39

J. Japan. Soc. Hort. Sci. 82 (1): 39–50. 2013.

Available online at www.jstage.jst.go.jp/browse/jjshs1

JSHS © 2013

A Torenia (Torenia fournieri Lind. ex Fourn.) Novel Mutant ‘Flecked’ Produces

Variegated Flowers by Insertion of a DNA Transposon into an R2R3-MYB Gene

Takaaki Nishijima1,2*, Yasumasa Morita1**, Katsutomo Sasaki1, Masayoshi Nakayama1,

Hiroyasu Yamaguchi1, Norihiro Ohtsubo1, Tomoya Niki1,2 and Tomoko Niki1

1NARO Institute of Floricultural Science, Tsukuba 305-8519, Japan2Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba 305-8577, Japan

A novel torenia (Torenia fournieri Lind. ex Fourn.) mutant ‘flecked’, which bears variegated flowers, was obtained

from ethyl methanesulfonate-treated M2 plants. The lower lip of this mutant has small violet spots with a pale

violet background, while that of the normal type is solid violet. The mutant trait frequently reverted to a

semicircular violet sector or solid violet lower lip. Germinal revertant plants with a solid violet lower lip also

frequently occurred in S1 plants derived from self-pollinated mutant flowers. In the lower lip of the mutant type,

anthocyanin concentration was much lower than in the normal type. This was attributed to decreased expression

of the genes encoding anthocyanin biosynthesis enzymes, i.e. torenia chalcone synthase (TfCHS), flavanone 3-

hydroxylase (TfF3H), dihydroflavonol 4-reductase (TfDFR), anthocyanidin synthase (TfANS), and UDP-glucose

3-O-flavonoid glucosyltransferase (TfUFGT). In the lower lip of the mutant, expression of a gene encoding R2R3-

MYB transcription factor (TfMYB1, Torenia fournieri MYB1) was much lower than in the normal type and the

revertants; this was caused by insertion of a Enhancer/Suppressor-Mutator (En/Spm)-like transposon (Ttf1,

Transposon Torenia fournieri 1) in the 2nd intron of TfMYB1. Furthermore, it was found that the reversion of

anthocyanin accumulation in the lower lips correlated to excision of Ttf1 from the TfMYB1. Overexpression of

TfMYB1 in torenia caused anthocyanins to accumulate in the purple callus as a result of enhanced expression of

the five structural genes mentioned above, demonstrating that TfMYB1 regulates these genes. Therefore, we

concluded that a homozygous allele of Ttf1-inserted TfMYB1 caused the mutant phenotype. Ttf1 is a non-

autonomous element because Ttf1 does not have the DNA sequence encoding transposase. Based on these results,

potential uses of the flecked mutant for torenia breeding and transposon tagging are discussed.

Key Words: anthocyanin, En/Spm family, mutable allele, transposable element.

Introduction

Torenia (Torenia fournieri Lind. ex Fourn.) is mainly

used as a bedding or potted plant in the summer in Japan.

Torenia plants branch vigorously and bear many flowers,

forming a compact and neat appearance (Morise, 2001;

National Agriculture and Food Research Organization,

2006). Torenia grows well under a wide range of light

intensities, including direct sunlight to weak light in the

shade, and is also highly tolerant of high temperatures

during mid-summer that have been increased by recent

climate changes on account of global warming. Breeding

for flower color variation has produced torenia cultivars

with white, pink, red, and yellow flowers, in addition to

the original violet flower of the wild T. fournieri.;

however, variation in flower morphology is relatively

poor, lacking large-flowered and double-flowered

cultivars. If this defect could be overcome, and a highly

attractive appearance could be combined with the

excellent growth properties mentioned above, the

commercial value of torenia would increase significantly.

Several breeding techniques have been employed to

extend the genetic variation of torenia. Interspecific

crosses among Torenia species have increased the variety

of flower colors (Miyazaki et al., 2007); however, fertile

combinations of interspecific crosses have been limited

and variation in flower morphology is relatively poor

among Torenia species. Heavy ion-beam radiation and

gene recombination has extended the variation of flower

Received; May 12, 2012. Accepted; August 8, 2012.* Corresponding author (E-mail: takaaki@affrc.go.jp).

** Present address: Faculty of Agriculture, Kagawa University,Kagawa 761-0795, Japan.

T. Nishijima, Y. Morita, K. Sasaki, M. Nakayama, H. Yamaguchi, N. Ohtsubo, T. Niki and T. Niki40

color and morphology of T. fournieri (Aida et al., 2000;

Sasaki et al., 2008); however, strains with sufficiently

large flowers and double flowers have not yet been

reported. Considering the current status of torenia

breeding, it is important to exploit new tools to extend

the genetic variation.

Spontaneous mutations caused by transposable

elements have been important mutagens in breeding

floricultural plants (Inagaki et al., 1994; Matsubara et al.,

2005; Nakajima et al., 2005; Nitasaka, 2003, 2007).

Transposable elements with high transposition activity

often cause unstable traits (e.g. Goodrich et al., 1992;

Inagaki et al., 1994). If transposition activity is moderate,

without disrupting the practical uniformity of cultivars,

transposable elements will function as a useful mutagen

for breeding (Matsubara et al., 2005; Nakajima et al.,

2005; Nitasaka, 2003, 2007).

Transposable elements have been used to identify the

gene causing a mutation, if the mutation is caused by

the insertion of a transposable element (e.g. Coen et al.,

1990). In this technique, i.e. transposon tagging, the

causal gene is identified using the sequence of the

transposable element as a tag. Torenia has the following

excellent traits as a model floricultural plant for

transposon tagging: moderate flower size, making

observation of the flower structure easy; compact plant

size, enabling a large number of plants to be grown in

a limited area; easy and efficient propagation, both by

seed and cutting; and a high Agrobacterium-mediated

transformation rate (Aida et al., 2000). Torenia is also

an excellent model plant for the fertilization processes

as the ovary structure enables the live fertilization

process to be observed under a microscope (Okuda et al.,

2009). If an active transposable element is found in

torenia, an excellent transposon tagging system could

be established for both floricultural science and plant

molecular biology.

Transposable elements are classified into class I and

class II elements (Flavel et al., 1994). The DNA sequence

of a class I element (also called a retrotransposon) is

transcribed into RNA and then the RNA is reverse-

transcribed into cDNA. The resultant cDNA is integrated

into the genome by integrase. Thus, the class I element

propagates with the parent element remaining in the

original position of the genome. In contrast, a class II

element (also called a DNA transposon; simply called

‘transposon’ in the following text) is directly excised

and then integrated into another site in the genome by

transposase. Transposons in higher plants are classified

into three groups; the Ac/Ds (or hAT) superfamily, the

En/Spm (or CACTA) superfamily and the Mu family,

depending on their structure and length of target site

duplication (Flavel et al., 1994).

Variegated flowers are caused by excisions of active

transposons from the genes involved in anthocyanin

biosynthesis. In such unstable mutants, transposition

activity of the transposon can be evaluated visually

because the somatic excision frequency of the transposon

is reflected in the density of the colored spots or sectors

(Bonas et al., 1984; Goodrich et al., 1992; Inagaki et al.,

1994; Luo et al., 1991; Martin et al., 1985; Sommer et

al., 1985). The molecular basis for such a variegation

trait is a transposon-induced insertion mutation in the

genes encoding anthocyanin biosynthesis enzyme

(Bonas et al., 1984; Inagaki et al., 1994; Martin et al.,

1985; Sommer et al., 1985) and transcription factors

regulating the genes for anthocyanin biosynthesis have

been reported (Goodrich et al., 1992). An early process

of anthocyanin biosynthesis is the phenylpropanoid

pathway, which synthesizes 4-coumaloyl-CoA. 4-

Coumaloyl-CoA and malonyl-CoA are converted into

tetrahydroxy chalcone by chalcone synthase (CHS)

(Forkmann, 1994; Heller and Forkmann, 1994).

Tetrahydroxy chalcone is converted into flavanone by

chalcone isomerase (CHI), and then converted into

dihydroflavonol by flavanone-3-hydroxylase (F3H).

Dihydroflavonol is converted into leucoanthocyanidin

by dihydroflavonol 4-reductase (DFR), and then into

anthocyanidin by anthocyanidin synthase (ANS). The

anthocyanidin is then glycosylated to generate anthocy-

anin by UDP-glucose 3-O-glucosyltransferase (UFGT).

The expression of the genes encoding those anthocyanin

biosynthesis enzymes is directly regulated by the

following transcription factors, i.e. R2R3-MYB protein,

basic helix-loop-helix protein (bHLH) and WD40 repeats

protein (WDR) (Broun, 2005; Koes et al., 2005).

We isolated a novel torenia mutant with variegated

flowers from ethyl methanesulfonate-treated M2 plants.

The lower lip of the flowers of this mutant had small

violet spots with a pale violet background, while that of

the normal-type flower was solid violet. The mutant

frequently produced flowers with a semicircular violet

sector or solid violet lower lip. These phenotypes

suggested the involvement of a transposon. In this paper,

we identify the transposon responsible for this mutation.

Potential uses of the mutant in torenia breeding and

transposon tagging are also discussed.

Materials and Methods

Plant material and isolation of mutant

An open pollination cultivar ‘Common Violet’ (Takii

Seed Co., Kyoto, Japan) of torenia (Torenia fournieri

Lind. ex Fourn.) was used. The mutant was isolated as

follows. Approximately 1000 seeds were immersed in

100 mM aqueous ethyl methanesulfonate with gentle

shaking for 16 h at room temperature. The seeds were

then washed repeatedly with distilled water for 4 h and

then planted in plastic containers (44 cm length, 32 cm

width, and 7 cm height) filled with Metromix 350 (Sun

Gro Horticulture, BC, Canada). Seedlings were planted

in 72-cell plug trays (54 cm length, 28 cm width; 4 cm

length, 4 cm width, and 6 cm height for a cell) filled

with Kureha-Engei-Baido (Kureha Chemical Industry

Co. Ltd., Tokyo, Japan) and Metromix 350 (1 : 1 (v/v)).

J. Japan. Soc. Hort. Sci. 82 (1): 39–50. 2013. 41

The plants were grown in a glasshouse with natural

sunlight. The temperature was kept between 18–32°C.

Lateral stems were removed and a slow-releasing coated

fertilizer (Ecolong 100; Chisso Co., Tokyo, Japan) was

used for top-dressing. Two flowers per plant were self-

pollinated by hand. Approximately 4000 M2 plants were

grown as described above. A M2 plant bearing flowers

with variegated lower lips was selected and self-

pollinated. This mutant trait was unstable and somatic

and germinal reversions frequently occurred. In this

paper we refer to normal-type and the variegated mutant-

type flowers as NT and MT flowers, respectively.

Flowers with apparently complete somatic reversion and

flowers of apparently germinal revertant plants, both of

which have solid violet lower lips, are termed NT-SR

and NT-GR flowers, respectively. To maintain the mutant

strain, the MT flowers were selectively self-pollinated

and M5 plants were used for experiments. The plants

used for the cross-pollination experiment, analysis of

anthocyanins and gene expression were planted in pots

(9 cm in diameter and 12 cm in depth) filled with the

same medium as that used in the plug tray culture to

obtain highly stable and uniform growth.

Cross pollination experiment

The NT, MT, and NT-SR flowers were cross-pollinated

by hand in the combinations shown in Table 1. Six

flowers per plant of the seed and pollen parents were

used for crossing.

Analysis of anthocyanins and related compounds

For anthocyanin analysis, we collected 20 mg FW of

the lateral limbs of the lower lip of the opened flower;

the lower limb was excluded because it had a yellow

blotch. The samples were frozen in liquid nitrogen and

stored at −80°C until analysis. Anthocyanins were

extracted with 5% aqueous acetic acid. We analyzed

10 µL of the extract using an HP1100 high-performance

liquid chromatography system with a photodiode array

detector (Agilent Technologies/Yokogawa Analytical

Systems, Tokyo, Japan) and an Inertsil ODS-2 column

(4.6 mm × 250 mm; GL Science, Tokyo, Japan) at 40°C

with a flow rate of 0.8 mL·min−1. Absorption spectra

were monitored at 240–580 nm. A linear gradient of 10%

to 50% of solvent B (1.5% H3PO4, 40% acetonitrile,

50% acetic acid) in solvent A (1.5% H3PO4) was run

over 40 min.

Molecular cloning of the genes encoding transcription

factors regulating anthocyanin biosynthesis

The lateral limbs of the lower lips were collected at

the late corolla development stage (stage 7) when petal

pigmentation started (Nishijima and Shima, 2006). The

samples were frozen in liquid nitrogen and stored at

−80°C until use. Total RNA was obtained using an

RNeasy Plant Mini Kit (QIAGEN K. K., Tokyo, Japan).

cDNA was synthesized using a 1st Strand cDNA

Synthesis Kit for RT-PCR (AMV; Roche Applied

Science, IN, USA). Partial sequences of cDNAs

encoding R2R3-MYB protein (MYB) and basic helix-

loop-helix protein (bHLH) were obtained by nested PCR

using the following degenerate primers based on the

conserved amino acid sequences indicated in parenthe-

ses; forward 5'-AARWSITGYMGIYTIMGITGGYT-3'

(KSCRLRWL) and reverse 5'-YTTISWRCAICKIVWIG

CYTTIGT-3' (K(S/T)CR(I/S)AKT) for 1st PCR and

forward 5'-AAYMRITGGWSIYTIATHGCIGG-3' (N(K/

R)WSLIAG) and reverse 5'-YTTISWRCAICKIVWIGC

YTTIGT-3' (K(S/T)CR(I/S)AKT) for 2nd PCR for MYB;

forward 5'-TGGDSIGAYGGITWYTAYAAYGG-3' (W(G/

S)DG(F/Y)YNG) and reverse 5'-GTYTGIAYISIIGCIS

WYTTIGC-3' (TQ(I/V)(S/G/R)ASKA) for 1st PCR and

forward 5'-GGIGMIATHAARACIMGIAARAC-3' (G(A/

D)IKTRKT) and reverse 5'-CKISWRAAIACYTTISWI

TCIRC-3' (R(S/T)FVK(T/S)(D/E)(A/V)) for 2nd PCR

for bHLH. 5'- and 3'-RACE-PCR (Frohman et al., 1988)

was performed using the CapFishing Full-length cDNA

Premix Kit (Seegene, Seoul, South Korea) based on the

partial cDNA sequences of the genes. Full-length cDNAs

were obtained using the following primer sets: for-

ward 5'-ACGCACGTATAATAATTATTTCGCG-3' and

reverse 5'-GTGGTGATTATGATCATAATTAATTACCAC-

3' for torenia MYB1 (TfMYB1); forward 5'-ACGCACGT

ATAATAATTATTTCGCG-3' and reverse 5'-GTGGT

GATTATGATCATAATTAATTACCAC-3' for torenia

bHLH1 (TfbHLH1).

Expression analysis of the genes involved in anthocyanin

biosynthesis

To investigate the expression of the genes involved

in anthocyanin biosynthesis, cDNAs were obtained from

the lateral limbs of the lower lip in stage 7 as described

above. For total RNA extraction for cDNA synthesis,

we treated the samples with DNase to avoid potential

contamination with genomic DNA. For organ-specific

analysis of the genes, the following organs were

collected: sepal, limb, tube, stamen, and pistil of flowers

at stage 7, stems, young and adult leaves (about 1 cm

and 3–4 cm in length, respectively).

Primers for quantitative real-time PCR (qPCR) were

Table 1. Trait segregation of F1 and S1 plants derived from crossesamong the normal-type flower (NT), mutant-type flower(MT), and the flower apparently with complete somaticreversion (NT-SR).

z Plants with MT flowers include those bearing both MT and NT-SRflowers.

CrossPlant solely with NT

flowers(No. of plants (%))

Plant with MT flowersz (No. of plants (%))

NT × MT 70 (100) 0 (0)

MT × NT 69 (100) 0 (0)

MT × MT 115 (81.6) 26 (18.4)

NT-SR × NT-SR 133 (94.3) 8 (5.6)

T. Nishijima, Y. Morita, K. Sasaki, M. Nakayama, H. Yamaguchi, N. Ohtsubo, T. Niki and T. Niki42

designed to amplify 190–225 bp fragments of the 3'

regions of the cDNAs (listed in Table 2). Although two

DNA sequences for TfCHS are registered as TfCHS1

and TfCHS2, we designed a primer set for total

quantification of those genes without discriminating

between them. This is because the difference between

the two sequences is negligible for clear discrimination

as different genes. Primer sequences for torenia ACTIN3

(TfACT3) used as an internal standard were as described

previously (Niki et al., 2012). Gene expression was

quantified using a qPCR machine (LightCycler; Roche

Diagnostics, Mannheim, Germany) and SYBR Premix

Ex Taq (TakaraBio, Shiga, Japan). The reactions were

cycled with a preincubation step of 10 min at 95°C

followed by 50 cycles of 5 s at 95°C, 10 s at 60°C and

20 s at 72°C each. The raw data were analysed with

LightCycler software version 3.5 (Roche Diagnostics).

Plasmids (pGEM-T Easy vector) harbouring cDNAs of

the corresponding genes were used to obtain the standard

curves. The ratio of the expression of each gene with

that of TfACT3 was calculated. The expression analysis

was conducted independently in triplicate.

Construction of transgenic callus overexpressing

TfMYB1

The entire coding sequence of TfMYB1 cDNA was

amplified by PCR with the following primer set that

creates SalI and NotI sites: forward 5'-CACGGTCGAC

AATTATTTCGCGTTCAAATGAGTAGA-3' and re-

verse 5'-ATGAGCGGCCGCAATTACCACCATAAC

ATGGTCTCCTC-3' (single underline, restriction site;

double underline, start and stop codons). The amplified

fragment was inserted into pGreen binary Ti vector

(Hellens et al., 2000) at the SalI/NotI site downstream

of the CaMV 35S promoter. The construct was

transformed into Agrobacterium tumefaciens strain

EHA105, and then torenia ‘Common Violet’ was

transformed according to Aida et al. (2000). Plants

transformed with empty vector were used as the control.

T0 transgenic calli were used for analysis of anthocyanin

and gene expression as described above.

Molecular cloning of torenia transposon (Ttf1) and the

correspondence of Ttf1 insertion with mutant trait

The genomic sequence including the full-length open

reading frame of TfMYB1 was amplified by PCR using

the same primer set used for amplification of the full-

length cDNA as described above. Genomic DNA was

extracted from lateral limbs of lower lips using

MagExtractor Plant Genome Kit (TOYOBO, Osaka,

Japan) and used as templates. Comparing the amplified

sequences among NT, MT, and NT-SR flowers, we iden-

tified the DNA sequence of the torenia transposon (Ttf1,

Transposon Torenia fournieri 1) inserted in TfMYB1.

To confirm that insertion of Ttf1 into TfMYB1 actually

caused the mutant phenotype, the correlation between

the TfMYB1 genotype and the mutant trait in the S1segregants derived from self-pollination of the variegated

mutant flowers was investigated. We have indicated the

genotype of Ttf1-inserted TfMYB1 as myb1Ttf1, which is

a recessive allele, as proved below. The genotype of

TfMYB1 without Ttf1 insertion is indicated as MYB1.

We used 5 S1 mutant plants bearing solely MT flowers,

22 mutant plants bearing both MT and NT-SR flowers

within a plant and 18 apparent germinal revertant plants

bearing solely NT-GR flowers for the analysis. Lateral

limbs of lower lips of a MT and a NT-SR flowers were

collected from a mutant plant, while that of a NT-SR

flower was collected from a germinal revertant plant.

Sample collection was conducted at flower opening and

genomic DNA was extracted as described above. qPCR

analysis was performed as described above to confirm

the TfMYB1 genotype. Quantitative analysis was needed

because the lower lip of the MT flower has small violet

spots possibly caused by somatic reversion, although we

excluded MT flowers with large violet sectors from the

analysis. We used the following 2 primer sets (Fig. 11A).

Primer set A, forward 5'-CATTTGGCGACAGACCG

TTTC-3' and reverse 5'-TTTAATCGGCGGTTAATAAA

TGTTTC-3', amplifies the 153 bp sequence between the

right subterminal region of Ttf1 and the 2nd exon of

TfMYB1 in the myb1Ttf1 genotype, but does not amplify

any sequence of the MYB1 genotype. Primer set B,

forward 5'-TGAAGCTCACTTTGGTGCATTAAAC-3'

and reverse 5'-TTTAATCGGCGGTTAATAAATGTTTC-

3', amplifies a 104 bp sequence of MYB1 genotype, but

Table 2. Primers used for gene expression analysis using quantitative real-time PCR.

Target gene (Accession No.) Forward primer (5'-3') Reverse primer (5'-3')

TfCHS (AB548585 and AB548586) GAGGAACGTGCTGAGCGAGT ATTAATTGGGCGTGCTGTGC

TfCHI (AB548584) TCTTTTCACTCAATCACCTTCCG CACTATTTCAGGAACAACTCAGAGAGTC

TfF3H (AB548588) AGCCCATCACTTATGGAGAAATGTAC ACCTTAAGACGAATACGACATAGAGAATAT

TfDFR (AB548587) AATTTGAGGGAATTGACAAGGACA TTCGATGCATGTTCTATTCTATCTTATG

TfANS (AB548583) CCAAGGAGAAGATCGTGCTCA CAATAAACTCCACCCATCACTCAAC

TfUFGT (AB548591) GCGGCGTGTTCACTGAGAAT TTCCCAATCTTTGCACCGAT

TfMYB1 (AB719455) AGCAGATGATTCAAGATGAACGC CACCATAACATGGTCTCCTCCTC

TfbHLH1 (AB719456) AAGTTTCAGACAAGGAAGTGTTGATC TGAAGAGCCTGCCTTATCACACTAG

TfACTIN3 (AB330989) TTCACAGAAAATGCTTCTAAACAAAGAC AACGACACATAATGAAAGAACACAAGA

J. Japan. Soc. Hort. Sci. 82 (1): 39–50. 2013. 43

does not amplify any sequence of the myb1Ttf1 genotype

because the sequence to be amplified is too long

(3073 bp). qPCR analysis was performed as described

above using genomic DNA as a template. Plasmids

(pGEM-T Easy vector) harbouring the myb1Ttf1 and

MYB1 genotypes of TfMYB1 were used to obtain standard

curves. TfACT3 was employed as an internal standard

using the primer set described in Table 2. The genomic

sequence amplified by this primer set was the same size

as that of the cDNA sequence.

Estimation of copy number of Ttf1 and related elements

Genomic DNA extracted from normal type plants was

digested by EcoRI and XbaI, and subjected to Southern

blot analysis as described previously (Niki et al., 2001).

Probe construction and signal detection were performed

using a DIG DNA Labelling Kit and DIG Luminescent

Detection Kit, respectively, following the manufacturer’s

instructions (Roche Applied Science, Penzberg,

Germany). DNA sequence spanning 1712 bp from 520

to 2231 bp (from the left terminal) of Ttf1, which

excludes the subterminal and terminal regions, was used

as probe 1, while that spanning 377 bp from 2437 to

2813 bp within the right subterminal region was used as

probe 2.

Detection of Ttf1 in normal-type plant

To investigate whether the DNA sequence of Ttf1 is

mutated by EMS treatment, we performed molecular

cloning of Ttf1 in the normal-type plant. The full-length

Ttf1 sequence in the normal-type plant was obtained by

PCR using a primer set based on the terminal sequence

of Ttf1, forward 5'-CACAGCAAAAAAACATGTTTT

TAGCGACAGG-3' and reverse 5'-TCACACTAC

AAAATATAAGGGTTTTAGCGACGGA-3'. We further

conducted TAIL-PCR (Liu and Whittier, 1995) to

confirm the DNA sequence at those primer-binding sites.

Results and Discussion

Mutant traits and its heredity

In the normal-type plant, the limb of the upper lip of

the flower was solid pale violet, while that of the lower

lip was solid violet (Fig. 1A, NT, normal type); however,

the lower lip of the mutant had small violet spots with

a pale violet background (Fig. 1A, MT, mutant type).

This mutant frequently displayed a semicircular violet

sector on its pale violet lower lips (Fig. 1A, MT with

large reversion sectors) or solid violet lower lip (Fig. 1A,

NT-SR, normal type apparently with complete somatic

reversion). The stamen and tube of NT flower had pale

violet pigmentation. The stamen pigmentation of MT

flower was paler than that of NT flower (photo not shown

because the color difference could not be clearly

photographed due to pale pigmentation), although

variegation was not clearly observed in MT flower. No

difference in color depth between NT and MT flowers

was observed in the tube. MT and NT-SR flowers

occurred chimerically within a plant (Fig. 1B). Once a

NT-SR flower occurred, the more apical flowers

seemingly generated from the same cell lineage were

always NT-SR. The pale violet background of the MT

flower indicated that anthocyanin biosynthesis leaked

slightly. Since those mutable traits resembled those of

the ‘flecked’ mutant of Ipomoea nil described by Hiraga

(1763), we named the torenia mutant and its trait (i.e.

variegated lower lip) as ‘flecked’. We refer to the limb

of the lower lip as simply ‘petal’ or ‘flower’ in the

following text unless otherwise stated.

All F1 plants derived from the cross between MT and

NT flowers showed the normal-type trait, suggesting

that MT is recessive (Table 1). If the MT or NT-SR

flower was self-pollinated, some S1 plants had MT

flowers. The ratio of S1 plants to MT flowers was higher

in the progeny of MT flowers than NT-SR flowers. If it

is hypothesized that the flecked mutation is caused by

a single recessive allele, the low rate of S1 plants with

the mutant trait (i.e. 18.4% as shown in Table 1) suggests

a high reversion rate. Of course, this is not direct evidence

of a high germinal reversion rate but is an indirect

indication. This is because apparent discrimination of

MT and NT-SR flowers depends on the anthocyanin

pigmentation pattern expressed in the L1 layer, while

reproductive cells are generated from the L2 layer which

is scarcely competent for anthocyanin biosynthesis.

Therefore, it is possible that the genotype of the causal

allele in the L2 layer is different from that estimated

from the petal pigmentation pattern appearing in the L1

layer.

Analysis of anthocyanins and expression of the genes

encoding anthocyanin biosynthesis enzymes

Anthocyanins (cyaniding 3,5-diglucoside, Cy 3,5dG;

peonidin 3,5-diglucoside, Pe 3,5dG; delphinidin 3,5-

digulcoside, Dp 3,5dG; petunidin 3,5-diglucoside, Pt

3,5dG; malvidin 3,5-diglucoside, Mv 3,5dG) and

flavones (apigenin 7-glucronide, AP 7G acid; lutein 7-

glucronide, Lut 7G acid; lutein 7-glucoside, Lut 7G)

listed in Figure 2 were identified from the petals. MT

petals had much lower anthocyanin and slightly higher

total flavone concentrations than NT petals (Fig. 2).

Anthocyanin and flavone concentrations of NT-SR petals

recovered to levels similar to those of NT petals. These

results suggest that inhibition of anthocyanin biosynthe-

sis mainly occurs in biosynthesis steps after that

catalyzed by F3H.

Expressions of TfCHS, TfF3H, TfDFR, TfANS, and

TfUFGT were lower in MT petals than in NT petals

(Fig. 3). In NT-SR petals, these genes were expressed at

almost the same levels as in NT petals. Expression of

TfCHI did not change markedly among the samples.

Estimation from the endogenous concentrations of

anthocyanins and related compounds suggested that CHS

had substantial activity even in MT flowers in which

TfCHS was down-regulated. Synchronous low expres-

T. Nishijima, Y. Morita, K. Sasaki, M. Nakayama, H. Yamaguchi, N. Ohtsubo, T. Niki and T. Niki44

sion of the structural genes suggested that the MT trait

was caused by a mutation of a transcription factor

regulating those genes; thus, we isolated and analyzed

the genes encoding transcription factors MYB and bHLH

that regulate petal-specific anthocyanin biosynthesis

(Morita et al., 2006). We excluded WDR, which regulates

whole-plant anthocyanin biosynthesis (Morita et al.,

2006), because the variegation of the flecked mutant was

a petal-specific trait; variegation was not observed in

the sepal margin and stem ridge expressing anthocyanin

pigmentation.

Molecular cloning, expression and functional analysis

of MYB and bHLH genes

Full-length cDNAs of an MYB-like gene (TfMYB1,

AB719455) and a bHLH-like gene (TfbHLH1,

AB719456) were isolated from young petals. The

deduced TfMYB1 protein had highly conserved R2 and

R3 DNA-binding domains and was closely related to

Antirrhinum majus VENOSA (AmVENOSA) (Fig. 4A).

The TfbHLH1 proteins had a highly conserved bHLH

DNA-binding domain and were closely related to

A. majus DELILA (AmDEL) (Fig. 4B).

Expression of TfMYB1 was lower in MT petals than

in NT petals, while that in NT-SR petals recovered almost

to the level of NT petals (Fig. 5). In contrast, there was

no marked difference in the expression of TfbHLH1

among NT, MT, and NT-SR petals.

TfMYB1 was expressed only in the floral organs with

violet pigmentation, i.e., limb, tube, and stamen (Fig. 6);

the expression was higher in the limb than in the tube

and stamen, probably reflecting the dark violet

pigmentation of the limb, while pigmentation of the tube

and stamen was faint. This result indicates that TfMYB1

controls pigmentation of the limb, tube, and stamen. In

contrast, TfbHLH was expressed in all floral organs,

stem, and leaf, indicating that TfbHLH is involved in

Fig. 1. Traits of the flecked mutant. A, flowers of normal-type andflecked mutant plants. NT, normal type; MT, mutant type; NT-SR, flower apparently with complete somatic reversion. B,Chimeric reversion of the flecked trait in the inflorescence.Flower trait is indicated by MT and NT-SR as in A. Main stemwas pinched in the photo for clarity.

Fig. 2. Concentrations of anthocyanins and related compounds in themutant flowers. NT, normal type; MT, mutant type; NT-SR,flower apparently with complete somatic reversion. Anthocya-nin: Cy 3,5dG, cyaniding 3,5-diglucoside; Pe 3,5dG, peonidin3,5-diglucoside; Dp 3,5dG, delphinidin 3,5-digulcoside; Pt3,5dG, petunidin 3,5-diglucoside; Mv 3,5dG, malvidin 3,5-diglucoside. Flavone: AP 7G acid, apigenin 7-glucronide; Lut7G acid, lutein 7-glucoside; Lut 7G, lutein 7-glucoside. Verticalbar at the top of a column represents ± SE (n = 3).

Fig. 3. Expression of the genes encoding anthocyanin biosynthesis enzymes in the mutant flower. NT, normal type; MT, mutant type; NT-SR,flower apparently with complete somatic reversion. TfCHS, torenia chalcone synthase gene; TfCHI, torenia chalcone isomerase gene; TfF3H,torenia flavanone 3-hydroxylase gene; TfDFR, torenia dihydroflavonol 4-reductase gene; TfANS, torenia anthocyanin synthase gene; TfUFGT,torenia UDP-glucose 3-O-flavonoid glucosyltransferase gene. Vertical bars represent ± SE (n = 3).

J. Japan. Soc. Hort. Sci. 82 (1): 39–50. 2013. 45

the pigmentation of both floral and vegetative organs.

Since the variegation of the flecked mutant was a petal-

specific trait, as described above, it was expected that

TfMYB1 would be involved in the expression of the

flecked trait.

We obtained only two p35S::TfMYB1 transgenic calli

from 200 leaf explants subjected to transformation. In

contrast, when an empty vector was transformed, 32

transgenic calli were obtained from 60 leaf explants.

Both of the p35S::TfMYB1 calli were deep violet, while

all of the vector control calli were green (Fig. 7). The

p35S::TfMYB1 calli accumulated anthocyanins (i.e. Cy

3,5dG, Pe 3,5dG, Dp 3,5dG, Pt 3,5dG, and Mv 3,5dG)

and flavones (i.e. AP 7G acid, Lut 7G acid, and Lut

Fig. 4. Phylogenetic relationship of R2R3-MYB (A) and basic helix-loop-helix (bHLH) (B) proteins in torenia and other plant species. Theabbreviations shown in front of each protein indicate the plant species: Tf, Torenia fournieri; Am, Antirrhinum majus; At, Arabidopsis

thaliana; In, Ipomoea nil; Pf, Perilla frutescens; Ph, Petunia hybrida; Sl, Solanum lycopersicon; Vv, Vitis vinifera; Zm, Zea mays. Arrowsindicate TfMYB1 (AB719455) and TfbHLH1 (AB719456). Accession numbers of the other proteins: AmROSEA1, ABB83826; AmROSEA2,ABB83827; AmVENOSA, ABB83828; AtMYB113, AAG38380; AtMYB75, AAG42001; AtMYB90, AAC83637; PhAN2, AAF66727;SlANT1, AAQ55181; AtMYB123, CAC40021; ZmC1, AAK09327; InMYB1, BAE94389; VvMYBA1, BAD18977; AmDEL, AAA32663;InbHLH1/InDEL, BAE94393; PhJAF13, AAC39455; AtEGL3, Q9CAD0; AtGL3, NP_680372; ZmLC, AAA33504; ZmIN1, AAB03841;AtTT8, Q9FT81; PfMYC-F3G1, BAC56998; PhAN1, AAG25928. Values in paretheses indicate P-distance.

Fig. 5. Expression of TfMYB1 and TfbHLH1 in the mutant flower.NT, normal type; MT, mutant type; NT-SR, flower apparentlywith complete somatic reversion. Vertical bars represent ± SE(n = 3).

Fig. 6. Expression of TfMYB1 and TfbHLH1 in the floral andvegetative organs of normal-type plant. Vertical bars represent± SE (n = 3).

Fig. 7. Transgenic torenia calli overexpressing TfMYB1. VC, vectorcontrol; TC1/2, calli overexpressing TfMYB1.

Fig. 8. Concentrations of anthocyanins and related compounds intorenia callus overexpressing TfMYB1. VC, vector control. TC1/2, calli overexpressing TfMYB1. CA G, caffeic acid 3-glucoside(tentative identification). For abbreviations of the othercompounds, see Figure 2 legend. Vertical bar at the top of acolumn represents ± SE (n = 3).

T. Nishijima, Y. Morita, K. Sasaki, M. Nakayama, H. Yamaguchi, N. Ohtsubo, T. Niki and T. Niki46

7G), while the vector control calli did not accumulate

these compounds (Fig. 8). In the p35S::TfMYB1 calli,

TfMYB1 and structural genes for anthocyanin biosynthe-

sis (TfCHS, TfCHI, TfF3H, TfDFR, TfANS, and TfUFGT)

were highly promoted (Fig. 9). Comparing the two

p35S::TfMYB1 calli, indicated as TC1 and TC2 in

Figures 7 and 8, induction of the structural genes for

anthocyanin biosynthesis was greater in TC2, while

anthocyanin accumulation was greater in TC1. This

contradictory result might be attributable to the different

nature of the calli; TC1 was an embyogenic callus, while

TC2 was a friable callus, as shown in Figure 7. Promotion

of structural genes for anthocyanin biosynthesis in the

p35S::TfMYB1 calli (Figs. 7 and 8) and clear correlation

between expressions of TfMYB1 and the structural genes

in petal, except for that of TfCHI (Figs. 3 and 5), strongly

suggest that TfMYB1 functions in planta as a

transcription factor regulating anthocyanin biosynthesis

through promotion of at least five structural genes other

than TfCHI. Since the effect of low expression of

TfMYB1 to TfCHI expression was not clear (Figs. 3 and

5), further study is necessary to confirm the involvement

of TfMYB1 in the regulation of TfCHI.

In contrast, we could not obtain any evidence clearly

illustrating the involvement of TfbHLH1 in anthocyanin

biosynthesis. TfbHLH1 was induced in one of the

transgenic calli overexpressing TfMYB1 (Fig. 9, TC2),

which was in accordance with the result that MYB

induces bHLH to promote anthocyanin biosynthesis

(Spelt et al., 2000; Tohge et al., 2005). In contrast, the

other TfMYB1-overexpressing callus showed no marked

induction of TfbHLH1 (Fig. 9, TC1), suggesting no

involvement of TfbHLH1 in anthocyanin biosynthesis.

However, the involvement of TfbHLH1 in anthocyanin

biosynthesis cannot be completely ruled out, because

TfbHLH1 was slightly (i.e. to about the same extent as

the vector control callus) expressed in this transgenic

callus (Fig. 9), suggesting that this slight expression

might be sufficient for the promotion of anthocyanin

biosynthesis.

Excision of integrated Ttf1 from the TfMYB1 gene causes

flecked trait

When the genomic sequence, including the full-length

open reading frame of TfMYB1, was amplified by PCR,

a 2.0 kbp DNA fragment was detected in NT petals. In

contrast, a 4.8 kbp fragment and faint amount of a 2.0 kbp

fragment were detected in MT petals (Fig. 10). In NT-

SR petals, a 2.0 kbp fragment was detected, as in NT

petals. These results suggest the insertion of a transposon

Fig. 9. Expression of the genes encoding anthocyanin biosynthesis enzymes and transcription factors in torenia callus overexpressing TfMYB1.VC, vector control. TC1/2, calli overexpressing TfMYB1. For abbreviations of genes, see legends of Figures 3 and 4. Vertical bars represent± SE (n = 3).

Fig. 10. Amplification of TfMYB1 genomic sequence in the mutantflower. NT, normal type; MT, mutant type; NT-SR, flowerapparently with complete somatic reversion. M, molecularweight marker. Numerals indicate base pairs of molecular weightmarker.

J. Japan. Soc. Hort. Sci. 82 (1): 39–50. 2013. 47

in TfMYB1. In contrast, amplification of the TfbHLH1

genomic sequence, including the full-length open

reading frame, gave an approximately 2.4 kbp fragment

in all of the NT, MT, and NT-SR petals, suggesting no

insertion of transposon (data not shown). Molecular

cloning of the 2.0 kbp DNA fragment of TfMYB1 showed

that TfMYB1 consisted of 3 exons and 2 introns

(Fig. 11A). Further, sequence analysis of the 4.8 kbp

fragment showed insertion of a 2893 bp DNA sequence

in the 2nd intron of TfMYB1 (Fig. 11A). This inserted

sequence (named Ttf1 as described in Materials and

Methods, AB719454) had the typical structure of a

transposon (Fig. 11B, C). The left subterminal 264 bp

and right subterminal 456 bp regions had repeats of the

6 bp CGACAG motif. The right subterminal region had

102 bp and 37 bp tandem repeats. Both left and right

terminals had terminal inverted repeats. The DNA

sequence of the terminal inverted repeat suggested that

Ttf1 belongs to the family of En/Spm transposon

(Fig. 11C). Ttf1 was flanked by 3-bp direct repeat TGA

that was identical to the integration site (Fig. 11B). This

result also supports the idea that Ttf1 belongs to the

family of En/Spm transposon, because the Spm/En

transposon and its relatives generate 3-bp target

duplications when integrated (Gierl and Saedler, 1992).

No DNA sequences encoding known proteins, including

transposase, were detected in Ttf1, suggesting that Ttf1

is a non-autonomous element. Moreover, in the 2.0 kbp

fragment of NT-SR petals, 6 bp of the target duplication

sequence was converted to 3- and 4-bp new sequences

(Fig. 11B), which were generated as footprints of Ttf1

excision.

qPCR analysis of genomic DNA in S1 segregants

showed clear correspondence between the quantities of

TfMYB1 genotypes (i.e. MYB1 and myb1Ttf1) and the

flower traits (Fig. 12). Most MT flowers exhibited a high

quantity of mybTtf1, while slight MYB1 was detected,

probably because of somatic reversion, observed as small

violet spots on the petal (Fig. 1A MT). This result

indicates that the genotype of MT flowers is basically

myb1Ttf1/myb1Ttf1; however, 2 out of 27 MT flowers

exhibited a substantial amount of MYB1 (indicated by

open arrowhead in Fig. 12). Since these two flowers

exhibited a low expression of TfMYB1, as expected from

their MT phenotype (data not shown), the MYB1/myb1Ttf1

or MYB1/MYB1 genotypes very probably occurred in

the L2 and/or L3 layers of the petals, which scarcely

induce anthocyanin biosynthesis.

In contrast, all NT-SR and NT-GR flowers exhibited

a high quantity of MYB1. myb1Ttf1 was detected in 21

out of 22 NT-SR flowers, suggesting that these flowers

have MYB1/myb1Ttf1 genotype, while the other NT-SR

flower had no detectable myb1Ttf (indicated by an asterisk

in Fig. 12), suggesting that this flower has MYB1/MYB1

genotype. In NT-GR flowers, MYB1 was detected in 13

out of 18 flowers, suggesting that these flowers have

MYB1/myb1Ttf1 genotype; however, the rate of flowers

without detectable myb1Ttf, which probably have MYB1/

MYB1 genotype, increased to 5 out of 18 flowers. These

results correspond with the natural prediction that

germinal revertant plants have a higher rate of MYB1/

MYB1 flowers than mutant plants with somatic reversion.

Overall, we concluded that the homozygous allele of

Ttf1-inserted TfMYB1 (i.e. genotype myb1Ttf1/myb1Ttf1)

Fig. 11. Characterization of torenia transposon Ttf1 (Transposon Torenia fournieli 1). A: Structure of TfMYB1 carrying Ttf1. Obliquely-stripedsquare, 5' UTR; grey square, coding region; dashed line, intron. Oblique double lines on the square indicating Ttf1 represent abbreviationbecause Ttf1 is too long to be illustrated to the right scale. Primer binding sites for qPCR analysis of TfMYB1 genotype are indicated byarrows; black arrow, forward primer for specific detection of TfMYB1 without Ttf1 insertion (MYB1 genotype); open arrow; forward primerfor specific detection of TfMYB1 with Ttf1 insertion (myb1Ttf1 genotype); grey arrow, common reverse primer. B: Structure of Ttf1 (uppercolumn), DNA sequence around Ttf1 insertion site of TfMYB1 (lower column), and footprint sequences formed by excision of Ttf1 (TCGAand TCA). Open square, subterminal region; large black triangle, terminal inverted repeat; small black triangle, 6 bp CGACAG motif; largegrey pentagon, 102 bp tandem repeat; small grey pentagon, 37 bp tandem repeat. Sequences of TGA underlined in TfMYB1 sequence are3 bp target duplications. C: DNA sequence of terminal inverted repeats (TIR) of Ttf1.

T. Nishijima, Y. Morita, K. Sasaki, M. Nakayama, H. Yamaguchi, N. Ohtsubo, T. Niki and T. Niki48

causes the flecked phenotype. In this phenotype, somatic

reversion, expressed as violet spots and sectors on the

petal, is caused by spontaneous excision of Ttf1 from

TfMYB. In contrast, the MYB1/myb1Ttf1 and MYB1/MYB1

genotypes cause the normal phenotype.

In A. majus, which belongs to Lamiales as T. furnieri,

three R2R3-MYB genes, i.e. ROSEA1, ROSEA2, and

VENOSA, control petal pigmentation (Schwinn et al.,

2006; Shang et al., 2011). Activity of ROSEA1 gives

strong corolla pigmentation in both the adaxial and

abaxial epidermis, while that of ROSEA2 gives weak

pigmentation mainly in the adaxial epidermis of the

corolla limb. Activity of VENOSA, which is closely

related to TfMYB1 as described above, promotes

pigmentation of the epidermis overlying the veins in a

petal. Out of these R2R3-MYB genes, TfMYB1 seemingly

has partially-common roles to those of ROSEA1 and

ROSEA2 despite its close relationship to VENOSA. This

is because the activity of TfMYB1 induced strong solid

pigmentation in both the adaxial and abaxial epidermis

of the petal as ROSEA1, and this pigmentation was

limited in the limb as ROSEA2 (Fig. 1). Concerning the

great difference in anthocyanin concentration and

expression of the structural genes between NT and MT

petal (Figs. 2 and 3), TfMYB1 is at least one of the main

regulators of petal pigmentation in torenia. However, the

pale violet background of MT petals may indicate that

another transcription factor is also involved in the

promotion of anthocyanin pigmentation.

To estimate the copy number of Ttf1-related elements

in the normal-type torenia plant, southern hybridization

analysis was conducted. Both probes designed on

different positions of Ttf1 detected the 3 and 1 bands

when genomic DNA was digested with EcoRV and XbaI,

respectively (Fig. 13); therefore, the copy number of

Ttf1-related elements may be not much more than 3.

Fig. 12. Quantification of TfMYB1 genotypes in S1 plants derived from self pollination of mutant-type (MT) flowers. TfMYB1 genotype: myb1Ttf1,mutant-type allele with Ttf1 insertion; MYB1, normal type allele without Ttf1 insertion. Flower phenotype: MT, mutant type; NT-SR, flowerapparently with complete somatic reversion; NT-GR, flower in the apparent germinal revertant plant. Plant phenotype: MT, mutant type;MT with SR, MT plant bearing both MT and NT-SR flower; NT-GR, apparent germinal revertant plant. Open arrowhead indicates MTflowers with substantial amount of MYB1, suggesting MYB1/myb1Ttf1 genotype. Asterisk indicates flowers having no myb1Ttf1, suggestingMYB1/MYB1 genotype. For clarity, flowers within a combination of flower phenotype and plant phenotype were arranged in order fromlarge to small value of mybTtf1.

Fig. 13. Southern blot analysis of Ttf1-related elements. GenomicDNA was digested with EcoRV (E) and Xba I (X). Probe 1 wasdesigned within the centre sequence of Ttf1 flanked by the leftand right subterminal regions, while probe 2 was designed withinthe right subterminal region (for details, see Materials andMethods).

J. Japan. Soc. Hort. Sci. 82 (1): 39–50. 2013. 49

In normal-type plants, we detected a DNA sequence

that was identical to that of Ttf1 in the flecked mutant;

therefore, the high transposition activity of Ttf1 in the

mutant cannot be attributed to a mutation in the base

sequence of Ttf1.

Potential use of Ttf1 in breeding and transposon tagging

of torenia

The high germinal reversion rate of the flecked mutant,

as shown in Table 1, indicates high transposition activity

of Ttf1 in the reproductive cells and/or L2 layer, which

is highly likely to cause novel mutations. When Ttf1 is

used as a mutagen for torenia breeding, the high

transposition activity may also make the mutant

phenotype unstable; however, the mutation might be

stabilized if Ttf1 and the allele promoting transposition

of Ttf1 (possibly the allele encoding the transposase for

Ttf1) are genetically separated. The allele promoting Ttf1

transposition may be homozygous in the flecked mutant,

because a mutant plant with no reversion was not

separated by M6 generation. We are currently

constructing an F2 population derived from cross

pollination of NT and MT flowers, which may enable

genetic separation of Ttf1 and the allele promoting Ttf1

transposition.

Since the copy number of the Ttf1-related elements

in the torenia genome may be small, as discussed above,

Ttf1 could potentially be useful for transposon tagging.

If Ttf1 is the sole transposon with high transposition

activity out of the related elements, an efficient

transposon tagging system could be established using

the flecked mutant. To confirm this, complete analysis

of the Ttf1-related elements is necessary.

Acknowledgements

We thank Mrs. Tomoko Kurobe for her technical

assistance.

Literature Cited

Aida, R., S. Kishimoto, Y. Tanaka and M. Shibata. 2000.

Modification of flower color in torenia (Torenia fournieri

Lind.) by genetic transformation. Plant Sci. 153: 33–42.

Bonas, U., H. Sommer and H. Saedler. 1984. The 17-kb Tam1

element of Antirrhinum majus induces a 3-bp duplication

upon integration into the chalcone synthase gene. EMBO J.

3: 1015–1019.

Broun, P. 2005. Transcriptional control of flavonoid biosynthesis:

a complex network of conserved regulators involved in

multiple aspects of differentiation in Arabidopsis. Curr. Opin.

Plant Biol. 8: 272–279.

Coen, E. S., J. M. Romero, S. Doyle, R. Elliott, G. Murphy and

R. Carpenter. 1990. floricaula: A homeotic gene required for

flower development in Antirrhinum majus. Cell 63: 1311–

1322.

Flavell, A. J., S. R. Pearce and A. Kumar. 1994. Plant transposable

elements and the genome. Curr. Opin. Genet. Dev. 4: 838–844.

Forkmann, G. 1994. Biosynthesis of flavonoids. p. 499–535. In:

J. B. Harbone (ed.). The flavonoids. Chapman & Hall,

London.

Frohman, M. A., M. K. Dush and G. R. Martin. 1988. Rapid

production of full-length cDNAs from rare transcripts:

amplification using a single gene-specific oligonucleotide

primer. Proc. Natl. Acad. Sci. USA 85: 8998–9002.

Gierl, A. and H. Saedler. 1992. Plant-transposable elements and

gene tagging. Plant Mol. Biol. 19: 39–49.

Goodrich, J., R. Carpenter and E. S. Coen. 1992. A common gene

regulates pigmentation pattern in diverse plant species. Cell

68: 955–964.

Hellens, R. P., E. A. Edwards, N. R. Leyland, S. Bean and P. M.

Mullineaux. 2000. pGreen: a versatile flexible binary Ti vector

for Agrobacterium-mediated plant transformation. Plant Mol.

Biol. 42: 819–832.

Heller, W. and G. Forkmann. 1994. Genetics of flavonoids. p. 537–

564. In: J. B. Harbone (ed.). The flavonoids. Chapman &

Hall, London.

Hiraga, G. 1763 (reprinted in 1972). Butsurui-hinshitsu (In

Japanese). Yasaka-Shobo, Tokyo.

Inagaki, Y., Y. Hisatomi, T. Suzuki, K. Kasahara and S. Iida. 1994.

Isolation of a Suppressor-Mutator/Enhancer-like transpos-

able element, Tpn1, from Japanese morning glory bearing

variegated flowers. Plant Cell 6: 375–383.

Koes, R., W. Verweij and F. Quattrocchio. 2005. Flavonoids: a

colorful model for the regulation and evolution of biochemical

pathways. Trends Plant Sci. 10: 236–242.

Liu, Y. G. and R. F. Whittier. 1995. Thermal asymmetric interlaced

PCR: Automatable amplification and sequencing of insert

end fragments from P1 and YAC clones for chromosome

walking. Genomics 25: 674–681.

Luo, D., E. S. Coen, S. Doyle and R. Carpenter. 1991. Pigmentation

mutants produced by transposon mutagenesis in Antirrhinum

majus. Plant J. 1: 59–69.

Martin, C., R. Carpenter, H. Sommer, H. Saedler and E. S. Coen.

1985. Molecular analysis of instability in flower pigmentation

of Antirrhinum majus, following isolation of the pallida locus

by transposon tagging. EMBO J. 4: 1625–1630.

Matsubara, K., H. Kodama, H. Kokubun, H. Watanabe and T.

Ando. 2005. Two novel transposable elements in a

cytochrome P450 gene govern anthocyanin biosynthesis of

commercial petunias. Gene 358: 121–126.

Miyazaki, K., C. Kuwayama, K. Kageyama, S. Matsumoto and

H. Fukui. 2007. Relation between interspecific compatibility

and phylogenic analysis in Torenia. Shokubutsu Kankyo

Kogaku 19: 66–73 (In Japanese with English abstract).

Morise, N. 2001. Torenia. p. 567–568. In: Nosangyosonbunka-

kyokai (ed.). Nogyogijutsutaikei Kakihen 8 (In Japanese).

Nosangyosonbunkakyokai, Tokyo.

Morita, Y., M. Saitoh, A. Hoshino, E. Nitasaka and S. Iida. 2006.

Isolation of cDNAs for R2R3-MYB, bHLH and WDR

transcriptional regulators and identification of c and ca

mutations conferring white flowers in the Japanese morning

glory. Plant Cell Physiol. 47: 457–470.

Nakajima, T., K. Matsubara, H. Kodama, H. Kokubun, H.

Watanabe and T. Ando. 2005. Insertion and excision of a

transposable element governs the red floral phenotype in

commercial petunias. Theor. Appl. Genet. 110: 1038–1043.

National Agriculture and Food Research Organaization. 2006.

Torenia. p. 1112. In: National Agriculture and Food Research

Organization (ed.). NAROPEDIA (In Japanese). Nosan-

gyosonbunkakyokai, Tokyo.

Niki, T., M. Hirai, T. Niki, A. Kanno and T. Nishijima. 2012. Role

of homeotic genes in the morphology of forchlorfenuron-

induced paracorollas in Torenia fournieri Lind. J. Japan. Soc.

Hort. Sci. 81: 204–212.

Niki, T., T. Nishijima, M. Nakayama, T. Hisamatsu, N. Oyama-

T. Nishijima, Y. Morita, K. Sasaki, M. Nakayama, H. Yamaguchi, N. Ohtsubo, T. Niki and T. Niki50

Okubo, H. Yamazaki, P. Hedden, T. Lange, L. N. Mander

and M. Koshioka. 2001. Production of dwarf lettuce by

overexpressing a pumpkin gibberellin 20-oxidase gene. Plant

Physiol. 126: 965–972.

Nishijima, T. and K. Shima. 2006. Change in flower morphology

of Torenia fournieri Lind. induced by forchlorfenuron

application. Sci. Hortic. 109: 254–261.

Nitasaka, E. 2003. Insertion of an En/Spm-related transposable

element into a floral homeotic gene DUPLICATED causes a

double flower phenotype in the Japanese morning glory. Plant

J. 36: 522–531.

Nitasaka, E. 2007. Morphological mutants induced by transposable

elements in the Japanese morning glory. Gamma Field Symp.

46: 73–79.

Okuda, S., H. Tsutsui, K. Shiina, S. Sprunck, H. Takeuchi, R. Yui,

D. Kasahara, Y. Hamamura, A. Mizukami, D. Susaki, N.

Kawano, T. Sakakibara, S. Namiki, K. Itoh, K. Otsuka, M.

Matsuzaki, H. Nozaki, T. Kuroiwa, A. Nakano, M. Kanaoka,

T. Dresselhaus, N. Sasaki and T. Higashiyama. 2009.

Defensin-like polypeptide LUREs are pollen tube attractants

secreted from synergid cells. Nature 458: 357–361.

Sasaki, K., R. Aida, T. Niki, H. Yamaguchi, T. Narumi, T.

Nishijima, Y. Hayashi, H. Ryuto, N. Fukunishi, T. Abe and

N. Otsubo. 2008. High-efficiency improvement of transgenic

torenia flowers by ion beam irradiation. Plant Biotechnol. 25:

81–90.

Schwinn, K., J. Venail, Y. Shang, S. Mackay, V. Alm, E. Butelli,

R. Oyama, P. Bailey, K. Davies and C. Martin. 2006. A small

family of MYB-regulatory genes controls floral pigmentation

intensity and patterning in the genus Antirrhinum. Plant Cell

18: 831–851.

Shang, Y., J. Venail, S. Mackay, P. C. Bailey, K. E. Schwinn, P. E.

Jameson, C. R. Martin and K. M. Davies. 2011. The molecular

basis for venation patterning of pigmentation and its effect

on pollinator attraction in flowers of Antirrhinum. New

Phytologist 189: 602–615.

Sommer, H., R. Carpenter, B. J. Harrison and H. Saedler. 1985.

The transposable element of Tam3 of Antirrhinum majus

generates a novel type of sequence alterations upon excision.

Mol. Gen. Genet. 199: 225–231.

Spelt, C., F. Quattrocchio, J. N. M. Mol and R. Koes. 2000.

anthocyanin1 of petunia encodes a basic helix-loop-helix

protein that directly activates transcription of structural

anthocyanin genes. Plant Cell 12: 1619–1631.

Tohge, T., Y. Nishiyama, M. Yokota-Hirai, M. Yano, J. Nakajima,

M. Awazuhara, E. Inoue, H. Takahashi, D. B. Goodenowe,

M. Kitayama, M. Noji, M. Yamazaki and K. Saito. 2005.

Functional genomics by integrated analysis of metabolome

and transcriptome of Arabidopsis plants over-expressing an

MYB transcription factor. Plant J. 42: 218–235.