Dna Profiling Part 1

DNA PROFILING & ITS DNA PROFILING & ITS APPLICATIONSAPPLICATIONS

DNA PROFILINGDNA PROFILING

• Genetic Genetic FingerprintingFingerprinting (also (also called called DNA testingDNA testing, , DNA typingDNA typing, or , or DNA DNA profilingprofiling) is a ) is a technique used to technique used to distinguish between distinguish between individuals of the same individuals of the same species using only species using only samples of their DNA.samples of their DNA.

Who Invented it?Who Invented it?

• The process of DNA The process of DNA fingerprinting was fingerprinting was invented by Alec invented by Alec Jeffreys at the Jeffreys at the University of Leicester University of Leicester in 1985. in 1985.

• He was knighted in He was knighted in 1994.1994.

• To understand DNA profiling, you first have to know that To understand DNA profiling, you first have to know that large portions of any single person's DNA are the same as large portions of any single person's DNA are the same as every other person's. Because we're all human beings, a every other person's. Because we're all human beings, a large chunk of our DNA is dedicated to our species-large chunk of our DNA is dedicated to our species-specific traits - we have feet instead of hooves, skin specific traits - we have feet instead of hooves, skin instead of scales, etc. But other sections - or fragments - of instead of scales, etc. But other sections - or fragments - of human DNA are unique to the individual. These fragments human DNA are unique to the individual. These fragments are called polymorphic because they vary in shape from are called polymorphic because they vary in shape from person to person. Essentially, DNA profiling is the process person to person. Essentially, DNA profiling is the process of separating an individual's unique, polymorphic, of separating an individual's unique, polymorphic, fragments from the common ones. fragments from the common ones.

• Although two individuals will have the vast majority of their Although two individuals will have the vast majority of their DNA sequence in common, DNA profiling exploits highly DNA sequence in common, DNA profiling exploits highly variable repeat sequences called variable repeat sequences called VNTRs.VNTRs.

• These loci are variable enough that two unrelated humans are These loci are variable enough that two unrelated humans are unlikely to have the same alleles.unlikely to have the same alleles.

7 repeats

8 repeats

AATG

• Each of us has a unique DNA profile or fingerprint. A Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that DNA profiles, relying on sections of our DNA that are known as non-coding DNA – that does not code are known as non-coding DNA – that does not code for a protein.for a protein.

• For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATATCTTCTAACACATGACCGATCATGCATGCCATGCATGCATGCATGCATGCATGCATATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCAGCATGCATGCATGTTCCATGATAGCA

CATCAT

• Polymerase chain reaction (PCR) is used first to Polymerase chain reaction (PCR) is used first to produce many copies of the ten STRs before they are produce many copies of the ten STRs before they are analyzed using electrophoresis. The different lengths analyzed using electrophoresis. The different lengths will show up as bands at different spots on the will show up as bands at different spots on the electrophoresis gel. The banding pattern produced is electrophoresis gel. The banding pattern produced is called a DNA profile or fingerprint, and can be called a DNA profile or fingerprint, and can be analyzed. analyzed.

How can DNA be used to identify How can DNA be used to identify an individual?an individual?

• Every single cell in our bodies contains DNA, the Every single cell in our bodies contains DNA, the genetic material that programs how cells work. 99.9 genetic material that programs how cells work. 99.9 percent of human DNA is the same in everyone, percent of human DNA is the same in everyone, meaning that only 0.1 percent of our DNA is meaning that only 0.1 percent of our DNA is unique.unique.

• Each human cell contains three billion DNA base Each human cell contains three billion DNA base pairs. Our unique DNA, 0.1 percent of 3 billion, pairs. Our unique DNA, 0.1 percent of 3 billion, amounts to 3 million base pairs. This is more than amounts to 3 million base pairs. This is more than enough to provide profiles that accurately identify a enough to provide profiles that accurately identify a person. The only exception is identical twins, who person. The only exception is identical twins, who share 100 percent identical DNA.share 100 percent identical DNA.

• At a crime scene, DNA is everywhere. It is present in At a crime scene, DNA is everywhere. It is present in all kinds of evidence collected at the scene, including all kinds of evidence collected at the scene, including blood, hair, skin, saliva and semen. Scientists can blood, hair, skin, saliva and semen. Scientists can analyze the DNA in evidence samples to see if it analyze the DNA in evidence samples to see if it matches a suspect's DNA.matches a suspect's DNA.

Biological materials used for DNA Biological materials used for DNA profilingprofiling

• BloodBlood• HairHair• SalivaSaliva• SemenSemen• Body tissue cellsBody tissue cells• DNA samples have been DNA samples have been

obtained from vaginal obtained from vaginal cells transferred to the cells transferred to the outside of a condom outside of a condom during intercourse.during intercourse.

Stages of DNA ProfilingStages of DNA Profiling

• Stage 1Stage 1::

Cells are broken downCells are broken down

to release DNAto release DNA

If only a small amount of If only a small amount of DNA is available it can be DNA is available it can be amplified using the amplified using the polymerase chain reaction polymerase chain reaction (PCR)(PCR)


• Step 2:Step 2: The DNA is cut into fragments using The DNA is cut into fragments using restriction enzymesrestriction enzymes..

Each restriction enzyme cuts DNA at a specific base Each restriction enzyme cuts DNA at a specific base sequence.sequence.


• The sections of DNA that are cut out are The sections of DNA that are cut out are called called restriction fragments. restriction fragments.

• This yields thousands of restriction This yields thousands of restriction fragments of all different sizes because the fragments of all different sizes because the base sequences being cut may be far apart base sequences being cut may be far apart (long fragment) or close together (short (long fragment) or close together (short fragment).fragment).


Stage 3:Stage 3:• Fragments are Fragments are

separated on the basis separated on the basis of size using a process of size using a process called called gel gel electrophoresis.electrophoresis.

• DNA fragments are DNA fragments are injected into wells and injected into wells and an electric current is an electric current is applied along the gel. applied along the gel.


DNA is negatively DNA is negatively charged so it is charged so it is attracted to the attracted to the positive end of the gel.positive end of the gel.

The shorter DNA The shorter DNA fragments move faster fragments move faster than the longer than the longer fragments. fragments.

DNA is separated on DNA is separated on basis of size.basis of size.


• A radioactive material A radioactive material is added which is added which combines with the combines with the DNA fragments to DNA fragments to produce a fluorescent produce a fluorescent image.image.

• A photographic copy A photographic copy of the DNA bands is of the DNA bands is obtained.obtained.


Stage 4:Stage 4:

• The pattern of fragment distribution is then The pattern of fragment distribution is then analysed.analysed.

Uses of DNA ProfilingUses of DNA Profiling

• DNA profiling is used to solve DNA profiling is used to solve crimes crimes and and medical problemsmedical problems

• Parentage testing Parentage testing (explored in more detail)(explored in more detail)

• Victim identification in Victim identification in mass disastersmass disasters

• Animal identification- Animal identification- e.g. racehorsese.g. racehorses

• Conservation biology Conservation biology and evolutionary studiesand evolutionary studies

METHODOLOGY

• DNA fingerprinting begins by extracting DNA from the cells in a sample of blood, saliva, semen, or other appropriate fluid or tissue.

METHODS

• RFLP – ( Restriction Fragment Length Polymorphism - pronounced as "rif-lip" )

• PCR – (Polymerase chain reaction )

• Y- chromosome analysis• STR – (short tandem repeats) • ampFLP• mitochondrial analysis

RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM )

• The first methods used for DNA fingerprinting involved restriction enzyme digestion, followed by Southern blot analysis.

• Although polymorphisms can exist in the restriction enzyme cleavage sites, more commonly the enzymes and DNA probes were used to analyze VNTR loci.

• The technique for detecting RFLPs involves the fragmentation of genomic DNA by a restriction enzyme, which can recognize and cut DNA wherever a specific short sequence occurs, in a process known as a restriction digest.

• The resulting DNA fragments are then separated by length through a process known as agarose gel electrophoresis, &

• transferred to a membrane via the Southern blot procedure

RFLP - TECHNIQUE

RFLP

• Hybridization of the membrane to a labeled DNA probe then determines the size of the fragments which are complementary to the probe.

• An RFLP occurs when the size of a detected fragment varies between individuals. Each fragment size is considered an allele, and can be used in genetic analysis.

• The analysis of VNTR alleles continues, but is now usually performed by polymerase chain reaction (PCR) methods.

• For example, the standard protocols for DNA fingerprinting involve PCR analysis of panels of more than a dozen VNTRs.

PCR (POLYMEREASE CHAIN REACTION)

• DNA fingerprinting took huge strides forward in both discriminating power and the ability to recover information from very small (or degraded) starting samples.

• PCR greatly amplifies the amounts of a specific region of DNA, using oligonucleotide primers and a thermostable DNA polymerase.

• PCR method is readily adaptable for analyzing VNTR loci.

• In US, the FBI has standardized a set of 13 VNTR assays for DNA typing, and has organized database for forensic identification in criminal cases.

• Similar assays and databases have been set up in other countries..

PCR

VIDEO

Y CHROMOSOME ANALYSIS

• Recent innovations have included the creation of primers targeting polymorphic regions on the Y-chromosome (Y-STR), which allows resolution of a mixed DNA sample from a male and female and/or cases in which a differential extraction is not possible.

• Y-chromosomes are paternally inherited, so Y-STR analysis can help in the identification of paternally related males.

• Y-STR analysis was performed in the Sally Hemings controversy to determine if Thomas Jefferson had sired a son with one of his slaves. It turns out that he did.

Documents

Dna Profiling Part 1