -G., Doi, M., Shimazaki, K. and Nagatani, A. (2011) Tissue-autonomous promotion of palisade cell development byphototropin 2 in Arabidopsis. Plant Cell 23:3684-3695


Lariguet P, Schepens I, Hodgson D, Pedmale UV, Trevisan M, Kami C, de Carbonnel M, Alonso JM, Ecker JR, Liscum E, Fankhauser C.(2006) PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism. Proc Natl Acad Sci USA103: 10134-10139


Larsson, C., Sommarin, M. and Widell, S. (1994) Isolation of highly purified plant plasma membranes and separation of inside-out andright-side-out vesicles. Methods Enzymol 228: 451-469.


Lee, Y. J., Kim, D.H., Kim, Y. W. and Hwang, I. (2001) Identification of a signal that distinguishes between the chloroplast outerenvelope membrane and the endomembrane system in vivo. Plant Cell 13: 2175-2190 www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from


https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kagawa,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast-avoidance response induced by high-fluence blue light in prothallial cells of the fern Adiantum capillus-veneris as analyzed by microbeam irradiation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast-avoidance response induced by high-fluence blue light in prothallial cells of the fern Adiantum capillus-veneris as analyzed by microbeam irradiation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kagawa,&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kami%2C C%2E%2C Lorrain%2C S%2E%2C Hornitschek%2C P%2E and Fankhauser%2C C%2E %282010%29 Light%2Dregulated plant growth and development%2E Curr Top Dev Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kami,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Light-regulated plant growth and development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Light-regulated plant growth and development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kami,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kasahara%2C M%2E%2C Kagawa%2C T%2E%2C Oikawa%2C K%2E%2C Suetsugu%2C N%2E%2C Miyao%2C M and Wada%2C M%2E %282002%29 Chloroplast avoidance movement reduces photodamage in plants%2E Nature&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kasahara,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast avoidance movement reduces photodamage in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast avoidance movement reduces photodamage in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kasahara,&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kikuchi%2C S%2E%2C Hirohashi%2C T%2E and Nakai%2C M%2E %282006%29 Characterization of the preprotein translocon at the outer envelope nembrane of chloroplasts by blue native PAGE%2E Plant Cell Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kikuchi,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Characterization of the preprotein translocon at the outer envelope nembrane of chloroplasts by blue native PAGE&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Characterization of the preprotein translocon at the outer envelope nembrane of chloroplasts by blue native PAGE&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kikuchi,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kinoshita%2C T%2E%2C Doi%2C M%2E%2C Suetsugu%2C N%2E%2C Kagawa%2C T%2E%2C Wada%2C M%2E and Shimazaki%2C K%2E %282001%29 phot1 and phot2 mediate blue light regulation of stomatal opening%2E Nature&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kinoshita,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=phot1 and phot2 mediate blue light regulation of stomatal opening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=phot1 and phot2 mediate blue light regulation of stomatal opening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kinoshita,&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Knieb%2C E%2E%2C Salomon%2C M%2E and R�diger%2C W%2E %282004%29 Tissue%2Dspecific and subcellular localization of phototropin determined by immuno%2Dblotting%2E Planta&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Knieb,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Tissue-specific and subcellular localization of phototropin determined by immuno-blotting&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Tissue-specific and subcellular localization of phototropin determined by immuno-blotting&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Knieb,&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kodama%2C Y%2E %282016%29 Time gating of chloroplast autofluorescence allows clearer fluorescence imaging in Planta%2E PLoS One 11%3A e&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kodama,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Time gating of chloroplast autofluorescence allows clearer fluorescence imaging in Planta&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Time gating of chloroplast autofluorescence allows clearer fluorescence imaging in Planta&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kodama,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Komatsu%2C A%2E%2C Terai%2C M%2E%2C Ishizaki%2C K%2E%2C Suetsugu%2C N%2E%2C Tsuboi%2C H%2E%2C Nishihama%2C R%2E%2C Yamato%2C K%2E T%2E%2C Wada%2C M%2E and Kohchi%2C T%2E %282014%29 Phototropin encoded by a single%2Dcopy gene mediates chloroplast photorelocation movements in the liverwort Marchantia polymorpha%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Komatsu,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropin encoded by a single-copy gene mediates chloroplast photorelocation movements in the liverwort Marchantia polymorpha&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropin encoded by a single-copy gene mediates chloroplast photorelocation movements in the liverwort Marchantia polymorpha&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Komatsu,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kong%2C S%2E %2DG%2E%2C Arai%2C Y%2E%2C Suetsugu%2C N%2E%2C Yanagida%2C M%2E and Wada%2C M%2E %282013a%29 Rapid severing and motility of chloroplast%2Dactin filaments are required for the chloroplast avoidance response in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kong,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Rapid severing and motility of chloroplast-actin filaments are required for the chloroplast avoidance response in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Rapid severing and motility of chloroplast-actin filaments are required for the chloroplast avoidance response in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kong,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kong%2C S%2E %2DG%2E%2C Kagawa%2C T%2E%2C Wada%2C M%2E and Nagatani%2C A%2E %282013b%29 A C%2Dterminal membrane association domain of phototropin 2 is necessary for chloroplast movement%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=A C-terminal membrane association domain of phototropin 2 is necessary for chloroplast movement&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A C-terminal membrane association domain of phototropin 2 is necessary for chloroplast movement&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kong,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kong%2C S%2E %2DG%2E%2C Suetsugu%2C N%2E%2C Kikuchi%2C S%2E%2C Nakai%2C M%2E%2C Nagatani%2C A%2E and Wada%2C M%2E %282013c%29 Both phototropin 1 and 2 localize on the chloroplast outer membrane with distinct localization activity%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Both phototropin 1 and 2 localize on the chloroplast outer membrane with distinct localization activity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Both phototropin 1 and 2 localize on the chloroplast outer membrane with distinct localization activity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kong,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kong%2C S%2E %2DG%2E%2C Suzuki%2C T%2E%2C Tamura%2C K%2E%2C Mochizuki%2C N%2E%2C Hara%2DNishimura%2C I%2E and Nagatani%2C A%2E %282006%29 Blue light%2Dinduced association of phototropin 2 with the Golgi apparatus%2E Plant J&dopt=abstract


https://scholar.google.com/scholar?as_q=Blue light-induced association of phototropin 2 with the Golgi apparatus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light-induced association of phototropin 2 with the Golgi apparatus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kong,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kozuka%2C T%2E%2C Kong%2C S%2E %2DG%2E%2C Doi%2C M%2E%2C Shimazaki%2C K%2E and Nagatani%2C A%2E %282011%29 Tissue%2Dautonomous promotion of palisade cell development by phototropin 2 in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kozuka,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Tissue-autonomous promotion of palisade cell development by phototropin 2 in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Tissue-autonomous promotion of palisade cell development by phototropin 2 in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kozuka,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lariguet P%2C Schepens I%2C Hodgson D%2C Pedmale UV%2C Trevisan M%2C Kami C%2C de Carbonnel M%2C Alonso JM%2C Ecker JR%2C Liscum E%2C Fankhauser C%2E %282006%29 PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism%2E Proc Natl Acad Sci USA&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lariguet&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lariguet&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Larsson%2C C%2E%2C Sommarin%2C M%2E and Widell%2C S%2E %281994%29 Isolation of highly purified plant plasma membranes and separation of inside%2Dout and right%2Dside%2Dout vesicles%2E Methods Enzymol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Larsson,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Isolation of highly purified plant plasma membranes and separation of inside-out and right-side-out vesicles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Isolation of highly purified plant plasma membranes and separation of inside-out and right-side-out vesicles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Larsson,&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1



Liang, T., Yang, Y. and Liu, H. (2019) Signal transduction mediated by the plant UV-B photoreceptor UVR8. J Plant Res 221: 1247-1252Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Liu, B., Yang, Z., Gomez, A., Liu, B., Lin, C. and Oka, Y. (2016) Signaling mechanisms of plant cryptochromes in Arabidopsis thaliana. JPlant Res 129: 137-148


Luesse, D. R., DeBlasio, S. L. and Hangarter, R. P. (2010) Integration of phot1, phot2, and PhyB signalling in light-induced chloroplastmovements. J Exp Bot 61: 4387-4397


Marten, H., Hedrich, R. and Roelfsema, M. R. (2007) Blue light inhibits guard cell plasma membrane anion channels in a phototropin-dependent manner. Plant J 50: 29-39


Motochoulski, A. and Liscum, E. (1999) Arabidopsis NPH3: A NPH1 photoreceptor-interacting protein essential for phototropism.Science 286: 961-964


Oikawa, K., Kasahara, M., Kiyosue, T., Kagawa, T., Suetsugu, N., Takahashi, F., Kanegae, T., Niwa, Y., Kadota, A. and Wada, M. (2003)CHLOROPLAST UNUSUAL POSITIONING is essential for proper chloroplast positioning. Plant Cell 15: 2805-2815


Oikawa, K., Yamasato, A., Kong, S. G., Kasahara, M., Nakai, M., Takahashi, F., Ohura, Y., Kagawa, T. and Wada, M. (2008) Chloroplastouter envelope protein CHUP1 is essential for chloroplast anchorage to the plasma membrane and chloroplast movement. PlantPhysiol 148: 829-842


Paik, I. and Huq, E (2019) Plant photoreceptors: Multi-functional sensory proteins and their signaling networks. Semin Cell Dev Biol 92:114-121


Pham, V. N., Kathare, P. K. and Huq, E. (2018) Phytochromes and phytochrome interacting factors. Plant Physiol 176: 1025-1038Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Preuten, T., Blackwood, L., Christie, J. M. and Fankhauser, C. (2015) Lipid anchoring of Arabidopsis phototropin 1 to assess thefunctional significance of receptor internalization: should I stay or should I go? New Phytol 206: 1038-1050


Sakai, T., Kagawa, T., Kasahara, M., Swartz, T.E., Christie, J.M., Briggs, W.R., Wada, M., and Okada, K. (2001) Arabidopsis nph1 andnpl1: blue light receptors that mediate both phototropism and chloroplast relocation. Proc Natl Acad Sci USA 98: 6969–6974.


Sakai, T., Wada, T., Ishiguro, S. and Okada, K. (2000) RPT2: A signal transducer of the phototropic response in Arabidopsis. Plant Cell12: 225-236


Sakamoto, K. and Briggs, W. R. (2002) Cellular and subcellular localization of phototropin 1. Plant Cell 14: 1723-1735Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Suetsugu, N., Kagawa, T. and Wada, M. (2005) An auxilin-like J-domain protein, JAC1, regulates phototropin-mediated chloroplastmovement in Arabidopsis. Plant Physiol 139: 151-162


Suetsugu, N., Takemiya, A., Kong, S. -G., Higa, T., Komatsu, A., Shimazaki, K., Kohchi, T. and Wada, M. (2016) RPT2/NCH1 subfamily ofNPH3-like proteins is essential for the chloroplast accumulation response in land plants. Proc Natl Acad Sci USA 113: 10424-10429

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon July 15, 2020 - Published by Downloaded from


https://www.ncbi.nlm.nih.gov/pubmed?term=Lee%2C Y%2E J%2E%2C Kim%2C D%2EH%2E%2C Kim%2C Y%2E W%2E and Hwang%2C I%2E %282001%29 Identification of a signal that distinguishes between the chloroplast outer envelope membrane and the endomembrane system in vivo%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Identification of a signal that distinguishes between the chloroplast outer envelope membrane and the endomembrane system in vivo&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Identification of a signal that distinguishes between the chloroplast outer envelope membrane and the endomembrane system in vivo&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee,&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Liang%2C T%2E%2C Yang%2C Y%2E and Liu%2C H%2E %282019%29 Signal transduction mediated by the plant UV%2DB photoreceptor UVR8%2E J Plant Res&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liang,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Signal transduction mediated by the plant UV-B photoreceptor UVR8&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Signal transduction mediated by the plant UV-B photoreceptor UVR8&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liang,&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Liu%2C B%2E%2C Yang%2C Z%2E%2C Gomez%2C A%2E%2C Liu%2C B%2E%2C Lin%2C C%2E and Oka%2C Y%2E %282016%29 Signaling mechanisms of plant cryptochromes in Arabidopsis thaliana%2E J Plant Res&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Signaling mechanisms of plant cryptochromes in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Signaling mechanisms of plant cryptochromes in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Luesse%2C D%2E R%2E%2C DeBlasio%2C S%2E L%2E and Hangarter%2C R%2E P%2E %282010%29 Integration of phot1%2C phot2%2C and PhyB signalling in light%2Dinduced chloroplast movements%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Luesse,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Luesse,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Marten%2C H%2E%2C Hedrich%2C R%2E and Roelfsema%2C M%2E R%2E %282007%29 Blue light inhibits guard cell plasma membrane anion channels in a phototropin%2Ddependent manner%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Marten,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light inhibits guard cell plasma membrane anion channels in a phototropin-dependent manner&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Blue light inhibits guard cell plasma membrane anion channels in a phototropin-dependent manner&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Marten,&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Motochoulski%2C A%2E and Liscum%2C E%2E %281999%29 Arabidopsis NPH3%3A A NPH1 photoreceptor%2Dinteracting protein essential for phototropism%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Motochoulski,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Motochoulski,&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Oikawa%2C K%2E%2C Kasahara%2C M%2E%2C Kiyosue%2C T%2E%2C Kagawa%2C T%2E%2C Suetsugu%2C N%2E%2C Takahashi%2C F%2E%2C Kanegae%2C T%2E%2C Niwa%2C Y%2E%2C Kadota%2C A%2E and Wada%2C M%2E %282003%29 CHLOROPLAST UNUSUAL POSITIONING is essential for proper chloroplast positioning%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Oikawa,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=CHLOROPLAST UNUSUAL POSITIONING is essential for proper chloroplast positioning&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=CHLOROPLAST UNUSUAL POSITIONING is essential for proper chloroplast positioning&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Oikawa,&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Oikawa%2C K%2E%2C Yamasato%2C A%2E%2C Kong%2C S%2E G%2E%2C Kasahara%2C M%2E%2C Nakai%2C M%2E%2C Takahashi%2C F%2E%2C Ohura%2C Y%2E%2C Kagawa%2C T%2E and Wada%2C M%2E %282008%29 Chloroplast outer envelope protein CHUP1 is essential for chloroplast anchorage to the plasma membrane and chloroplast movement%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Oikawa,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast outer envelope protein CHUP1 is essential for chloroplast anchorage to the plasma membrane and chloroplast movement&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplast outer envelope protein CHUP1 is essential for chloroplast anchorage to the plasma membrane and chloroplast movement&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Oikawa,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Paik%2C I%2E and Huq%2C E %282019%29 Plant photoreceptors%3A Multi%2Dfunctional sensory proteins and their signaling networks%2E Semin Cell Dev Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Paik,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Plant photoreceptors: Multi-functional sensory proteins and their signaling networks&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Plant photoreceptors: Multi-functional sensory proteins and their signaling networks&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Paik,&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Pham%2C V%2E N%2E%2C Kathare%2C P%2E K%2E and Huq%2C E%2E %282018%29 Phytochromes and phytochrome interacting factors%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pham,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochromes and phytochrome interacting factors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phytochromes and phytochrome interacting factors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pham,&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Preuten%2C T%2E%2C Blackwood%2C L%2E%2C Christie%2C J%2E M%2E and Fankhauser%2C C%2E %282015%29 Lipid anchoring of Arabidopsis phototropin 1 to assess the functional significance of receptor internalization%3A should I stay or should I go%3F New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Preuten,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Lipid anchoring of Arabidopsis phototropin 1 to assess the functional significance of receptor internalization: should I stay or should I go&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Lipid anchoring of Arabidopsis phototropin 1 to assess the functional significance of receptor internalization: should I stay or should I go&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Preuten,&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Sakai%2C T%2E%2C Kagawa%2C T%2E%2C Kasahara%2C M%2E%2C Swartz%2C T%2EE%2E%2C Christie%2C J%2EM%2E%2C Briggs%2C W%2ER%2E%2C Wada%2C M%2E%2C and Okada%2C K%2E %282001%29 Arabidopsis nph1 and npl1%3A blue light receptors that mediate both phototropism and chloroplast relocation%2E Proc Natl Acad Sci USA 98%3A 6969%26%23x&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sakai,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sakai,&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Sakai%2C T%2E%2C Wada%2C T%2E%2C Ishiguro%2C S%2E and Okada%2C K%2E %282000%29 RPT2%3A A signal transducer of the phototropic response in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sakai,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sakai,&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Sakamoto%2C K%2E and Briggs%2C W%2E R%2E %282002%29 Cellular and subcellular localization of phototropin 1%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sakamoto,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Cellular and subcellular localization of phototropin 1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Cellular and subcellular localization of phototropin 1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sakamoto,&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Suetsugu%2C N%2E%2C Kagawa%2C T%2E and Wada%2C M%2E %282005%29 An auxilin%2Dlike J%2Ddomain protein%2C JAC1%2C regulates phototropin%2Dmediated chloroplast movement in Arabidopsis%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Suetsugu,&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suetsugu,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Suetsugu%2C N%2E%2C Takemiya%2C A%2E%2C Kong%2C S%2E %2DG%2E%2C Higa%2C T%2E%2C Komatsu%2C A%2E%2C Shimazaki%2C K%2E%2C Kohchi%2C T%2E and Wada%2C M%2E %282016%29 RPT2%2FNCH1 subfamily of NPH3%2Dlike proteins is essential for the chloroplast accumulation response in land plants%2E Proc Natl Acad Sci USA&dopt=abstract


https://scholar.google.com/scholar?as_q=RPT2/NCH1 subfamily of NPH3-like proteins is essential for the chloroplast accumulation response in land plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=RPT2/NCH1 subfamily of NPH3-like proteins is essential for the chloroplast accumulation response in land plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suetsugu,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1


Suetsugu, N. Kong, S. -G., Kasahara, M. and Wada, M. (2013) Both LOV1 and LOV2 domains of phototropin2 function as thephotosensory domain for hypocotyl phototopic responses in Arabidopsis thaliana (Brassicaceae). Am J Bot 100: 60-69


Suetsugu, N. and Wada, M. (2013) Evolution of three LOV blue light receptor families in green plants and photosyntheticstramenopiles: phototropin, ZTL/FKF1/LKP2 and aureochrome. Plant Cell Physiol 54: 8-23


Suetsugu, N., Yamada, N., Kagawa, T., Yonekura, H., Uyeda, T. Q., Kadota, A. and Wada, M. (2010) Two kinesin-like proteins mediateactin-based chloroplast movement in Arabidopsis thaliana. Proc Natl Acad Sci USA 107: 8860-8865


Sztatelman, 0., Łabuz, J., Hermanowicz, P., Banaś, A. K., Bażant, A., Zgłobicki, P, Aggarwal, C., Nadzieja, M., Krzeszowiec, W., Strzałka,W. and Gabryś, H. (2016) Fine tuning chloroplast movements through physical interactions between phototropins. J Exp Bot 67: 4963-4978


Takemiya, A., Inoue, S., Doi, M., Kinoshita, T. and Shimazaki, K. (2005) Phototropins promote plant growth in response to blue light inlow light environments. Plant Cell 17: 1120-1127


Takemiya, A., Kinoshita, T., Asanuma, M. and Shimazaki, K. (2006) Protein phosphatase 1 positively regulates stomatal opening inresponse to blue light in Vicia faba. Proc Natl Acad Sci USA 103: 13549-13554


Takemiya, A., Sugiyama, N., Fujimoto, H., Tsutsumi, T., Yamauchi, S., Hiyama, A., Tada, Y., Christie, J. M. and Shimazaki, K. (2013a)Phosphorylation of BLUS1 kinase by phototropins is a primary step in stomatal opening. Nat Commun 4: 2094


Takemiya, A., Yamauchi, S., Yano, T., Ariyoshi, C. and Shimazaki, K.(2013b) Identification of a regulatory subunit of protein phosphatase1 which mediates blue light signaling for stomatal opening. Plant Cell Physiol 54: 24-35


Tsuboi, H. and Wada, M. (2010) Speed of signal transfer in the chloroplast accumulation response. J Plant Res 123: 381-390Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Tsuboi, H. and Wada, M. (2011) Chloroplasts can move away in any direction to avoid strong light. J Plant Res 124: 201-210Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ushijima, T., Hanada, K., Gotoh, E., Yamori, W., Kodama, Y., Tanaka, H., Kusano, M., Fukushima, A., Tokizawa, M., Yamamoto, Y. Y.,Tada, Y., Suzuki, Y. and Matsushita, M. (2017) Light control protein localization through phytochrome-mediated alternative promoterselection. Cell 171: 1316-1325


Wada, M. and Kong, S. -G. (2011) Analysis of chloroplast movement and relocation in Arabidopsis. Methods Mol Biol 774: 215-234Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wan, Y.L., Eisinger, W., Ehrhardt, D., Kubitschek, U., Baluska, F. and Briggs, W. R. (2008) The subcellular localization and blue-lightinduced movement of phototropin 1-GFP in etiolated seedlings of Arabidopsis thaliana. Mol Plant 1:103-117


Wang, P., Zhang, J., Su, J., Wang, P., Liu, J., Liu, B., Feng, D., Wang, J. and Wang, H. (2013) The chloroplast Min system functionsdifferentially in two specific nongreen plastids in Arabidopsis thaliana. Plos ONE 8: e71190


Wu, F. H., Shen, S. C., Lee, L. Y. and Lee, S. H. (2009) Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method.Nature Methods 5:16



https://www.ncbi.nlm.nih.gov/pubmed?term=Suetsugu%2C N%2E Kong%2C S%2E %2DG%2E%2C Kasahara%2C M%2E and Wada%2C M%2E %282013%29 Both LOV1 and LOV2 domains of phototropin2 function as the photosensory domain for hypocotyl phototopic responses in Arabidopsis thaliana %28Brassicaceae%29%2E Am J Bot&dopt=abstract


https://scholar.google.com/scholar?as_q=Both LOV1 and LOV2 domains of phototropin2 function as the photosensory domain for hypocotyl phototopic responses in Arabidopsis thaliana (Brassicaceae)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Both LOV1 and LOV2 domains of phototropin2 function as the photosensory domain for hypocotyl phototopic responses in Arabidopsis thaliana (Brassicaceae)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suetsugu,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Suetsugu%2C N%2E and Wada%2C M%2E %282013%29 Evolution of three LOV blue light receptor families in green plants and photosynthetic stramenopiles%3A phototropin%2C ZTL%2FFKF1%2FLKP2 and aureochrome%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Evolution of three LOV blue light receptor families in green plants and photosynthetic stramenopiles: phototropin, ZTL/FKF1/LKP2 and aureochrome&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Evolution of three LOV blue light receptor families in green plants and photosynthetic stramenopiles: phototropin, ZTL/FKF1/LKP2 and aureochrome&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suetsugu,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Suetsugu%2C N%2E%2C Yamada%2C N%2E%2C Kagawa%2C T%2E%2C Yonekura%2C H%2E%2C Uyeda%2C T%2E Q%2E%2C Kadota%2C A%2E and Wada%2C M%2E %282010%29 Two kinesin%2Dlike proteins mediate actin%2Dbased chloroplast movement in Arabidopsis thaliana%2E Proc Natl Acad Sci USA&dopt=abstract


https://scholar.google.com/scholar?as_q=Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suetsugu,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Sztatelman%2C 0%2E%2C Łabuz%2C J%2E%2C Hermanowicz%2C P%2E%2C Bana�?%2C A%2E K%2E%2C Bażant%2C A%2E%2C Zg�?obicki%2C P%2C Aggarwal%2C C%2E%2C Nadzieja%2C M%2E%2C Krzeszowiec%2C W%2E%2C Strza�?ka%2C W%2E and Gabry�?%2C H%2E %282016%29 Fine tuning chloroplast movements through physical interactions between phototropins%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sztatelman,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Fine tuning chloroplast movements through physical interactions between phototropins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Fine tuning chloroplast movements through physical interactions between phototropins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sztatelman,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Takemiya%2C A%2E%2C Inoue%2C S%2E%2C Doi%2C M%2E%2C Kinoshita%2C T%2E and Shimazaki%2C K%2E %282005%29 Phototropins promote plant growth in response to blue light in low light environments%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Takemiya,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropins promote plant growth in response to blue light in low light environments&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phototropins promote plant growth in response to blue light in low light environments&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takemiya,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Takemiya%2C A%2E%2C Kinoshita%2C T%2E%2C Asanuma%2C M%2E and Shimazaki%2C K%2E %282006%29 Protein phosphatase 1 positively regulates stomatal opening in response to blue light in Vicia faba%2E Proc Natl Acad Sci USA&dopt=abstract


https://scholar.google.com/scholar?as_q=Protein phosphatase 1 positively regulates stomatal opening in response to blue light in Vicia faba&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Protein phosphatase 1 positively regulates stomatal opening in response to blue light in Vicia faba&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takemiya,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Takemiya%2C A%2E%2C Sugiyama%2C N%2E%2C Fujimoto%2C H%2E%2C Tsutsumi%2C T%2E%2C Yamauchi%2C S%2E%2C Hiyama%2C A%2E%2C Tada%2C Y%2E%2C Christie%2C J%2E M%2E and Shimazaki%2C K%2E %282013a%29 Phosphorylation of BLUS1 kinase by phototropins is a primary step in stomatal opening%2E Nat Commun&dopt=abstract


https://scholar.google.com/scholar?as_q=Phosphorylation of BLUS1 kinase by phototropins is a primary step in stomatal opening.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Phosphorylation of BLUS1 kinase by phototropins is a primary step in stomatal opening.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takemiya,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Takemiya%2C A%2E%2C Yamauchi%2C S%2E%2C Yano%2C T%2E%2C Ariyoshi%2C C%2E and Shimazaki%2C K%2E%282013b%29 Identification of a regulatory subunit of protein phosphatase 1 which mediates blue light signaling for stomatal opening%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Identification of a regulatory subunit of protein phosphatase 1 which mediates blue light signaling for stomatal opening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Identification of a regulatory subunit of protein phosphatase 1 which mediates blue light signaling for stomatal opening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takemiya,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Tsuboi%2C H%2E and Wada%2C M%2E %282010%29 Speed of signal transfer in the chloroplast accumulation response%2E J Plant Res&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tsuboi,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Speed of signal transfer in the chloroplast accumulation response&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Speed of signal transfer in the chloroplast accumulation response&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tsuboi,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Tsuboi%2C H%2E and Wada%2C M%2E %282011%29 Chloroplasts can move away in any direction to avoid strong light%2E J Plant Res&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tsuboi,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplasts can move away in any direction to avoid strong light&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Chloroplasts can move away in any direction to avoid strong light&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tsuboi,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Ushijima%2C T%2E%2C Hanada%2C K%2E%2C Gotoh%2C E%2E%2C Yamori%2C W%2E%2C Kodama%2C Y%2E%2C Tanaka%2C H%2E%2C Kusano%2C M%2E%2C Fukushima%2C A%2E%2C Tokizawa%2C M%2E%2C Yamamoto%2C Y%2E Y%2E%2C Tada%2C Y%2E%2C Suzuki%2C Y%2E and Matsushita%2C M%2E %282017%29 Light control protein localization through phytochrome%2Dmediated alternative promoter selection%2E Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ushijima,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Light control protein localization through phytochrome-mediated alternative promoter selection&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Light control protein localization through phytochrome-mediated alternative promoter selection&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ushijima,&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wada%2C M%2E and Kong%2C S%2E %2DG%2E %282011%29 Analysis of chloroplast movement and relocation in Arabidopsis%2E Methods Mol Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wada,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Analysis of chloroplast movement and relocation in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Analysis of chloroplast movement and relocation in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wada,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wan%2C Y%2EL%2E%2C Eisinger%2C W%2E%2C Ehrhardt%2C D%2E%2C Kubitschek%2C U%2E%2C Baluska%2C F%2E and Briggs%2C W%2E R%2E %282008%29 The subcellular localization and blue%2Dlight induced movement of phototropin 1%2DGFP in etiolated seedlings of Arabidopsis thaliana%2E Mol Plant&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wan,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The subcellular localization and blue-light induced movement of phototropin 1-GFP in etiolated seedlings of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The subcellular localization and blue-light induced movement of phototropin 1-GFP in etiolated seedlings of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wan,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wang%2C P%2E%2C Zhang%2C J%2E%2C Su%2C J%2E%2C Wang%2C P%2E%2C Liu%2C J%2E%2C Liu%2C B%2E%2C Feng%2C D%2E%2C Wang%2C J%2E and Wang%2C H%2E %282013%29 The chloroplast Min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana%2E Plos ONE 8%3A e&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The chloroplast Min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The chloroplast Min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wu%2C F%2E H%2E%2C Shen%2C S%2E C%2E%2C Lee%2C L%2E Y%2E and Lee%2C S%2E H%2E %282009%29 Tape%2DArabidopsis Sandwich %2D a simpler Arabidopsis protoplast isolation method%2E Nature Methods&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wu,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wu,&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


Yanai, H. Statcel 3 – The useful add-in software forms on Excel (3rd ed). OMS, Tokyo, Japan. (2011).Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title


https://www.ncbi.nlm.nih.gov/pubmed?term=Yanai%2C H%2E Statcel 3 %26%23x2013%3B The useful add%2Din software forms on Excel %283rd ed%29%2E OMS%2C Tokyo%2C Japan&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yanai,&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The useful add-in software forms on Excel (3rd ed).&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The useful add-in software forms on Excel (3rd ed).&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yanai,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


Documents

Phototropin 2 contributes to the chloroplast …...2020/03/19 · 99 and avoidance (Komatsu et al., 2014). It is localized on the chloroplast outer envelope and the It is localized