Seite 1 von 34

Overproduction of magnetosomes by genomic amplification of biosynthetic gene clusters in a 1

magnetotactic bacterium 2

3

4

Anna Lohße,a Isabel Kolinko,a Oliver Raschdorf,a,b René Uebe,a* Sarah Borg,a Andreas 5

Brachmann,a Jürgen M. Plitzko,b Rolf Müller,c Youming Zhang,d Dirk Schülera*# 6

7

8

Ludwig-Maximilians-Universität München, Department of Biology I, Martinsried, Germanya; 9

Max Planck Institute of Biochemistry, Department of Molecular Structural Biology, 10

Martinsried, Germanyb; Saarland University - Helmholtz Institute for Pharmaceutical 11

Research Saarland, Helmholtz Centre for Infection Research and Department of 12

Pharmaceutical Biotechnology, Saarbrücken, Germanyc; Shandong University - Helmholtz 13

Joint Institute of Biotechnology, State Key Laboratory of Microbial Technology, Life Science 14

College, Shandong University, Qingdao, Chinad 15

16

Running Head: Magnetosome overproduction in magnetotactic bacteria 17

18

Address correspondence to D. Schüler, dirk.schueler@uni-bayreuth.de. 19

*Present address: Universität Bayreuth, Department of Microbiology, Bayreuth, Germany. 20

A.L. and I.K. contributed equally to this work. 21

22

23

Word count abstract: 250 24

Word count text: 5, 046 25

26

AEM Accepted Manuscript Posted Online 11 March 2016Appl. Environ. Microbiol. doi:10.1128/AEM.03860-15Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 2 von 34

Abstract 27

Magnetotactic bacteria biosynthesize specific organelles, the magnetosomes, which are 28

membrane-enclosed crystals of a magnetic iron mineral that are aligned in a linear chain. The 29

number and size of magnetosome particles have to be critically controlled to build a sensor 30

sufficiently strong to ensure efficient alignment of cells within the weak earth’s magnetic 31

field, while at the same time minimizing the metabolic costs imposed by excessive 32

magnetosome biosynthesis. 33

Apart from their biological function, bacterial magnetosomes have gained considerable 34

interest, since they provide a highly useful model for prokaryotic organelle formation and 35

represent biogenic magnetic nanoparticles with exceptional properties. However, potential 36

applications have been hampered by difficult cultivation of the fastidious bacteria and their 37

poor yields of magnetosomes. 38

In this study we found that size and number of magnetosomes within the cell are controlled by 39

many different Mam and Mms proteins. We present a strategy for overexpression of 40

magnetosome biosynthesis in the alphaprotebacterium Magnetospirillum gryphiswaldense by 41

chromosomal multiplication of individual and multiple magnetosome gene clusters via 42

transposition. While stepwise amplification of the mms6 operon resulted in the formation of 43

increasingly larger crystals (increase of about 35%), the duplication of all major magnetosome 44

operons (mamGFDC, mamAB, mms6 and mamXY, comprising 29 genes in total) yielded an 45

overproducing strain, in which magnetosome numbers were 2.2-fold increased. We 46

demonstrate that tuned expression of the mam and mms clusters provides a powerful strategy 47

for the control of magnetosome size and numbers, thereby setting the stage for high-yield 48

production of tailored magnetic nanoparticles by synthetic biology approaches. 49

50

51

52

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 3 von 34

Importance 53

Before our study, it had remained unknown how the upper size and numbers of 54

magnetosomes are genetically regulated, and overproduction of magnetosome 55

biosynthesis has not been achieved, owing to the difficulties of large-scale 56

genome engineering in the recalcitrant magnetotactic bacteria. In this manuscript, 57

we established and systematically explored a strategy for overexpression of 58

magnetosome biosynthesis by genomic amplification of single and multiple 59

magnetosome gene clusters via sequential chromosomal insertion by 60

transposition. Our findings also indicate that the expression level of magnetosome 61

proteins together limits the upper size and number of magnetosomes within the 62

cell. We demonstrate that tuned overexpression of magnetosome genes clusters 63

provides a powerful strategy for the precise control of the magnetosome size and 64

numbers. 65

66

67

68

69

70

71

72

73

74

75

76

77

78

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 4 von 34

Introduction 79

Magnetotactic bacteria (MTB) biosynthesize specific organelles, the magnetosomes, which 80

are membrane-enclosed crystals of a magnetic iron mineral. To most efficiently function as 81

magnetic sensors for navigation within the weak earth’s magnetic field, the size, shape, 82

number and intracellular arrangement of magnetosome particles are evolutionary optimized, 83

while at the same time minimizing the metabolic burden imposed by excessive magnetosome 84

biosynthesis (1). In accordance with these constraints, the alphaproteobacterium 85

Magnetospirillum gryphiswaldense MSR-1 (in the following referred to as MSR) and related 86

magnetospirilla under environmental conditions typically form around twenty cuboctahedral 87

crystals of magnetite (Fe3O4) with a mean diameter of about 42 nm (2, 3). Magnetosome 88

biosynthesis proceeds in several steps, which include the formation of magnetosome 89

membrane (MM) vesicles by invagination from the cytoplasmic membrane, the sorting of 90

MM-specific proteins, the magnetosomal iron uptake and redox-controlled magnetite 91

crystallization, which is followed by assembly of nascent crystals into a single regular chain 92

along an actin-like magnetosome cytoskeleton (4-8). 93

The high degree of biological control over their synthesis results in unprecedented properties 94

of the nano-scaled magnetite crystals, such as high crystallinity, strong magnetization, and 95

uniform composition, shape and size that cannot be replicated by abiogenic fabrication (8). 96

The structural perfection and exceptional magnetic properties as well as their biocompatibility 97

make magnetosomes highly attractive for many bio-nanotechnological applications (9), such 98

as magnetic drug targeting, immunoassays, magnetic resonance imaging, and hyperthermia 99

(10-14). However, all applications of magnetosome particles so far have been hampered by 100

their poor availability due to the fastidious growth requirements of MTB and the low 101

magnetosome content of biomass. Therefore, an attractive possibility to increase 102

magnetosome bioproduction would be genetic engineering or overexpression of the entire 103

biosynthesis pathway in native or foreign hosts. 104

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 5 von 34

However, until recently magnetosome biosynthesis has remained poorly understood at the 105

molecular level. We previously discovered genes controlling magnetosome synthesis in MSR 106

to be clustered in several operons within a large genomic magnetosome island (15, 16). These 107

genes (approximately 30) also proved sufficient to induce biosynthesis of well-ordered 108

magnetosome chains upon transfer into the photosynthetic bacterium Rhodospirillum rubrum 109

as a foreign expression host (17). In the native host MSR, the large mamAB operon 110

(mamABop) alone is sufficient to sustain rudimentary magnetite biomineralization in the 111

absence of all other magnetosome genes (16). From the 17 mamABop genes, a subset of only 112

few (mamE, M, O, Q, B) is essential for magnetite biomineralization, while in single deletion 113

mutants of the other genes biomineralization was impaired to different degree (18). The 114

smaller mamGFDCop, mms6op and mamXYop are not essential but have accessory roles in 115

controlling the biomineralization of properly sized and shaped crystals (2, 16, 19). For 116

instance, the combined deletion of mamG, F, D, and C encoding some of the most abundant 117

magnetosome membrane proteins resulted in somewhat smaller and less regular magnetite 118

particles (2), whereas deletion of the entire 3.7 kb (5 genes) mms6op caused the synthesis of 119

substantially smaller and misaligned crystals (16). Consistent with these findings, the MmsF 120

and Mms6 proteins were predicted to be major regulators of crystal size and shape in the 121

closely related M. magneticum (20, 21). In MSR deletion of the entire mamXYop that encodes 122

various functions in redox and transport of iron also caused a mixed phenotype, characterized 123

by smaller, regular shaped magnetite crystals that were flanked by irregular shaped tiny flake-124

like hematite crystals. Unlike deletions of all other magnetosome genes which consistently 125

resulted in crystal size reduction of various degrees, loss of mms36 and mms48 (comprised 126

within mms6op) intriguingly caused the synthesis of fewer but larger magnetite crystals (18). 127

Plasmid expression of the entire mamGFDCop in the WT also resulted in the formation of 128

slightly enlarged (by 14.7%) magnetite particles (2). From these observations it was 129

concluded that magnetite biomineralization is affected in a cumulative manner by various 130

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 6 von 34

different magnetosome proteins (18). However, it has remained unknown how maximum size 131

and numbers of magnetosomes are precisely regulated, and controlled genetic overproduction 132

of magnetosome biosynthesis has not been achieved, much due to the difficulties of large 133

scale genome engineering in the native MTB. 134

In this study, we established and systematically explored a strategy for overexpression of 135

magnetosome biosynthesis by genomic multiplication of single and multiple magnetosome 136

gene clusters via sequential chromosomal insertion by transposition. While stepwise insertion 137

of additional mms6op copies caused the formation of increasingly larger (up to 80 nm) 138

regularly shaped magnetite crystals, duplication of all four known magnetosome operons 139

resulted in an overproducing strain, in which magnetosome numbers were more than 2fold 140

increased on average. Our findings also indicate that the expression level of many Mam and 141

Mms proteins together limits the upper size and number of magnetosomes within the cell. We 142

demonstrate that genetically tuned expression of the mam and mms clusters provides a 143

powerful strategy for the control of the magnetosome size and numbers, thereby setting the 144

stage for high-yield production of tailored magnetic nanoparticles in various hosts by 145

synthetic biology approaches. 146

147

148

149

150

151

152

153

154

155

156

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 7 von 34

Methods 157

Bacterial strains, plasmids, and culture conditions 158

MSR and its mutant strains (Tab. S1) were grown in liquid modified flask standard medium 159

(FSM) or low iron medium (LIM) at 30° C under microaerobic condition if not otherwise 160

specified (24). Therefore, cells were cultivated in gassed flasks with a mixture of 2% O2 and 161

98% N2 or in purged jars. For anaerobic cultivation, O2 was excluded from the gas mixture, 162

while aerobic conditions were generated by free gas exchange to air. Single colonies were 163

transferred into 100 μl FSM medium in 96-deep-well plates (Eppendorf, Hamburg, Germany 164

and incubated in anaerobic jars for 5 to 6 days. The liquid cultures were scaled up to an final 165

volume of 10 ml. Culture conditions for Escherichia coli strains (Tab. S1) were as previously 166

described (38). For strains BW29427 and WM3064 lysogeny broth medium was 167

supplemented with 1 mM DL-α, ε-diaminopimelic acid (DAP). For selection of antibiotic 168

resistant strains the following antibiotics concentrations were used: 25 µg ml-1 kanamycin 169

(Km), 12 µg ml-1 tetracycline (Tet), and 15 µg ml-1 gentamicin (Gm) for E. coli strains, and 170

5 µg ml-1 kanamycin, 5 µg ml-1 tetracycline, and 20 µg ml-1 gentamicin for MSR strains, 171

respectively. Magnetosomes were isolated as described in Grünberg et al. (2004) after 172

microaerobic cultivation of 5 liter cultures (39). Optical density and magnetic response (Cmag) 173

were analyzed photometrical at 565 nm (40). 174

175

Molecular and genetic techniques 176

Oligonucleotide sequences for amplification of DNA fragments (Tab. 1) were deduced from 177

the working draft genome sequence of MSR (GenBank accession number No. CU459003) 178

and were purchased from Sigma-Aldrich (Steinheim, Germany). Standard polymerase chain 179

reaction (PCR) procedures were used to amplify genetic fragments, and plasmids were 180

sequenced using BigDye Terminator v3.1 chemistry on an in-house ABI 3730 capillary 181

sequencer (Applied Biosystems, Darmstadt, Germany). Sequences were analyzed with 182

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 8 von 34

Software Vector NTI Advance® 11.5 (Invitrogen, Darmstadt, Germany). For genomic 183

sequencing of overexpression strains tagged libraries (about 200-300 bp insert size) were 184

constructed from 1 ng of genomic DNA with the Nextera XT DNA kit (Illumina) according to 185

the manufacturer's protocol. The eight libraries were sequenced in multiplex format using the 186

Illumina MiSeq technology. The obtained sequences were assembled de novo as well as to the 187

reference genome with a commercial software, CLC Genomics Workbench 5.5. 188

189

Analytical methods 190

Iron content of magnetosomes or whole cells was measured three times in triplicates by 191

ferrozine assay (41). After 16 hours of cultivation cells were washed with 20 mM Tris-HCl, 5 192

mM EDTA, pH 7.4 to remove extracellular iron. 1 ml cultures were centrifuged for 1 min at 193

11,000 xg and resuspended in 90 µl HNO3 (65%) for 3 h at 99° C. Afterwards, the lysate was 194

cleared by centrifugation and resuspended in 1 ml H2O and ferrozine assay was performed as 195

previously described (22, 41). 196

197

Construction of plasmids for overexpression and conjugative transfer 198

Plasmids pTps_AB and pTps_XYZ were constructed in a previous study by Kolinko et al., 199

2014 (17). For cloning of plasmid Gm-pTps_AB, the Km resistance gene on plasmid 200

pTps_AB was exchanged by gentamicin via recombinogenic cloning (42, 43). To this end, a 201

cloning cassette comprising the gentamicin gene and the respective promoter was PCR-202

amplified (oligonucleotides IB173/IB174) and transferred into electrocompetent E. coli cells 203

(DH10ß+pTps_AB) expressing phage derived recombinases from a plasmid (pSC101-BAD-204

gbaA). After transfer of the cassette, recombination between homologous regions on the 205

linear fragment and the plasmid pTps_AB occurred. 206

For overexpression of the mms6 and mamGFDC operon, a modified pBam-1 vector was 207

designed. To this end, egfp (enhanced green fluorescent protein) was amplified with 208

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 9 von 34

oligonucleotides IB102 and IB103 and integrated after digestion with KpnI and EcoRI into 209

pBam-1, resulting in pBam-gfp. The mamGFDC (2185 bp) and mms6 operons (3638 bp) were 210

amplified by PCR from the genome of MSR (AL179/AL301) and were inserted into the 211

XbaI+KpnI digested pBam-gfp, resulting in pBam_mamGFDC and pBam_mms6 1x, 212

respectively with a C-terminal fusion to mamC or mms48 of egfp. For generation of 213

pBam_mms6 2x and pBam_GFDC/mms6, the mms6 operon of pBam_mms6 1x was amplified 214

with oligonucleotides AL377/AL379 and integrated into pBam_mamGFDC as well as 215

pBam_mms6 1x after digestion with EcoRI. To realize the insertion of four mms6 operons the 216

gentamicin gene, flanked by a lox71 and lox66 sequence was generated by amplification with 217

oligonucleotides AL300/AL303 from pBBR-MCS5 and cloned into the SanDI/AatII side of 218

pBam_mamGFDC, resulting in pBam_GFDC/Gm. The mamGFDC operon was exchanged by 219

the mms6 operon after digestion of pBam_GFDC/Gm with XbaI+KpnI, generating 220

pBam_mms6/Gm. Generated plasmids were examined by restriction analysis with a set of 221

different enzymes or PCR and transferred into different recipients via conjugation as 222

described elsewhere (22). 223

224

Fluorescence microscopy 225

For localization studies of the EGFP-fusion proteins and cell length measurements, generated 226

mutant strains of MSR were immobilized on agarose pads (FSM salts in H2O, supplemented 227

with 1% agarose), and analyzed with an Olympus BX81 microscope provided with a 100 228

UPLSAPO100XO objective (numerical aperture of 1.40) and a Hamamatsu Orca AG camera. 229

Data were evaluated with the Olympus cell software. 230

231

Electron microscopy techniques 232

Cells or magnetosomes were concentrated and adsorbed onto carbon-coated copper grids for 233

TEM analyses. Isolated magnetosomes were treated with 1% (v/v) uranyl acetate for staining 234

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 10 von 34

of magnetosome membrane. Cells and vesicles were imaged with a FEI Morgagni 268 (FEI, 235

Eindhoven, Netherlands) at an accelerating voltage of 200 kV. 236

For Cryo-electron tomography (CET) analysis, cells were cultivated anaerobically in FSM or 237

aerobically in LIM and treated with formaldehyde (Fluka, Switzerland) to a final 238

concentration of 0.1% v/v after 16 h of cultivation. A FEI Tecnai F30 Polara transmission 239

electron microscope (FEI; Eindhoven, the Netherlands), equipped with a 300 kV field 240

emission gun, a Gatan GIF 2002 Post-Column Energy Filter, and a 2048 x 2048 pixel Gatan 241

CCD camera (Gatan; Pleasanton, CA) was used for data generation, whereby image 242

acquisition was performed at 300 kV, with the energy filter operated in the zero-loss mode 243

(slit width of 20 eV). Sample preparation and acquisition scheme were implemented as 244

described previously (5). Tilt series were acquired with Serial EM software and three-245

dimensional reconstructions were performed with the weighted back-projection method using 246

TOM toolbox (44). 247

248

Statistical analysis of magnetosome size and number 249

The t-test (http://www.socscistatistics.com/tests/studentttest/Default.aspx) was used to 250

determine the significance of differences in crystal size distributions. For statistical analysis of 251

the differences in crystal numbers, the u-test was performed (https://ccb-compute2.cs.uni-252

saarland.de/wtest/?id=www/www-ccb/html/wtest). 253

254

Cell fractionation 255

Mutant strains IK-1, 3xmms6op, and 2xABG6Xop were grown in 5 liter FSM under 256

microaerobic conditions. After centrifugation at 9,000 xg, cells were resuspended in 20 mM 257

Tris-HCl, pH 7.4, 5 mM EDTA and stored at 4° C. Cell fractionation and magnetosomes 258

isolation were executed as described elsewhere (45). 259

260

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 11 von 34

Gel electrophoresis and Western blot experiments 261

The BCA-Protein Micro assay kit (Pierce) was used for determination of protein 262

concentrations, according to the manufacturer’s recommendation. Protein samples from the 263

magnetosome membrane fraction were resuspended in electrophoresis sample buffer and 264

denatured at 98° C for 5 min. Polyacrylamide gels were prepared according to the procedure 265

of Laemmli (46). 10 µg of protein extracts were separated on a 15% SDS-polyacrylamide gel. 266

Protein bands were visualized by Coomassie brilliant blue staining. Western blot analysis for 267

detection of MamM, MamA and MamC was performed as previously described (39). The 268

intensity of the protein bands of MamM, MamA and MamC was compared via the ImageJ 269

software. 270

271

272

273

274

275

276

277

278

279

280

281

282

283

284

285

286

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 12 von 34

Results 287

Magnetosome gene clusters can be multiplied by sequential chromosomal 288

transposition 289

In the absence of appropriate promoters for transcriptional overexpression (13), we 290

explored the effects of genetic multiplication of magnetosome operons by sequential 291

transposition. For stabilization of multiple identical gene copies we chose the recA mutant 292

strain IK-1 (22) of MSR as chassis, which is otherwise wildtype (WT) with respect to 293

magnetosome biosynthesis (Tab. 2). As described below, multiple copies of various 294

magnetosome gene clusters between 2 and 17 kb in size cloned on non-replicative vectors 295

were inserted into the chromosome of the parental strain IK-1. Therefore sequential rounds 296

of mariner or Tn5 transposon driven random chromosomal insertions were selected by 297

multiple antibiotic resistances (Fig. 1), similar as previously applied for genetic transfer of 298

the entire magnetosome biosynthesis pathway into a foreign host (17). Transconjugants 299

were typically obtained at frequencies of 10-7 and 10-8 and found inserted in single copies 300

as revealed by genome sequencing (Tab. S2). As tested for several of the resulting strains, 301

antibiotic resistance and magnetosome phenotypes remained stable for >100 generations in 302

the absence of selective pressure. 303

304

Multiplication of mms6 and mamGFDC operons causes enlargement of 305

magnetite crystals 306

First, we tested the approach by attempting to insert one, two, three and four additional 307

copies of the mms6 operon by consecutive transposition of pBam_mms6 1x, pBam_mms6 308

2x and pBam_mms6/Gm, resulting in strains 2xmms6op, 3xmms6op, 4xmms6op and 309

5xmms6op, respectively. The merodiploidic strain 2xmms6op, which now harbored one 310

additional copy of the mms6op, displayed a slightly increased magnetic response, an 311

increased intracellular iron accumulation (+15%), and the number of magnetosome crystals 312

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 13 von 34

per cell (47 particles, p<1.3 E-6) was higher (+37%) than in IK-1 with the mean particle 313

size increased by 26% (46 nm, p<1. 0 E-5, Tab. 2). Insertion of two and three additional 314

copies resulted in strains 3xmms6op and 4xmms6op, respectively, and caused a further 315

increase in crystal size and number by about 32% and 70% compared to IK-1. However, 316

insertion of an additional mms6op copy (yielding strain 5xmms6op) did not further enhance 317

biomineralization, but caused reduction of particle size and number compared to its parent 318

strain 4xmms6op (Tab. 2). Also, increasing extracellular iron concentrations up to 250 µM 319

had no effect on biomineralization in the overproducing strains (data not shown). 320

Within some cells of 2xmms6op and 2xmamABop, a variable proportion of enlarged 321

vesicles were visible in cryo electron tomograms (Fig. 3a). These “giant” vesicles 322

appeared spherically shaped as in the WT, but their size was increased up to nearly 110 nm 323

(2xmms6op) or 81 nm respectivley (2xmamABop), whereas vesicles of the WT had a 324

maximum size of 63 nm. In addition, increase in mms6op copy number caused a slight 325

gradual cell elongation with a maximum mean cell length of 5.3 µm for strain 5xmms6op, 326

(IK-1: 4.4 µm, Tab. 2, Fig. 2a). Cell length seemed to be correlated with the magnetosome 327

number within the same strain. For example shorter cells of strain 2xmms6op contained 328

fewer (43 particles) and smaller (43 nm) crystals. On the other hand highly elongated cells 329

(>10 µm) contained significantly more (53-138 particles, mean: 104) and larger (49 nm) 330

magnetosome crystals with a maximum size of 80 nm (Fig. S1). While magnetosome 331

chains in cells of strains 2xmms6op and 3xmms6op were persistently located at midcell and 332

split during cell division as in the WT (23), daughter cells of 2xmms6op and 3xmms6op 333

remained frequently connected by deformed separation sites, sometimes even extending 334

into tubular structures connecting the daughter cells, which probably result from 335

incomplete separation of the cells during or after division (Fig. 4). Within these structures 336

often up to 20 magnetosome particles were found to be enclosed (Fig. 4b). 337

Next, we explored the effects of overexpressing the mamGFDCop, which is adjacent to the 338

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 14 von 34

mms6op and which was previously shown to be involved in size control of magnetosomes 339

(2). While duplication of mamGFDCop (strain 2xGFDCop) alone only resulted in only 340

moderate increase in number (+7%, p<0.32, Tab. 2) and size (+24%, p<1. 0 E-5, Tab. 2) of 341

crystals, the simultaneous duplication of both mms6op and mamGFDCop 342

(2xmms6op+2xGFDCop) caused the synthesis of 33% more crystals per cell (p<8.2 E-6, 343

Tab. 2), consistent with the iron content increased by 7.4% in 2xGFDCop and even further 344

by 14.1% in strain 2xmms6op+2xGFDCop (Tab. 2). Magnetosome crystals of strains 345

2xGFDCop and 2xmms6op+2xGFDCop were larger by approximately 25% compared to 346

IK-1 (Tab. 2). 347

348

Multiplication of the mamABop results in heterogeneous magnetosome morphotypes 349

We next attempted to multiply the large mamABop that was shown to encode all 350

magnetosome proteins essential for magnetosome formation (16, 18). The merodiploidic 351

strain 2xmamABop (i. e., harboring one native and one additional mamABop copy) showed 352

a similar magnetic response and iron content as the parental strain (Tab. 2). Remarkably, 353

the mean number of crystals per cell was increased by 115%. However, closer inspection 354

by TEM revealed that cultures of strain 2xmamABop were heterogeneous with respect to 355

magnetosome phenotypes. Three distinct morphotypes were present in variable 356

proportions, comprising i) ~50% cells in which the number of regular-sized magnetosomes 357

was increased to 77 particles per cell with a regular chain like organization, ii) ~40% cells 358

with increased number of magnetosomes (68 per cell), but with smaller crystal sizes and 359

aberrant intracellular localization, and iii) 10% WT-like cells (Fig. S2). This pattern 360

remained constant even after repeated clonal selection by colony purification of the strain. 361

Compared to the single chain typically found in WT cells, we frequently observed two 362

distinct magnetosome chains within cells of 2xmamABop, which were aligned along two 363

separate bundles of cytoskeletal filaments located at opposite sides of the cell as detected 364

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 15 von 34

by Cryo-electron tomography (CET) (Fig. 3b). Purified magnetosome crystals from strain 365

2xmamABop were enveloped by a magnetosome membrane (MM) with the same 366

appearance and thickness as in the WT. Coomassie-stained SDS-PAGE profiles of the MM 367

from strains 2xmamABop and 3xmms6op displayed also similar band patterns as the MM 368

of strain IK-1. However, the intensity of bands at 33 and 24 kDa (corresponding to 369

magnetosome proteins MamA and MamM that were among the duplicated genes) was 370

increased, and quantitative Western blot analysis confirmed higher abundance of these 371

proteins by about 130% and 145%, respectively. On the contrary, the abundance of MamC, 372

which is encoded outside the mamABop was not significantly affected (below 10% 373

variation, Fig. S3). 374

The merotriploidic insertion mutant 3xmamABop (obtained by transfer of pTps-mamAB-375

Gm into strain 2xmamABop) showed a similar phenotype as strain 2xmamABop, and the 376

number of magnetosomes did not further increase, despite of a slightly increased 377

intracellular iron content (+9.4%). The Cmag (magnetic response) of strain 3xmamABop 378

was even lower than that of the parental strain (0.5±0.2), possibly caused by the altered cell 379

dimensions (Tab. 2). In summary, overexpression of mamABop alone caused a 380

heterogeneous phenotype, but overall did not consistently enhance magnetosome 381

biosynthesis. 382

383

Chromosomal duplication of all magnetosome gene clusters causes magnetosome 384

overproduction 385

The previous experiments had revealed that chromosomal insertion of up to three 386

additional mms6 operons gradually enhanced the biosynthesis of magnetosomes. However, 387

neither introduction of additional mms6op copies nor the combined overexpression of 388

mamGFDCop, and mamABop alone did further increase biomineralization, suggesting that 389

magnetosome synthesis in these strains was likely limited by different factors encoded 390

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 16 von 34

outside the multiplied operons. Therefore, we next attempted the combined overexpression 391

of all four major operons (mms6op, mamGFDCop, mamABop and mamXYop). To this end, 392

mamABop, mms6op, and mamGFDCop were altogether inserted into the chromosome of 393

IK-1 by transposition of pTps_ABG6. Next, in addition we inserted the mamXYZop 394

(lacking ftsZm to avoid interference with cell division during cloning (17) resulting in 395

strain 2xABG6Xop, which is merodiploidic for all four key magnetosome operons (Fig. 1). 396

Transconjugants of 2xABG6Xop were obtained at frequencies of only 2-5x10-9. Compared 397

to strains in which the copy number of a single operon was increased and which showed 398

essentially WT-like growth under all tested conditions, growth of strain 2xABG6Xop was 399

severely impaired at temperatures ≥30 °C. However, since WT-like growth was observed 400

at 23 °C, cells were cultivated at this temperature in all subsequent experiments. Cells on 401

average were more elongated (5.1 µm) than the parent strain IK-1, and we also observed 402

deformed separation sites during or after cell division similar to those in 4xmms6op (data 403

not shown). 404

While the magnetic response of strain 2xABG6Xop was similar to that of IK-1, the 405

intracellular iron content was 2.4 fold increased. Cells contained 74 electron-dense 406

particles on average, equivalent to an increase in number by 118% (Tab. 2; Fig. 1). 407

Magnetosome yields (mg Fe3O4 per g biomass (wet weight)) were also substantially 408

increased during anaerobic, nitrate-fed growth experiments at larger scale in a 30 liter 409

fermenter, in which strain 2xABG6Xop showed similar cell yields (cells per ml) to the WT 410

(OD565nm = 0.5 after 36 h), and 2.8 mg Fe3O4 per g of biomass (wet weight) could be 411

isolated, compared to the about 1.20 mg/g obtained from fermenter-grown WT cells. 412

As we recently found that co-expression of the ferrous iron uptake system FeoAB1 413

encoded next to the MAI together with the four key magnetosome operons further 414

enhanced heterologous magnetosome biosynthesis (17), we tested whether overexpression 415

of these proteins also may enhance biomineralization in overproducing MSR. To this end, 416

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 17 von 34

feoA and feoB genes (comprised on Tet-pBam_feoAB1) were inserted into 2xABG6Xop by 417

Tn5 transposition. Whereas crystal sizes were not significantly increased (41 nm vs. 39 nm 418

in 2xABG6Xop) in the resulting strain 2xABG6X+2xfeo, the crystal number per cell was 419

slightly decreased (69 particles instead of 74 in strain for 2xABG6Xop, Tab. 2). 420

About 28% of the cells from the overproducer strain 2xABG6Xop had more than 100 421

magnetosomes (maximum: 170), whereas IK-1 cells were found to never contain more 422

than about 60 magnetosomes. However, the mean size of crystals was only slightly 423

increased to 39 nm (Fig. S4, Tab. 2), and empty and partially filled MM vesicles 424

(approximately 54 nm in size) were not significantly enlarged compared to the WT (Fig. 425

2). Most cells contained multiple (two to four) magnetosome chains (9% one chain, 23% 426

two chains, 34% three chains, 18% four chains) (Fig. 2), whereas the WT typically exhibits 427

not more than 2 chains per cell (76% one chain, 20% two chains, 4% three chains, 0% four 428

chains) (23). Beside cells with proper WT-like chains (localized near the inner curvature of 429

the cell), we frequently observed cells with ectopically positioned chains (Fig. 2bi). The 430

plentiful particles present in some cells often lacked any clearly ordered chain-like 431

alignment, but appeared “stuffed” into compact bundles or large irregular clusters (Fig. 432

2bii). Cells exhibited a tendency to spontaneously disintegrate as indicated by the presence 433

of released magnetosome particles in the vicinity of partially lysed cell bodies in TEM 434

micrographs (Fig. 2biii). 435

436

437

438

439

440

441

442

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 18 von 34

Discussion 443

Despite of some progress by growth optimization (24, 25) previous attempts to increase 444

magnetosome yields at large scale were met only by limited success. In this work, we 445

established a strategy to enhance magnetosome production by genetic engineering. In the 446

absence of well characterized promoters for very strong and inducible transcription, we 447

attempted overexpression by increasing copy numbers of several or all mam and mms operons 448

comprised within the genomic magnetosome island. Since we previously found that 449

unbalanced multi-copy expression of the large mamABop from replicative plasmids was 450

unstable in MSR and caused spontaneous deletions and rearrangements (data not shown), we 451

employed chromosomal insertion via transposition. In striking contrast to plasmid expression, 452

chromosomally multiplied gene clusters apparently remained stable at least within the tested 453

>100 generations grown under laboratory-scale conditions. 454

Similar amplification via chromosomal multi-copy insertion of gene clusters has been applied 455

in several other studies. For instance, Tang et al. recently increased production of the 456

secondary metabolite spinosyn in the native host by partial gene cluster duplication (26). 457

Using a chemically inducible chromosomal evolution approach, 40 copies of a poly-3-458

hydroxybutyrate gene cluster were consecutively inserted into the chromosome of E. coli, 459

thereby causing a significant productivity increase for this biopolymer (27). 460

In our study, dupli- or triplication of the mms6 operon alone caused a gradual strong 461

enlargement of magnetite crystals, but only a moderate increase in their numbers. In contrast, 462

duplication of all mam and mms gene clusters yielded an overproducing strain (2xABG6Xop), 463

in which average magnetosome numbers per cell were greatly increased by at least 120% 464

compared to previous studies (16, 10). This strain is also highly promising for future 465

magnetosome production at larger scale as it continued to produce large magnetosome 466

numbers per cell (up to 170 cell-1) even during mass cultivation while cell yield remained 467

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 19 von 34

wildtype-like. Thus, magnetosome yields from the overproducing strain (2xABG6Xop) were 468

2.3-fold increased compared to the WT. 469

On the other hand, the mean size of magnetite crystals was only weakly increased by 470

duplication of all MAI clusters, compared to the strong effect of mms6 operon multiplication 471

alone. This suggests that the engineering of distinct determinants can control both 472

magnetosome size and number independently. However, the fact that the iron contents of less 473

magnetic strains with fewer particles were in similar to those with more particles, such as 474

2xmms6op and 2xABG6Xop, raises the question whether the less magnetic strains might have 475

accumulated iron in form other than magnetite, or other substantial iron pools. The existence 476

of such variable iron pools could have been affected to different degrees by inserted mutations 477

in a yet unknown way and will be subject to future studies. 478

It is well established that various physical characteristics of magnetic nanoparticles, such as 479

sedimentation stability and magnetic remanence, are functions of their size (14). While 480

particles smaller than about 30 nm are superparamagnetic (i. e. no permanent magnetic signal 481

at room temperature in the absence of an external field), particles between 30 and about 60-482

100 nm have stable single domains (i. e., a remanent magnetization), and the large single 483

domain particles generated in this study can be expected to be close to the maximum with 484

respect to coercivity (28). Although full characterization of their magnetic properties remains 485

to be completed, initial analysis of some of the engineered large particles indeed indicated 486

stable single domain behavior and a higher magnetic coercivity than WT magnetosome 487

particles (29). Since so far no synthetic routes are available for the abiogenic fabrication of 488

such large magnetic single domain nanoparticles, our findings will be of particular interest in 489

applications, which depend on the specific magnetic properties of such large and size-490

adjustable particles, such as magnetic resonance imaging (30) or hyperthermia (14). 491

Size, shape, number and intracellular organization of magnetosomes also critically affect the 492

strength of the cellular dipole moment that aligns cells by magnetic torque (1). Under 493

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 20 von 34

environmental conditions, magnetosome biosynthesis has to be precisely regulated to be 494

strong enough to orient the cell within the weak geomagnetic field with sufficient efficiency. 495

On the other hand increasing the number and size beyond the rather narrow evolutionary 496

optimum that has been calculated for magnetic spirilla with about 20-25 particles per cell (31) 497

would not significantly improve orientation because of the asymptotic Langevin function for 498

alignment of magnetic dipoles (1), but would increase metabolic burden and energetic costs of 499

excessive magnetosome biosynthesis as well as potential harmful effects related to increased 500

iron uptake (1). However, it has remained unknown, how the maximum number and upper 501

size limit of magnetic single-domain particles are controlled at the molecular and structural 502

levels. One important factor spatially constraining the growth of crystals can be expected the 503

size of magnetosome vesicles (2). In fact, we sometimes observed significantly enlarged 504

vesicles in the mms6 insertion strains by CET (Fig. 3). This indicates that overexpression of a 505

subset of proteins might directly influence the vesicle diameter prior to crystallization, thereby 506

defining the increase in crystal size. Besides vesicle biogenesis, also magnetosomal iron 507

import into the vesicles is required to sustain growth of magnetite (Fe3O4) crystals. While 508

none of the proteins encoded by the mms6 operon likely function as iron transport proteins, 509

amplification of putative iron transporters (MamB, M, H, and Z) might explain the increase in 510

magnetosome number in 2xABG6Xop. In fact, in strain 2xmamABop, expression of MamM in 511

the MM was markedly increased by about 130% compared to the parent strain. 512

Overexpression of a subset of magnetosome genes might also influence expression or 513

recruitment of other proteins controlling accessory processes during magnetosome formation 514

(32, 33). 515

Altogether, our findings suggest that the balanced expression level of magnetosome proteins 516

is one important factor for determination of the number and size of magnetite crystals. 517

However, this also raises the intriguing question of what might potentially define the upper 518

limit of number or size of magnetosomes in overexpression strains. For instance, the 519

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 21 von 34

extracellular supply is known to be critical for magnetosome formation in MSR and iron 520

concentrations of 100 µM were found to be already saturating for cell yield and magnetism 521

(34). Surprisingly, increasing extracellular iron beyond that concentration had no effect on 522

biomineralization in the overproducing strains, and chromosomal duplication of genes 523

encoding the ferrous iron transporter FeoAB1 also had only minor effects (Tab. 2), indicating 524

that the iron supply is not a limiting factor for magnetite overproduction under tested 525

conditions. However, biomineralization of the mixed-valence iron oxide magnetite was found 526

to be critically dependent on proper ferric-to-ferrous iron ratio (35-37), and thus regulation by 527

general metabolic pathways such as aerobic and anaerobic respiration processes might 528

become limiting with increasing expression of the magnetosome synthesis machinery. 529

It might be also possible that further increase in magnetosome overproduction might be 530

simply limited by spatial constraints imposed by the shape and confined size of the cell 531

lumen. We also found that magnetosome overexpression increasingly impaired growth of 532

overproducing cells. For instance, strain 2xABG6Xop eventually reached similar cell yields, it 533

no longer grew at the usual 30° C, but required incubation at lower temperatures around 23° 534

C, possibly due to accumulation of misfolded overexpressed proteins or effects on lipid 535

biosynthesis required for increased MM biosynthesis. In addition, we observed that cell 536

division was slightly impaired in cells, as indicated by the presence of conspicuously 537

elongated cells that often remained connected by deformed separation sites at advanced stages 538

of constriction. This phenotype might be caused by the stronger magnetostatic interactions 539

between the larger and more abundant particles within the chains, which require higher 540

mechanical forces to be overcome (23). Altogether, in addition to the maximum cell size, 541

there are likely multiple factors, which set an upper limit for future overexpression 542

approaches that may require engineering of the native host or use of alternative foreign 543

expression hosts. 544

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 22 von 34

In conclusion, our results are very promising for the construction of further engineered strains 545

of magnetotactic bacteria, overproducing for example genetically engineered magnetosomes 546

with enhanced functionalities and even higher magnetosome yields (9, 13). Furthermore, 547

overexpression of selected magnetosome genes and clusters in homologous and heterologous 548

hosts might be exploited for the design and mass production of size-adjusted nanocrystals 549

with tuned magnetic properties. 550

551

Funding Information 552

This work was supported by the Human Frontier Science Foundation (grant RGP0052/2012), 553

the Deutsche Forschungsgemeinschaft (grant SCHU 1080/15-2) and the European Union 554

(Bio2MaN4MRI). A.L. was supported by the Konrad-Adenauer-Stiftung. The funders had no 555

role in study design, data collection and interpretation, or the decision to submit the work for 556

publication. 557

558

Acknowledgment 559

We are thankful to A. Nieto, R. Susen, and A. Hähle for expert technical and experimental 560

assistance. All authors declare that no competing interests exist. 561

562

Supplemental Material 563

Table S1 564

Figure S1 565

Figure S2 566

Figure S3 567

Figure S4 568

569

570

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 23 von 34

References 571

1. Frankel RB, Bazylinski DA. 1995. Structure and function of the bacterial 572

magnetosome. ASM News 61:337–343. 573

2. Scheffel A, Gardes A, Grünberg K, Wanner G, Schüler D. 2008. The major 574

magnetosome proteins MamGFDC are not essential for magnetite biomineralization in 575

Magnetospirillum gryphiswaldense but regulate the size of magnetosome crystals. J 576

Bacteriol 190:377-386. 577

3. Schleifer KH, Schüler D, Spring S, Weizenegger M, Amann R, Ludwig W, 578

Köhler M. 1991. The Genus Magnetospirillum gen. nov. Description of 579

Magnetospirillum gryphiswaldense sp. nov. and Transfer of Aquaspirillum 580

magnetotacticum to Magnetospirillum magnetotacticum comb. nov. System Appl 581

Microbiol 14:379–385. 582

4. Schüler D. 2008. Genetics and cell biology of magnetosome formation in 583

magnetotactic bacteria. FEMS Microbiol Rev 32:654-672. 584

5. Katzmann E, Scheffel A, Gruska M, Plitzko JM, Schüler D. 2010. Loss of the 585

actin-like protein MamK has pleiotropic effects on magnetosome formation and chain 586

assembly in Magnetospirillum gryphiswaldense. Mol Microbiol 77:208-224. 587

6. Scheffel A, Gruska M, Faivre D, Linaroudis A, Plitzko JM, Schüler D. 2006. An 588

acidic protein aligns magnetosomes along a filamentous structure in magnetotactic 589

bacteria. Nature 440:110-114. 590

7. Uebe R, Voigt B, Schweder T, Albrecht D, Katzmann E, Lang C, Böttger L, 591

Matzanke B, Schüler D. 2010. Deletion of a fur-like gene affects iron homeostasis 592

and magnetosome formation in Magnetospirillum gryphiswaldense. J Bacteriol 593

192:4192-4204. 594

8. Faivre D, Schüler D. 2008. Magnetotactic bacteria and magnetosomes. Chem Rev 595

108:4875-4898. 596

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 24 von 34

9. Lang C, Schüler D. 2006. Biogenic nanoparticles: production, characterization, and 597

application of bacterial magnetosomes. J Phys: Condens Matter 18:2815-2828. 598

10. Sun JB, Duan JH, Dai SL, Ren J, Guo L, Jiang W, Li Y. 2008. Preparation and 599

anti-tumor efficiency evaluation of doxorubicin-loaded bacterial magnetosomes: 600

magnetic nanoparticles as drug carriers isolated from Magnetospirillum 601

gryphiswaldense. Biotechnol Bioeng 101:1313-1320. 602

11. Lang C, Schüler D, Faivre D. 2007. Synthesis of magnetite nanoparticles for bio- 603

and nanotechnology: genetic engineering and biomimetics of bacterial magnetosomes. 604

Macromol Biosci 7:144-151. 605

12. Lang C, Schüler D. 2008. Expression of green fluorescent protein fused to 606

magnetosome proteins in microaerophilic magnetotactic bacteria. Appl Environ 607

Microbiol 74:4944-4953. 608

13. Borg S, Hofmann J, Pollithy A, Lang C, Schüler D. 2014. New vectors for 609

chromosomal integration enable high-level constitutive or inducible magnetosome 610

expression of fusion proteins in Magnetospirillum gryphiswaldense. Appl Environ 611

Microbiol 8:2609-2616. 612

14. Hergt R, Hiergeist R, Zeisberger M, Schüler D, Heyen U, Hilger I, Kaiser WA. 613

2005. Magnetic properties of bacterial magnetosomes as diagnostic and therapeutic 614

tools. J Magn Magn Mater 293:80-86. 615

15. Ullrich S, Kube M, Schübbe S, Reinhardt R, Schüler D. 2005. A hypervariable 616

130-kilobase genomic region of Magnetospirillum gryphiswaldense comprises a 617

magnetosome island which undergoes frequent rearrangements during stationary 618

growth. J Bacteriol 187:7176-7184. 619

16. Lohsse A, Ullrich S, Katzmann E, Borg S, Wanner G, Richter M, Voigt B, 620

Schweder T, Schüler D. 2011. Functional analysis of the magnetosome island in 621

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 25 von 34

Magnetospirillum gryphiswaldense: the mamAB operon is sufficient for magnetite 622

biomineralization. PLoS One 6:e25561. 623

17. Kolinko I, Lohsse A, Borg S, Raschdorf O, Jogler C, Tu Q, Posfai M, Tompa E, 624

Plitzko JM, Brachmann A, Wanner G, Müller R, Zhang Y, Schüler D. 2014. 625

Biosynthesis of magnetic nanostructures in a foreign organism by transfer of bacterial 626

magnetosome gene clusters. Nature Nanotech 9:193-197. 627

18. Lohsse A, Borg S, Raschdorf O, Kolinko I, Tompa É, Pósfai M, Faivre D, 628

Baumgartner J, Schüler D. 2014. Genetic dissection of the mamAB and mms6 629

operons reveals a gene set essential for magnetosome biogenesis in Magnetospirillum 630

gryphiswaldense. J Bacteriol 14:2658-2669. 631

19. Raschdorf O, Müller FD, Pósfai M, Plitzko JM, Schüler D. 2013. The 632

magnetosome proteins MamX, MamZ and MamH are involved in redox control of 633

magnetite biomineralization in Magnetospirillum gryphiswaldense. Mol Microbiol 634

89:872-886. 635

20. Tanaka M, Mazuyama E, Arakaki A, Matsunaga T. 2011. MMS6 protein regulates 636

crystal morphology during nano-sized magnetite biomineralization in vivo. J Biol 637

Chem 286:6386-6392. 638

21. Murat D, Falahati V, Bertinetti L, Csencsits R, Kornig A, Downing K, Faivre D, 639

Komeili A. 2012. The magnetosome membrane protein, MmsF, is a major regulator of 640

magnetite biomineralization in Magnetospirillum magneticum AMB-1. Mol Microbiol 641

4:684-699. 642

22. Kolinko I, Jogler C, Katzmann E, Schüler D. 2011. Frequent mutations within the 643

genomic magnetosome island of Magnetospirillum gryphiswaldense are mediated by 644

RecA. J Bacteriol 193:5328-5334. 645

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 26 von 34

23. Katzmann E, Müller FD, Lang C, Messerer M, Winklhofer M, Plitzko JM, 646

Schüler D. 2011. Magnetosome chains are recruited to cellular division sites and split 647

by asymmetric septation. Mol Microbiol 82:1316-1329. 648

24. Heyen U, Schüler D. 2003. Growth and magnetosome formation by microaerophilic 649

Magnetospirillum strains in an oxygen-controlled fermentor. Appl Microbiol 650

Biotechnol 61:536-544. 651

25. Zhang Y, Zhang X, Jiang W, Li Y, Li J. 2011. Semicontinuous culture of 652

Magnetospirillum gryphiswaldense MSR-1 cells in an autofermentor by nutrient-653

balanced and isosmotic feeding strategies. Appl Environ Microbiol 77:5851-5856. 654

26. Tang Y, Xia L, Ding X, Luo Y, Huang F, Jiang Y. 2011. Duplication of partial 655

spinosyn biosynthetic gene cluster in Saccharopolyspora spinosa enhances spinosyn 656

production. FEMS Microbiol Lett 325:22-29. 657

27. Tyo KE, Ajikumar PK, Stephanopoulos G. 2009. Stabilized gene duplication 658

enables long-term selection-free heterologous pathway expression. Nature Biotechnol 659

27:760-765. 660

28. Bennet M, Bertinetti L, Neely RK, Schertel A, Kornig A, Flors C, Müller FD, 661

Schüler D, Klumpp S, Faivre D. 2015. Biologically controlled synthesis and 662

assembly of magnetite nanoparticles. Faraday Discuss 181:71-83. 663

29. Kumari M, Widdrat M, Tompa E, Uebe R, Schüler D, Pósfai M, Faivre D, Hirt 664

AM. 2014. Distinguishing magnetic particle size of iron oxide nanoparticles with first-665

order reversal curves. J Appl Phys 116:12304. 666

30. Sun C, Lee JS, Zhang M. 2008. Magnetic nanoparticles in MR imaging and drug 667

delivery. Adv Drug Deliv Rev 60:1252-1265. 668

31. Frankel RB. 1984. Magnetic guidance of organisms. Annu Rev Biophys Bioeng 669

13:85-103. 670

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 27 von 34

32. Zeytuni N, Ozyamak E, Ben-Harush K, Davidov G, Levin M, Gat Y, Moyal T, 671

Brik A, Komeili A, Zarivach R. 2011. Self-recognition mechanism of MamA, a 672

magnetosome-associated TPR-containing protein, promotes complex assembly. Proc 673

Natl Acad Sci U S A 108:E480-487. 674

33. Murat D, Quinlan A, Vali H, Komeili A. 2010. Comprehensive genetic dissection of 675

the magnetosome gene island reveals the step-wise assembly of a prokaryotic 676

organelle. Proc Natl Acad Sci U S A 107:5593-5598. 677

34. Schüler D, Bäuerlein E. 1996. Iron-limited growth and kinetics of iron uptake in 678

Magnetospirillum gryphiswaldense. Arch Microbiol 166:301-307. 679

35. Li YJ, Katzmann E, Borg S, Schüler D. 2012. The Periplasmic Nitrate Reductase 680

Nap Is Required for Anaerobic Growth and Involved in Redox Control of Magnetite 681

Biomineralization in Magnetospirillum gryphiswaldense. J Bacteriol 194:4847-4856. 682

36. Li YJ, Bali S, Borg S, Katzmann E, Ferguson SJ, Schüler D. 2013. Cytochrome 683

cd1 Nitrite Reductase NirS Is Involved in Anaerobic Magnetite Biomineralization in 684

Magnetospirillum gryphiswaldense and Requires NirN for Proper d1 Heme Assembly. 685

J Bacteriol 195:4297-4309. 686

37. Li Y, Raschdorf O, Silva KT, Schüler D. 2014. The terminal oxidase cbb3 functions 687

in redox control of magnetite biomineralization in Magnetospirillum gryphiswaldense. 688

J Bacteriol 196:2552-2562. 689

38. Sambrook J, Russell D. 2001. Molecular cloning:a laboratory manual, vol 3. Cold 690

Spring Harbor Laboratory Press, Cold Spring Harbor NY. 691

39. Grünberg K, Müller EC, Otto A, Reszka R, Linder D, Kube M, Reinhardt R, 692

Schüler D. 2004. Biochemical and proteomic analysis of the magnetosome membrane 693

in Magnetospirillum gryphiswaldense. Appl Environ Microbiol 70:1040-1050. 694

40. Schüler D, Uhl R, Bäuerlein E. 1995. A simple light-scattering method to assay 695

magnetism in Magnetospirillum gryphiswaldense FEMS Microbiol Lett 132:139-145. 696

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 28 von 34

41. Viollier E, Inglett PW, Hunter K, Roychoudhury AN, Van Cappellen P. 2000. 697

The ferrozine method revisited: Fe(II)/Fe(III) determination in natural waters. Appl 698

Geochemistry 15:785-790. 699

42. Wang J, Sarov M, Rientjes J, Fu J, Hollak H, Kranz H, Xie W, Stewart AF, 700

Zhang Y. 2006. An improved recombineering approach by adding RecA to lambda 701

Red recombination. Mol Biotechnol 32:43-53. 702

43. Zhang YM, Buchholz F, Muyrers JPP, Stewart AF. 1998. A new logic for DNA 703

engineering using recombination in Escherichia coli. Nature Genet 20:123-128. 704

44. Nickell S, Förster F, Linaroudis A, Net WD, Beck F, Hegerl R, Baumeister W, 705

Plitzko JM. 2005. TOM software toolbox: acquisition and analysis for electron 706

tomography. J Struct Biol 149:227-234. 707

45. Uebe R, Junge K, Henn V, Poxleitner G, Katzmann E, Plitzko JM, Zarivach R, 708

Kasama T, Wanner G, Posfai M, Böttger L, Matzanke B, Schüler D. 2011. The 709

cation diffusion facilitator proteins MamB and MamM of Magnetospirillum 710

gryphiswaldense have distinct and complex functions, and are involved in magnetite 711

biomineralization and magnetosome membrane assembly. Mol Microbiol 82:818-835. 712

46. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head 713

of bacteriophage T4. Nature 227:680-685. 714

715

716

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 29 von 34

Figures 717

Figure 1. (a) Schematic overview of cloned magnetosome operons (brown: mms6, green: 718

mamGFDC, dark blue: mamAB, pale blue: mamXY, pink: feoAB1) and the respective 719

promoters (angled arrows). (b) Strategy for construction of overexpression strains by 720

amplification of different magnetosome operons. Genomic fragments from 721

M. gryphiswaldense were cloned into transposon-based vectors. Plasmids contain the 722

magnetosome operons mamAB (blue, AB), mamGFDC (green, GFDC), mms6 (brown) and the 723

mamXY operon lacking ftsZm (pale blue, XYZ). The vector backbone (genes are indicated in 724

red) contains a transposase gene (tps), inverted repeats (IR), origin of transfer (oriT), an R6K 725

or p15A origin of replication (ori) and antibiotic resistance cassette (abR). After conjugative 726

transfer of the plasmids, the transposase recognizes IR sequences and catalyzes chromosomal 727

insertion of the target sequence. Additional copies of respective magnetosome operons in the 728

chromosome (oval shape) are marked with asterisks. 729

730

Figure 2. TEM analysis of overexpression strains compared to the parental strain IK-1. (a) 731

TEM of the overexpression strains 4xmms6op (aii), 2xmamABop (aiii) and 2xABG6Xop (aiv) 732

compared to IK-1 (ai). Arrows 1 and 2 in (aiii) illustrate two different morphotypes found for 733

2xmamABop. (b) Transmission electron micrographs of 2xABG6Xop. Cells with one chain 734

located at the inner convex cell curvature and up to three magnetosome chains with ectopic 735

localization (bii). Cells that lack a clearly ordered chain-like alignment of the produced 736

particles and tend to burst during TEM grid preparation (biii). Scale bar = 500 nm. 737

738

Figure 3. Cryo-electron tomographs of 3xmms6op, 2xmamABop and 2xABG6Xop. (a) 739

Segmented tomogram of a 3xmms6op cell, illustrating the intracellular position of the 740

magnetosome chain as well as the membrane vesicles (ai). Slightly enlarged vesicles are 741

indicated by white arrows. Tomogram section of the same 3xmms6op cell with enlarged 742

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 30 von 34

vesicles (white arrows, aii). (b) Tomograms of a 2xmamABop mutant cell (bi and bii) from 743

different angles, which illustrate two independent magnetosome chains aligned along two 744

parallel filaments at opposite sites of the cell. (c) Segmented tomograms of a 2xABG6Xop cell 745

shown from different angles (ci and cii), which contains three intertwined magnetosome 746

chains, and regularly sized vesicles. Different colors indicate the outer and inner membrane 747

(blue), magnetosome membrane vesicles (yellow), magnetosome filament (green), and 748

magnetite crystals (red). 749

750

Figure 4. TEM micrographs of dividing cells of 4xmms6op (a) and 2xABG6X+2xfeo (b), 751

which remained connected by deformed separation sites with enclosed magnetosomes 752

(arrows). Scale bar = 500 nm. 753

754

755

756

757

758

759

760

761

762

763

764

765

766

767

768

769

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 31 von 34

Tables 770

Tab. 1: DNA oligonucleotides used in this work. 771

Name Sequence

IB102 GGCGGTACCGGAGGCGGAGGCGGT

IB103 GGCGAATTCTTACTTGTACAGCTCGTCCATG

IB173 CCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAACGTA

TAATATTTGCCCATG

IB174 AGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCGA

TCTCGGCTTGAA

AL179 CATATGTTGGGCTTGTGGTTTTGGCGG

AL301 GGTACCTGTACTGCGGAACAGTCGCG

AL377 GAATTCCAACTTTTTCGCTTTACTAG

AL379 GAATTCTCATGTACTGCGGAACAGTC

AL300 TATGGGACCCTACCGTTCGTATAATGTATGCTATACGAAGTTATCGATCTCGGCT

TGAA

AL303 AATGACGTCTACCGTTCGTATAGCATACATTATACGAAGTTATCGTATAATATTT

GCCCATG

772

773

774

775

776

777

778

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 32 von 34

Tab. 2. Characteristics of generated overexpression strains compared to the parental strain IK-1 (n.d. = not determined). 779

Strain Genotypeb Number of

measured

crystals

Mean

crystal size

Cmag Increase in

crystal size

(%)*

Statistical

analysis of

difference in

crystal size

(p-value)*

Crystal

number per

cell

Increase in

crystal

number

(%)a

Statistical

analysis of

difference in

crystal number

(p-value)*

Iron content

(% of the dry

weight) a

Cell

length

(µm)

IK-1

1x MAI

(=WT)s

390 36.2±11.0

0.8±0.2

-

- 33.9±10.3

-

- (3.9±0.2)

4.4± 1.3

2xGFDCop

2x

mamGFDC

operon

424 44.9±13.5

0.9±0.03

24.0

p<1.0 E-5 36.3±12.4

7.1

p<0.303 7.4±1.1

n.d.

2xmms6op

2x mms6

operon

616 45.7±14.2

0.9±0.03

26.2

p<1.0 E-5 46.5±14.3

36.8

p<1.3 E-6 14.9±2.9

4.5±1.6

2xmms6op+

2xGFDC

2x mms6

2x

mamGFDC

operon

483 45.1±12.2

0.9±0.01

24.6

p<3.4 E-5 45.1±14.3

32.7

p<8.2 E-6 14.1±1.9

n.d.

3xmms6op

3x mms6

operon

1183 47.9±12.8

1.0±0.2

32.3

p<1.0 E-5 54.3±29.9

59.5

p<7.2 E-7 34.8±2.5

4.6 ±1.5

4xmms6op 4x mms6 665 44.4±13.2 1.0±0.03 22.6 p<1.0 E-5 57.8±26.9 69.7 p<4.2 E-10 38.8±2.5 5.1 ±1.9

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 33 von 34

operon

5xmms6op

5x mms6

operon

545 41.9±12.0

0.9±0.1

15.7

p<1.0 E-5 46.0±14.8

35.3

p<9.5 E-7 n.d.

5.3±1.7

2xmamABop

2x mamAB

operon

436 34.0±17.6

1.0±0.04

-6.1

p<0.05

73.4±43.1

115.2

p<1.5 E-9 0.4±0.5

4.8± 1.8

3xmamABop

3x mamAB

operon

477 35.6±15.4

0.5±0.1

-1.6

p<0.05

68.8±13.2

102.9

p<1.5 E-9 9.4±0.5

6.0± 2.6

2xABG6Xop

2x

mamGFDC

2x mms6

2x mamAB

2x mamXYZ

operon

708 38.7±11.9

0.8 ± 0.1

6.9

p<1.0 E-5 74.5±34.9

118.3

p<9.8 E-15 140.7±2.4

5.1 ±2.1

2xAG6X+

2xfeo

2x

mamGFDC

2x mms6

2x mamAB

2x mamXYZ

operon

2x feoAB

operon

697 41.1 ± 8.4

0.7 ± 0.2

13.5

p<0.00001 69.3±13.4

104.4

p<1.5 E-15 135.9±6.4

n.d.

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Seite 34 von 34

780

781

a Compared to IK-1. b with respect to magnetosome genes 782

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

mms6mamXY

Plasmid construction

b

mms6abR

tps

IR IR

ori

ABabR

tps

IR IR

ori

AB

abR

tps

IR IR

ori

mms6

GFDC

XYZ

abR

tps

IR IR

ori

4xmms6op

genomic

insertion

2xmamABop 2xABG6Xop

MAI

mms6 IR

MAIMAI

mamGFDC

genomic

insertion

genomic

insertion

MAI

IK-1

DNA

extraction

mamAB oriTabR oriTabR oriTabR oriTabR

IR ABIR IRabRabR ABIR IR

abR

mms6

GFDC

IR IRabRXYZ

a

mamABmms6 mamGFDC

J

mamXY

H I E K L M N O P A Q R B S T U

mmsF

G F D Cmms6

1 kb

mms36

mms48PmamH

PmamDC

Pmms

ftsZmZXY

PmamXY

feoBfeoA

feoAB1

PmamH

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4xmms6op

2

1

2xmamABop 2xABG6Xop

100 nm

IK-1

ai

500 nm

bi

500 nm

bii biii

aii aiii aiv

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

200 nm

ai aii

cii

cibi bii

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

500 nm

a b

500 nm

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from