General and Comparative Endocrinology 138 (2004) 121–127

www.elsevier.com/locate/ygcen

Possible direct induction by estrogen of calcitonin secretion from ultimobranchial cells in the goldWsh

Nobuo Suzuki,a,¤ Kazutoshi Yamamoto,b Yuichi Sasayama,a Tohru Suzuki,c Tadahide Kurokawa,d Akira Kambegawa,e Ajai K. Srivastav,f Shinji Hayashi,g

and Sakaé Kikuyamab

a Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University, Uchiura, Ishikawa 927-0553, Japanb Department of Biology, School of Education, Waseda University, Nishiwaseda 1-6-1, Tokyo 169-8050, Japan

c Laboratory of Bioindustrial Informatics, Graduate School of Agricultural Science, Tohoku University, Sendai, Miyagi 981-8555, Japand National Research Institute of Aquaculture, Nansei, Mie 516-0193, Japan

e Kambegawa Laboratory, Komae, Tokyo 201-0013, Japanf Department of Zoology, University of Gorakhpur, Gorakhpur 273-009, India

g Graduate School of Integrated Science and Faculty of Science, Yokohama City University, Kanagawa 236-0027, Japan

Received 14 April 2004; accepted 24 May 2004Available online 2 July 2004

Abstract

The plasma level of calcitonin (CT), a calcium (Ca)-regulating hormone, is known to increase in female teleosts during the repro-ductive period. In the present study, a correlation between plasma CT and Ca and one between plasma CT and the gonad somaticindex were demonstrated in the female goldWsh but not in the male. To clarify the relationship between CT and Ca, we examined theplasma CT and Ca levels after injecting immature goldWsh with estrogen. At day 1, the plasma CT level signiWcantly increased,whereas the plasma Ca level was not changed from its initial level. This result suggests that the trigger of CT secretion is estrogen andthat estrogen directly acts on the ultimobranchial gland (UBG), a CT-secreting organ. To determine whether the UBG is equippedwith estrogen receptor (ER), an ER binding assay and immunohistochemical staining of UBG cells with an antibody against ERwere conducted. As a result, estrogen-speciWc binding (Kd, 18.52 nM; Bmax, 1.35 pmol/mg protein) and ER-immunoreactivity in theUBG were demonstrated. Furthermore, the expression of �, �, and � types of ER in the UBG was also detected by use of the reverse-transcription polymerase chain reaction. Thus, we concluded that estrogen acts on the UBG to induce the release of CT, which inturn plays an important role in reproduction directly and/or indirectly through Ca. This is the Wrst report on the existence of ERs ina teleost UBG and the occurrence of CT secretion caused by estrogen. 2004 Elsevier Inc. All rights reserved.

Keywords: Calcitonin; Estrogen; Estrogen receptor; Ultimobranchial gland; Calcium; Reproduction; Teleost

1. Introduction

Calcitonin (CT), a 32-amino acid peptide hormone, issecreted from the C-cells of the thyroid glands inmammals and from the ultimobranchial gland (UBG) innon-mammalian species (Azria, 1989). In mammals, thishormone has a hypocalcemic action that can mineralizethe bones by suppressing the activities of osteoclasts(Wimalawansa, 1997). In postmenopausal women, estro-

¤ Corresponding author. Fax: +81-768-74-1644.E-mail address: nobuo@kenroku.kanazawa-u.ac.jp (N. Suzuki).

0016-6480/$ - see front matter 2004 Elsevier Inc. All rights reserved.doi:10.1016/j.ygcen.2004.05.013

gen-replacement therapy is useful for preventing boneloss (Christiansen et al., 1980). In the postmenopausalstate, the concentration of circulating CT is decreased(Shamonki et al., 1980) but is restored by estrogen-replacement therapy (Stevenson et al., 1983). Further-more, Greenberg et al. (1986) demonstrated that estrogenstimulated CT secretion by rat thyroid C-cells in vitro,suggesting that CT-secreting cells are one of the targetsof estrogen.

In teleosts, the roles of CT have not been clariWed inspite of the fact that the UBG contains a large amount ofCT (Dacke, 1979). The injection of CT into teleosts does

122 N. Suzuki et al. / General and Comparative Endocrinology 138 (2004) 121–127

not induce hypocalcemia under normal conditions(Dacke, 1979; Hirano et al., 1981). Interestingly, there areseveral reports suggesting a possible involvement of CT inreproductive function in female teleosts (Yamane andYamada, 1977; Yamane, 1978). The plasma CT level insockeye salmon is higher in females than in males duringthe spawning season (Watts et al., 1975). Also, CT levelsincrease before ovulation in salmonid Wshes (Björnssonet al., 1986; Norberg et al., 1989) and eels (Yamauchiet al., 1978), and UBGs in the females of some teleostspecies are maximally active in the period of sexual matu-ration (Yamane and Yamada, 1977; Yamane, 1978).

In the present experiments, we conWrmed the correla-tion between the plasma CT concentration and thegonad somatic index (GSI) in female goldWsh. Further-more, we demonstrated the presence of estrogen recep-tors in the UBG and obtained evidence that estrogentriggers CT secretion, presumably by acting directly onthe UBG through its estrogen receptor (ER).

2. Materials and methods

2.1. Animals

GoldWsh (Carassius auratus) were purchased from acommercial source (Higashikawa Fish Farm, Nara,Japan). Female (N D 20) and male (N D 18) goldWsh withgonads at various stages of maturation were used toexamine the relationship between CT and GSI. Imma-ture goldWsh (N D 56: 5–7 g body weight) of both sexesand female goldWsh (N D 19: GSI, 7.7 § 0.8%) were usedfor the examination of the eVect of estrogen on CT secre-tion and the detection of ER in the UBG, respectively.All experimental procedures were conducted in accor-dance with the Guide for the Care and Use of Labora-tory Animals prepared by Kanazawa University.

2.2. Relationship between plasma CT and plasma Ca orGSI

GoldWsh were anesthetized with ethyl 3-amino-benzo-ate methanesulfonic acid salt (MS222; Aldrich Chemi-cal, WI, USA). Blood samples were collected from thecaudal vessels of each individual Wsh into a heparinizedsyringe and centrifuged at 25,000g for 10 min at 4 °C.The plasma was immediately frozen and kept at ¡80 °Cuntil use. Thereafter, each goldWsh was dissected, andboth body and gonadal weight were measured to obtainthe GSI (gonadal weight/body weight £ 100) for eachanimal. Plasma CT levels were determined by using asandwich-type enzyme-linked immunosorbent assay(ELISA) (Sasayama et al., 1996). The plasma Ca (totalCa) concentrations were measured by using a microplatereader according to a modiWed version of the Gitelmanmethod (1967).

2.3. Plasma CT and Ca levels in immature goldWsh treatedwith estrogen

Blood samples from 8 goldWsh were taken into hepa-rinized hematocrit capillary tubes from the gill underanesthesia with MS222 prior to the start of the experi-ment (0 h). The remaining Wsh were randomly dividedinto two groups (each N D 24). They received a singleintraperitoneal injection of either estradiol-17� (water-soluble type, Sigma, MO, USA) at the dose of 0.5 �g/g body weight in 20 �l of saline or the same volume ofsaline alone as the control. Blood samples from 8 gold-Wsh in each group were collected after anesthetizationwith MS222 from the gill at days 1, 2, and 4 followingthe treatment. The plasma CT and Ca were measured inthe same way as described above.

2.4. Estrogen-speciWc binding in UBG

Pooled UBGs from 6 female goldWsh were homoge-nized with an all-glass homogenizer in 20 volumes (v/w)of a TEDMG buVer (pH 7.4), consisting of 10 mM Tris–HCl, 1 mM EDTA, 1 mM dithiothreitol, 10 mM sodiummolybdate, and 10% (v/v) glycerol. All subsequent pro-cedures were carried out at 0–4 °C. The homogenate wascentrifuged at 800g for 15 min. The low-speed superna-tant was then centrifuged at 105,000g for 1 h in a HitachiSCP85H ultracentrifuge (Hitachi Koki, Tokyo, Japan)to obtain crude cytosol. The protein concentration of thecytosol was determined by the method of Lowry et al.(1951) with bovine serum albumin used as the proteinstandard. After preincubation for 1 h at 4 °C aliquots(245 �l; 300 �g protein) of cytosol were incubated induplicate with increasing concentrations (0.625–20 nM)of [3H]estradiol-17� (2,4,6,7,16, 17-[3H]estradiol-17�;spec. act., 5.254 TBq/mmol; Dupond/NEN, MA, USA)in the presence or absence of a 100-fold molar excess ofradioinert estradiol-17� (62.5–2000 nM)(Sigma) for 2 hat 25 °C in a total volume of 250�l (estradiol-17� addedin 5 �l of ethanol) to label both occupied and unoccupiedERs according to the method of Katzenellenbogen et al.(1973). At the end of the incubation, an equal volume of60% (v/v) hydroxyapatite (HAP; Bio-Rad, CA, USA)slurry was added to each tube; and the absorption wasthen continued for 15 min with occasional vortexing(Yamamoto et al., 1996). Two milliliters of coldTEDMG buVer was then added to the mixture, and thetubes were centrifuged at 800g for 5 min. The pelletswere washed three times with 2 ml of a TEDMG buVerand extracted with 1 ml of absolute ethanol for 30 min atroom temperature. Three milliliters of scintillation Xuid(Atomlight, Dupond/NEN) was then added to eachextract, and the radioactivity was measured. SpeciWcbinding was obtained by subtracting non-speciWc bind-ing from the total binding. The amount of [3H]estradiol-17� speciWcally bound was plotted according to the

N. Suzuki et al. / General and Comparative Endocrinology 138 (2004) 121–127 123

method of Scatchard (1949), and the dissociationconstant (Kd) and maximum number of binding sites(Bmax) were obtained by using the appropriate computerprograms.

2.5. Immunostaining of ER in UBG

Female goldWsh UBGs were Wxed in Bouin's solutionfor 24 h, dehydrated, embedded in paraYn, and cut at a5-�m thickness. Immunohistochemical staining was per-formed according to the method described previously(Kurokawa et al., 2000). In brief, several sections wereincubated for 15 min with 10 mM Tris–HCl buVer con-taining 0.15 M NaCl (pH 7.6) supplemented with 10%normal goat serum, and were incubated with a rabbitantiserum against rat ER� (diluted 1:5000) (Okamuraet al., 1992) for 3 h at room temperature. Next, the sec-tions were treated with biotinylated goat anti-rabbit IgG(Nichirei HistoWne Kit; Nichirei, Tokyo, Japan) for30 min and subsequently with peroxidase-labeledstreptavidin (Nichirei) for 15 min. Finally, they wereimmersed in a 100-ml solution comprising 20 mg ofdiaminobenzidine (Wako, Osaka, Japan) and 0.015%H2O2 in 0.05 M Tris–HCl buVer (pH 7.6). Neighboringsections were stained with hematoxylin–eosin.

2.6. IdentiWcation of ERs in UBG

Separate total RNA samples were prepared from theUBG and breast muscle from 7 goldWsh by using a totalRNA isolation kit (Nippon Gene, Tokyo, Japan). Thereverse-transcription-polymerase chain reaction (RT-PCR) was performed according to the method describedelsewhere (Suzuki et al., 1997). Gene-speciWc primers forthree subtypes of ERs (Choi and Habibi, 2003; Ma et al.,2000; Tchoudakova et al., 1999) (ER�5�:TATGTACCCTAAGGAGGAGC; ER�3�:TGAGTCTCCACACTCTTCAG; ER�5�:TCAAGATTGCCACAGACTCC;ER�3�:TTGTGTGTCCATCCGGAGAG; ER�5�:TTCTCTGGCAGGATGAGAAC; ER�3�:GCCGAACTCAGACACATGTT) were used for the PCR ampliWca-tion of a cDNA fragment of ER in the present study.The conditions for PCR ampliWcation were 28 cycles ofdenaturation for 0.5 min at 96 °C, annealing for 1 min at56 °C, and extension for 2 min at 72 °C, followed by asingle cycle at 72 °C for 30 min. The PCR conditions forthe ampliWcation of �-actin cDNA with primers(5�:CACTGTGCCCATCTACGAG; 3�:CCATCTCCTGCTCGAAGTC) (Chan et al., 1998) were 20 cycles ofdenaturation for 0.5 min at 96 °C, annealing for 1 min at55 °C, and extension for 2 min at 72 °C, followed by asingle cycle at 72 °C for 15 min. The PCR products wereanalyzed on 3% NuSive GTG agarose gel (FMCBioProducts, ME, USA) and stained with ethidium bro-mide.

2.7. Statistical analysis

Simple correlation coeYcients were calculated toassess the relationship between plasma CT and plasmaCa or GSI. The statistical signiWcance of the correlationwas evaluated by the method of Snedecor and Cochran(1980). The signiWcance of the results was assessed byanalysis of variance (ANOVA) and Duncan's multiplerange test. A P value less than 0.05 was considered sig-niWcant.

3. Results

3.1. Relationship between plasma CT and plasma Ca orGSI

Plasma CT was detected in female (141.0 § 35.5 pg/ml) and male (23.5 § 9.1 pg/ml) goldWsh and the diVer-ence between the sexes was signiWcant (P 0 0.01). Fur-thermore, there was a correlation (r D 0.50, P 0 0.05)between plasma CT and plasma Ca levels in the female(Fig. 1A) but not in the male (Fig. 1B). Plasma Ca levelsin the female (11.3 § 0.6 mg/100 ml) were signiWcantly(P 0 0.05) higher than those in the male (8.9 § 0.3 mg/100 ml). Furthermore, a signiWcant correlation (r D 0.60,P 0 0.01) between CT and GSI was recognized in thefemale goldWsh (Fig. 1C), but not in the male goldWsh(Fig. 1D).

3.2. Changes in plasma CT and Ca levels after estrogentreatment

Prior to the estrogen treatment, the plasma CT levelin the immature goldWsh was 160.0 § 20.1 pg/ml. In thecontrol group, the concentrations were scarcely changed(day 1: 164.9 § 8.6 pg/ml; day 2: 165.7 § 9.7 pg/ml; andday 4: 170.2 § 19.2 pg/ml). On the day following estrogeninjection, however, the plasma CT level increased signiW-cantly (to 615.8 § 109.9 pg/ml,P 0 0.01). The levelreached its maximum at 2 days after the injection(1033.3 §237.5 pg/ml, P 0 0.01), and even 4 days aftertreatment it was still signiWcantly higher (395.8 §55.5 pg/ml, P 0 0.05) than that in the control group(Fig. 2A).

Changes in plasma Ca levels after the treatment withestrogen are indicated in Fig. 2B. Prior to the injection,the plasma Ca concentration was 6.0 § 0.1 mg/100 ml.In the saline-injected group the concentrationremained nearly constant: 6.1 § 0.1 mg/100 ml at day 1,6.2 §0.1 mg/100 ml at day 2, and 6.1 § 0.2 mg/100 ml atday 4. The plasma Ca concentration in the estrogen-injected animals scarcely changed at day 1 (6.3 § 0.1 mg/100 ml) but increased signiWcantly at days 2 (19.3 §2.0 mg/100 ml, P 0 0.01) and 4 (24.7 § 0.5 mg/100 ml,P 0 0.01).

124 N. Suzuki et al. / General and Comparative Endocrinology 138 (2004) 121–127

Fig. 2. Changes in plasma CT (A) and Ca (B) concentrations in immature goldWsh following a single estradiol-17� (E2) injection. The Wsh received asingle intraperitoneal injection (0.5 �g/g body weight) of E2 (water-soluble type) or equal volume of saline. Blood samples were taken from the gill ofeach individual Wsh. The plasma CT and Ca levels were measured as indicated in Fig. 1. Values are the means § SE of 8 Wsh for the control and 8 forthe experimental group. *,** indicate statistically signiWcant diVerence at P 0 0.05 and P 0 0.01, respectively, compared with the values for thecontrol Wsh.

3.3. Estrogen-speciWc binding in UBG

Saturation analysis was performed by incubatingaliquots of cytosol with increasing concentrations

(0.69–20.80 nM) of [3H]estradiol-17� in the presence orabsence of a 100-fold excess of radioinert estradiol-17�,and speciWc binding was calculated (Fig. 3A). Scatchardanalysis of these data revealed that the dissociation

Fig. 1. Relationship between plasma CT and plasma Ca in female (A) and male (B) or the gonad somatic index (GSI) in female (C) and male (D)goldWsh. GoldWsh with gonads at various stages of maturation were used. Blood samples were taken from the caudal vessels of each individual Wsh.Thereafter, each goldWsh was dissected, and the GSI was determined. Plasma CT levels were determined by ELISA (Sasayama et al., 1996). Theplasma Ca concentrations were measured by using a microplate reader according to a modiWed version of the Gitelman method (1967). A signiWcantcorrelation between plasma CT and plasma Ca (P 0 0.05) or GSI (P 0 0.01) was found in the female goldWsh.

N. Suzuki et al. / General and Comparative Endocrinology 138 (2004) 121–127 125

constant (Kd) and the maximum number of binding sites(Bmax) were 18.52 nM and 1.35 pmol/mg protein of cyto-sol, respectively (Fig. 3B).

3.4. Immunostaining of ER in UBG

ER-immunoreactivity was observed in the UBG cellsscattered around the esophagus, with the immunoreac-tivity being conWned to the nuclei (Fig. 4).

3.5. IdentiWcation of ERs in UBG

By use of the RT-PCR method, ER�, �, and �mRNAs were detected in the UBG, with ER� mRNAbeing the main one. No speciWc PCR product wasdetected in the muscle sample, under the present experi-mental conditions, although �-actin mRNA was almostequally expressed in both tissues (Fig. 5). There was noband when reverse transcriptase was omitted from thereaction mixture (data not shown).

Fig. 4. Immunohistochemical staining of goldWsh UBG cells. Twoadjacent sections were stained, one with hematoxylin–eosin (A) andone with antiserum against rat ER� (B). Arrowheads indicate ER-pos-itive nuclei. The bars indicate 50 �m.

4. Discussion

In female teleosts, estrogen enhances the synthesis ofvitellogenin, which is a major component of egg proteinand a Ca-binding protein (Kwon et al., 1993; Tinsley,1985). At the same time, estrogen promotes Ca resorp-tion from the scales by activating osteoclasts (Persson etal., 1995; Suzuki et al., 2000a). Consequently, plasmavitellogenin and Ca levels increase corresponding to theincrease in estrogen level (Norberg et al., 1989). On theother hand, the plasma CT level also increases in femaleteleosts during the reproductive period (Björnsson et al.,1986; Norberg et al., 1989; Watts et al., 1975; Yamauchiet al., 1978). However, it remained obscure whether thetrigger for CT secretion from the UBG is estrogen or theincreased plasma Ca. In the present experiment, weobserved that the plasma CT level in female goldWshincreased in parallel with the GSI value. The plasma Calevel was signiWcantly higher in female than in malegoldWsh and showed a correlation with the plasma CTvalue in the former. Analysis of the early inXuence of theestrogen injection on the plasma CT and Ca levels of the

Fig. 5. PCR ampliWcation of ER�, �, and � mRNAs in the goldWshUBG. ER�, �, and � mRNAs were detected in the UBG but not in themuscle. In both tissues �-actin mRNA was equally detected. PCRproducts of ER�, ER�, ER�, and �-actin cDNA were detected at thepositions of 1735, 327, 554, and 200 bp, respectively.

Fig. 3. Saturation of [3H]estradiol-17� binding (A) and Scatchard analysis of [3H]estradiol-17� binding (B) to the cytosol of female goldWsh UBG.Aliquots (250 �l) of cytosol were incubated with increasing concentrations (0.625–20 nM) of [3H]estradiol-17� (total binding, triangle) and in parallelwith the same concentration of the radioactive estradiol-17� plus a 100-fold excess of radioinert estradiol-17� (non-speciWc binding, square) for 2 h at25 °C. SpeciWc binding (solid circle) was obtained by the subtracting the non-speciWc binding from the total binding. The binding data in (A) were ana-lyzed according to the method of Scatchard (1949). The dissociation constant (Kd) was 18.52 nM; and the receptor density (Bmax), 1.35 pmol/mg protein.

126 N. Suzuki et al. / General and Comparative Endocrinology 138 (2004) 121–127

goldWsh indicated that elevation of CT levels precededthat of Ca by 1 day, thus indicating that Ca does nottrigger CT secretion. Furthermore, we demonstrated theexistence in UBG of estrogen-speciWc binding, ER-immunoreactivity, and ER mRNA. This is the Wrstreport on the presence of ERs in a teleost UBG and theWrst data showing that CT secretion is caused by estro-gen, not by Ca.

In teleosts, 3 types of ERs have been cloned and des-ignated as � (Choi and Habibi, 2003), � (Ma et al., 2000),and � (Tchoudakova et al., 1999). Whereas in mammalsand birds, only ER� and ER� have been identiWed(Hawkins et al., 2000). From phylogenetic analysis, ER�has been considered to have branched from ER� (Haw-kins et al., 2000). The present RT-PCR analysis revealedthat all three subtypes of ER were expressed in the gold-Wsh UBG. According to Choi and Habibi (2003), thesethree subtypes show a high homology among themselvesin their DNA-binding and ligand-binding domains. Inthis experiment, we could not distinguish these ERs byScatchard plot analysis (1949), perhaps due to similarityin their aYnity for estrogen or to the dominant expres-sion of one subtype, presumably ER�. Furthermore,immunohistological study demonstrated the presence ofER-immunoreactivity in the nuclei of UBG cells, indi-cating that ER expresses in the goldWsh UBG.

In mammals, CT is induced by an increase in plasmaCa after the intake of Ca-containing foods, and it regu-lates the plasma Ca level (Azria, 1989). Recently, a cal-cium-sensing receptor (CaSR) in C-cells of themammalian thyroid gland was cloned (Freichel et al.,1996; Garrett et al., 1995). This receptor promotes CTsecretion by monitoring the increase in plasma Ca. Atfood intake, therefore, CT secretion is considered to beinduced via CaSR in mammals. In eels as well as inmammals, we earlier demonstrated that the plasma CTlevel increased with a rise in plasma Ca caused by a die-tary uptake of Ca–consomme solution (Suzuki et al.,1999). In the case of stoneWsh, the plasma Ca levelsincreased (more than 2-fold) after the Wsh had been fed ahigh Ca–consomme solution and then decreased corre-sponding to the increase in plasma CT (Kaida andSasayama, 2003). Recently, a CaSR was cloned from akidney cDNA library prepared from a teleost (gillheadseabream) (Power et al., 2002). Therefore, it is highlyprobable that teleost UBG cells are equipped withCaSRs through which CT secretion is controlled.

In this experiment, we demonstrated that CT levelselevated in response to estrogen. This response wasrather quick and was induced independently of the ele-vation of Ca, which occurred 1 day after the elevation ofthe CT level. Björnsson et al. (1989) observed two peaksof plasma CT after a single injection of estradiol intoimmature coho salmon. The plasma CT level increasedat day 5 and then at days 12–18. At day 12, the increasewas marked. In their experiment, no rapid increase in the

plasma CT level was observed, but this level was ele-vated prior to the elevation of the total Ca level, as in thepresent case. In the female brown trout that attained sex-ual maturity in the wild, the plasma CT level increasedslightly right after the increase in the plasma estrogenconcentration and then increased again immediatelybefore ovulation (Norberg et al., 1989). In this species,the plasma Ca level decreased corresponding to the sec-ond peak of CT (Norberg et al., 1989). Using immaturegoldWsh in a long-term time-course study, we obtainedpreliminary data showing that the plasma Ca levelincreased around day 15 after the injection of estrogenand then decreased corresponding to a second increasein plasma CT around day 30 (data not shown). There-fore, the second CT peak may be caused by the increasedplasma Ca. Similar results were observed in culturedcoho salmon (Björnsson et al., 1989). We previouslyreported that the UBG of the stingray (Dasyatis akajei),a cartilaginous Wsh having neither bone nor osteoclasts,contains a large amount of CT (Suzuki et al., 1995; Takeiet al., 1991) and indicated that the plasma CT levels wereincreased by the administration of estrogen (unpub-lished data). Furthermore, estrogen-speciWc-binding andER mRNA in the stingray UBG were detected by areceptor-binding assay and Northern blot analysis,respectively (Yamamoto et al., 1996). In this case again,it is highly possible that estrogen directly caused CTsecretion by acting on the UBG. In the eel and sockeyesalmon, CT levels are known to elevate at the time closeto ovulation (Norberg et al., 1989; Yamauchi et al.,1978). Analysis of the signiWcance of CT involvement inreproduction in female teleosts is awaited.

In conclusion, secretion of CT may be caused by Caand estrogen. The former secretion contributes to Cahomeostasis, whereas the latter is related to some repro-ductive event(s) such as ovarian maturation in thefemale. In this context, it is of interest to note that CTreceptors are expressed in the ovary of the Xounder(Suzuki et al., 2000b), indicating that CT acts directly onthe ovary.

Acknowledgments

We thank Ms. Y. Fujihiko (Department of Biology,Faculty of Science, University of Toyama) for her assis-tance in this study. This study was supported by a grantfrom the program Grants-in-Aid for Encouragement ofYoung Scientists (B) of the Ministry of Education, Cul-ture, Sports, Science and Technology of Japan to N.S.(No.14740455).

References

Azria, M., 1989. The Calcitonins: Physiology and Pharmacology. Kar-ger, Basel.

N. Suzuki et al. / General and Comparative Endocrinology 138 (2004) 121–127 127

Björnsson, B.Th., Haux, C., Förlin, L., Deftos, L.J., 1986. The involve-ment of calcitonin in the reproductive physiology of the rainbowtrout. J. Endocrinol. 108, 17–23.

Björnsson, B.Th., Haux, C., Bern, H.A., Deftos, L.J., 1989. 17�-Estra-diol increases plasma calcitonin levels in salmonid Wsh. Endocrinol-ogy 125, 1754–1760.

Chan, K.-W., Yu, K.-L., Rivier, J., Chow, B.K.-C., 1998. IdentiWcationand characterization of a receptor from goldWsh speciWc for a tele-ost growth hormone-releasing hormone-like peptide. Neuroendo-crinology 68, 44–56.

Choi, C.Y., Habibi, H.R., 2003. Molecular cloning of estrogen receptor� and expression pattern of estrogen receptor subtypes in male andfemale goldWsh. Mol. Cell. Endocrinol. 204, 169–177.

Christiansen, C., Christensen, M.S., McNair, P., Hagen, C., Stocklund,K.-E., Transbol, I.B., 1980. Prevention of early postmenopausalbone loss: controlled 2-year study in 315 normal females. Eur. J.Clin. Invest. 10, 273–279.

Dacke, C.G., 1979. Calcium Regulation in Sub-Mammalian Verte-brates. Academic Press, London.

Freichel, M., Zink-Lorenz, A., Holloschi, A., Hafner, M., Flockerzi, V.,Raue, F., 1996. Expression of a calcium-sensing receptor in ahuman medullary thyroid carcinoma cell line and its contributionto calcitonin secretion. Endocrinology 137, 3842–3848.

Garrett, J.E., Tamir, H., Kifor, O., Simin, R.T., Rogers, K.V., Mithal,A., Gagel, R.F., Brown, E.M., 1995. Calcitonin-secreting cells of thethyroid express an extracellular calcium receptor gene. Endocrinol-ogy 136, 5202–5211.

Gitelman, H.J., 1967. An improved automated procedure for the determi-nation of calcium in biological specimens. Anal. Biochem. 18, 521–531.

Greenberg, C., Kukreja, S.C., Bowser, E.N., Hargis, G.K., Henderson,W.J., Williams, G.A., 1986. EVects of estradiol and progesterone oncalcitonin secretion. Endocrinology 118, 2594–2598.

Hawkins, M.B., Thornton, J.W., Crews, D., Skipper, J.K., Dotte, A.,Thomas, P., 2000. IdentiWcation of a third distinct estrogen receptorand reclassiWcation of estrogen receptors in teleosts. Proc. Natl.Acad. Sci. USA 97, 10751–10756.

Hirano, T., Hasegawa, S., Yamauchi, H., Orimo, H., 1981. Furtherstudies on the absence of hypocalcemic eVects of eel calcitonin inthe eel, Anguilla japonica. Gen. Comp. Endocrinol. 43, 42–50.

Kaida, N., Sasayama, Y., 2003. Dynamics of plasma Ca and calcitoninlevels in stoneWsh (Inimicus japonicus) administered a high-Ca solu-tion into the stomach. Zool. Sci. 20, 353–356.

Katzenellenbogen, J.A., Johnson Jr., H.J., Carlson, K.E., 1973. Studieson the uterine, cytoplasmic estrogen binding protein. Thermal sta-bility and ligand dissociation rate. An assay of empty and Wlledsites by exchange. Biochemistry 12, 4092–4099.

Kurokawa, T., Suzuki, T., Andoh, T., 2000. Development of cholecys-tokinin and pancreatic polypeptide endocrine systems during thelarval stage of Japanese Xounder, Paralichthys olivaceus. Gen.Comp. Endocrinol. 120, 8–16.

Kwon, H.C., Hayashi, S., Mugiya, Y., 1993. Vitellogenin induction byestradiol-17� in primary hepatocyte culture in the rainbow trout,Oncorhynchus mykiss. Comp. Biochem. Physiol. B 104, 381–386.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Proteinmeasurement with the Folin phenol reagent. J. Biol. Chem. 193,265–275.

Ma, C.H., Dong, K.W., Yu, K.L., 2000. cDNA cloning and expressionof a novel estrogen receptor �-subtype in goldWsh (Carassius aura-tus). Biochim. Biophys. Acta. 1490, 145–152.

Norberg, B., Björnsson, B.Th., Brown, C.L., Wichardt, U.-P., Deftos,L.J., Haux, C., 1989. Changes in plasma vitellogenin, sex steroids, cal-citonin, and thyroid hormones related to sexual maturation in femalebrown trout (Salmo trutta). Gen. Comp. Endocrinol. 75, 316–326.

Okamura, H., Yamamoto, K., Hayashi, S., Kuroiwa, A., Muramatsu,M., 1992. A polyclonal antibody to the rat oestrogen receptorexpressed in Escherichia coli: characterization and application toimmunohistochemistry. J. Endocrinol. 135, 333–341.

Persson, P., Takagi, Y., Björnsson, B.Th., 1995. Tartrate resistant acidphosphatase as a marker for scale resorption in rainbow trout,Oncorhynchus mykiss: eVects of estradiol-17� treatment and refeed-ing. Fish Physiol. Biochem. 14, 329–339.

Power, D.M., Ingleton, P.M., Clark, M.S., 2002. Application of compar-ative genomics in Wsh endocrinology. Int. Rev. Cytol. 221, 149–190.

Sasayama, Y., Abe, I., Suzuki, N., Hayakawa, T., 1996. Plasma calciumand calcitonin levels at food intake in eels and goldWsh. Zool. Sci.13, 731–735.

Scatchard, G., 1949. The attractions of proteins for small moleculesand ions. Ann. N.Y. Acad. Sci. 51, 660–672.

Shamonki, I.M., Frumar, A.M., Tataryn, I.V., Meldrum, D.R., David-son, B.H., Parthemore, J.G., Judd, H.L., Deftos, L.J., 1980. Age-related changes of calcitonin secretion in females. J. Clin. Endocri-nol. Metab. 50, 437–439.

Snedecor, G.W., Cochran, W.G., 1980. Statistical Methods, seventh ed.Iowa State Univ. Press, Ames.

Stevenson, J.C., Abeyasekera, G., Hillyard, C.J., Phang, K.-G., MacIntyre,I., Campbell, S., Lane, G., Townsend, P.T., Young, O., Whitehead,M.I., 1983. Regulation of calcium-regulating hormones by exogenoussex steroids in early postmenopause. Eur. J. Clin. Invest. 13, 481–487.

Suzuki, N., Suzuki, T., Kurokawa, T., 2000a. Suppression of osteoclas-tic activities by calcitonin in the scales of goldWsh (freshwater tele-ost) and nibbler Wsh (seawater teleost). Peptides 21, 115–124.

Suzuki, N., Suzuki, T., Kurokawa, T., 2000b. Cloning of a calcitoningene-related peptide receptor and a novel calcitonin receptor-likereceptor from the gill of Xounder, Paralichthys olivaceus. Gene 244,81–88.

Suzuki, N., Eguchi, C., Hirai, T., Sasayama, Y., 1997. Nucleotidesequences of reptile calcitonins: their high homology to chicken cal-citonin. Zool. Sci. 14, 833–836.

Suzuki, N., Takagi, T., Sasayama, Y., Kambegawa, A., 1995. EVects ofultimobranchialectomy on the mineral balances of the plasma andbile in the stingray (Elasmobranchii). Zool. Sci. 12, 239–242.

Suzuki, N., Suzuki, D., Sasayama, Y., Srivastav, A.K., Kambegawa, A.,Asahina, K., 1999. Plasma calcium and calcitonin levels in eels fed ahigh calcium solution or transferred to seawater. Gen. Comp.Endocrinol. 114, 324–329.

Takei, Y., Takahashi, A., Watanabe, T.X., Nakajima, K., Sakakibara,S., Sasayama, Y., Suzuki, N., Oguro, C., 1991. New calcitonin iso-lated from the ray, Dasyatis akajei. Biol. Bull. 180, 485–488.

Tchoudakova, A., Pathak, S., Callard, G.V., 1999. Molecular cloning ofan estrogen receptor � subtype from the goldWsh, Carassius auratus.Gen. Comp. Endocrinol. 113, 388–400.

Tinsley, D., 1985. A comparison of plasma levels of phosphoprotein,total protein and total calcium as indirect indices of exogenousvitellogenesis in the Crucian carp, Carassius carassius (L.). Comp.Biochem. Physiol. B 80, 913–916.

Watts, E.G., Copp, D.H., Deftos, L.J., 1975. Changes in plasma calcito-nin and calcium during the migration of salmon. Endocrinology 96,214–218.

Wimalawansa, S.J., 1997. Amylin, calcitonin gene-related peptide, cal-citonin, and adrenomedullin: a peptide superfamily. Crit. Rev. Neu-robiol. 11, 167–239.

Yamamoto, K., Suzuki, N., Takahashi, N., Sasayama, Y., Kikuyama,S., 1996. Estrogen receptors in the stingray (Dasyatis akajei) ulti-mobranchial gland. Gen. Comp. Endocrinol. 101, 107–114.

Yamane, S., 1978. Histology and Wne structure of the ultimobranchialgland in zebraWsh, Brachydanio rerio. Bull. Fac. Fish. HokkaidoUniv. 29, 213–221.

Yamane, S., Yamada, J., 1977. Histological changes of the ultimobran-chial gland through the life history of the Masu salmon. Bull. Jap.Soc. Sci. Fish. 43, 375–386.

Yamauchi, H., Orimo, H., Yamauchi, K., Takano, K., Takahashi,H., 1978. Increased calcitonin levels during ovarian develop-ment in the eel, Anguilla japonica. Gen. Comp. Endocrinol. 36,526–529.