ביולוגיה מולקולרית פתרונות

  • View
    634

  • Download
    4

Embed Size (px)

Transcript

, . 1 : 90.11.8

1. " " - ]%23 = ] , A] = [T- ]%63 =%46-%001 = ]C] + [G ]%81 = ]G]= [C 2 . " - A ,T G ,C % A=%T- % G=%C ) -1)A+C G+T A+G C+T

3. %A 02 03 51 52 %G 03 02 03 53 %T 0 0 52 52 %C 02 02 03 51 %U 03 03 0 0 1 2 3 4

" - " - " - " -

4. . ) pH ( ", -linking number 5. . - ) relaxed - ) ( , ( 6. . AAGCTT" 4/1 6904/1 = 6)4/1( = 4/1 x 1/4 x1/4 x 1/4 x 1/4 x 6904 bp . AATGCATT" )4/1(8 = 63556/1

63556 bp

. 2/1, . - GA Py Pu TC 4/1 4201/1 = 4/1 x 1/4 x1/2 x 1/2 x 1/4 x 4201 bp . -N , =1 GANNTC" 4/1 652/1 = 4/1 x 1/4 x1x 1 x 1/4 x 652 bp

7. " - -. G 6/1, .C 3/2= ]] ,A+T = A 3/1 = .T AAGCTT" 3/1 6192/1 = 3/1 x 1/3 x1/6 x 1/6 x 1/3 x 8. + 9. : , , . " . -% -) G-C G-C 3 , -A T (. " )( . , - )= . ( . ) - Tm , , 4]( [G+C]+2[A+T 01. . " 11. . . , , ' . ) EcoRI 6 (. ". . . , 8.1 Kb 6.0 .Kb . . " )( . 21. " ", " . " . . A , . . A . . "" " .

, . 2

1. . , )=( -. " ' 4T. 41 T4 N- 51 ,T4 N , : 51. T4 N14 /T4 N14 ; T4 N15 /T4 N15 ; T4 N14 /T4 N 41 '- 4T- .5T - T4 N- 51 . T5 N ' ) ( , - 4T-) 5T (, 51.T4 N14 /T4 N14 ; T5 N15 /T5 N 2.

okazaki

okazaki

" 1" " "". - . : -: , . 1. . , )?( : ) (leading strand )lagging 2. (strand )(, - . 3. , . , "" :

4. E .

E- D , , E .D 5. " 001 // . 4.2 x 105 = 100 60 x40 x -04 /: )-(, 501 x 2= 4.8 x 105 2.4 x -04 : - ) ( " 2.1 52 = 501 x 107 / 4.8 x 04 52: : " " 1. - , . ! . ! . 2. , . 3. . 6. 1. " - III " , 2. " - I , " " - )" : )( )( ". - -'5 - " )(, . 3. " - . ) ", - (. 4. ) " -(III- ,sliding clamp-processivity , . 5. " ) - (helicase - . 6. ) -(primase - . 7. ) (AZT .dTTP '3, - OH ) .(3N ) (RT - DNA ) ,(dTTP OH '3 - AZT - . 8. . )(lagging strand 9. .

, . 3

1. 4/1 3. 2.

. - " ) (. , - . : U AU- - CG- ) .AT - .(CG - . - , U A- , G " ) DNA '- , BER ) - 5 ( mC ", . : : CG .AT : 1. - 5 mC ": - C" . 2. , "" -5 T mC- CG - ,AT . 3. " ) ,(hotspots - 5.mC 3. . - , . ) (NER, BER , " -. )- BER , - NER , " -(.

" " "

4.

5. " 6. NER 7.

" - DNA polII E. coli 1. )?( 2. , -'5 -'3 3. . T ", U ". " " - *. : , )"(, : . " I . , -U - T . *- - U )"(. , . U ,C - U .A. .

, . 4

1.

3'-5- 'CTACTCCTACTCCTCTTC...GTAGTGTTATACAAGTCA

, . . ,forward )= -f ( ,reverse . -g f- Tm = 4X9 + 2X9 = 54 oC g- Tm = 4X6 + 2X12 = 48 oC 2. PCR : . , , , . . M- . , . 03 03 x M. . 2. : 01 - 012 = 0001 ~ x M, - . 02 '. , , 0001 ~ x M, 02 02 x 1000 x M, )?(. 3. - . ) , - (. PCR " , - PCR . CAG, - . ) . - . . ?( 4. . . , ) ? ?( 5. . ddNTP ) (dNTP , . ".

6. : 5' 3 'AGCGTT(T/G)CATTT - T - -G - - - .

, . 5 1. . 2. . 2. 2 . 3. " -:DNaseI -53 1+ ) ( 83- 45-

- . " " " . ; ) b ( " , .

4. " ) ; ( ", ) ; ( ) ( : 5.

- (EMSA (=gel shift " - footprinting " ' " " . - gel shift , . - footprinting - , )( , , , )(, "" . ) , - .( - footprinting " ' ) ' (, "" ". , - gel shift " ' ) ' (. 6. -EMSA 1 - , " , 2 - 1- TFA " ', A 3 - 2- TFA " 4 - - TF : B " + 1- TFA

-1- TFA ", 2- TFA ", 1- TFA "-2 .TFA1-TFA " 2) TFA 1 TFA "(. -footprinting 1 - , 2 - 2- TFA - - 2 TFA " 3 - 1- TFA ) (, -1- TFA " 4 - - TF ) (. 2) ?TFA (.

.

)'Gln7. )3 5' CAA 3' 5' CAG " - wobble ) 6, 42( A G 3 " U . 1 . gln-tRNA 3' 5 'GUU . 8. ?tRNA - wobble -3 ! )-' 5 ( . " - wobble - tRNA 5' 3 'IAG 5' 3 ,'CUU 3', 5' CUC 3', 5' CUA .

tRNA 5' 3 'IAA 5' 3 ,'UUU 3', 5' UUC 3', 5' UUA . , tRNA , , "- .

, . 61. - mRNA - 303 )( 001 - " 001 003 = 3 x + + 303 . mRNA ) untranslated 3' )= UT-'5 . . 2. A , " , ,P ) A (.

, .

3.N

'3 '5

1

2

3

4 . tRNA ) (cys-tRNAcys . ? ) -cell (free - tRNA , , - . 5. : 5' 3 'CAU 3', 5' CAC : 3' 5 'GUA 5', 3' GUC ,'3 'CGU ,'5 'GCA 5' 3 5' CGC 3' 5 3' GCC : :

) , , (. , , 2 - U ,C )- (. ) , ", - T-.(C . . , )( - tRNA - tRNA, , . . his-tRNA synthetase tRNA HIS " , - ,tRNA - tRNA .

? . : , " - tRNA, o . " - tRNA- - o tRNA ARG ) ( - tRNA ) (.

6. '5 * & # CGAGGGGAAAUCCGAUGGUCGAGACAGUGACCUAAGGCUCA '3

) .(AUG - mRNA AUG, + , -

Met Val

AUG GUC GAG ACA GUG ACC Glu Thr Val Thr 7..

: frameshift mutation 1. , ) ""(. - AUG UCG AGA CAG Met Ser Arg Gln Val Ile 2. . missense mutation , , , - .Neutral mutation ) .( Val Asp 3. . missense mutation stop codon Glu : . .

nonsense mutationsilent mutation Thr Thr . .

- . , , : - . - ) , , '- (, : '- ': . - .

8. ) bambaR - (-bambaR . , , " bambaR . ) , .(

9.2.

, argR 5.

, argR ) .(argR , )- - (. .argR , argR - ) (. . , argR - . - , - " .01.

+ + + + - CAP ) -- ,cAMP (, . , , ) (- )(, .

, . 71. - +Z , -I+O+Z , . - +Z " ,OC ) ( Z . - +I , - ,+Z .

2.

. ggz " )" + ( 1- - " : " . 2- . 3- GgmB- . : GgmB ) ( 4- GgmB ) 1(. : , . (Gel Shift Assay (EMSA ". - (ggz promoter (200 bp . , " , . . " ". " , ) (. 1- - GgmB ' , - " : GgmB . 2- GgmB - " : . : )=( . 3- " - ' , . 1 : " .GgmB 4- " - 3 : " . 5- GgmB" - 1 , 3 -4- " : - , " - GgmB ". ) ?( 6- , " + " ) 3(, : "" - GgmB". ) 2/1.( GgmB ".- . : GgmB ) ggz (. . , , )" " , , , (. , " " .

3.. I , ". - " ) (. "-" - .IS . . - ", , "" . . " ) ( . 4. ''- ) (mRNA - lac operon ) lacZ ( -galactosidase

-) lac operator , -(mRNA

, . 8 : . ) 1, 2, , 6, 7(, , -. . ? ) 5( : ) ; ( )=( ) (: - = +1 - = / " " AAATTT -'3 1. 2.

3. - HindIII .........Gly-Pro - GGNCCN - Sau96I -

: AluI , :. ......Pro-Ala 3 ,A - CCNGCN ,T . 3 4. - 005 bp 5. 1. 2 BamHI- 2 PstI 2. P B P 5 4 2 3

B 1 0

EcoRI- MfeI

6. : .

. BglII- MboI EcoRV- PvuII . , . -, )=(, . : ) MboI GATC(; " MboI T - -C " .BglII 7. , , NheI- ,BmlI, . , " : " 4 ) - ) -) NheI - ) ) .(BmlI?( CTAGGATC :

E, . 9 5.2 0.3 B B 5.3 E 0.4 .1 0 B 1. .

. ) " (

5.2 KbBamHI

2 .

5.0 KbEcoRI EcoRI

. . Kb " ) - 2 Kb 5.1- (EcoRI .

SalI

5.0 Kb

. - " EcoRI ) ,(EcoRI , ) - SalI - ,BamHI 1 KB. 3. 1. ) - (corn ori , ), " (, , , . )) selection . . R ) - ,(XbaI , . - .ClaI+EcoRI ClaI+PvuII- SmaI+EcoRI. SmaI+PvuII , , . 4. )= " " (