of 31 /31
BIOKIMIA SEL BIOKIMIA SEL KOMPONEN-KOMPONEN KIMIA SEL

Biokimia Sel

Embed Size (px)

DESCRIPTION

biokomia

Citation preview

Page 1: Biokimia Sel

BIOKIMIA SELBIOKIMIA SEL

KOMPONEN-KOMPONEN KIMIA SEL

Page 2: Biokimia Sel

• Atom = unit yang paling kecil dari suatu unsur– Contoh : atom C, atau H, atau O, dll.

• Element = substansi yang tidak bisa dipecah ke dalam unsur lebih sederhana.– Contoh adalah 5O2, atau O2, atau H2, dll.– Catatan masing-masing hanya satu jenis

• Compound (campuran) = dua atau lebih unsur-unsur kombinasi secara kimiawi. ( Mempunyai 2 atau lebih unsur)– Air- H2O- adalah suatu campuran terdiri dari H&

O. • Molecule = unit yang paling kecil kebanyakan

campuran– Contoh adalah gula C6H12O6, air H2O dll.– C6H12O6 dan H2O adalah campuran. O2 dan H2

bukan campuran.

Page 3: Biokimia Sel

• Sel merupakan dasar dari suatu bangunan yang hidup.

• Sel terbuat dari bahan kimia berupa susunan elemen.– Bagaimana bahan kimia dapat berfungsi

dalam kehidupan

Page 4: Biokimia Sel

• Sebuah sel hidup tersusun oleh sejumlah unsur yang terbatas, empat diantaranya C, H, N, dan O yang menyusun dari 99 % dari berat sel

• 59% Hydrogen (H) • 24% Oxygen (O) • 11% Carbon (C) • 4% Nitrogen (N) • 2% Lainnya - Phosphorus (P), Sulphur (S),

dll.

Page 5: Biokimia Sel

• H dan O (air) paling banyak terdapat di dalam sel (sekitar 70 %), merupakan medium untuk reaksi di dalam sel

• Karbon (C ), sangat dominan terdapat di dalam sel

• Empat jenis molekul kecil yang pokok di dalam sel yaitu merupakan kombinasi dari atom sederhana, membentuk :– gugus metil (-CH3), – hidroksil (-OH), – karboksil (-COOH), dan – asam amino (-NH2), selalu muncul berulang dalam molekul biolologi

Page 6: Biokimia Sel

Makromolekul dalam selMakromolekul dalam sel

• Empat unsur organik pokok dalam makhluk hidup:

1. Proteins (50 %)2. Carbohydrates (15 %)3. Lipids (10 %)4. Nucleic Acids (15 %)• Dan unsur lain

Page 7: Biokimia Sel

1. Protein1. Protein

• Secara garis besar dibedakan dua kelompok :– protein globuler – protein serabut (fibrous protein).

• Kebanyakan enzim merupakan protein globuler.

• Protein serabut merupakan protein struktural yang penting,  misalnya fibroin pada sutera dan keratin pada rambut dan bulu domba.

Page 8: Biokimia Sel

1. Protein1. Protein

• Beberapa protein berikatan :– Dengan materi nonprotein, dalam

bentuk gugus prostetik (bekerja sebagai kofaktor enzim)

– Dengan molekul berukuran besar seperti • lipoprotein (dengan lemak)•glikoprotein (dengan karbohidrat).

Page 9: Biokimia Sel

1. Protein1. Protein

• Protein tersusun dari sejumlah asam amino yang satu sama lain dihubungkan secara kovalen oleh ikatan peptida.

• Terdapat 20 macam asam amino, tetapi sel tersusun dari kombinasi mereka

• Asam amino dapat menyusun ribuan macam protein yang berbeda.

• Tiap polipeptida biasanya terdiri atas 100 hingga 1.500 asam amino.

Page 10: Biokimia Sel

1. Protein1. Protein

• Asam-asam amino secara kimia berbeda-beda, namun semua memiliki sebuah gugus asam karboksilat (COO-), dan sebuah gugus amino (NH3)

20 macam asam amino

  alanine   glutamic acid     leucine   serine

  arginine   glutamine   lysine   threonine

  asparagine   glycine   methionine   tryptophan  

  aspartic acid     histidine   phenylalanine     tyrosine

  cysteine   isoleucine   proline   valine

Page 11: Biokimia Sel

1. Protein1. Protein

• Kegunaan proteins : hampir semua jaringan tubuh disusun oleh protein– Otot– membran sel dan sebagian besar organel– Enzim dan hormon – dll

Page 12: Biokimia Sel

Feathers

Feathers Muscles

Page 13: Biokimia Sel

2. Karbohidrat2. Karbohidrat

karbohidrat (Gula) dalam bentuk sederhana adalah

monosakarida, mempunyai senyawa dengan rumus

umum (CH2O)n, dengan n sebuah bilangan bulat dari 3

hingga 7.

Gula dalam bentuk terbuka mempunyai sejumlah

gugus hidroksil yang dapat berikatan dengan molekul

gula yang lain melalui ikatan glikosidik membentuk

disakarida

Dengan cara yang sama akan terbentuk oligisakarida

(trisakarida, tetrasakarida dst.), pada akhirnya terbentuk

molekul polisakarida yang besar dengan ribuan unit

monosakarida

Page 14: Biokimia Sel

2. Karbohidrat2. Karbohidrat

Gula merupakan sumber energi bagi kebanyakan sel

Contoh reaksi C6H12O6 (heksosa), menjadi CO2 dan H2O

C6H12O6 + 6O2 6CO2 + 6H2O + energi

Energi yang dihasilkan dari reaksi ini disimpan dalam bentuk

molekul yang sangat penting yaitu ATP atau NADH

Molekul polisakarida sederhana pada sel-sel hewan

disimpan dalam bentuk glikogen.

Sedangkan pada tumbuh-tumbuhan disimpan dalam

bentuk amilum (pati)

Page 15: Biokimia Sel

2. Karbohidrat2. Karbohidrat

Molekul polisakarida sederhana yang

terdapat di luar sel hewan terikat secara

kovalen :

dengan protein membentuk glikoprotein,

dengan lipid membentuk glikolipid.

Pada tumbuh-tumbuhan sangat penting

untuk membentuk selulose merupakan

komponen utama penyusun struktur dinding

sel.  

Page 16: Biokimia Sel

3. Lipid3. Lipid3. Lipid = fats, oils, & waxes,

Merupakan energi yang, tersusun dari C, H, O– lipid mengandung lebih banyak energi

daripada karbohidrat.– Cadangan energi dari lipid digunakan

pada waktu tertentu.

Page 17: Biokimia Sel

3. Lipid3. Lipid

Lemak terdiri atas 4 bagian :

1 molekul gliserol

3 molekul asam lemak

• Sebuah molekul asam lemak terdiri dari dua bagian yang

berlawanan

Rantai hidrokarbon panjang, bersifat hidrofobik

(nonpolar/tidak larut dalam air)

Sebuah gugus asam karboksilat, yang terionisasi dalam

larutan (COO), bersifat hidrofilik (polar/larut dalam air),

mudah membentuk ester maupun amida

Asam lemak merupakan sumber energi yang lebih baik

dibandingkan dengan glukosa karena dapat diuraikan

menghasilkan energi hampir dua kali lipat

Page 18: Biokimia Sel

3. Lipid3. Lipid

Molekul asam lemak mengandung 4 sampai 24 atom

karbon

Beberapa molekul asam lemak mempunyai satu atau

lebih ikatan ganda antara atom karbon -> lemak tidak

jenuh

asam lemak tak jenuh lebih mudah mengikat atom

hidrogen sehingga dalam suhu kamar berbentuk cair ->

disebut minyak (lemak pada tanaman)

Pada hewan asam lemak tidak mempunyai ikatan rangkap

berupa butiran-butiran molekul trigliserid, yang tersusun

dalam 3 rantai asam lemak yang masing-masing mengikat

molekul gliserol (berbentuk padat dalam suhu kamar)

Page 19: Biokimia Sel

3. Lipid3. Lipid

• Apabila dibutuhkan, rantai asam lemak tersebut

dilepaskan dari trigliserid dan diuraikan menjadi

unit-unit karbon ganda berupa gugus asetil dalam

molekul yang larut air (asetil CoA)• Asetil CoA, melalui beberapa reaksi di dalam sel

menghasilkan energi.• Fungsi asam lemak yang paling penting adalah

pembentuk membran sel yang tersusun dalam

bentuk fosfolipid

Page 20: Biokimia Sel
Page 21: Biokimia Sel

Asam NukleatAsam Nukleat

Pada organisme hidup terdapat 2 golongan besar asam

nukleat

Asam deoksiribonukleat (DNA)

Asam ribonukleat (RNA)

Asam nukleat dapat dipecah menjadi monomer -> disebut

nukleotida

Nukleotida berperan penting dalam menyimpan informasi biologi (informasi genetika)

Nukleotida merupakan senyawa bentuk cincin yang mengandung 3 unsur yaitu gula, nitrogen, dan pospat

Page 22: Biokimia Sel

4. Asam Nukleat4. Asam Nukleat

1. gula -> berkarbon 5 (pentosa) 2 jenis gula pada RNA berbentuk ribosa

gula pada DNA berbentuk deoksiribosa

2. nitrogen -> basa nitrogen

basa DNA :

adenin dan guanin (mempunyai cincin ganda

basa purin), timin dan sitosin (mempunyai

cincin tunggal basa pirimidin

basa RNA:

adenin, guanin, sitosin, dan urasil (urasil masuk

basa pirimidin pengganti timin)

Basa-basa dalam asam nukleat saling berpasangan:

G berpasangan dengan C,

A berpasangan dengan T atau U

Page 23: Biokimia Sel

3. Gugus fosfat DNA maupun RNA dibentuk oleh nukleotida trifosfat

• fosfat pada DNA dATP, dCTP, dGTP, dan dTTP• fosfat pada RNA ATP, CTP, GTP, dan UTP

• Nukleotida dapat bertindak sebagai pembawa energi kimia di dalam sel, yang banyak diperankan oleh ATP

• Nukleotida berperan penting dalam menyimpan informasi biologi (informasi genetika)

Page 24: Biokimia Sel

• Alur informasi dari DNA ke RNA sampai protein adalah salah satu

dari prinsip pokok dari biologi molekul disebut "dogma sentral."

Protein

RNA

DNA

transcription

translation

CCTGAGCCAACTATTGATGAA

PEPTIDE

CCUGAGCCAACUAUUGAUGAA

Central Dogma: DNA -> RNA -> Central Dogma: DNA -> RNA -> ProteinProtein

Page 25: Biokimia Sel

Tata nama nukleosida dan mono, di dan trifosfatnyaTata nama nukleosida dan mono, di dan trifosfatnya

Basa Nukleosida Nukleotida

Nukleosida monfosfat

Nukleosida difosfat

Nukleosida trifosfat

RNA Adenin Adenosin AMP ADP ATP

Guanin Guanosin GMP GDP GTP

Sitosin Sitidin CMP CDP CTP

Urasil Uridin UMP UDP UTP

DNA Adenin Deoksi adenosin dAMP dADP dATP

Guanin Deoksi Guanosin dGMP dGDP dGTP

Sitosin Deoksi sitidin dCMP DCDP dCTP

Timin Deoksi timidin dTMP dTDP dTTP

Page 26: Biokimia Sel

Fig. 13.2, p. 215

DNA

Page 27: Biokimia Sel

AirAir

• Air:– Penyusun 2/3 dari tubuh.– Diperlukan untuk reaksi kimia di dalam sel.– Menjaga sel dalam ukuran dan bentuknya.– Membantu dalam homeostasis, menjaga

perubahan temperatur tubuh.– Air merupakan bahan yang paling banyak

terdapat di dalam sel (sekitar 90 %), merupakan medium untuk reaksi di dalam sel

– di dalam sitoplasma terdapat unsur yang terbatas, empat diantaranya C, H, N, dan O yang menyusun dari 99 % dari berat sel

Page 28: Biokimia Sel

Here is a list of Elements, Here is a list of Elements, symbols, weights and biological symbols, weights and biological

roles. roles.

ELEMENT (Symbol)Atomic Weight Biological role

• Calcium (Ca) 40.1 Bone; muscle contraction

• Carbon (C) 12.0 Constituent (backbone) of organic molecules

• Chlorine (Cl) 35.5 Digestion and photosynthesis

• Copper (Cu) 63.5 Part of Oxygen- carrying pigment of mollusk blood.

• Fluorine (F) 19.0 For normal tooth enamel development

• Hydrogen (H) 1.0 Part of water and all organic molecules

Page 29: Biokimia Sel

ELEMENT (Symbol)Atomic Weight Biological role

• Iodine (I) 126.9 Part of thyroxine (a hormone)

• Iron (Fe) 55.8 Hemoglobin, oxygen caring pigment of many

animals• Magnesium (Mg) 24.3 Part of chlorophyll, the

photo- synthetic pigment; essential

to some enzymes.• Manganese (Mn) 54.9 Essential to some enzyme

actions.• Nitrogen (N) 14.0 Constituent of all proteins

and nucleic acids.

• Oxygen (O) 16.0 Respiration; part of water; and in nearly all

organic molecules.• enzyme.

Page 30: Biokimia Sel

ELEMENT (Symbol)Atomic Weight Biological role

• Phosphorus (P) 31.0 High energy bond in ATP.• Potassium (K) 39.1 Generation of nerve

impulses.• Selenium (Se) 79.0 For the working of many

enzymes.• Silicon (Si) 28.1 Diatom shells; grass leaves.• Sodium (Na) 23.0 Part of Salt; nerve

conduction• Sulfur (S) 32.1 Constituent of most proteins.

Important in protein structure:

Sulfide bonds are strong.• Zinc (Zn) 65.4 Essential to alcohol oxidizing

Page 31: Biokimia Sel

KOMPOSISI KIMIA (DALAM SEL BAKTERI)

Persen total berat sel

Banyak jenis dalam setiap molekul

Air 70 1

Ion orgnik 1 20

Gula dan pembentuknya 1 250

Asam amino dan pembentuknya 0,4 100

Nukleotid dan pembentuknya 0,4 100

Asam lemak dan pembentuknya 1 50

Molekul kecil lain 0,2 ~300

Makromolekul (protein, asam nukleat, dan polisakarida

26 ~3000