Upload
vuongbao
View
218
Download
0
Embed Size (px)
Citation preview
1
RNA Interference
Department of Animal Science
National Chung Hsing University
Pin-Chi Tang
2
RNA processing in eukaryoteSmall RNAMechanism of RNA interferenceApplication of RNAi
Outline
3
The Analysis of Gene Function
Production of transgenic animals
Deletion of gene from genome
RNA interference
Gene targeting
4
The Central dogma of living Cells-1
5
RNA processing in eukaryote
6Biology, 6th ed., 2000
Transcription in Eukaryotes
7
Transcription in Eukaryotes
RNA polymerases needto interact with a varietyinteract with a variety
of proteinsof proteins
RNA polymerasebinding directly tobinding directly to
promoterpromoter sequences
multiplemultiple different RNApolymerases
a singlea single RNApolymerase
EukaryotesProkarytoes
8
Classes of genes transcribed by eukarytoic RNA polymerase
9
Formation of a polymerase IItranscription complex
TBP: TATA binding proteinTAF: TBP-associated factorsD: TFIIDB: TFIIBF: TFIIF
E: TFIIEH: TFIIH
At least 5 TFs are required forinitiation of transcription by RNApolymerase II in reconstituted in vitrosystem
The Cell, 1st ed., 1997
Transcription in eukaryotes
10
Transcription in eukaryotes
The Cell, 1st ed., 1997
Transcription of polymerase III genes
11
Transcription in eukaryotes
The Cell, 1st ed., 1997
Regulation of transcription in eukaryotes
Promoters and enhancersRegulatory proteins
Activators
Eukaryotic repressors
Chromatin structure
DNA methylation
12The Cell, 1st ed., 1997
Transcription in eukaryotes
Processing of rRNA
13The Cell, 1st ed., 1997
Transcription in eukaryotes
Site ofSite of a.aa.a. attachment. attachment
Processing of tRNAin prokaryotes and eukaryotes
14
Processing of tRNA - Modification of bases
Transcription in eukaryotes
The Cell, 1st ed., 1997
15
Transcription in eukaryotes
The Cell, 1st ed., 1997
Processing of eukaryotic mRNAs
Aligns mRNA on the ribosome during translationAligns mRNA on the ribosome during translation
16The Cell, 1st ed., 1997
Transcription in eukaryotes
Formation of the 3’ends of eukaryotic mRNAs
polyadenylationpolyadenylation signalsignal
StabilityStabilityTranslationTranslationRegulationRegulation
17
Transcription in eukaryotes
The Cell, 1st ed., 1997
Splicing of eukaryotic pre-mRNAs
18
Transcription in Eukaryotes
19
Small RNA
20
RNA worldRNA worldbefore the evolution of DNA
The discovery of catalytic RNA molecules
NonNon--proteinprotein--coding RNA molecules havecoding RNA molecules havebeen identifiedbeen identified
Acting aloneActing aloneororwith proteins, such aswith proteins, such as RNPsRNPs
(ribonucleic proteins(ribonucleic proteins))
21
Short interfering RNAs (siRNAs)
Micro RNAs (miRNAs)
regulate gene expressionregulate gene expression
at a postat a post--transcriptional leveltranscriptional level
in a sequencein a sequence--specific mannerspecific manner
22Plant Cell 2:279-289, 1990
A control (parental) V26 flower is
shown along with four different CHS
(chalcone synthase) transgenotes.
Four representative flowers are
shown in a row for each of four
transgenotes, identified at the left
of each row.
Phenotypes of chimeric CHS transgenotes and
variations among flowers on single plants
23Plant Cell 2:279-289, 1990
Heritability and variation among progeny of CHS transgenotesback-crossed to V26 (Parental).
24Plant Cell 2:279-289, 1990
Developmental pattern of expression of endogenous CHS messagesin violet flowers from control plants.
M 15mm 30mm 40mm 53mm 58mm 58mm
25
Developmental pattern of expression of introduced and endogenousCHS messages in white flowers of transgenote218.38.
Plant Cell 2:279-289, 1990
Lane 1: molecular weight marker
Lane 2: the undigested probe
Lane 3: a 40-mm corolla controlRNA
Lanes 4 through 9: contain RNaseprotected RNA fromcorollas of 218.38 flowers15 mm, 30 mm, 40 mm,53 mm, and 58 mm (twosamples) in length,respectively.
Lane 10: is a tRNA negative control
E: the endogenous CHS-protectedfragment at 96 bases
I: the introduced CHS-protectedRNA at 157 bases
P: the radiolabeled probe at 208bases
26
Comparison of steady-state CHSmessage levels in violet and whiteflowers from transgenote 218.41.
Plant Cell 2:279-289, 1990
Lane 1: molecular weight standard
Lanes labeled "2“: RNase protections ofRNA isolated from three separate40-mm-long violet revertantcorollas
Lanes labeled "3“: RNase protections of RNAisolated from three separate 40-mm-long white corollas
E: the position of the protected fragment forthe endogenous CHS transcript
I: the position of the protected fragmentfor the introduced CHS transcript.
27
The phenomenon ofpostpost--transcriptional gene silencingtranscriptional gene silencing
(PTGS)
•PTGS is ubiquitous in both the animal andplant kingdoms
•PTGS is responsible for important biologicalfunctions
•As a tool for the knocking out of geneexpression in the field of functional genomics
28
co-suppressionTomato
Polygalacturonase geneFruit ripening
Tobacco plantTransformed with -1 ,3-glucanase gene
Decrease in mRNA
C. elegansIntroduction of antisense or sense RNA intoembryos
29
Quelling
Neurospora crassa - fungusTransformation of albinoTransformation of albino--1 gene1 gene
Carotene biosynthesis, andintense orange phenotype
expectedexpected
~30 % albinoresultresult
30
Discovery of miRNAs
The first miRNA was discovered in C.elegans by Victor Ambros and his group.
They describe the identification of thefirst miRNA, lin4, and report thesequence complementarily between lin-4and the 3’UTR of the lin-14 mRNA.
>cel-lin-4 MIMAT0000002UCCCUGAGACCUCAAGUGUGA
(Cell,1993. 75, 843-854)
(by Dr. J. F. Lin)
31
Discovery of miRNAs
Lin4
Lin14
Life cycle of C.elegans
Science 1984. 226, 409
Lin4 and Lin14 were identified ina genetic screen for defects inthe temporal control of post-embryonic development.
Disrupt of Lin4 block L1L2
Disrupt of Lin14 promote L1L2
(by Dr. J. F. Lin)
32
Discovery of miRNAs
Lin4 encodes a 22-nucleotide non-coding RNA
Lin4 is partially complementary to 7 conserved sites located in 3’UTR of Lin14
Nature 2004 5:522
33
Gene transfer technology
Potent and unexpected responsesto foreign nucleic acids
The ability of some transgenes tosilence the expression of
homologous loci
34
Discovery of miRNAs
New Insight in Gene regulation
DNA
RNA
Protein
Transcription
Translation
replication Genomic DNA silencing-Methylation
Transcription control-Template recognition (TF and promoter)
RNA half-life (RNA degradation)-PolyA protection-RNA binding protein
Post-transcriptional regulation-microRNA
Protein half-life (Protein degradation)-Ubiquitination-SUMOlation
Protein sortingProtein-Protein Interaction
(by Dr. J. F. Lin)
35Nature 391:806-811, 1998
Effects of mex-3 RNA interference on levels of the endogenous mRNA
a. Negative controlb. Embryos from uninjected parent (showing normal pattern of endogenous mex-3 RNAc. Embryos from a parent injected with purified mex-3B antisense RNAd. Embryos from a parent injected with dsRNA corresponding to mex-3B
36
Microinjection of ds-ntl affects distribution of the endogenous mRNA.Ventral views are shown for the 6 hpf embryos. The other embryos areviewed from the dorsal side with anterior to the left. Arrowheads markequivalent positions of the notochord.
Biochem. Biophysiol. Res. Commun. 263:156-161, 1999
6hpf 10hpf 14hpf
Non-injected
Injected
zebrafish
37Nature 418:244-251, 2002
Double-stranded RNA can be introduced experimentally tosilence target genes interested
38
dsRNA triggers an interferon responseinterferon response
dsRNA
Activation of RPK
Inactivation of EIF2a
Activation of the 2’, 5’oligoadenlyate synthetase
RNase L activation
Non-specific suppression of translation
Apoptosis
39Apoptosis 5:107-114, 2000
Mechanism of PKR-induced apoptosis
(A) PKR activation regulates translational and transcriptional pathwaysresulting in the specific expression of selected proteins that triggeredcell death by engaging with the caspase pathway.
dsRNA responsive protein kinase
40Apoptosis 5:107-114, 2000
Mechanism of PKR-induced apoptosis
(B) Through an unknown mechanism,upon PKR activation, FADD recruitsprocaspase 8, activating it to its activeform, caspase 8 then in turn, activatesdownstream caspases such as caspase 3,6, 7, which cleave multiple targetstriggering cell death. Role of the caspase 9pathway in these events is unknown.
41Nature Cell Biology 2:70-75, 2000
MmGFP dsRNA specifically abrogates the expression of MmGFPin the MmGFP transgenic embryos
transgenic mouse embryos
Injected MmGFP dsRNA
Injected c-mos dsRNA
42Nature Cell Biology 2:70-75, 2000
Injection of E-cadherin dsRNA into the zygote reduce E-cadherinexpression and perturbs the development of injected embryos
Injected MmGFP dsRNA Injected E-cadherin dsRNA
43
Western blot analysis of E-cadherin expression
Nature Cell Biology 2:70-75, 2000
44Development 127:4147-4156, 2000
Effect of Mos and Plat dsRNA on the relativeabundance of Mos and Plat transcripts.
1. Uninjected oocytes2. Oocytes injected with Mos dsRNA at t=20 h3. Oocytes injected with Plat dsRNA at t=20 h4. Oocytes injected with water at t=20 h5. Uninjected oocytes at t=20 h
45Development 127:4147-4156, 2000
1. Oocytes injected with water2. Oocytes injected with sense RNA3. Oocytes injected with antisense RNA4. Oocytes injected with dsRNA5. Uninjected oocytes
Effect of Mos and Plat sense, antisense and dsRNA on therelative abundance of Mos and Plat transcripts.
Injected 106 molecules
Injected 105 molecules
46
Effect of Mos sense, antisense and dsRNA on MAPkinase and MPF activities.
Development 127:4147-4156, 2000
Oocytes were injected with 106 mol., or 105 mol. of either Mos sense, antisenseand dsRNA.
BA
47
Dicer participates in RNAi.
Nature 409:363-366, 2001
Extracts from S2 cells transfected withCasp9 dsRNA or Dicer dsRNA
48
Biogenesis of miRNAs
(Nature 2004 5:522 )
Dorsha/ Dicer: RNase-III enzyme
Exportin5: Ran-GTP dependentcargo transporter
RISC: RNA-induced silencingcomplex
(by Dr. J. F. Lin)
49
Biogenesis of miRNAs
•Transcriptional regulation:–Polymerase II transcription–Three types of miRNA•Intronic miRNAs–Transcriptional regulated with same promoter of its host
gene
•Polycistronic cluster miRNAs–Own promoter
•Intergenic miRNAs–Own promoter
(by Dr. J. F. Lin)
50
Biogenesis of miRNAs•Intronic miRNAs
(http://www.usc.edu/programs/pibbs/site/faculty/ying_s.htm)
(by Dr. J. F. Lin)
51Biochem. Biophy. Res. Comm. 287:1099-1104, 2001
Different constructs affect the effect of RNAi
MosMos inverted repeatinverted repeat
52Biochem. Biophy. Res. Comm. 287:1099-1104, 2001
Different constructs affect the effect of RNAi
53
Genetic and biochemical data indicate apossible two-step mechanism for RNAinterference (RNAi):
an initiation stepinitiation stepan effectoreffector stepstep
How does RNAi work?
54
http://www.nature.com/nrg/journal/v2/n2/animation/nrg0201_110a_swf_MEDIA1.html
Nature Reviews Genetics 2: 110-119, 2001
A model for the mechanism of RNAi
Guide sequences
55
A model for the mechanism of RNAi from siRNA
56Gene Therapy 13:478-486, 2006
miRNA processing and RNAi in mammals.
57
The RNAi pathway.
RISC: RNA induced silencingcomplex
miRNP: RISC-likeribonucleoprotein particles
58
Actions of miRNAs
Precursor miRNA
Dicer
21-23nt miRNA
Inhibit Translation Cleavage of target mRNA Deadenylation of target mRNA
(by Dr. J. F. Lin)
59
A model for the mechanism of RNAi from miRNA
60
Application of RNAi
61
Design of dsRNA triggersAvoidAvoid regions of the mRNA which might bind RNA
regulatory proteins, such as 55’’and 3and 3’’UTRUTR;
Avoid regions close to the start site (<100 nt):between +100 (AUG as +1) to the stop+100 (AUG as +1) to the stop codoncodon.
23 nt, the consensus 55’’--AA[N19]UUAA[N19]UU--33’’.
Sequence of <70% , >30% GC<70% , >30% GC , ideally 50%50%
Avoid highly GAvoid highly G--richrich
End with two 3two 3’’22--deoxythymidinedeoxythymidine residues
Select 33--6 sequences6 sequences per gene
Perform a BLASTBLAST
62
Delivery of dsRNA triggers
TransfectionTransfection reagentsreagents
Retroviral integrationRetroviral integration
TransposonTransposon hoppinghopping
Homologous recombinationHomologous recombination
Random plasmid integrationRandom plasmid integration
FeedingFeeding
63
‧Investigation of gene function
high-throughput genetic screen
‧Potential therapeutic tool
The applications of RNAi
64Nature Biotech. 21:629-630, 2003
RNA silencing pathways.
65Nature Biotech. 21:639-644, 2003
Target sites for HBV transcripts
Schematic of U6 promoterconstructs
Predicted folding of HBVU6no.2
66Nature Biotech. 21:639-644, 2003
HBsAg measurements in medium of shRNA-treated cultured cells
67Cancer Cell 2:17-23, 2002
Potential applications of RNAi in mammalians
68Gene Therapy 13:478-486, 2006
The potential uses of RNAi in ES cells.
69Gene Therapy 13:464-477, 2006
Schematic diagram to illustrate siRNA targets important for tumor-host interaction.siRNA technology can be used to target molecules that are important for tumorangiogenesis, invasion, metastasis and immune evasion.