The FASEB Journal • Research Communication

HIF-1-PHD2 axis controls expression of syndecan 4 innucleus pulposus cells

Nobuyuki Fujita,*,†,‡ Yuichiro Hirose,*,†,‡ Cassie M. Tran,*,† Kazuhiro Chiba,§

Takeshi Miyamoto,‡ Yoshiaki Toyama,‡ Irving M. Shapiro,*,†

and Makarand V. Risbud*,†,1

*Department of Orthopaedic Surgery and †Graduate Program in Cell and Developmental Biology,Thomas Jefferson University, Philadelphia, Pennsylvania, USA; ‡Department of Orthopaedic Surgery,Keio University School of Medicine, Tokyo, Japan; and §Department of Orthopaedic Surgery,Kitasato University, Kitasato Institute Hospital, Tokyo, Japan

ABSTRACT Intervertebral disc degeneration is theleading cause of chronic back pain. Recent studiesshow that raised level of SDC4, a cell-surface heparansulfate (HS) proteoglycan, plays a role in pathogenesisof disc degeneration. However, in nucleus pulposus(NP) cells of the healthy intervertebral disc, the mech-anisms that control expression of SDC4 and its physi-ological function are unknown. Hypoxia induced SDC4mRNA and protein expression by �2.4- and 4.4-fold(P<0.05), respectively, in NP cells. While the activity ofthe SDC4 promoter containing hypoxia response ele-ment (HRE) was induced 2-fold (P<0.05), the HREmutation decreased the activity by 40% in hypoxia.Transfections with plasmids coding prolyl-4-hydroxy-lase domain protein 2 (PHD2) and ShPHD2 show thathypoxic expression of SDC4 mRNA and protein isregulated by PHD2 through controlling hypoxia-induc-ible factor 1� (HIF-1�) levels. Although overexpres-sion of HIF-1� significantly increased SDC4 proteinlevels, stable suppression of HIF-1� and HIF-1� de-creased SDC4 expression by 50% in human NP cells.Finally, suppression of SDC4 expression, as well as HSfunction, resulted in an �2-fold increase in sex-deter-mining region Y (SRY)-box 9 (Sox9) mRNA, and pro-tein (P<0.05) and simultaneous increase in Sox9 tran-scriptional activity and target gene expression. Takentogether, our findings suggest that in healthy discs,SDC4, through its HS side chains, contributes to main-tenance of the hypoxic tissue niche by controllingbaseline expression of Sox9.—Fujita, N., Hirose, Y.,Tran, C. M., Chiba, K., Miyamoto, T., Toyama, Y.,Shapiro, I. M., Risbud, M. V. HIF-1-PHD2 axis controlsexpression of syndecan 4 in nucleus pulposus cells.FASEB J. 28, 2455–2465 (2014). www.fasebj.org

Key Words: cartilage � hypoxia � intervertebral disc

The intervertebral disc is a complex tissue thatpermits a range of motions between adjacent vertebraeand accommodates high biomechanical forces. Theblood vessels originating in the vertebral body pene-trate the superficial region of the endplates; none ofthese vessels infiltrate the central aggrecan (Agc1)-richgel-like tissue, the nucleus pulposus (NP). With respectto the annulus, this tissue is avascular except for smalldiscrete capillary beds in the dorsal and ventral surfaces—in no case does the annulus vasculature enter the NP(1–4). Thus, the hypoxic NP is completely devoid ofvasculature and expresses transcription factors hypoxia-inducible factor 1 and 2 (HIF-1 and HIF-2) that arecomposed of a constitutively expressed � subunit andregulatory � subunit (5). Previous work has shown thatthese proteins play an important role in regulatingenergy metabolism and synthesis of extracellular matrixcomponents, as well as proteins that contribute to cellsurvival in the disc (6–11). Moreover, recent work fromour laboratory has shown that degradation and tran-scriptional activity of HIF-� in cultured NP cells isdifferentially regulated by prolyl 4-hydroxylase domain(PHD) proteins, members of the 2-oxoglutarate/Fe2�-dependent dioxygenase superfamily (12, 13). WhilePHD2 contributes to a limited oxygen-dependent deg-radation of HIF-1� but not that of HIF-2�, PHD3 servesas a transcriptional cofactor of HIF-1� under hypoxia.Notably, growing evidence suggests that HIF-1� andHIF-2� are not functionally redundant in the NP (13)and that the relative importance of each of the homo-logues, in response to hypoxia, varies among differentcell types (14).

1 Correspondence: Department of Orthopaedic Surgery,1025 Walnut St., Ste. 511 Curtis Bldg., Thomas JeffersonUniversity, Philadelphia, PA 19107, USA. E-mail: makarand.risbud@jefferson.edu

doi: 10.1096/fj.13-243741This article includes supplemental data. Please visit http://

www.fasebj.org to obtain this information.

Abbreviations: ADAMTS, a disintegrin-like and metallo-protease with thrombospondin type I motifs; AF, annulusfibrosus; Agc1, aggrecan; CA-HIF, constitutively active HIF;DMOG, dimethyloxalylglycine; ECR, Evolutionary Con-served Regions; HIF, hypoxia-inducible factor; HRE, hyp-oxia response element; HS, heparan sulfate; NP, nucleuspulposus; Pgk1, phosphoglycerate kinase 1; PHD, prolyl-4-hydroxylase domain; SDC, syndecan; Sox9, sex-determining region Y (SRY)-box 9

24550892-6638/14/0028-2455 © FASEB

The syndecans (SDCs) are a family of single-passtransmembrane proteins with 3–5 sites for post-transla-tional glycosylation with predominantly heparan sulfate(HS) chains (15). These glycosaminoglycans conferthem with the ability to interact with diverse extracel-lular ligands, including growth factors, such as FGF-2,Ihh, Wnt, and BMP-2, and matrix components likefibronectin and CCN2 (15–17). All syndecans have ashort cytoplasmic region containing sites for phosphor-ylation and interaction with signaling and protein-scaffolding molecules (15). We previously reported thatin the NP inflammatory cytokines, TNF-� and IL-1�regulate expression of SDC4 through NF-�B signaling(18). Our studies showed that p65/RelA interacts witha conserved �B element located at �97/�88 bp inSDC4 promoter in NP cells, resulting in increased geneexpression, an observation also confirmed in endothe-lium-like cells very recently (19). Notably, our workshowed that SDC4, through its HS chains, promotesAgc1 degradation by enhancing post-translational pro-cessing of a disintegrin-like and metalloprotease withthrombospondin type I motifs 5 (ADAMTS-5) protein,likely playing a key role in pathogenesis of disc disease(18). Likewise, SDC4 has been shown to play a role inarticular cartilage degeneration during osteoarthritis(20). Interestingly, the prominent expression of SDC4in healthy NP indicated that it might also play animportant physiological function.

The major objective of the study was to determinewhether SDC4 expression is dependent on oxemictension and whether regulation is HIF dependent incells of the NP. We show for the first time that in NPcells, SDC4 expression is induced by hypoxia andselectively regulated by the HIF-1–PHD2 system. More-over, our data show that SDC4 controls expression ofimportant transcription factor sex-determining regionY (SRY)-box 9 (Sox9) and its downstream target geneAgc1. Our findings indicate that SDC4 is important inhomeostatic maintenance of hypoxic discs and thatdysregulated expression may be deleterious to tissuefunction.

MATERIALS AND METHODS

Plasmids and reagents

psPAX2 (catalog no. 12260) and pMD2G (12259), developedby Dr. Didier Trono (École Polytechnique, Lausanne, Swit-zerland); HIF-1� with a double mutation (P402A/P564A;18955), developed by Dr. William G. Kaelin (Dana FarberCancer Institute, Boston, MA, USA); and phosphoglyceratekinase 1 (Pgk1)-3xHRE-Luc containing 3 hypoxia responseelements (HREs; TGTCACGTCCTGCACGACTCTAGT) from thePgk1 promoter upstream of firefly luciferase (26731) were ob-tained from Addgene (Addgene, Cambridge, MA, USA).Human SDC4 promoter constructs, wild type and with muta-

Figure 1. Hypoxic regulation of SDC4 expression in NP cells. A) Analysis of previously reported microarray data set for SDC1-4expression in 13 rat tissues: bone, bone marrow, blood, tendon, AF, NP, cartilage, fat, skin, muscle, spinal cord, brain, and lens.Data represent log2 values of the normalized expression ratios (see Materials and Methods for details). SDC4 expression is highin NP compared with other tissues and other SDC isoforms. B) Expression ratios for SDC4 from different rat tissues (cyanine5 intensity from sample/cyanine 3 intensity of rat common reference RNA). Analysis shows high relative expression of SDC4message in the rat NP tissue compared with other tissues. C) Immunohistochemical staining of SDC4 on embryonic section ofrat intervertebral disc shows robust and enriched SCD4 staining in the NP compared to surrounding tissues. D) Real-timeRT-PCR analysis of SDC4 in NP cells cultured under hypoxic (Hx) condition. Expression was significantly induced by 8 h in Hxcompared to normoxia (Nx). E) Western blot analysis of SDC4 expression in rat NP cells cultured under Hx for 24 h. SDC4levels are elevated by Hx. F) Densitometric analysis of multiple blots from experiment in D shows significant induction in SDC4protein levels by Hx. Values are means � se of 3 independent experiments. *P 0.05.

2456 Vol. 28 June 2014 FUJITA ET AL.The FASEB Journal � www.fasebj.org

tion in NF-�B site, were provided by Dr. Jitendra Gautam(University of Virginia, Charlottesville, VA, USA; ref. 21).4xA1-pAgc-Luc reporter containing 4 repeats of 359-bp en-hancer, which contains Sox9 binding site (found 9.477 kbupstream of the Agc1 transcription start site) with �596 to�90 bp Agc1 promoter-driving luciferase, was provided by Dr.Veronique Lefebvre (Cleveland Clinic, Cleveland, OH, USA;ref. 22). Lentiviral vectors coexpressing EGFP and ShRNAtargeting rat SDC4 or control ShRNA were purchased fromGenecoepia (Rockville, MD, USA). The plasmid expressingconstitutively active HIF-2� (CA-HIF-2�) with a triple muta-tion (P405A/P530A/N851A) was provided by Dr. CelesteSimon (University of Pennsylvania, Philadelphia, PA, USA).Plasmids were kindly provided by Dr. Andree Yeramian(University of Lleida, Lleida, Spain; lentiviral ShHIF-1� coex-pressing YFP; ref. 23), Mark B. Taubman (University ofRochester, Rochester, NY, USA; NF-�B-responsive luciferasereporter: 3xNF-�B-Luc; ref. 24), Kenneth Thirstrup (H. Lun-dbeck A/S, Valby, Denmark; lentiviral ShPHD2-coexpressingGFP; ref. 25), Karen Westerman (Harvard Medical School,Boston, MA, USA; lentiviral CA-HIF-1� vector, GFP controlvector, and TAT expression plasmid), and John Basile (Uni-versity of Maryland, College Park, MD, USA; lentiviralShHIF-1� construct and control vector). As an internal trans-fection control, vector pRL-TK (Promega, Madison, WI, USA)containing Renilla reniformis luciferase gene was used. Theamount of transfected plasmid, the pretransfection periodafter seeding, and the posttransfection period before harvest-ing, have been optimized for rat NP cells using pSV �-galac-tosidase plasmid (Promega; ref. 7). Surfen was obtained fromthe Developmental Therapeutics Program of the National

Cancer Institute (U.S. National Institutes of Health,Bethesda, MD, USA).

Tissue expression analysis

Microarray expression analysis of rat tissues has been per-formed and reported previously (26). Briefly, following hy-bridization, signals were measured and processed into pri-mary expression ratios (ratio of cyanine 5 intensity of eachsample to cyanine 3 intensity of the rat common referenceRNA). Normalization was performed for the median of ratiosby multiplying normalization factors calculated for eachfeature on a microarray by the GenePix Pro 3.0 software(Molecular Devices Corp., Sunnyvale, CA, USA). The expres-sion ratios were then converted into log2 values and reported.For the current study, these available data were analyzed forexpression of SDC1-4 in bone, bone marrow, blood, tendon,annulus fibrosus (AF), NP, cartilage, fat, skin, muscle, spinalcord, brain, and lens.

Isolation of NP cells, treatments, and hypoxic culture

Rat and human NP cells were isolated using a methodreported earlier (7). Human NP cells were isolated fromMRI-graded tissue samples (grade 2) obtained during spinalsurgery following guidelines of the U.S. Office of HumanResearch Institutional Review Board. Cells were maintainedin DMEM and 10% FBS supplemented with antibiotics. Insome experiments, cells were treated with 0.5 or 1 mMdimethyloxalylglycine (DMOG) for 5 min to 24 h. DMOG is a

Figure 2. Contribution of HRE in SDC4 promoter in hypoxic induction in NP cells. A) ECR genome browser shows pairwise alignment ofseveral vertebrate SDC4 gene sequences with conservation relative to the human sequence. The x axis represents base positions in thegenome; the y axis represents the percent identity between aligned bases at the specific position. Thus, the peaks represent regions of higherconservation, with the pink line above the peaks denoting ECRs that have �80% identity with the human sequence. The promoter regionis shown in red, coding region in blue, untranslated region in yellow, transposons and simple repeats in green, and intronic sequences inpeach. Note that several regions of high evolutionary conservation in the promoter region are conserved through several vertebrate species.B) Schematic of SDC4 promoter fragments in luciferase constructs used for transfections (HRE-WT and HRE-MT). Putative HRE is locatedat �696/�689 bp (AGGCGTGA). A mutation in the HRE is introduced by site-directed mutagenesis (AGGAAAAA). C) While SDC4-WTshows hypoxic induction in activity, mutation of the HRE (HRE-MT) abolishes hypoxic induction in activity. D) SDC4-WT promoter activityis significantly increased by treatment with DMOG, a pan-PHD inhibitor. E) SDC4 promoter with HRE mutation (HRE-MT) shows noinduction when treated with DMOG. F) Real-time RT-PCR analysis of SDC4 in rat NP cells treated with DMOG, inhibitor of PHD enzymaticactivity. SDC4 expression was significantly induced at 24 h. Data represent means � se of 3 independent experiments performed in triplicate(n3). ns, not significant. *P 0.05.

2457HIF-1 CONTROLS SDC4 EXPRESSION IN NUCLEUS PULPOSUS

cell-permeable, competitive inhibitor of PHD function andresults in stabilization of HIF-1� in NP cells (12). Cells werecultured in a Hypoxia Work Station (Invivo2 300; RuskinnTechnology, Bridgend, UK) with a mixture of 1% O2, 5%CO2, and 94% N2 for 4–24 h.

Real-time RT-PCR analysis

Total RNA was extracted from rat and human NP cells usingRNeasy minicolumns (Qiagen, Valencia, CA, USA). Beforeelution from the column, RNA was treated with RNase-freeDNase I (Qiagen). The purified, DNA-free RNA was con-verted to cDNA using EcoDry Premix (Clontech, MountainView, CA, USA). Reactions were set up in triplicate in 96-wellplates using 1 �l cDNA with SYBR Green PCR Master Mix(Applied Biosystems, Foster City, CA, USA), to which gene-specific forward and reverse PCR primers (synthesized byIntegrated DNA Technologies, Coralville, IA, USA) wereadded (Supplemental Table S1). PCR reactions were per-formed in a StepOnePlus real-time PCR system (AppliedBiosystems), according to the manufacturer’s instructions.�-Actin was used to normalize. Melting curves were analyzedto verify the specificity of the RT-PCR reaction and theabsence of primer dimer formation.

Immunohistochemistry and fluorescence microscopy

Rat spinal tissues were fixed in 4% paraformaldehyde in PBSand then embedded in paraffin. Transverse and coronalsections, 6–8 �m in thickness, were cut. For localizing SDC4,deparaffinized sections were incubated with the anti-SDC4antibody (Abcam, Cambridge, MA, USA) in 2% BSA in PBS ata dilution of 1:200 at 4°C overnight. After thoroughly washingthe sections, the bound primary antibody was incubated withAlexa Fluor-488 conjugated anti-rabbit secondary antibody(Invitrogen, Carlsbad, CA, USA), at a dilution of 1:200 for 45min at room temperature. Sections were visualized using afluorescence microscope (Nikon, Japan). To assess lentiviraltransduction, GFP- or YFP-positive cells were imaged using a

laser-scanning confocal microscope (Olympus Fluoview;Olympus, Tokyo, Japan).

Protein extraction and Western blot analysis

Cells were placed on ice immediately and washed withice-cold HBSS. Total cell protein was extracted using mam-malian protein extraction reagent (MPER; Pierce, Rockford,IL, USA). All of the wash buffers and extraction bufferincluded 1� protease inhibitor cocktail (Roche, Indianapolis,IN, USA), NaF (5 mM) and Na3VO4 (200 �M). Proteins wereresolved on 8–12% SDS-polyacrylamide gels and transferredby electroblotting to PVDF membranes (Bio-Rad, Hercules,CA, USA). The membranes were blocked with 5% nonfat drymilk in TBST (50 mM Tris, pH 7.6; 150 mM NaCl; and 0.1%Tween 20) and incubated overnight at 4°C in 3% nonfat drymilk in TBST with both rat and human reactive HIF-1�(1:1000; R&D Systems, Minneapolis, MN, USA), HIF-1� (1:1000; BD Biosciences, San Jose, CA, USA), PHD2 (1:1000;Cell Signaling Technology, Boston, MA, USA), SDC4 (1:1000), Sox9 (1:500; Abcam) and �-tubulin (1:3000; Develop-mental Studies Hybridoma Bank, Iowa City, IA, USA) anti-bodies. Immunolabeling was detected using the ECL reagent(Amersham Biosciences, Piscataway, NJ, USA). Relative ex-pression levels were determined by quantitative densitometricanalysis using 1D image analysis software (Quantity One;Bio-Rad).

Site-directed mutagenesis

SDC4 wild-type reporter plasmid was used to mutate HREsites (AGGCGTGA to AGGAAAAA). Mutants were generatedusing the QuickChange II XL site-directed mutagenesis kit(Stratagene, Cedar Creek, TX, USA), using forward andreverse primer pairs containing the desired mutation, follow-ing the manufacturer’s instructions. The mutations wereverified by sequencing using the Applied Biosystems 3730DNA sequencer.

Figure 3. Increase in SDC4 expression following inhibition of PHD activity is independent of NF-�B signaling. A) Top panel:schematic of 3xNF-�B-luc and Pgk1-3xHRE-luc used for transfections. Bottom panel: activity of 3xNF-�B-luc is not influenced,while Pgk1-3xHRE-luc is significantly induced by DMOG in a dose-dependent manner, indicating sustained activation of HIF butnot NF-�B signaling. B) Top panel: schematic of NRE mutant SDC4 reporter used for transfections. Bottom panel: note thatSDC4-NRE-MT promoter activity is significantly induced by DMOG in a dose-dependent manner. C) Activity of SDC4-NRE-MTis increased by hypoxia (Hx) in rat NP cells, indicating sole contribution of HIF to this induction. Data represent means � seof 3 independent experiments performed in triplicate (n3). ns, not significant. *P 0.05.

2458 Vol. 28 June 2014 FUJITA ET AL.The FASEB Journal � www.fasebj.org

Transfections and dual-luciferase assay

All transient transfections were performed using only rat NPcells. NP cells were transferred to 48-well plates at a density of2 � 104 cells/well 1 d before transfection. Lipofectamine2000 (Invitrogen) was used as a transfection reagent. For eachtransfection, plasmids were premixed with the transfectionreagent. The next day, the cells were harvested, and adual-luciferase reporter assay system (Promega) was used forsequential measurements of firefly and Renilla luciferaseactivities. Quantification of luciferase activities and calcula-tion of relative ratios were carried out using a luminometer(TD-20/20; Turner Designs, Sunnyvale, CA, USA).

Lentiviral production and transduction

HEK 293T cells were seeded in 10-cm plates (6�106

cells/plate) in DMEM with 10% heat-inactivated FBS 1 dbefore transfection. Cells were transfected with 9 �g ofShHIF-1�, ShPHD2, and ShSDC4 plasmids along with 6 �gpsPAX2 and 3 �g pMD2G using Lipofectamine 2000.CA-HIF-1� and shHIF-1� were used following an earlier

reported method (27, 28). After 16 h, transfection mediawere removed and replaced with DMEM with 5% heat-inactivated FBS and penicillin-streptomycin. Lentiviral par-ticles were harvested at 48 and 60 h post-transfection. Rator human NP cells were plated in DMEM with 5% heat-inactivated FBS 1 day before transduction. Cells in 10-cmplates were transduced with 5 ml of conditioned mediacontaining viral particles along with 6 �g/ml polybrene.After 24 h, conditioned medium was removed and replacedwith DMEM with 5% heat-inactivated FBS. Cells wereharvested for protein extraction 5 d after viral transduc-tion. A transduction efficiency of �80% was achieved, asdetermined from the number of GFP/YFP-positive cells.

Statistical and bioinformatic analysis

All measurements were performed in triplicate; data arepresented as means � se. Differences between groups wereanalyzed by the Student’s t test and 1-way ANOVA. Values ofP 0.05 were considered significant. Analysis of 2.7 kb ofSDC4 promoter from various vertebrate species was per-formed using the Evolutionary Conserved Regions (ECR)

Figure 4. Effect of PHD2 modulation on the expression of SDC4 in NP cells. A) Cotransfection of PHD2 resulted in decreasein activities of Pgk1-3xHRE-luc (HRE) and SDC4 promoter (SDC4-WT) in rat NP cells. In contrast, 3xNF-�B-luc (NRE) activityremained unchanged by PHD2. B) Activities of HRE and SDC4-WT, but not NRE, were significantly induced by cotransfectionwith Sh-PHD2. C) GFP signal from rat NP cells transduced with a lentivirus coexpressing GFP and PHD2 ShRNA (LV-Sh-PHD2)shows high transduction efficiency. View �20. D, E) Real-time RT-PCR (D) and Western blot analysis (E) of PHD2 and SDC4in rat NP cells transduced with LV-Sh-control or LV-Sh-PHD2 under normoxia (NX) and hypoxia (HX). PHD2 suppressionresulted in significant increase in SDC4 mRNA and protein expression in both NX and HX. PHD2 suppression also resulted inincreased HIF-1� protein levels. F) Densitometric analysis of 3 independent Western blot experiments in D shows thattransduction of cells with lentiviral PHD2 ShRNA (LV-ShPHD2) resulted in an increase in HIF-1� and SDC4 protein levels inboth NX and HX. Data represent means � se of 3 independent experiments performed in triplicate (n3). ns, not significant.*P 0.05.

2459HIF-1 CONTROLS SDC4 EXPRESSION IN NUCLEUS PULPOSUS

genome browser (http://ecrbrowser.dcode.org/) and theJaspar core database (http://jaspardev.genereg.net/).

RESULTS

We have previously performed microarray analysis of 13rat tissues, including NP and AF (26). In this study, wefocused on SDC4, which is highly expressed and en-riched among other isoforms in NP compared to othertissues (Fig. 1A, B). Immunohistological studies con-firmed robust expression of SDC4 in the rat NP tissuecompared to surrounding endplate and hypertrophicchondrocytes (Fig. 1C). To examine the relationship ofSDC4 to oxemic status of NP cells, we measured expres-sion under hypoxic condition by real-time RT-PCR andWestern blot analysis. Figure 1D shows that SDC4mRNA expression is significantly up-regulated at 8 and24 h in hypoxia. Western blot and subsequent densito-metric analysis confirmed that the protein expression isalso significantly induced by hypoxia (Fig. 1E, F).

Next, we evaluated whether hypoxic regulation ofSDC4 expression is dependent on HIF. Analysis of 2.7kb of SDC4 promoter from various vertebrate speciesusing the ECR genome browser showed multiple areasof high evolutionary conservation relative to the humansequence (Fig. 2A). Further analysis with the Jaspar coredatabase indicates that a putative HRE is located at�696/�689 bp (AGGCGTGA) in human SDC4 pro-moter (Fig. 2B). To evaluate the functional significance ofthis HRE in oxemic regulation of SDC4 promoter activity,we generated a SDC4 reporter construct-containing mu-tation (AGGAAAAA) in HRE (SDC4-HRE-MT; Fig. 2B).

Figure 2C shows that in rat NP cells, wild-type SDC4promoter activity is significantly induced under the hy-poxic condition. In contrast, the HRE mutation com-pletely abolishes this induction of SDC4 reporter (SDC4-HRE-MT). In addition, we observed that while wild-typeSDC4 promoter activity is significantly increased by treat-ment with DMOG, an inhibitor of PHD function, SDC4-HRE-MT reporter showed no increase (Fig. 2D, E). Wethen determined whether treatment of rat NP cells withDMOG induces SDC4 mRNA expression. Figure 2F showsthat the expression of SDC4 is significantly up-regulatedat 24 h by DMOG treatment.

Since our previous work has identified a positiverelationship between PHD3 and NF-�B signaling (29),and as SDC4 expression is NF-�B sensitive in NP cells(18), we investigated whether the pan-PHD inhibitorrobustly influenced NF-�B signaling. We measured theactivation status of prototype NF-�B responsive (3xNF-�B-Luc) and hypoxia responsive (Pgk1-3xHRE-Luc)reporters following DMOG treatment of rat NP cells.Although the activity of 3xNF-�B-Luc is not influenced,Pgk1-3xHRE-Luc is significantly induced by DMOG in adose-dependent manner (Fig. 3A). To further confirmthat DMOG-mediated induction of SDC4 is indepen-dent of NF-�B binding to its promoter, we measuredthe activity of SDC4 promoter construct harboringmutation in NF-�B responsive element (SDC4-NRE-MT). Figure 3B shows that SDC4-NRE-MT activity issignificantly induced by DMOG in a dose-dependentmanner. As such, hypoxia induced SDC4-NRE-MT ac-tivity in rat NP cells, indicating lack of NF-�B involve-ment in this process (Fig. 3C).

Figure 5. Regulation of SDC4 expression is dependent on HIF-1� but not HIF-2� in NPcells. A) Activity of Pgk1-3xHRE-luc (HRE-luc) is significantly induced by cotransfection ofeither HIF-1� or HIF-2� in rat NP cells. ) SDC4 promoter activity is induced byoverexpression of HIF-1� but not HIF-2�. C) Analysis of GFP in rat NP cells transducedwith control lentivirus expressing GFP (LV-control) shows high transduction efficiency.View �20. D) Western blot analysis of cells transduced with LV-control or LV-CAHIF-1�.HIF-1� was accumulated in LV-CAHIF-1� transduced rat NP cells compared to control.Overexpression of HIF-1� under normoxic conditions resulted in the induction of SDC4protein levels. E) Densitometric analysis of multiple blots from experiment in D. Asexpected, relative HIF-1� level in LV-CAHIF-1� group was higher compared to control.Expression of SDC4 was significantly increased in cells transduced with LV-CAHIF-1�. Datarepresent means � se of 3 independent experiments performed in triplicate (n3). ns,not significant. *P 0.05.

2460 Vol. 28 June 2014 FUJITA ET AL.The FASEB Journal � www.fasebj.org

To further investigate whether the expression ofSDC4 is specifically regulated by PHD2 through HIF-1�accumulation, PHD2 gain- and loss-of-function studieswere performed in rat NP cells. Overexpression ofPHD2 significantly suppressed both Pgk1-3xHRE-Lucand wild-type SDC4 promoter activities (Fig. 4A), while3x-NF-�B-Luc activity remained unaffected. In contrast,cotransfection of Sh-PHD2 resulted in significant in-duction in activity of Pgk1-3xHRE-Luc and, more im-portant, SDC4 promoter; again, no effect on prototype3x-NF-�B-Luc was seen (Fig. 4B). To measure the effectof stable suppression of PHD2 on SDC4 expression, wetransduced rat NP cells with a lentivirus expressingSh-PHD2 under both normoxic and hypoxic condi-tions. The assessment of GFP-positive cells confirmedhigh transduction efficiency (Fig. 4C). Real-time RT-PCR (Fig. 4D) and Western blot (Fig. 4E) analysisconfirmed that the mRNA and protein expression ofPHD2 is significantly suppressed in the cells transducedwith Sh-PHD2, compared to cells transduced with Sh-control. Notably, regardless of the oxemic status, PHD2suppressed rat NP cells evidenced by a significantincrease in SDC4 mRNA (Fig. 4D) and protein (Fig. 4E)expression under both normoxic and hypoxic condi-tion. Densitometric studies confirmed significant in-crease in SDC4 protein levels in PHD2-silenced cells(Fig. 4F). In agreement with previous reports (11, 12),

sh-PHD2 transduction of rat NP cells resulted in accu-mulation of HIF-1� under both normoxic and hypoxicconditions (Fig. 4E, F).

To further investigate which HIF-� homologue con-tributes to regulation of SDC4 expression, HIF-� gain-of-function studies were performed. We first validatedthat the activity of Pgk1-3xHRE-luc reporter is signifi-cantly induced by cotransfection by both HIF-1� andHIF-2� in rat NP cells (Fig. 5A). Interestingly, whileSDC4 promoter activity is induced when HIF-1� iscoexpressed, HIF-2� showed no effect on the promoteractivity (Fig. 5B). To measure the effect of stableoverexpression of HIF-1� on SDC4 protein levels, wetransduced rat NP cells with lentivirus expressing CA-HIF-1�. The assessment of GFP-expressing cells con-firmed that the transduction efficiency was high (Fig.5C). As expected, Western blot analysis confirmed thatthere is an increase in HIF-1� protein level in thetransduced cells (Fig. 5D). Moreover, we found that theHIF-1� transduced cells show increased SDC4 expres-sion (Fig. 5D). Densitometric analysis confirmed thatthe increase in SDC4 is correlated with the accumula-tion of HIF-1� (Fig. 5E).

We next stably suppressed the activity of HIF-1� orHIF-1� by transducing human NP cells with lentivirusexpressing either HIF-1� or HIF-1� shRNA. Since func-tional HIF-1 and HIF-2 proteins require heterodimerization

Figure 6. Role of HIF-1� in control-ling SDC4 expression in NP cells. A)Analysis of YFP in human NP cellstransduced with lentivirus coexpress-ing Sh-HIF-1� (LV-Sh-HIF-1�) withYFP shows high transduction efficiency.View �20. B) Real-time RT-PCR ofHIF-1�, SDC4, and HIF-1� targetgenes: VEGF and enolase1 in NP cellstransduced with LV-Sh-control or LV-Sh-HIF-1� under hypoxia. HIF-1� sup-pression results in significant decreasein mRNA expression of SDC4, as wellas VEGF and enolase1. C) Westernblot analysis of human NP cells trans-duced with LV-Sh-control or LV-Sh-HIF-1� under hypoxia. Decrease inHIF-1� protein levels resulted in de-creased SDC4 levels. D) Densitometricanalysis of multiple blots from exper-iment described in C. Protein level of

SDC4 is significantly decreased correlating with suppression of HIF-1�. E) Western blot analysis of cells transducedwith LV-Sh-control or LV-Sh-HIF-1�. HIF-1� was suppressed by LV-Sh-HIF-1� compared with human NP cellstransduced with control lentivirus (LV-Sh-control). Decreased HIF-1� protein levels resulted in decrease in SDC4level. Data represent means � se of 3 independent experiments performed in triplicate (n3). ns, not significant.*P 0.05.

2461HIF-1 CONTROLS SDC4 EXPRESSION IN NUCLEUS PULPOSUS

of the HIF-1�/2� and HIF-1� subunits, lack of a �subunit inhibits both HIF-1 and HIF-2 transcriptionalactivity. Figure 6A shows that high transduction effi-ciency was achieved by lentiviral sh-HIF-1�. Real-timeRT-PCR analysis confirmed that mRNA expression ofHIF-1� is suppressed in the cells transduced withSh-HIF-1�, compared with Sh-control (Fig. 6B). HIF-1�-suppressed cells evidence a significant decrease inSDC4 mRNA expression, as well as HIF-1� target genes,VEGF, and enolase1 (Fig. 6B). Western blot analysisalso shows that hypoxic suppression of HIF-1� in hu-man NP cells results in decreased SDC4 protein levels(Fig. 6C). Densitometry analysis confirmed that theexpression of SDC4 is dependent on HIF-1� levels (Fig.6D). In addition, Western blot analysis confirms thathypoxic suppression of HIF-1� results in decreasedlevels of SDC4 (Fig. 6E).

Finally, to investigate the role of SDC4 in NPhomeostasis, we evaluated whether SDC4 controlsthe activity of Sox9. For this purpose, we first mea-sured the activity of a luciferase reporter that con-tains 4 repeats of an upstream 359 bp of Sox9binding enhancer of Agc1 in conjunction with 519 bpof Agc1 promoter (4xA1-pAgc-Luc) in presence ofsurfen, a small molecular antagonist of HS (Fig. 7A).Interestingly, we found that the reporter activity (Fig.7B), as well as Agc1 mRNA expression (Fig. 7C), issignificantly increased by surfen, compared to con-

trol in rat NP cells. Next, we measured activity of4xA1-pAgc-Luc reporter in rat NP cells followingcotransfection with Sh-SDC4. Figure 7D shows thatsilencing of SDC4 results in significant increase inthe reporter activity. To further validate these find-ings by stably silencing SDC4, we transduced rat NPcells with lentivirus expressing Sh-SDC4. High trans-duction efficiency (�70%) was observed, as deter-mined by GFP positivity (Fig. 7E). Real-time RT-PCR(Fig. 7F) and Western blot analysis (Fig. 7G) indicatethat there was a robust suppression of SDC4 expres-sion. Notably, mRNA expression of Sox9 was signifi-cantly induced in SDC4-silenced rat NP cells (Fig.7F). Western blot analysis and subsequent densito-metric analysis confirmed that at the protein level,expression of Sox9 is significantly increased in SDC4-silenced cells (Fig. 7G, H).

DISCUSSION

The experiments described in this investigation dem-onstrated for the first time that in NP cells, expressionof SDC4 was controlled by oxemic tension. Our studiesalso revealed that HIF-1�, and not HIF-2�, controlledhypoxic regulation of SDC4 expression. A second ma-jor observation was that SDC4 modulated the expres-sion of Sox9, a key transcriptional regulator of Agc1

Figure 7. SDC4 regulates Sox9 expression in NP cells. A) Schematic of [4xA1]-pAgc-Luc reporter used to measure Sox9 activity.Reporter contains 359 bp Sox9-responsive enhancer and 596 bp of proximal promoter of mouse Agc1 gene. B) [4xA1]-pAgc-Lucreporter activity is significantly induced by surfen (7.5 �M), antagonist of HS, compared to control. C) Real-time RT-PCRanalysis shows that surfen treatment induced Agc1 mRNA expression by rat NP cells. D) Activity of 4xA1-pAgc-Luc reporter inrat NP cells is suppressed with cotransfection of Sh-SDC4. E) Analysis of GFP in rat NP cells transduced with lentiviruscoexpressing GFP and ShRNA of SDC4 (LV-Sh-SDC4) shows high transduction efficiency. View �20. F) Real-time RT-PCRanalysis of SDC4 and Sox9 in rat NP cells transduced with LV-Sh-control or LV-Sh-SDC4 under hypoxia. A significant reductionin SDC4 was accompanied by a concomitant increase in Sox9 in rat NP cells transduced with LV-Sh-SDC4. G) Western blotanalysis of rat NP cells transduced with LV-Sh-control or LV-Sh-SDC4 under hypoxia. Decrease in SDC4 was accompanied by anincrease in Sox9 levels. H) Densitometric analysis of multiple blots from experiment in G. Sox9 protein levels are significantlyelevated in SDC4-suppressed NP cells. Quantitative data represent means � se of 3 independent experiments performed intriplicate (n3). ns, not significant. *P 0.05.

2462 Vol. 28 June 2014 FUJITA ET AL.The FASEB Journal � www.fasebj.org

expression in NP cells. These findings lend strongsupport to the hypothesis that in the hypoxic interver-tebral disc, SDC4 is important in homeostatic mainte-nance of the NP.

We have previously shown that inflammatory cyto-kines associated with disc disease, TNF-� and IL-1�,regulated SDC4 expression through NF-�B signalingand that SDC4 was responsible for promoting Agc1degradation through controlling ADAMTS-5 activityin NP cells (18). Interestingly, we noted that SDC4 isenriched in healthy NP tissue compared with othertissues, including AF and cartilage, a likely reflectionof its notochordal nature and unique tissue microen-vironment. This led us to formulate two questions:first, what is the major signaling pathway that con-trols physiological expression of SDC4 in NP cells,and second, what is the physiological function ofSDC4 in NP cells? We investigated the role of hyp-oxia, one of the most important niche factors con-trolling expression of this molecule. Results clearlyshow that SDC4 is a hypoxia-sensitive gene and thatthe regulation is dependent on the PHD2-HIF-1�axis in NP cells. While some studies have reportedthat inhibition of PHDs stimulates NF-�B signaling(24, 30 –32), our own studies have shown a positiverelationship between PHD3 and NF-�B signaling inNP cells (29). Although PHD3 controlled NF-�Bactivation independent of its hydroxylase activity inNP cells (29), it was important to investigate thepossibility of whether functional inhibition of otherPHD homologues PHD1 and PHD2 by DMOG posi-tively affected NF-�B signaling, as observed in othercell types, thus influencing SDC4 expression (30, 31).Our results clearly suggest that inhibition of PHD isnot sufficient to activate prototypical NF-�B-sensitivereporter. Moreover, that the activity of SDC4 pro-moter with NRE mutation is induced by DMOG andthat the silencing of PHD2 did not affect activity of3xNF-�B-Luc indicated that PHD2 mediated its ef-fects solely through HIF-1� accumulation. Thesefindings were further validated by HIF gain- andloss-of-function studies, demonstrating the importantrole of HIF-1� in this regulation. Taken together, ourresults clearly indicate that in the healthy state,PHD2-HIF-1� system controls SDC4 expression in NPcells and that the expression is responsive to theprevalent niche conditions and signaling pathways,i.e., hypoxia and HIF-1 under physiological andTNF-�, IL-1�, and NF-�B under pathological condi-tions. Notably, HIF-2� did not contribute in control-ling SDC4 expression, a finding consistent with pre-vious report that in NP cells, HIF-2� levels areindependent of PHD2 function.

Next, we investigated the function of SDC4 inhealthy disc. Our results clearly suggest that hypoxiaand HIF-driven SDC4 in NP cells through its HS sidechains were important in controlling basal mRNAexpression of Sox9, a key transcriptional regulator ofAgc1 and collagen II. Our results are in agreementwith recent studies that showed that blocking HS

function with surfen in micromass cultures of limbbud mesenchyme increased cellular responsivenessto BMP signaling and promoted chondrogenesis, asevidenced by elevated Sox9 and Agc1 mRNA expres-sion (33). Thus, these micromass studies suggest thatcell surface HS proteoglycans modulate BMP bio-availability to cells and may play an active role inmaintenance of chondrogenic phenotype (33). Rel-evant to this discussion is the study by Tim et al. (34)that showed up-regulation of Sox9 expression inintervertebral disc cells by BMP-2. In addition, HSproteoglycans SDC1 and SDC4 have been shown tomodulate Wnt (35, 36), as well as Shh signaling (16).Notably, the Wnt and Shh pathway promotes chon-drocyte and NP cell phenotype in a Sox9-dependentmanner (37, 38). Therefore, sequestration of severalgrowth factors and precise control of their bioavail-abilty and, thus, activity, is a critical function of cellsurface proteoglycans, such as SDC4. This is espe-cially critical, as uncontrolled growth factor signalingis known to promote disc degeneration (39). There-fore, it is possible that in the physiologically hypoxicniche of the NP, SDC4 through its HS side chainsmay control Sox9 mRNA expression and thus subse-quent transcriptional activity through modulatingactivity of BMP, Wnt, Shh, or all of these growthfactor-signaling pathways. It is noteworthy that hyp-oxia has been shown to increase Sox9 mRNA levels inNP cells (40). This raises an interesting possibility:that a fine balance between transcriptional activationby HIF-1 or HIF-2, as seen in MSCs and chondrocytes(41– 43), and transcriptional repression by HIF-1-dependent SDC4 precisely maintains Sox9 levels inthe hypoxic NP. Experiments are in progress to test

Figure 8. Schematic showing context-dependent regulationand function of SDC4 in NP cells. In healthy disc, SDC4 levelsare primarily controlled by hypoxia through HIF-1 signaling.In this state, cell surface SDC4 controls the bioavailability andactivity of growth factors like BMP, Wnt, and SHH by bidingand their sequestration through its HS side chains. Thisinteraction controls the precise levels of Sox9 in NP cells andmaintains their phenotype.

2463HIF-1 CONTROLS SDC4 EXPRESSION IN NUCLEUS PULPOSUS

this premise. Taken together, findings of this studylend strong support to the hypothesis that in thehypoxic niche of the healthy discs, this cell surfaceHS proteoglycan plays a critical role in NP tissue homeostasisand maintenance of cell phenotype through preciselycontrolling Sox9 levels (see schematic in Fig. 8).

This work was supported by grants from the U.S. NationalInstitutes of Health/National Institute of Arthritis and Mus-culoskeletal and Skin Diseases (R01-AR050087 and R01-AR055655). The authors report no conflicts of interest.

REFERENCES

1. Gruber, H. E., Ashraf, N., Kilburn, J., Williams, C., Norton, H. J.,Gordon, B. E., and Hanley, E. N. Jr. (2005) Vertebral endplatearchitecture and vascularization: application of micro-comput-erized tomography, a vascular tracer, and immunocytochemistryin analyses of disc degeneration in the aging sand rat. Spine 30,2593–2600

2. Hassler, O. (1969) The human intervertebral disc. A micro-angiographical study on its vascular supply at various ages. ActaOrthop. Scand. 40, 765–772

3. Rudert, M., and Tillmann, B. (1993) Lymph and blood supply ofthe human intervertebral disc. Cadaver study of correlationsto discitis. Acta Orthop. Scand. 64, 37–40

4. Bartels, E. M., Fairbank, J. C., Winlove, C. P., and Urban, J. P.(1998) Oxygen and lactate concentrations measured in vivo inthe intervertebral discs of patients with scoliosis and back pain.Spine 23, 1–7

5. Semenza, G. L., Roth, P. H., Fang, H. M., and Wang, G. L.(1994) Transcriptional regulation of genes encoding glycolyticenzymes by hypoxia-inducible factor 1. J. Biol. Chem. 269,23757–23763

6. Rajpurohit, R., Risbud, M. V., Ducheyne, P., Vresilovic, E. J., andShapiro, I. M. (2002) Phenotypic characteristics of the nucleuspulposus: expression of hypoxia inducing factor-1, glucosetransporter-1 and MMP-2. Cell Tissue Res. 308, 401–407

7. Risbud, M. V., Guttapalli, A., Stokes, D. G., Hawkins, D.,Danielson, K. G., Schaer, T. P., Albert, T. J., and Shapiro, I. M.(2006) Nucleus pulposus cells express HIF-1 alpha under nor-moxic culture conditions: a metabolic adaptation to the inter-vertebral disc microenvironment. J. Cell. Biochem. 98, 152–159

8. Agrawal, A., Guttapalli, A., Narayan, S., Albert, T. J., Shapiro,I. M., and Risbud, M. V. (2007) Normoxic stabilization ofHIF-1� drives glycolytic metabolism and regulates aggrecangene expression in nucleus pulposus cells of the rat interverte-bral disk. Am. J. Physiol. Cell Physiol. 293, C621–C631

9. Agrawal, A., Gajghate, S., Smith, H., Anderson, D. G., Albert,T. J., Shapiro, I. M., and Risbud, M. V. (2008) Cited2 modulateshypoxia-inducible factor-dependent expression of vascular en-dothelial growth factor in nucleus pulposus cells of the ratintervertebral disc. Arthritis Rheum. 58, 3798–3808

10. Zeng, Y., Danielson, K. G., Albert, T. J., Shapiro, I. M., andRisbud, M. V. (2007) HIF-1� is a regulator of galectin-3 expres-sion in the intervertebral disc. J Bone Miner. Res. 22, 1851–1861

11. Tran, C. M., Fujita, N., Huang, B. L., Ong, J. R., Lyons, K. M.,Shapiro, I. M., and Risbud, M. V. (2013) Hypoxia-induciblefactor (HIF)-1� and CCN2 form a regulatory circuit in hypoxicnucleus pulposus cells: CCN2 suppresses HIF-1� level andtranscriptional activity. J. Biol. Chem. 288, 12654–12666

12. Fujita, N., Chiba, K., Shapiro, I. M., and Risbud, M. V. (2012)HIF-1� and HIF-2� degradation is differentially regulated innucleus pulposus cells of the intervertebral disc. J. Bone Miner.Res. 27, 401–412

13. Fujita, N., Markova, D., Anderson, D. G., Chiba, K., Toyama, Y.,Shapiro, I. M., and Risbud, M. V. (2012) Expression of prolylhydroxylases (PHDs) is selectively controlled by HIF-1 andHIF-2 proteins in nucleus pulposus cells of the intervertebraldisc: distinct roles of PHD2 and PHD3 proteins in controllingHIF-1� activity in hypoxia. J. Biol. Chem. 287, 16975–16986

14. Sowter, H. M., Raval, R. R., Moore, J. W., Ratcliffe, P. J., andHarris, A. L. (2003) Predominant role of hypoxia-inducible

transcription factor (Hif)-1� versus Hif-2� in regulation of thetranscriptional response to hypoxia. Cancer Res. 63, 6130–6134

15. Tkachenko, E., Rhodes, J. M., and Simons, M. (2005) Synde-cans: new kids on the signaling block. Circ. Res. 96, 488–500

16. Chang, S. C., Mulloy, B., Magee, A. I., and Couchman, J. R.(2011) Two distinct sites in sonic Hedgehog combine forheparan sulfate interactions and cell signaling functions. J. Biol.Chem. 286, 44391–44402

17. Chen, Y., Abraham, D. J., Shi-Wen, X., Pearson, J. D., Black,C. M., Lyons, K. M., and Leask, A. (2004) CCN2 (connectivetissue growth factor) promotes fibroblast adhesion to fibronec-tin. Mol. Biol. Cell 15, 5635–5646

18. Wang, J., Markova, D., Anderson, D. G., Zheng, Z., Shapiro,I. M., and Risbud, M. V. (2011) TNF-� and IL-1� promote adisintegrin-like and metalloprotease with thrombospondin typeI motif-5-mediated aggrecan degradation through syndecan-4 inintervertebral disc. J. Biol. Chem. 286, 39738–39749

19. Okuyama, E., Suzuki, A., Murata, M., Ando, Y., Kato, I., Takagi,Y., Takagi, A., Murate, T., Saito, H., and Kojima, T. (2013)Molecular mechanisms of syndecan-4 upregulation by TNF-� inthe endothelium-like EAhy926 cells. J. Biochem. 154, 41–50

20. Echtermeyer, F., Bertrand, J., Dreier, R., Meinecke, I., Neuge-bauer, K., Fuerst, M., Lee, Y. J., Song, Y. W., Herzog, C.,Theilmeier, G., Pap, T. (2009) Syndecan-4 regulates ADAMTS-5activation and cartilage breakdown in osteoarthritis. Nat Med.15, 1072–1076

21. Smith, M. F., Jr., Novotny, J., Carl, V. S., and Comeau, L. D.(2006) Helicobacter pylori and Toll-like receptor agonists inducesyndecan-4 expression in an NF-�B-dependent manner. Glycobi-ology 16, 221–229

22. Han, Y., and Lefebvre, V. (2008) L-Sox5 and Sox6 drive expres-sion of the aggrecan gene in cartilage by securing binding ofSox9 to a far-upstream enhancer. Mol. Cell. Biol. 28, 4999–5013

23. Yeramian, A., Santacana, M., Sorolla, A., Llobet, D., Encinas, M.,Velasco, A., Bahi, N., Eritja, N., Domingo, M., Oliva, E., Dolcet,X., and Matias-Guiu, X. (2011) Nuclear factor-�B2/p100 pro-motes endometrial carcinoma cell survival under hypoxia in aHIF-1� independent manner. Lab. Invest. 91, 859–871

24. Fu, J., and Taubman, M. B. (2010) Prolyl hydroxylase EGLN3regulates skeletal myoblast differentiation through an NF-�B-dependent pathway. J. Biol. Chem. 285, 8927–8935

25. Johansen, J. L., Sager, T. N., Lotharius, J., Witten, L., Mørk, A.,Egebjerg, J., and Thirstrup, K. (2010) HIF prolyl hydroxylaseinhibition increases cell viability and potentiates dopaminerelease in dopaminergic cells. J. Neurochem. 115, 209–219

26. Fujita, N., Miyamoto, T., Imai, J., Hosogane, N., Suzuki, T., Yagi,M., Morita, K., Ninomiya, K., Miyamoto, K., Takaishi, H.,Matsumoto, M., Morioka, H., Yabe, H., Chiba, K., Watanabe, S.,Toyama, Y., and Suda, T. (2005) CD24 is expressed specificallyin the nucleus pulposus of intervertebral discs. Biochem. Biophys.Res. Commun. 338, 1890–1896

27. Sun, Q., Zhou, H., Binmadi, N. O., and Basile, J. R. (2009)Hypoxia-inducible factor-1-mediated regulation of semaphorin4D affects tumor growth and vascularity. J. Biol. Chem. 284,32066–32074

28. Kong, T., Westerman, K. A., Faigle, M., Eltzschig, H. K., andColgan, S. P. (2006) HIF-dependent induction of adenosineA2B receptor in hypoxia. FASEB J. 20, 2242–2250

29. Fujita, N., Gogate, S. S., Chiba, K., Toyama, Y., Shapiro, I. M.,and Risbud, M. V. (2012) Prolyl hydroxylase 3 (PHD3) modu-lates catabolic effects of tumor necrosis factor-� (TNF-�) oncells of the nucleus pulposus through co-activation of nuclearfactor �B (NF-�B)/p65 signaling. J. Biol. Chem. 287, 39942–39953

30. Adluri, R. S., Thirunavukkarasu, M., Dunna, N. R., Zhan, L.,Oriowo, B., Takeda, K., Sanchez, J. A., Otani, H., Maulik, G., Fong,G. H., Maulik, N. (2011) Disruption of hypoxia-inducible transcrip-tion factor-prolyl hydroxylase domain-1 (PHD-1-/-) attenuates exvivo myocardial ischemia/reperfusion injury through hypoxia-inducible factor-1� transcription factor and its target genesin mice. Antioxid. Redox Signal. 15, 1789–1797

31. Takeda, Y., Costa, S., Delamarre, E., Roncal, C., Leite deOliveira, R., Squadrito, M. L., Finisguerra, V., Deschoemaeker,S., Bruyère, F., Wenes, M., Hamm, A., Serneels, J., Magat, J.,Bhattacharyya, T., Anisimov, A., Jordan, B. F., Alitalo, K.,Maxwell, P., Gallez, B., Zhuang, Z. W., Saito, Y., Simons, M., DePalma, M., Mazzone, M. (2011) Macrophage skewing by Phd2

2464 Vol. 28 June 2014 FUJITA ET AL.The FASEB Journal � www.fasebj.org

haplodeficiency prevents ischaemia by inducing arteriogenesis.Nature 479, 122–126

32. Xue, J., Li, X., Jiao, S., Wei, Y., Wu, G., and Fang, J. (2010) Prolylhydroxylase-3 is down-regulated in colorectal cancer cells andinhibits IKK� independent of hydroxylase activity. Gastroenterol-ogy 138, 606–615

33. Huegel, J., Mundy, C., Sgariglia, F., Nygren, P., Billings, P. C.,Yamaguchi, Y., Koyama, E., and Pacifici, M. (2013) Perichon-drium phenotype and border function are regulated by Ext1and heparan sulfate in developing long bones: a mechanismlikely deranged in hereditary multiple exostoses. Dev. Biol. 377,100–112

34. Tim, Y. S., Kim, S. K., Li, J., Soo Park, J., Akamaru, T., Elmer,W. A., and Hutton, W. C. (2003) The effect of bone morpho-genetic protein-2 on rat intervertebral disc cells in vitro. Spine28, 1773–1780

35. O’Connell, M. P., Fiori, J. L., Kershner, E. K., Frank, B. P., Indig,F. E., Taub, D. D., Hoek, K. S., and Weeraratna, A. T. (2009)Heparan sulfate proteoglycan modulation of Wnt5A signaltransduction in metastatic melanoma cells. J. Biol. Chem. 284,28704–28712

36. Fuerer, C., Habib, S. J., and Nusse, R. (2010) A study on theinteractions between heparan sulfate proteoglycans andWnt proteins. Dev. Dyn. 239, 184–190

37. Yano, F., Kugimiya, F., Ohba, S., Ikeda, T., Chikuda, H.,Ogasawara, T., Ogata, N., Takato, T., Nakamura, K., Kawaguchi,H., and Chung, U. I. (2005) The canonical Wnt signalingpathway promotes chondrocyte differentiation in a Sox9-depen-dent manner. Biochem. Biophys. Res. Commun. 333, 1300–1308

38. Dahia, C. L., Mahoney, E., and Wylie, C. (2012) Shh signalingfrom the nucleus pulposus is required for the postnatal growthand differentiation of the mouse intervertebral disc. PLoS One 7,e35944

39. Cully, M. (2013) Degenerative disc disease: Altered Wnt signal-ling in intervertebral disc degeneration. Nat. Rev. Rheumatol. 9,136

40. Risbud, M. V., Fertala, J., Vresilovic, E. J., Albert, T. J., andShapiro, I. M. (2005) Nucleus pulposus cells upregulate PI3K/Akt and MEK/ERK signaling pathways under hypoxic condi-tions and resist apoptosis induced by serum withdrawal. Spine30, 882–889

41. Robins, J. C., Akeno, N., Mukherjee, A., Dalal, R. R., Aronow,B. J., Koopman, P., and Clemens, T. L. (2005) Hypoxia induceschondrocyte-specific gene expression in mesenchymal cells inassociation with transcriptional activation of Sox9. Bone 37,313–322

42. Amarilio, R., Viukov, S. V., Sharir, A., Eshkar-Oren, I., Johnson,R. S., and Zelzer, E. (2007) HIF1� regulation of Sox9 isnecessary to maintain differentiation of hypoxic prechondro-genic cells during early skeletogenesis. Development 134, 3917–3928

43. Lafont, J. E., Talma, S., and Murphy, C. L. (2007) Hypoxia-inducible factor 2� is essential for hypoxic induction of thehuman articular chondrocyte phenotype. Arthritis Rheum. 56,3297–3306

Received for publication October 28, 2013.Accepted for publication February 10, 2014.

2465HIF-1 CONTROLS SDC4 EXPRESSION IN NUCLEUS PULPOSUS