1
Genotyping RBP-Jk (CSL, RPBsuh) Flox, Del and WT mice JDW 10/2011 MGI: 3583755 From: Hua Han, Kenji Tanigaki, Norio Yamamoto, Kazuki Kuroda, Momoko Yoshimoto, Tatsutoshi Nakahata, Koichi Ikuta, and Tasuku Honjo. Inducible gene knockout of transcription factor recombination signal binding protein-J reveals its essential role in T versus B lineage decision. Nature Immunology, 2002. Note: You must sign an MTA before importing these mice into another colony. Primers currently being used: Floxed and WT: 10X Buffer 2.5 ul 95 JDW 16 (DY223): ACCAGAATCTGTTTGTTATTTGCATTACTG 10 mM dNTPS 0.5 ul 95 JDW 17 (DY225): ATGTACATTTTGTACTCACAGAGATGGATG FOR @ 100 uM 0.1 ul 59 Flox: ~ 400 bp REV @ 100 uM 0.1 ul 72 Wild-type: ~300 bp Taq 0.25 ul repeat 34X ddH 2 O 20.55 ul 72 25 ul T.V. 16 forever Deleted / KO: JDW 16 (DY223): ACCAGAATCTGTTTGTTATTTGCATTACTG JDW 18 (RBPJ-RΔ(yhk)): TCCACCATGATTTGCTTGAG Deleted: 700-800bp (*still gives a band for WT > 1kb) DEL ALLELE WT ALLELE Flox / WT WT/WT + Δ + Δ + + Δ + Δ + + + + + + + From the paper: Deletion of the floxed RBP-J allele and wild-type RBP-J exons was detected by PCR using the following primers: Floxed1: 5-GAAGGTCGGTTGACACCAGATAGC-3; Floxed2: 5-GCAATCCATCTTGTTCAATGGCC-3; WT1: 5-GTTCTTAACCTGTTGGTCGGAACC-3; WT2: 5-GCTTGAGGCTTGATGTTCTGTATTGC-3. From Krebs LT, et al., 2004, G&D. The Rbpsuh null allele was genotyped using primers TAGACCTTGGTTTGTTGTTTGG and CCATAGGAAAACATCCACAGC, which span the deleted region.

Genotyping RBP-Jk (CSL, RPBsuh) Flox, Del and WT mice · Flox: ~ 400 bp REV @ 100 uM 0.1 ul 72 Wild-type: ~300 bp Taq 0.25 ul repeat 34X ddH 2O 20.55 ul 72 25 ul T.V. 16 forever Deleted

  • Upload
    others

  • View
    0

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Genotyping RBP-Jk (CSL, RPBsuh) Flox, Del and WT mice · Flox: ~ 400 bp REV @ 100 uM 0.1 ul 72 Wild-type: ~300 bp Taq 0.25 ul repeat 34X ddH 2O 20.55 ul 72 25 ul T.V. 16 forever Deleted

Genotyping RBP-Jk (CSL, RPBsuh) Flox, Del and WT mice

JDW 10/2011 MGI: 3583755

From: Hua Han, Kenji Tanigaki, Norio Yamamoto, Kazuki Kuroda, Momoko Yoshimoto, Tatsutoshi Nakahata, Koichi Ikuta, and Tasuku Honjo. Inducible gene knockout of transcription factor recombination signal binding protein-J reveals its essential role in T versus B lineage decision. Nature Immunology, 2002.

Note: You must sign an MTA before importing these mice into another colony.

Primers currently being used:

Floxed and WT: 10X Buffer 2.5 ul 95 JDW 16 (DY223): ACCAGAATCTGTTTGTTATTTGCATTACTG 10 mM dNTPS 0.5 ul 95 JDW 17 (DY225): ATGTACATTTTGTACTCACAGAGATGGATG FOR @ 100 uM 0.1 ul 59 Flox: ~ 400 bp REV @ 100 uM 0.1 ul 72 Wild-type: ~300 bp Taq 0.25 ul repeat 34X ddH2O 20.55 ul 72 25 ul T.V. 16 forever Deleted / KO: JDW 16 (DY223): ACCAGAATCTGTTTGTTATTTGCATTACTG JDW 18 (RBPJ-RΔ(yhk)): TCCACCATGATTTGCTTGAG Deleted: 700-800bp (*still gives a band for WT > 1kb)

DEL ALLELE WT ALLELE Flox / WT WT/WT + Δ + Δ + + Δ + Δ + + + + + + +

From the paper: Deletion of the floxed RBP-J allele and wild-type RBP-J exons was detected by PCR using the following primers: Floxed1: 5′-GAAGGTCGGTTGACACCAGATAGC-3′; Floxed2: 5′-GCAATCCATCTTGTTCAATGGCC-3′; WT1: 5′-GTTCTTAACCTGTTGGTCGGAACC-3′; WT2: 5′-GCTTGAGGCTTGATGTTCTGTATTGC-3′. From Krebs LT, et al., 2004, G&D. The Rbpsuh null allele was genotyped using primers TAGACCTTGGTTTGTTGTTTGG and CCATAGGAAAACATCCACAGC, which span the deleted region.