INOM EXAMENSARBETE BIOTEKNIK,AVANCERAD NIVÅ, 30 HP

, STOCKHOLM SVERIGE 2017

NOVEL AND EFFICIENT DELIVERY OF CRISPR/CAS9 FOR GENOME ENGINEERING IN EUKARYOTIC CELLS.

OSKAR GUSTAFSSON

KTHSKOLAN FÖR BIOTEKNOLOGI

1

EXAMENSARBETE INOM BIOTEKNIK,

AVANCERAD NIVÅ, 30 HP

STOCKHOLM, SVERIGE 2017

NOVEL AND EFFICIENT

DELIVERY OF CRISPR/CAS9

FOR GENOME ENGINEERING

IN EUKARYOTIC CELLS.

Oskar Gustafsson ogu@kth.se

19920503-5539

2

Contents 1. Abstract ............................................................................................................................. 3

2. Introduction ....................................................................................................................... 3

3. Materials and methods ...................................................................................................... 8

3.1. Materials .............................................................................................................................................. 8

3.2. Cell culture ........................................................................................................................................... 8

3.3. Reporter system testing. ...................................................................................................................... 8

3.4. Flow cytometry .................................................................................................................................... 9

3.5. Synthesis of sgRNA .............................................................................................................................10

3.6. sgRNA genome editing evaluation .....................................................................................................12

3.7. CPP to RNP ratio optimization ...........................................................................................................12

3.8. Transfection buffer optimization .......................................................................................................12

3.9. sgRNA modification............................................................................................................................13

3.10. In vitro cleavage assay .....................................................................................................................13

3.11 Transmission electron microscopy ...................................................................................................14

3.12 Gel retardation analysis ....................................................................................................................14

4. Results ............................................................................................................................ 15

4.1. Reporter cell evaluation and RNP-lipid transfection. ........................................................................15

4.2. Ratio optimization. .............................................................................................................................16

4.3. Complexation buffer impact on genome editing efficiency. .............................................................17

4.4. sgRNA length modification ................................................................................................................18

4.5. Complex investigation........................................................................................................................20

5. Discussion ...................................................................................................................... 21

6. Future perspectives ......................................................................................................... 24

7. Appendix ......................................................................................................................... 25

3

1. Abstract The CRISPR (clustered, regularly interspaced, short palindromic repeat)/Cas9 system holds tremendous

applications and therapeutic value. However, a key limiting factor is the delivery of the system into

cells, both in vitro and in vivo. Existing delivery methods leaves much to be desired. An alternative

delivery method is cell-penetrating peptides (CPP) which are short peptides with proven cell-

penetrating abilities which has the capability to deliver cargo into eukaryotic cells. In this master

thesis, CPPs was studied as a delivery method for CRISPR/Cas9 ribonucleoprotein (RNP). The

CRISPR/Cas9 RNP was complexed with CPPs in a simple, non-covalent manner and successfully

delivered to eukaryotic cells. The genome editing efficiency of CPP delivery was found to be

comparable to leading lipid transfection agents. However, further optimization of this delivery method

is needed for both in vitro and in vivo applications.

Abstrakt

CRISPR/Cas9 systemet har oerhört mycket applikationer och terapeutiskt värde. Dock så hålls

CRISPR/Cas9 systemet tillbaka utav svårigheter att transportera systemet in i celler, både in vivo och in

vitro. Existerande transportmetoder lämnar mycket att önskas, en alternativ transportmetod är

cellpenetrerande peptider (CPP), vilka har bevisad kapacitet att transportera last över cellmembranet. I

denna masteruppsats studerades CPPs som en transportmetod för CRISPR/Cas9 ribonucleoprotein

(RNP). CRISPR/Cas9 komplexerades tillsammans med peptiden på ett enkelt, icke-kovalent sätt och

blev framgångsrikt transporterat in i eukaryotiska celler. Effektivitet av den genomiska redigeringen

var jämförelsebar med ledande lipid transformations agenter. Dock krävs ytterligare optimering för

denna transportmetod, både för applikationer in vitro och in vivo.

2. Introduction Programmable endonucleases have revolutionized the targeted genome engineering field, and made

possible applications that only a decade ago would have been daunting1. The foremost of these

endonucleases is the type II CRISPR/Cas9 system. Which acts in nature as an adaptive immune response

in bacteria and archaea against phages and plasmids by cleaving foreign DNA2,3. The system has been

adapted for use outside of its intended purpose in nature, and is today used in genome editing in a large

variety of organisms, such as bacteria4, plants5,6, diverse eukaryotic cells7–10 and human cells11–14. The

system has also been used in vivo mice models to treat dystrophic mouse cells15–17, with human in vivo

trials likely not far away.

A large difference between the CRISPR/Cas9 system and other targetable endonucleases, such as zinc

finger nucleases (ZFNs) 18,19 and transcription activator-like effector nucleases (TALENs)20,21, is that the

4

DNA-specificity of the CRISPR/Cas9 is based on RNA-DNA interactions, instead of protein-DNA

interactions.

The CRISPR/Cas9 system can be retargeted by exchanging the target sequence of the RNA-guide, which is

comparably easier than the retargeting ZFNs or TALENs. These systems require the protein sequence to

be altered, requiring specialized protein engineering expertise22. This combined with difficulties in protein

design, synthesis and validation have hampered previous targetable endonuclease systems from routine

use. Which has made it possible for the CRISPR/Cas9 system to swiftly catch up in popularity1,23.

In nature Cas9 interacts with CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) to form a RNP.

The crRNA confers specificity to the target sequence by base pairing and the tracrRNA performs a

structural role in the RNP1, the structure of the RNP bound to DNA can be seen in figure 1. In genome

editing applications it’s possible to use tracrRNA/crRNA in their original form or combine them into a

single guide RNA (sgRNA). Henceforth, this thesis will use the sgRNA terminology. The binding of

Cas9/sgRNA to the DNA triggers a double stranded break (DSB) were the cleaving of the DNA is carried

out by two putative nuclease domains, HNH and RuvC. HNH cleaves the DNA strand complementary to

the target sgRNA sequence while RuvC cleaves the opposite DNA strand. However, for the binding to DNA

to occur, Cas9 needs a protospacer-adjacent motif (PAM), which is a short sequence downstream of the

target sequence (e.g. NGG for S. pyrogenes) that is recognized by protein residues in Cas924. This must be

taken into consideration when sgRNAs are designed, since all targeted sequences must end with the PAM

sequence. Orthologs of the S.pyrogenes Cas9 belonging to other bacterial species have been found with

different PAM sequences. It is believed that deeper analysis of bacterial CRISPR systems might unveil

Cas9 enzymes with specificity against different PAM sequences1,25. It could also be possible in the future

to change the PAM sequence at will through protein engineering.

Figure 1. sgRNA interacts with Cas9 forming the RNP which in turn interacts with DNA. The sgRNA forms several loops,

three of which extrude from the Cas9.

5

The introduction of a DSB activates DNA repair pathways such as endogenous homologous

recombination (HR) or non-homologous end joining (NHEJ). Both of these pathways have valuable

therapeutic applications, which arise from the site directed mutagenesis caused by NHEJ and the repair

and replacement capabilities of HR14. These pathways are present in all three domains of life and serves a

vital purpose in DNA repair. An unrepaired or misrepaired DSB can lead to chromosomal aberrations,

senescence and apoptosis, it is therefore of importance that the generation of DSB by introduced

endonucleases is controlled and specific26. The HR results, in nature, in precise repair of the DSB resulting

in an identical sequence as was present before the DSB, this is done using a DNA template with

homologous overlap on each side of the DSB. HR can be exploited in genome engineering to introduce a

new gene or exchange nucleotides of a gene, which is done by introducing a DSB in the target sequence

and providing a homologous DNA template containing the insert27. However, the overwhelming majority

of DSB are repaired by NHEJ which frequently results in base insertions or deletions (indels), often

causing frameshift mutations and premature stop codons26. Therefore NHEJ is often induced for gene

knockout28. NHEJ mediates direct religation of the broken DNA molecules which is done independently of

the type of DNA end and without the need for a DNA template26. The potential of HR to repair or insert

new genes has generated considerable interest since the discovery of the pathway. However, efficient

DSB repair through the HR pathway has proven difficult due to the majority of DSB being quickly repaired

by the NHEJ29.

The specificity of targetable endonucleases is highly important, since off-target cleavage could have

highly detrimental consequences for the cell and/or organism. It has been shown that the specificity and

activity of Cas9/sgRNA are at least on par with previous targetable endonucleases23. However,

Cas9/sgRNA can in certain cases tolerate some mismatches in the RNA-DNA pairing, possibly introducing

off-target cleaving30. Several approaches have been developed to decrease the off-target cleaving. One of

which is the double-nicking approach. Cas9 nickase is a Cas9 that has had one of its nuclease sites

deactivated. The pairing of two of these nickases using two different sgRNAs makes it possible to induce a

DSB, dependent on the recognition of two Cas9 enzymes instead of one. This was shown to decrease

relative off-target effects by 50-1000 fold29. It has also been shown, quite counterintuitively, that using a

truncated (

6

approach is currently being done using oligonucleotides29. There are numerous applications of a specific

DNA targetable enzyme, the future no doubt holds further applications.

Despite attractive applications in a broad range of therapeutic settings, the efficient delivery of the

CRISPR/Cas9 remains a key limiting factor. The successful delivery of the system is paramount to any

application. The CRISPR/Cas9 can be delivered in three different forms: as DNA, as RNA and as an RNP22.

The transfection of Cas9/sgRNA encoding plasmids through lipofection, electroporation or viral delivery

has long been established. However, electroporation is not possible to perform on a systemic level in vivo

and viral delivery suffers from size restrictions to the cargo35. The small cargo size of viral delivery vectors

necessitates the need to separate delivery of Cas9 mRNA and sgRNA15. Furthermore, studies into

potential immune responses to viral vectors are needed36. Lipofection is the delivery of cargo, such as

DNA, RNA or protein using lipid molecules. However, lipofection is to an extent toxic, inflammatory and

immunogenic37,38. The plasmid CRISPR/Cas9 delivery may not be a suitable delivery method as there are

many drawbacks connected to it. For example, plasmid DNA can be inserted into on-/off-target Cas9

cleavage sites, this can result in permanent expression of Cas9 / sgRNA39,40. Another side effect of

introducing plasmid DNA into cells is the induced cell-stress and cyclic GMP-AMP synthase activation as

well as cell immune responses due to the presence of bacterial sequences41,42. Lastly, one of the large

drawbacks of plasmid transfection of the CRISPR/Cas9 system is the overexpression of CRISPR/Cas9 RNP.

It has been shown that overexpression of Cas9 RNPs over long periods of time leads to an significantly

increased off-target cleavage risk43. The second approach is the delivery of sgRNA and mRNA coding for

Cas9, this solves the issues of cell immune response to DNA in the cytoplasm and genome integration.

The delivery of mRNA has inherent issues with stability and immunogenicity which can addressed

through the modification of the RNA44,45. However, the delivery of CRISPR/Cas9 system in RNA form still

results in Cas9 RNP overexpression, albeit not in as high levels as plasmid transfection, leading to

increased risk of off-target effects. The delivery of Cas9 RNP would solve many of the issues associated

with the previous mentioned delivery methods. However, the RNP by itself holds no cell-penetrating

activity and must be transported over the cell membrane by carrier agents or through physical methods

such as electroporation46,47. One already established method for delivering RNPs is through lipid

nanoparticles, these have achieved impressive levels of indels creation, 70%, after 72h, in vitro48.

However, lipids can be detrimental to cells and organisms as mentioned earlier.

A promising carrier molecule is cell-penetrating peptides, which generally are cationic and/or

amphipathic peptides with cell-penetrating properties. The structure of CPPs varies greatly, from simple

linear forms to branched structures with multiple attached functional groups. Cargo transfection using

CPPs can be done by either conjugating CPP and cargo, thus creating a defined unit, or by non-covalent

nanoparticle formation between CPP and cargo. These nanoparticles are formed mainly due to

electrostatic and hydrophobic interactions49. One of the early problems of these nanoparticles was the

low stability in serum conditions; therefore, nanoparticle stability must be taken into consideration.

CPPs hold considerable interest for therapeutic therapies, given that CPPs can enable protein, RNA and

DNA delivery into cells in vivo50–53. CPPs have previously been used to directly deliver programmable

endonucleases, such as covalently attached CPP-TALENs or CPP-Cas9 / CPP-sgRNA47,49,54. In these studies,

7

one or more CPPs were covalently attached to the endonuclease granting it cell-penetrating properties.

While the uptake mechanism for CPPs is not fully determined and is heavily debated, it is generally

accepted to be an active uptake involving endocytosis pathways49. CPPs entering the cell are to a large

extent sequestered into the endo-/lysosomal compartments, as the uptake of the CPPs is believed to be

largely dependent on endocytosis55. Therefore the escape from these compartments is vital for the

effective delivery of cargos though the use of CPPs56,57. There are different approaches to increasing the

endo-/lysosomal escape of the CPP and their cargo. One such approach is the incorporation of

protonatable domains to counteract pH-change in the endo-/lysosomal compartments55. Another

approach would be to increasing the membrane interaction properties of the CPP to increase interaction

with endo-/lysosomal membranes49. However, the drawback of these modifications are often increased

cellular toxicity, thus a balance must be stuck between endo/lysosomal escape and toxicity49.

Ramakrishna et al successfully delivered the CRISPR/Cas9 system into human cells using conjugated CPP-

Cas9 and sgRNA-CPP complexes. The CPP was covalently attached to the Cas9 protein and to the sgRNA.

However, a disadvantage of using conjugated CPP-Cas9 is that the sgRNA and CPP-Cas9 must be

transfected separately since mixing of the two does not result in indel creation. Ramakrishna et al

speculated that the negatively charged sgRNA neutralize the positive charge of the CPP thus blocking the

CPP-mediated uptake. This results in the need of two separate treatments, one with Cas9-CPP and one

with CPP-sgRNA47. This could result in decreased overlap between cells transfected with sgRNA and cells

transfected with Cas9, reducing genome editing efficiency.

This project used RNP to form complexes with

CPP in a non-covalent manner. Thus, making it

possible to first form Cas9/sgRNA RNP, followed

by complexation with the CPP, called PepSe, to

form nanoparticles. The Cas9 used had 3xNLS

(nuclear localisation signals) covalently attached

to it, facilitating nuclear transport after delivery.

The PepSe in a amphipathic peptide with lipids

attached to it. The proposed interaction between

RNP and PepSe would be for the positively

charged groups of the PepSe to interact with

exposed negatively charged sgRNA, this

interaction is illustrated in figure 2. The PepSe has

in previous work in the lab been non-toxic in vivo.

Figure 2. The envisioned interaction between PepSe and RNP is through the positively charged amino acids present on the PepSe and the negatively charged sgRNA loops.

8

3. Materials and methods

3.1. Materials Human embryonic kidney (HEK) cells 293T (ATCC) with a stable incorporation of a Stop-light construct,

Dulbecco’s Modified Eagle Medium (DMEM)(1X) + GlutaMAX™-I (Gibco®), Fetal Bovine Serume (FBS)

(Gibco®), Opti-MEM® I (1X) (Gibco®), 0,05% Trypsin-EDTA (1X) (Gibco®), Penicillin-Streptomycin (P4333)

(Sigma-Aldrich). LB-media pH 7,5 +/- 0.2, LA+Ampicilin agar plate, EndoFree® Plasmid Maxi Kit (Qiagen).

HiScribe™ T7 High Yield RNA Synthesis Kit (NEB), NucleoSpin® Gel, PCR Clean-Up kit (Macherey-Nagel),

SeaKem® LE Agarose. Phusion® High-Fidelity DNA Polymerase master mix (NEB). Polyvinylpyrrolidone

average mol wt 10,000 (PVP) (Sigma-Aldrich) (C6H9NO)x, Hepes (Roche), CaCl2 (Sigma-Aldrich), NaCl

(Sigma-Aldrich). Glucose (Merck). Alt-R® S.p. Cas9 Nuclease 3NLS (Integrated DNA technologies), Peptide

2815 (PepSe)(Pepscan), Lipofectamine® 2000 (Thermo-Fisher), Lipofectamine® RNAiMAX (Thermo-

Fisher). DAPI dye (Thermo-Fisher), Uranyl Acetate (1%), Formvar/carbon 200 mesh nickel grids (Agar

Scientific).

3.2. Cell culture HEK293T Stop-Light cells were maintained in DMEM(1X) + GlutaMax™ - I supplemented with 10% FBS and

penicillin/streptomycin (100 U/mL and 100 µg/mL, respectively). The cells were passaged every 48 to 72

h. The cells were seeded at a concentration of 14.000 cells / 0.32 cm2 in an attachment-factor coated 96-

well plate 24 h before transfection in a total volume of 100 µl, 30-70% confluence was achieved at the

time of transfection.

3.3. Reporter system testing. The stop-light reporter system is a stable construct permanently expressing mCherry with eGFP inducible

by indel formation of +/- 1 or 2. The simplified construct displaying the relevant genetic elements is

displayed in figure 4. The system only responds to indels of +/-1 or 2, meaning any frameshift multiple of

3 will be missed. Therefore, it is likely that 1/3 of indels are not discovered using this reporter system.

Figure 4. Frameshift of +/-1 or 2 will result in expression of both mCherry and eGFP, no indel induction or indels a multiple

of 3 will result in only mCherry expression. The F2A element is a self-cleaving peptide and functions to cleave mCherry

from any expressed eGFP.

9

The reporter system was tested by transfection. Different plasmid combinations were used: negative

control plasmid and positive control. The positive control was two plasmids containing either Cas9 insert

or target sgRNA insert, while the negative control consisted of either of the Cas9 or the target sgRNA

insert plasmids. A total of 0.33 µg plasmid was used for each transfection together with 5 µl

Lipofectamine 2000 per µg plasmid. The transfection mixture was prepared following the manufactures

recommendations. The prepared mixture was added to triplicate wells in a 96-well plate, followed by 24

h incubation and flow cytometry analysis.

3.4. Flow cytometry Flow cytometry was carried out using MACSQuant® Analyser. DAPI was added to each analysed well to

discern viable cells. The investigated properties were cell viability, mCherry and eGFP expression. Shown

in figure 3 are the gates used to determine the eGFP expression of each well. The first gate selects the

viable cells by investigating DAPI uptake, high intensity in the V1-A :: VioBlue-A channel indicates that the

cells are non-viable. Due to DAPI uptake by dead cells with permeable cell membranes. The next two

gates exclude cell-clumps, cell-fragments and bubbles from the gating by measuring the side vs forward

scatter. The side vs forward scatter of single cells increases in a linear fashion while clumps and

fragments do not. The forth gate also measures side vs forward scatter and gates away particles too large

or small to be cells. This is followed by gating of cells with emission of mCherry wavelength. Finally, the

eGFP expressing cells are investigated by looking at cells with high emission in the GFP wavelength.

Figure 3. This dotplot is taken from the transfection of HEK293T stop-light cells using RNP2:b-CPP, 1.5 pmol per well and

serves as a representative dotplot of eGFP expression quantification. The eGFP positive gate has been set in such a manner

as to only truly positive eGFP expressing cells are counted. The strict gating result in missed true positive cells.

10

3.5. Synthesis of sgRNA Plasmids, 2.2kb, containing a T7 promoter and unique sgRNA were amplified by PCR. Each plasmid

contained extensions in rationally chosen location in the sgRNA, this is illustrated in figure 5. The linear

template products were used by RNA synthesis using NEB HighScribe T7 kit. The primers used were:

Universal Forward: 5`-TTACGCTGGAGTCTGAGGC-3`, Reverse: 5`-AAAAAGCACCGACTCGGTG-3`, and a

reverse primer binding further downstream of the sgRNA, creating an sgRNA tail. The primer binding sites

can be seen in figure 5.

a) b) Figure 5. a) Insert #1-4 contains the target sequence and differs from each other in the length and location of the rationally added extra nucleotides. Insert #5 lacks both random added nucleotides and target sequence and contains only the sgRNA backbone. b) Shown here is the primer binding sites during PCR amplification, the extended reverse primer binds several bp after the sgRNA.

The original, MiniGene (IDT), plasmid backbone sequence was: CCCGTGTAAAACGACGGCCAGTTTATCTAGTCAGCTTGATTCTAGCTGATCGTGGACCGGAAGGTGAGCCAGTGAGTTGATTGCAGTCCAGTTACGCTGGAGTCTGAGGCTCGTCCTGAATGATATGCGGCCTCGGCGCGTGATCTTACGGCATTATACGTATGATCGGTCCACGATCAGCTAGATTATCTAGTCAGCTTGATGTCATAGCTGTTTCCTGAGGCTCAATACTGACCATTTAAATCATACCTGACCTCCATAGCAGAAAGTCAAAAGCCTCCGACCGGAGGCTTTTGACTTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTACGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTCACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGGCAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGATCACTTCTGCGCTCGGCCCTCCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGCATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAATGAGGGCCCAAATGTAATCACCTGGCTCACCTTCGGGTGGGCCTTTCTTGAGGACCTAAATGTAATCACCTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGATGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAG

11

TCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATTTTCTACCGAAGAAAGG. The plasmid backbone can be seen in figure 6.

Figure 6. Ordered IDT MiniGene – Amp plasmid backbone.

The sgRNA insert in plasmid #1-4 all contain the same target sequence and only differ in the length and

location of added nucleotides. These nucleotides were added to increase interaction between the

negatively charged sgRNA and the positively charged domains of the PepSe.

PCR amplification was done by adding the universal forward and one of the two reverse oligonucleotide

primers to a Phusion High-fidelity mastermix according to manufacturer’s recommendations. The

thermocycler settings used were: 98°C – 30 s, [98°C – 10 s, 63.7 – 30 s, 72°C 10 s] x 30 cycles. The reverse

and extended reverse primer both binds downstream of the sgRNA, binding either on the 3´-end of the

sgRNA or a distance downstream thus creating the linear templates for sgRNA1-5:a and 1-5:b. The longer

template results in a significant sgRNA tail, since the T7 polymerase used during the in vitro transcription

does not dissociate from the template at 3´-end of the sgRNA proper. The PCR product was purified using

NucleoSpin® Clean-up kit and eluted in 30 µl water, the concentration was measured using a NanoDrop

spectrophotometer NP80 (Implen). The size was confirmed using gel electrophoresis in a 1% SeaKem®

agarose gel with 1xTAE buffer. The purified PCR mixture was used for in vitro transcription following the

manufacturers recommended conditions for shorter RNA transcripts. The sgRNA was then purified using

chloroform-phenol extraction, chloroform extraction followed by ethanol precipitation. The size of the

purified sgRNA was analysed on a 1% agarose gel. The sgRNA4:b failed to be transcribed, and was

therefore not used in the experiments described in this thesis.

12

3.6. sgRNA genome editing evaluation RNPs was created by mixing 330 ng Cas9 with sgRNA1-5:a-b in a molar ratio of 1:1.2 followed by 10 min

incubation at RT. Both Cas9 and the sgRNA was dissolved in water. Following the established protocol48,

0.4 µl of RNAiMAX was used for every ≈ 0,6 pmol RNP. A total of 330 ng Cas9 was used for each reaction,

resulting of 0,6 pmol RNP into each well in a 96-well plate. Opti-MEM was added after RNP incubation

until a total final volume of 16.5 µl was achieved, followed by addition of 13.2 µl Opti-MEM mixed 3.3 µl

RNAiMAX which had been incubated for 10 min at RT. This was incubated for 30 min and added to cells,

the cells were incubated for 24 h followed by analysis using flow cytometry described in 2.3. Flow

cytometry.

3.7. CPP to RNP ratio optimization Different amounts of PepSe was added to 5.2 pmol RNP2:b, prepared as described in 2.6 sgRNA genome

editing evaluation, in a HBG (Hepes buffered glucose) buffer with a final volume of 33 µl. The HBG

consisted of 20 mM Hepes and 5 w/v% glucose. The molar ratios tested was: 1:10, 1:30, 1:60, 1:100,

1:120, 1:150, 1:200 molar ratio between RNP and PepSe. The RNP-CPP was incubated 40 min at RT,

followed by addition to stop-light HEK293T cells seeded 24 h earlier. A total of ≈ 1.5 pmol was added per

well resulting in a concentration of ≈ 0.014 µM RNP. The cells were analysed 24 h later using the flow

cytometer, as described in 2.3 flow cytometry, to determine the genome editing efficiency of the

different RNP2:b-PepSe ratios.

3.8. Transfection buffer optimization The buffer optimization for transfection was done by preparing the 5.2 pmol RNP2:b as was done in 2.6

sgRNA genome evaluation, followed by addition of PepSe, in a molar ratio of 1:100 RNP to CPP. Quickly

followed by buffer until a final volume of 33 µl was achieved. The PepSe was dissolved in water. The RNP-

CPP was incubated 40 min at RT in the buffer, followed by addition to stop-light HEK293T cells seeded 24

h earlier. A total of ≈ 1.5 pmol was added per well resulting in a concentration of ≈ 0.014 µM RNP. The

cells were analysed 24 h later using the flow cytometer, as described in 2.3 flow cytometry.

The buffers used were: HBG buffer, 10 w/v% PVP mixed with HBG buffer, HEPES, CaCl2, NaCL, Opti-MEM

and water. The PVP solution was made by adding 20 w/v% PVP together with 12.6 w/v% sucrose to

water. The PVP transfection solution was prepared by adding 16.5 µl PVP 20 w/v% with 6.5 µl HBG

together with CPP in water to the RNP. The HEPES, CaCl2 and NaCl solutions were made by adding 23 µl

isotonic buffer together with 5 µl CPP to 5 µl RNP. The solutions using Opti-MEM and water were done by

adding 23 µl Opti-MEM or water together with 5 µl CPP to 5 µl RNP. The treatments were added to cells

in serum containing media.

13

3.9. sgRNA modification Extensions of the sgRNA2 and sgRNA5 were made according to the protocol described in 2.5 RNA

synthesis. Each reverse primer used bind further downstream of the sgRNA insert, creating the template

for an sgRNA tail of increasing length. The binding of the primers to the sgRNA insert can be seen in figure

7. The RNA synthesis was done using the same protocol described in 2.5 RNA synthesis, resulting in the

extended sgRNA2:c-e and sgRNA5:c-e. These extended guides, 2:a-e and 5:a-e, were tested with

RNAiMAX, using the same protocol as described in 2.6, with the exception of adding ≈ 1.5 pmol RNP per

well.

The new guides were transfected using PepSe, ≈ 1.5 pmol RNP per well, with a molar ratio of 100:1

between RNP and CPP, in HBG buffer with 10% PVP. The treatment were otherwise prepared and

administered as described earlier, the cells was incubated for 24 h, followed by analysis by flow

cytometry.

Figure 7. Primers binding x bp, y bp and z bp from the sgRNA was used to PCR amplify sgRNA templates

for the synthesis of sgRNA with extended tails.

3.10. In vitro cleavage assay 3 pmol Cas9 was mixed with sgRNA2:a-e and sgRNA5:a-e in a molar ratio of 1:1.2, followed by addition to

1 µg of target sequence plasmid. This was then incubated for 1h at 37°C followed by a heat inactivation

step at 98°C for 30s. Samples were evaluated by gel electrophoresis using a 1% agarose gel in 1xTAE

buffer.

14

3.11 Transmission electron microscopy Electron microscopy was performed to investigate the complex formation between RNP and PepSe. The

species analysed was RNP2:b, RNP2:b-CPP and RNP2:b-CPP with 10% PVP. The RNP2:b and RNP2:b-CPP

was added to the mesh in a concentration of 0.1 µM while the RNP2:b-CPP with 10% PVP was added in

the concentration of 0.01 µM. The samples were prepared following the protocol established in materials

and methods 2.6/2.7/2.8, with a molar ratio of 100:1 between CPP and RNP. The samples were applied to

a 200 mesh nickel grids coated with Formvar/carbon (Agar Scientific UK), followed by negative staining

using an aqueous solution of uranyl acetate (1%) and visualized using the transmission electron

microscopy.

3.12 Gel retardation analysis 0,49 pmol RNP was prepared as described in 2.6 sgRNA genome evaluation. RNP was mixed with CPP to

achieve a molar ratio of 1:10, 1:20, 1:40, 1:60, 1:100. Added to this was 20% m/v PVP, with the resulting

concentration of 10% m/v, HBG was added until the total volume of 20 µl. These samples were loaded,

together with pure sgRNA and RNP, to a 1% SeaKem® Agarose gel with 1xTAE buffer.

15

4. Results

4.1. Reporter cell evaluation and RNP-lipid transfection. The Stop-light HEK293T cells were transfected though lipid transfection with positive and negative

control plasmids. The positive control plasmids consisting of two plasmids with Cas9 gene insert

respectively a target sgRNA insert. While the negative controls consisted of only Cas9 plasmid, only

sgRNA plasmid or Stuffer plasmid which is an empty backbone. The positive control Lipofectamine2000

transfection resulted in expression of eGFP (data not shown). As expected no eGFP expression was

detected with the negative controls (data not shown).

It has previously been shown that lipid based transfection reagents can be applied for transfection of

Cas9/sgRNA RNP48. Liang et al compared several such lipid reagent and achieved the highest indel

creation by RNAiMAX – RNP transfection, therefore RNAiMAX was used for lipid transfection of RNP in

this thesis. RNAiMAX was used to transfect the cells with RNP1-5:a-b, which consisted of Cas9 complexed

with the sgRNA guides #1-5:a-b. This transfection resulted in eGFP expression in all cases expect 5:a-b, as

expected due to sgRNA5 not containing the target sequence. The resulting eGFP expression and

efficiencies can be seen in figure 8, these results imply that the targeting is correct in all target guides and

integrity of the sgRNA is adequate for genome cleavage. Failure in the design and synthesis of the sgRNA

would result in a percentage of eGFP expressing cells similar to the untreated control. However, as can be

seen in figure 8, there is an eGFP expressing population in the treated cells. The quality and size of the

sgRNA synthesised were also probed by gel electrophoresis on a 1% SeaKem Agarose gel with 1xTAE

buffer. The synthesised sgRNA were of the expected size with acceptable integrity (data not shown). The

RNAiMAX mediated RNP treatment resulting in the largest eGFP expressing cell population was

erroneously identified as sgRNA2:b, due to an unexpected fluorescent shift. It is believed certain parts of

the cell population become auto fluorescent in the same emission wavelength as eGFP, causing the

observed shift. The auto fluorescent population can be seen in figure 8, with an emission intensity higher

than the untreated population.

16

Figure 8. RNAiMAX transfection of RNP1-5:a-b. a) The

percentage of cells expressing eGFP and the Median

fluorescence intensity (MFI) after 24 h. The transfection was

done in serum using RNAiMAX, 0,6 pmol RNP per well. There

is a correlation between the treatments resulting in higher

eGFP expression and the treatments with high MFI b)

Representative dotplots after treatment. Treatment with

RNP1.b resulted in this well in 4.69% GFP expressing cells,

while RNP5.b result in no eGFP positive cells. The gating was

set in a strict manner as to exclude false positive cells.

4.2. Ratio optimization. Determination of the optimal molar ratio of PepSe to RNP was done to optimize the transfection

efficiency. As can be seen in figure 9, the ratio resulting in the largest percentage of edited cells were

molar ratio 100:1 PepSe to RNP. The data suggest that the PepSe – RNP can enter mammalian cells and

perform genome editing of target

sequences. Albeit at a very low

efficiency. The low, 100,

molar ratios are believed to form

too strong complexes, unable to

dissolve in the endo/-lysosomes.

Investigations using challenge

assays could shed further light on

the stability of the formed

complexes.

Figure 9. The percentage of eGFP expressing cells after 24 h and the

corresponding MFI of each molar ratio between PepSe and Cas9 RNP. The

buffer used for complexation was HBG.

17

4.3. Complexation buffer impact on genome editing efficiency. The solution in which the nanoparticles are formed greatly affect the transfection efficiency of the

particles as it can affect the size and charge of the formed nanoparticles. This in turn affects the

transfection efficiency, therefore, complexation was carried out in different buffers in search of the

optimal buffer. The resulting genome editing efficiencies varies greatly, as can be seen in figure 10. The

HBG buffer with an added 10% of PVP was the most efficient buffer with ≈ 3% genome editing according

to the stop-light assay. PVP is an crosslinker with high polarity, which was believed to be able to interact

with the polar groups of the nanoparticles, thus stabilizing them. While CaCl2 has similar levels of

efficiency as PVP, the growth of the cells is likely severely inhibited, as can be seen in figure 10. The

growth of the cells was evaluated by using the flow cytometry cell count data to calculate the number of

cells present in each well. However, this method of evaluating cell growth is far from optimal, and cannot

return definitive answers, further analysis with methods developed for this application is needed.

Figure 10. a) The percentage of the eGFP expressing cells together with the average MFI 24 h after each treatment. b) The average cell

count in each triplicate, the cell count gives hints as to how the cells react to the transfection agent and buffer. As can be seen here, using

CaCl2 as transfection buffer likely inhibits the cell growth to a large extent and is likely toxic to the cells. However, further analysis with

methods devoted to cell growth inhibition and toxicity is required.

18

4.4. sgRNA length modification It was hypothesised that increased sgRNA length in the 3´-end of the sgRNA would increase the

accessibility of the sgRNA to the CPP. This was postulated to result in increased complexation which

would result in increased nanoparticle formation and transfection efficiency. To that end, sgRNA2:c-e and

sgRNA5:c-e was created, with extensions on the 3´-end of the sgRNA. An in vitro cleavage assay was

performed to confirm the activity of the longer sgRNAs, all length variations of sgRNA2 cleaved the target

sequence while none of the negative control sgRNA5 did. Stop-light cells were transfected with the new

extended guides using RNAiMAX and PepSe. The results from the flow cytometry analysis of the

RNAiMAX transfection can be seen in figure 11. As shown, the sgRNA2:a has the highest transfection

efficiency using RNAiMAX. However, performing the same transfection using PepSe the highest efficiency

was achieved with sgRNA2:b as shown in figure 11.The average cell count in each RNP5:a-e is also shown

in figure 11, the amount of cells in each triplicate appears to decrease with increased sgRNA length.

Figure 11. a/b) These two graphs display the average percentage of GFP expressing cells corresponding MFI 24 h after

treatment. The wells in graph a) have been transfected using RNAiMAX, while the wells in graph b) have been transfected

using PepSe. c/d) These graphs display the average cell number in each well 24 h after treatment of RNP5:a-e using

RNAiMAX or CPP as transfection agent. The difference between the untreated control cell count and the treated is

generally lower in the PepSe mediated transfection than the RNAiMAX mediated.

19

The auto fluorescent shift is visible during transfection with both sgRNA2a:e and sgRNA5a:e, increasing as

the sgRNA length increase, implicating the length of the sgRNA to be the cause for the observed shift in

fluorescence and decrease in cell count. The increasing shift can be seen in figure 12.

Figure 12. a/b) Graph a) and b) are representative dotplots of each RNP treatment after 24 h using RNAiMAX, dotplot a), or

PepSe, dotplot b). It is possible to see the formation of two populations after treatment, with the population with

increased emission in the FITC-A channel increasing as the sgRNA length increase. This population shift is observable both

in RNP2 and RNP5 transfection. Note that the number of dots in not representative of the number of cells in the sample,

since different volumes was analysed in each treatment.

20

4.5. Complex investigation The presence of complexes was evaluated by electrophoresis and transmission electron microscopy. The

gel retardation investigation was performed by adding RNP2:b, RNP2:b with varying molar ratio to PepSe

and sgRNA2:b to an agarose gel followed by gel electrophoresis. The samples with RNP complexed to CPP

was retarded in their movement though the gel, indicating larger particle size. Furthermore, the

complexes had lower fluorescence intensity with higher CPP to RNP ratio reaching the lowest intensity at

the highest ratio tested, implying that the dye is excluded from interaction with the sgRNA (data not

shown). The presence of complexes was strengthened by EM analysis of RNP, RNP-CPP and RNP-CPP with

added 10% PVP, as shown in figure

13. No complexes can be observed

when observing only RNP, while

complexes formed in the presence

of CPP. The addition of PVP appears

to contribute to the formation of

more defined complexes, as can be

seen in genome editing rate

doubling with 10 w/v% PVP present

during complexation. The complexes

formed seemed to be formed from

clusters of spherical nanoparticles.

Further images of RNP-CPP

complexes in the presence of 10

w/v% PVP can be seen in the

appendix figure 15-17.

Figure 13. RNP-CPP-PVP. a) Imaged here

is the RNP only, the particles formed

under the EM were mostly protein smears

with no repeating pattern between each

particle. b/c) The RNP complexed to the

CPP in an HBG buffer. Here a larger

number of particles are seen on the

surface of the mesh, furthermore the

particles have a common, repeating,

pattern. d/e/f) Shown in these images is

RNP-CPP complexed in the presence of 10

w/v% PVP. The particles display a clear

coherent structure.

21

5. Discussion This thesis shows that transfection of human cells using Cas9 RNP complexed to CPP in a non-conjugated

manner is possible and comparable in genome editing efficiency to RNAiMAX transfection of Cas9/sgRNA.

The results are promising and further optimization will most likely improve the results. This is the first

study, to the authors knowledge, of CPP-RNP mediated transfection in a non-covalent manner. Earlier

studies have used CPP to transfect the CRISPR/Cas9 system by conjugating the CPPs to the Cas9 and

achieved higher indel creation than what is achieved in this thesis. Staalh et al 46 and Ramakrishna et al 47

achieved gene expression of 7% and 7.8% respectively using very similar reporter systems as the stop-

light system. However, Staalh used a concentration 70 times higher while Ramakrishna used a

concentration 115 times higher, during three consecutive treatments over 3 days, than the 14 nM used in

this thesis. The high concentrations used imply that insufficient genome editing was achieved at lower

concentrations. An interesting observation is that both Staalh et al and Ramakrishna et al applied their

treatments for no more than 4 h, followed by change of media. This likely implies certain toxicity of the

Cas9-CPP conjugates in the concentration ranges used. Therefore, even though the reported genome

editing is higher in both previous articles using CPP to transfect RNP, the genome editing per enzyme

used is lower. To note is that both Staalh et al and Ramakrishna et al used different cell lines than the

HEK293T cells used in this thesis. Therefore, a direct comparison as is done above is not fair and

definitive, but the comparison does provide certain hints about the transfection efficiency.

Recent, in-house, unpublished data indicate the presence of micelles in a solution containing PepSe. This

data was achieved by increasing the concentration of PepSe in the presence of a Eyosin Y, a dye which

becomes fluorescent in hydrophobic environments. It was determined that at sufficient concentrations,

hydrophobic environments are formed in solutions of PBS containing PepSe. The suggested origin of

these hydrophobic environments is micelle formation of the peptide, with the hydrophobic domains

facing inwards and the positively charged groups facing outwards, ready to interact with negatively

charged cargo. It is speculated that this also occurs when PepSe is complexed to RNP, and these micelles

are the smallest spheres seen during EM imaging. An illustration of the proposed micelle can be seen in

figure 14. Investigation of these micelles might provide insight into ways to further improve transfection

efficiency.

22

Figure 14. The suggested formed micelle has a hydrophobic core consisting of the hydrophobic domains of the peptide

combined with the lipids attached to each peptide. The hydrophobic core is surrounded by the hydrophilic cargo, in this

case the RNP. Further characterisation of this possible micelle could contribute to rational experiment designs to increase

transfection efficiency.

The buffer, the molar ratio, the sgRNA length all contribute greatly to the gene editing as can be seen in

figures: 8-10, this is likely due to the characteristics of the nanoparticle formed. The polarity of the buffer

likely contributes to the stability of the nanoparticles by increasing the Gibbs free energy of having PepSe

hydrophobic domains exposed to the solution. The unfavorability of having increased free energy likely

results in nanoparticles with hydrophobic cores. This increase in the free energy is believed to be

insufficient in water for the formation of stable hydrophobic-core containing nanoparticles. Possibly

explaining the lack of gene editing when complexes was formed in water. The measured gene editing of

nanoparticles formed HBG buffer indicates that the increase in buffer polarity compared to water results

in the formation of nanoparticles with hydrophobic cores. The addition of 10 w/v% PVP to the HBG buffer

during complexation was done in the belief that the polar crosslinking polymer, which is known to

interact strongly with polar substances, would stabilise the nanoparticles and increase transfection

efficiency. The addition of PVP doubled gene editing, indicating increased transfection efficiency.

However, the means of this appears to be different from what was believed. Recent, in-house,

unpublished heparin challenge essay data of PepSe-RNA complexes together with 10 w/v% PVP showed

that the addition of PVP destabilised the formed complexes (data not shown). The transfection efficiency

23

was increased for PepSe-RNA complexes in 10 w/v% PVP (data not shown), indicating that the less stable

nanoparticles have a higher transfection efficiency. It could be that complexation in pure water results in

too unstable nanoparticles, unable to reach the cells, while complexation in HBG buffer results in too

stable nanoparticles, unable to properly dissolve in endo-/lysosomes. The addition of PVP to HBG buffer

possibly brings the stability in the nanoparticles into the goldilocks range of CPP/RNP stability. This is

however opposed by the EM images, figure 13, were the nanoparticles formed in the presence of PVP

appears more defined and consistent. It could be that PepSe/RNP complexes behave differently from the

PepSe/RNA complexes in the presence of PVP. Further studies of the stability and composition of the

nanoparticles are warranted. Further work is also necessary to investigate why transfection is only

observed during surprisingly high molar ratios of 100:1 CPP to RNP. It should not logically be possible for

100 PepSe peptides to interact with the exposed sgRNA or a single RNP, even with the extended sgRNA.

The second hypothesis investigated, that increased sgRNA length would lead to increased transfection

efficiency appears to only be partially true. A short extension, such as is done in sgRNA2:b, appears to

increase the transfection efficiency of RNP-CPP compared to the shorter sgRNA2:a. However, extended

sgRNA2:c-e results in less editing and more fluorescent shift, which is possibly due to cell apoptosis giving

rise to auto fluorescence. The shift can be clearly seen in figure 12, increasing with sgRNA length,

independent on sgRNA target sequence. It is possible that that transfection efficiency is increased by the

longer sgRNA, however, this would be hard to observe due to the cell death caused by the longer sgRNA.

Further development is needed to determine if the transfection efficiency is increased, and if so how to

decrease the cell reaction to foreign RNA and thus reduce toxicity.

In a study by Liang, X. et al RNAiMAX was used to transfect RNP into HEK293 cells with the achieved indel

frequency was 48% after 24 h48. This is far higher than the indel frequency achieved in this master thesis

using the same protocol, apart from using more than twice the concentration of RNAiMAX-RNP. The indel

frequency is lower even when the lagg time between indel creation and eGFP expression taking into

consideration. This likely results in an underestimation of indel frequency. The highest percentage of cells

expressing eGFP achieved after 24 h, using RNAiMAX to transfect Cas9 RNP, was ≈ 6%. This likely equals

≈9% indels, due to frameshift of 1 or 2 result in eGFP expression. The low efficiency of the RNAiMAX

transfection suggests either an inefficient reporter system or low quality sgRNA. It should therefore be

possible to increase RNAiMAX efficiency by exchanging the cell line or synthesising new, high quality

sgRNA. This effect could carry over into CPP transfections, resulting in increased efficiency.

The stop-light reporter system works by knocking either of two eGFP genes into frame, giving rise to

eGFP expression if indels of +/- 1 or 2 in induced in the target sequence. This means that ≈ 1/3 of all

indels are not detected using this reporter system. An alternative system to evaluate indel formation

would be PCR amplification of target genes, followed by mismatch analysis using mismatch-

endonucleases. The endonuclease cleaves mismatched DNA strands. One such nuclease is the T7

endonuclease which can recognize and cleave single base pair mismatches, insert and deletions58. This

reporter system has successfully been used to evaluate indel frequency of targeted endonucleases and

has the advantage of simplicity, robustness and applicability to all cell types and gene targets37,48,58.

In summary, this thesis demonstrates a novel, alternative and enhanced CPP mediated delivery of

Cas9/sgRNA RNP to human cells in vitro. This delivery method has several advantages over delivery of

genomic material encoding the CRISPR/Cas9 system, with the primary advantage being the shortened

24

and reduced presence of the RNP in cells, reducing off-target effect substantially. Furthermore, the non-

covalent approach used in this thesis mediates flexibility compared to the covalent approaches

developed.

6. Future perspectives There are several aspects of RNP transfection using Pep-SEA that was left unexplored in this thesis. It is of

importance to investigate further how crosslinking agents can stabilize or destabilize the formed

nanoparticles. In this thesis only PVP was evaluated, which doubled the transfection efficiency, implying

the possibility of further crosslinkers conferring higher efficiency.

Further characterisation of the stability, size and toxicity of the nanoparticles are required, this can be

done through a heparin competition essays, nanoparticle tracking analysis and cell proliferation assays.

An interesting prospect would the disruption of the larger complexes formed when PVP is added to the

solution during complexation, as seen in figure 13. This disruption could possibly be done through

vigorous mixing during RNP-CPP incubation or through the usage of ultrasonication before cell treatment.

It is possible that the smaller spherical units could have an increased transfection efficiency or reduced

toxicity. An interesting point to investigate would be to investigate if micelles are formed when RNP is

complexed to PepSe.

Another interesting aspect would be the exchange of the target sgRNA to target real genes and evaluate

at the indel creation. If successful, then this could be extended to in vivo trials in gene disruption of

therapeutic proteins. The creation of a new RNA synthesis protocol were the integrity of the sgRNA has a

higher priority would ensure genome editing rates more accurately reflecting transfection efficiencies.

An additional interesting future perspective is the delivery of a DNA template together with the RNP to

induce HR. This could be done by having the extended sgRNA contain complimentary sequences for the

DNA template, allowing the DNA to be complexed into the nanoparticles together with the RNP. This

could facilitate the delivery of the DNA template directly to the DSB, thus increasing the rate of HR.

25

7. Appendix

Figure 15. An overview picture of RNP2:b complexed with PepSe in a 1:100 molar ratio with 10% w/v

ratio added PVP. There is a large variation in size of formed nanoparticles and it is unclear which of the

particles are the active species, if not all.

26

Figure 16. An magnified image of RNP2:b complexed with PepSe in a 1:100 molar ratio with 10% w/v ratio

added PVP. Once again there are larger nanoparticle complexes formed from smaller units.

27

Figure 17. An further magnified image of RNP2:b complexed with PepSe in a 1:100 molar ratio with 10%

w/v ratio added PVP. Shown here is the beginning of larger complexes, when the nanoparticles have just

started to collect.

28

References

1. Doudna, J. A. & Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science (80-. ). 346, (2014).

2. Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167–70 (2010).

3. Wiedenheft, B., Sternberg, S. H. & Doudna, J. A. RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331–8 (2012).

4. Jiang, W., Bikard, D., Cox, D., Zhang, F. & Marraffini, L. A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233–9 (2013).

5. Bortesi, L. & Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol. Adv. 33, 41–52 (2015).

6. Shan, Q. et al. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. Biotechnol. 31, 686–688 (2013).

7. Friedland, A. E. et al. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat. Methods 10, 741–3 (2013).

8. Hwang, W. Y. et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 31, 227–9 (2013).

9. Dickinson, D. J., Ward, J. D., Reiner, D. J. & Goldstein, B. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat. Methods 10, 1028–34 (2013).

10. Gratz, S. J. et al. Genome Engineering of Drosophila with the CRISPR RNA-Guided Cas9 Nuclease. Genetics 194, 1029–1035 (2013).

11. Cho, S. W., Kim, S., Kim, J. M. & Kim, J.-S. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol. 31, 230–2 (2013).

12. Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–23 (2013).

13. Jinek, M. et al. RNA-programmed genome editing in human cells. Elife 2, e00471 (2013).

14. Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823–6 (2013).

15. Nelson, C. E. et al. In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science (80-. ). 351, 403–407 (2016).

16. Long, C. et al. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 351, 400–3 (2016).

17. Tabebordbar, M. et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science (80-. ). 351, 407–411 (2016).

18. Bibikova, M., Beumer, K., Trautman, J. K. & Carroll, D. Enhancing Gene Targeting with Designed Zinc Finger Nucleases. Science (80-. ). 300, 764–764 (2003).

19. Porteus, M. H. & Baltimore, D. Chimeric Nucleases Stimulate Gene Targeting in Human Cells. Science (80-. ). 300, 763–763 (2003).

29

20. Miller, J. C. et al. A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29, 143–148 (2011).

21. Joung, J. K. & Sander, J. D. TALENs: a widely applicable technology for targeted genome editing. Nat. Rev. Mol. Cell Biol. 14, 49–55 (2013).

22. Kelton, W. J., Pesch, T., Matile, S. & Reddy, S. T. Surveying the Delivery Methods of CRISPR/Cas9 for ex vivo Mammalian Cell Engineering. Chim. Int. J. Chem. 70, 439–442 (2016).

23. Kim, S., Kim, D., Cho, S. W., Kim, J. & Kim, J.-S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012–9 (2014).

24. Nishimasu, H. et al. Crystal Structure of Cas9 in Complex with Guide RNA and Target DNA. Cell 156, 935–949 (2014).

25. Esvelt, K. M. et al. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat. Methods 10, 1116–1121 (2013).

26. Davis, A. J. & Chen, D. J. DNA double strand break repair via non-homologous end-joining. Transl. Cancer Res. 2, 130–143 (2013).

27. Li, X. & Heyer, W.-D. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res. 18, 99–113 (2008).

28. Bibikova, M., Golic, M., Golic, K. G. & Carroll, D. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics 161, 1169–75 (2002).

29. Burma, S., Chen, B. P. C. & Chen, D. J. Role of non-homologous end joining (NHEJ) in maintaining genomic integrity. DNA Repair (Amst). 5, 1042–1048 (2006).

30. Cho, S. W. et al. Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res. 24, 132–41 (2014).

31. Qi, L. S. et al. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell 152, 1173–1183 (2013).

32. Bikard, D. et al. Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Res. 41, 7429–7437 (2013).

33. Gilbert, L. A. et al. CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell 154, 442–451 (2013).

34. Zhao, Y. et al. Sequence-specific inhibition of microRNA via CRISPR/CRISPRi system. Sci. Rep. 4, 3943 (2015).

35. Flotte, T. R. Size does matter: overcoming the adeno-associated virus packaging limit. Respir. Res. 1, 16–8 (2000).

36. Mingozzi, F. & High, K. A. Immune responses to AAV vectors: overcoming barriers to successful gene therapy. Blood 122, 23–36 (2013).

37. Armeanu, S. et al. Optimization of Nonviral Gene Transfer of Vascular Smooth Muscle Cells in Vitro and in Vivo. Mol. Ther. 1, 366–375 (2000).

38. Dokka, S., Toledo, D., Shi, X., Castranova, V. & Rojanasakul, Y. Oxygen Radical-Mediated Pulmonary Toxicity Induced by Some Cationic Liposomes. Pharm. Res. 17, 521–525 (2000).

39. Gabriel, R. et al. An unbiased genome-wide analysis of zinc-finger nuclease specificity. Nat.

30

Biotechnol. 29, 816–823 (2011).

40. Gaj, T., Guo, J., Kato, Y., Sirk, S. J. & Barbas, C. F. Targeted gene knockout by direct delivery of zinc-finger nuclease proteins. Nat. Methods 9, 805–807 (2012).

41. Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP Synthase Is a Cytosolic DNA Sensor That Activates the Type I Interferon Pathway. Science (80-. ). 339, 786–791 (2013).

42. Wagner, H. Toll meets bacterial CpG-DNA. Immunity 14, 499–502 (2001).

43. Ishida, K., Gee, P. & Hotta, A. Minimizing off-Target Mutagenesis Risks Caused by Programmable Nucleases. Int. J. Mol. Sci. 16, 24751–71 (2015).

44. Karikó, K. et al. Incorporation of Pseudouridine Into mRNA Yields Superior Nonimmunogenic Vector With Increased Translational Capacity and Biological Stability. Mol. Ther. 16, 1833–1840 (2008).

45. Shen, B. et al. Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell Res. 23, 720–723 (2013).

46. Staahl, B. T. et al. Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat. Biotechnol. (2017). doi:10.1038/nbt.3806

47. Ramakrishna, S. et al. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Res. 24, 1020–7 (2014).

48. Liang, X. et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J. Biotechnol. 208, 44–53 (2015).

49. Lehto, T., Ezzat, K., Wood, M. J. A. & EL Andaloussi, S. Peptides for nucleic acid delivery. Adv. Drug Deliv. Rev. 106, 172–182 (2016).

50. Nakase, I., Tanaka, G. & Futaki, S. Cell-penetrating peptides (CPPs) as a vector for the delivery of siRNAs into cells. Mol. Biosyst. 9, 855 (2013).

51. Regberg, J., Eriksson, J. N. K. & Langel, U. Cell-penetrating peptides: from cell cultures to in vivo applications. Front. Biosci. (Elite Ed). 5, 509–16 (2013).

52. Järver, P. et al. Peptide-mediated Cell and In Vivo Delivery of Antisense Oligonucleotides and siRNA. Mol. Ther. Nucleic Acids 1, e27 (2012).

53. Ezzat, K. et al. PepFect 14, a novel cell-penetrating peptide for oligonucleotide delivery in solution and as solid formulation. Nucleic Acids Res. 39, 5284–98 (2011).

54. Liu, J., Gaj, T., Patterson, J. T., Sirk, S. J. & Barbas III, C. F. Cell-Penetrating Peptide-Mediated Delivery of TALEN Proteins via Bioconjugation for Genome Engineering. PLoS One 9, e85755 (2014).

55. Lehto, T., Ezzat, K., Wood, M. J. A. & EL Andaloussi, S. Peptides for nucleic acid delivery. Adv. Drug Deliv. Rev. 106, 172–182 (2016).

56. El-Sayed, A., Futaki, S. & Harashima, H. Delivery of Macromolecules Using Arginine-Rich Cell-Penetrating Peptides: Ways to Overcome Endosomal Entrapment. AAPS J. 11, 13–22 (2009).

57. Cleal, K., He, L., D. Watson, P. & T. Jones, A. Endocytosis, Intracellular Traffic and Fate of Cell Penetrating Peptide Based Conjugates and Nanoparticles. Curr. Pharm. Des. 19, 2878–2894 (2013).

58. Huang, M. C., Cheong, W. C., Lim, L. S. & Li, M.-H. A simple, high sensitivity mutation

31

screening using Ampligase mediated T7 endonuclease I and Surveyor nuclease with microfluidic capillary electrophoresis. Electrophoresis 33, 788–796 (2012).

www.kth.se

kth-cover4850181369365502625.pdfOskarGustafssonThesis-2.pdfkth-cover4850181369365502625