82
Transcription of DNA to RNA

Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

  • Upload
    others

  • View
    12

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Transcription of DNA to RNA

Page 2: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Prokaryotic(원핵생물) VS Eukaryotic(진핵생물) 차이

Page 3: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

• Two step process described as “DNA makes RNA makes protein”, the first step, transcription(전사), results in synthesis of mRNAs and noncoding RNAs, and the second step, translation(단백질합성), uses the mRNAs to direct synthesis of protein(단백질 합성에는 mRNA의 정보를 이용함)

Page 4: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

RNA transcription(전사)

• Transcription is 5′ to 3′ on a template that is 3′ to 5′. • coding (nontemplate) strand – The DNA strand that

has the same sequence as the mRNA and is related by the genetic code to the protein sequence that it represents.

• RNA polymerase(RNA 중합효소) – An enzyme that synthesizes RNA using a DNA template (formally described as a DNA-dependent RNA polymerase).

One strand of DNA is transcribed into RNA (DNA 한 가닥만 RNA 전사로 사용

됨)

Page 5: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

RNA polymerase enzymes must transcribe genes rather than random pieces of DNA, and must begin transcription near the start of a gene rather than in the middle. (RNA 전사는 특정한 위치에서 시작된다., DNA 는 모두 mRNA 로 전환되는 것은 아니다) Initial binding of an RNA polymerase to a DNA molecule must occur at a specific position, just in front(upstream) of the gene to be transcribed. Positions where transcription should begin are therefore marked by target sequences that are recognized either by the RNA polymerase itself or by a DNA-binding protein which forms a platform to which the RNA polymerase binds(RNA 중합효소가 붙는 지역).

Page 6: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

RNA transcription • promoter – A region of DNA where RNA polymerase binds to

initiate transcription (RNA 중합효소가 첫번째 붙어서 전사를 준비하는 DNA 서열).

• startpoint – The position on DNA corresponding to the first base incorporated into RNA (처음으로 RNA를 만드는 부분).

• terminator – A sequence of DNA that causes RNA polymerase to terminate transcription(RNA 전사가 끝나는 부분).

• transcription unit – The sequence between sites of initiation and termination by RNA polymerase; it may include more than one gene (시작과 끝 사이의 염기서열).

Promoters and terminators define the unit

Page 7: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

RNA transcription

• upstream – Sequences in the opposite direction from expression (RNA가 나오는 반대방향의 DNA 염기서열).

• downstream – Sequences proceeding further in the direction of expression within the transcription unit(RNA가 나오는 방향의 염기서열).

• primary transcript – The original unmodified RNA product corresponding to a transcription unit (RNA 중합효소를 통해 처음으로 생산된 RNA).

Page 8: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

RNA synthesis occurs in the transcription bubble

RNA polymerase surrounds the bubble

RNA polymerase separates the two strands of DNA in a transient “bubble” and uses one strand as a template to direct synthesis of a complementary sequence of RNA(Rna 중합효소는 두가닥의 DNA를 부풀려서 한가닥의 DNA를 주형으로 하여 RNA를 합성한다). The bubble is 12 to 14 bp, and the RNA–DNA

hybrid within the bubble is 8 to 9 bp.

Page 9: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The Transcription Reaction Has Three Stages (시작, 중합, 마침)

• RNA polymerase binds to a promoter site on DNA to form a closed complex.

• RNA polymerase initiates transcription (initiation) after opening the DNA duplex to form a transcription bubble (the open complex).

RNA polymerase catalyzes transcription

Page 10: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The Transcription Reaction Has Three Stages

• During elongation the transcription bubble moves along DNA and the RNA chain is extended in the 5′→3′ direction by adding nucleotides to the 3′ end.(RNA 체인은 5에서 3방향으로 진행되며 3번 OH에 붙는다)

• Transcription stops (termination) and the DNA duplex reforms when RNA polymerase dissociates at a terminator site (RNA 중합은 특이 서열을 갖고 있는 부분에서 종결된다).

Page 11: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Bacterial RNA Polymerase Consists of Multiple Subunits

• holoenzyme – The RNA polymerase form that is competent to initiate transcription. It consists of the five subunits of the core enzyme and σ factor (specificity).

• Bacterial RNA core polymerases are ~400 kD multisubunit complexes with the general

structure α2ββ′.

RNA polymerase has 4 types of subunit

Page 12: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

DNA molecule lies between the β and β’ subunits, within a though on the enclosed surface β’

Page 13: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

RNA Polymerase Holoenzyme Consists of the Core Enzyme and

Sigma Factor

• Bacterial RNA polymerase can be divided into the α2ββ′ core enzyme that catalyzes transcription and the subunit that is required only for initiation.

• Sigma factor changes the DNA-binding properties of RNA polymerase so that its affinity for general DNA is reduced and its affinity for promoters is increased.

Sigma factor controls specificity

Page 14: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The Holoenzyme Goes through Transitions in the Process of Recognizing and Escaping from Promoters

• When RNA polymerase binds to a promoter, it separates the DNA strands to form a transcription bubble and incorporates nucleotides into RNA.

Promoter :a regulatory region of DNA located upstream of a gene, providing a control point for regulated gene transcription

Page 15: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Footprinting Is a High Resolution Method for Characterizing RNA Polymerase–Promoter and

DNA–Protein Interactions in General • The consensus sequences at –35 and –10 provide most of the contact

points for RNA polymerase in the promoter.

• The points of contact lie primarily on one face of the DNA.

• The basal promoter contains a sequence of 7 bases (TATAAAA) called the TATA box

RNA polymerase contacts one face of

DNA

Page 16: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that
Page 17: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Bacterial RNA Polymerase Terminates at Discrete Sites

• There are two classes of terminators: Those recognized solely by RNA polymerase itself without the requirement for any cellular factors are usually referred to as “intrinsic terminators.”

– Others require a cellular protein called rho and are referred to as “rho-dependent terminators.”

Page 18: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Bacterial termination occurs at a discrete site

Page 19: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Bacterial RNA Polymerase Terminates at Discrete Sites

• Intrinsic termination requires recognition of a terminator sequence in DNA that codes for a hairpin structure in the RNA product.

• The signals for termination lie mostly within sequences already transcribed by RNA polymerase, and thus termination relies on scrutiny of the template and/or the RNA product that the polymerase is transcribing.

FIGURE 28: An intrinsic

terminator has two features

Page 20: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Rho terminates

transcription

Rho factor is a protein that binds to nascent RNA and tracks along the RNA to interact with RNA polymerase and release it from the elongation complex. rut – An acronym for rho utilization site, the sequence of RNA that is recognized by the rho termination factor.

Page 21: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Phage T7 RNA Polymerase Is a Useful Model System

• The T7 family of RNA polymerases are single polypeptides with the ability to recognize phage promoters and carry out many of the activities of the multisubunit RNA polymerases.

• Crystal structures of T7 family RNA polymerases with DNA identify the DNA-binding region, the active site, and suggest models for promoter escape.

T7 RNA polymerase has a single subunit

Page 22: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The Cycle of Bacterial Messenger RNA

• Transcription and translation occur simultaneously in bacteria (coupled transcription/translation) as ribosomes begin translating an mRNA before its synthesis has been completed.

• Bacterial mRNA is unstable and has a half-life of only a few minutes.

Page 23: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Trancription - translation - degradation.

Page 24: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The Cycle of Bacterial Messenger RNA

• nascent RNA – A ribonucleotide chain that is still being synthesized, so that its 3' end is paired with DNA where RNA polymerase is elongating.

• monocistronic mRNA – mRNA that encodes one protein.

• A bacterial mRNA may be polycistronic in having several coding regions that represent different genes.

Page 25: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The Cycle of Bacterial Messenger RNA

• 5′ UTR – The region in a mRNA between the start of the message and the first codon.

• 3′ UTR – The region in a mRNA between the termination codon and the end of the message.

• intercistronic region – The distance between the termination codon of one gene and the initiation codon of the next gene.

Bacterial mRNA is polycistronic.

Page 26: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Prokaryotic VS Eukaryotic

Page 27: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Eukaryotic RNA Transcription

More complicated in eukaryotes compared with bacteria, largely because eukaryotes have more sophisticated mechanisms for controlling the expression of individual genes and because many of these control processes operate by regulating the assembly of this transcription initiation complex

Page 28: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Eukaryotic mRNAs must be processed to remove introns from the transcripts of discontinuous genes. Many proteins are also processed, some by cutting into segments and some by post-translational chemical modification (glycosylation). These modifications include addition of chemical groups ranging in size from methyl residues(CH3) to large side chains made up of 5 to 10 sugar.

Page 29: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

mRNA(messenger RNA)

Messenger RNA (mRNA) is a molecule of RNA encoding a chemical "blueprint" for a protein product. mRNA is transcribed from a DNA template, and carries coding information to the sites of protein synthesis: the ribosomes

Page 30: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

• During transcription, RNA polymerase makes a copy of a gene from the DNA to mRNA as needed. This process is similar in eukaryotes and prokaryotes. One notable difference, however, is that prokaryotic RNA polymerase associates with mRNA processing enzymes during transcription so that processing can proceed quickly after the start of transcription. The short-lived, unprocessed or partially processed, product is termed pre-mRNA; once completely processed, it is termed mature mRNA.

Initiation – Elongation -Termination

Page 31: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

In eukaryotes, an additional level of complexity: has alternative promoters that transcription of the gene can begin at two or more different sites. Dystrophin gene: 2.4 Mb and 78 intron. The different promoters are active in different parts of the body, such as the brain, muscle, and the retina, enabling different versions of the dystrophin protein (세포골격단백질) to be made in these various tissues. The biochemical properties of these variants are matched to the needs of the cells in which they are synthesized. Alternative promoters can also generate related versions of a protein at different stages in development, and also can enable a single gene to direct synthesis of two or more proteins at the same time in a single tissue

Page 32: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Eukaryotic initiation involves more proteins and has added complexities Eukaryotic polymerases do not directly recognize their core promoter sequences. The initial contact is made by the protein called transcription factor IID or TFIID Another multisubunit complex, made up of the TATA-binding protein(TBP). -12 TBP associated proteins Forming a platform onto which the remainder of the initiation complex can be assembled

helicase

Page 33: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The RNA polymerase I initiation complex is made up of the polymerase and four additional multisubunit proteins, one of which contains TBP. These proteins locate the core promoter and the upstream control element and hence direct RNA polymerase I to its correct attachment point

TFIIIB provides the common link by making the initial contact with the core component of each promoter and, via its TBP subnuit, providing the platform onto which RNA polymerase III is attached

Page 34: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

mRNA processing: Capping

Capping of the pre-mRNA involves the addition of 7-methylguanosine (m7G) to the 5' end.

1. Regulation of nuclear export. 2. Prevention of degradation by exonucleases. 3. Promotion of translation (see ribosome and translation). 4. Promotion of 5' proximal intron excision.

Page 35: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

The gamma phosphate of the terminal nucleotide is removed, as are the beta and gamma phosphates of the GTP, 5’-5’ bond.

By attachment of a methyl group to nitrogen number 7 of the purine ring, 7 methylguanosine structure called a type 0 cap.

Page 36: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

mRNA processing :Cleavage and Polyadenylation

The pre-mRNA processing at the 3' end of the RNA molecule involves cleavage of its 3' end and then the addition of about 200 adenine residues to form a poly(A) tail. The cleavage and adenylation reactions occur if a polyadenylation signal sequence (5'- AAUAAA-3') is located near the 3' end of the pre-mRNA molecule, which is followed by another sequence, which is usually (5'-CA-3'). The second signal is the site of cleavage. A GU-rich sequence is also usually present further downstream on the pre-mRNA molecule.

Page 37: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

mRNA processing :Splicing

1. Spliceosome formation Splicing is catalyzed by the spliceosome which is a large RNA-protein complex composed of five small nuclear ribonucleoproteins (snRNPs, pronounced'snurps' ).

2. Self-splicing occurs for rare introns that form a ribozyme, performing the functions ofthe spliceosome by RNA alone

Page 38: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

3'OH of a free guanine nucleoside (or one located in the intron) or a nucleotide cofactor (GMP, GDP, GTP) attacks phosphate at the 5' splice site. 3'OH of the 5'exon becomes a nucleophile and the second transesterification results in the joining of the two exons.

Page 39: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

In the 1970s Thomas Cech, at the University of Colorado at Boulder, was studying the excision of introns in a ribosomal RNA gene in Tetrahymena thermophila. While trying to purify the enzyme responsible for splicing reaction, he found that intron could be spliced out in the absence of any added cell extract. As much as they tried, Cech and his colleagues could not identify any protein associated with the splicing reaction

Since Cech's and Altman's discovery, other investigators have discovered other examples of self-cleaving RNA or catalytic RNA molecules. Many ribozymes have either a hairpin – or hammerhead – shaped active center and a unique secondary structure thatallows them to cleave other RNA molecules at specific sequences. It is now possible to make ribozymes that will specifically cleave any RNA molecule. These RNA catalysts may have pharmaceutical applications. For example, a ribozyme has been designed to cleave the RNA of HIV. If such a ribozyme was made by a cell, all incoming virus particles would have their RNA genome cleaved by the ribozyme, which would prevent infection

In 1989, Thomas R. Cech and Sidney Altman won the Nobel Prize in chemistry for their "discovery of catalytic properties of RNA."

Page 40: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Produce mature RNA (messenger RNA) after mRNA processing

5’ cap, 5’ Untranslated region, Coding sequence, 3’ Untranslated region,Poly-A

These regions are transcribed with the coding region and thus are exonic as they are present in the mature mRNA. Several roles in gene expression have been attributed to the untranslated regions, including mRNA stability, mRNA localization, and translational efficiency. The ability of a UTR to perform these functions depends on the sequence of the UTR and can differ between mRNAs. The stability of mRNAs may be controlled by the 5' UTR and/or 3' UTR due to varying affinity for RNA degrading enzymes called ribonucleases and for ancillary proteins that can promote or inhibit RNA degradation. Translational efficiency, including sometimes the complete inhibition of translation, can be controlled by UTRs. Proteins that bind to either the 3' or 5' UTR may affect translation by influencing the ribosome's ability to bind to the mRNA. MicroRNAs bound to the 3' UTR also may affect translational efficiency or mRNA stability. Cytoplasmic localization of mRNA is thought to be a function of the 3' UTR. Proteins that are needed in a particular region of the cell can actually be translated there; in such a case, the 3' UTR may contain sequences that allow the transcript to be localized to this region for translation. Some of the elements contained in untranslated regions form a characteristic secondary structure when transcribed into RNA. These structural mRNA elements are involved in regulating the mRNA. Some, such as the SECIS element, are targets for proteins to bind. One class of mRNA element, the riboswitches, directly bind small molecules, changing their fold to modify levels of transcription or translation. In these cases, the mRNA regulates itself.

5’ UTR and 3 UTR

Page 41: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

Glycosyl hydrolases

WRKY protein

Peroxidase

Heat shock protein 70

RNA-dependent RNA polymerase

Calcium-binding protein

Calmodulin-binding protein

No apical meristem () protein

RNase3-like protein

Myb-like DNA-binding protien

Plastocyanin-like protein

NBS-LRR resistance gene analogue

Glycosyl hydrolases

Seed-storage protease inhibitor

Glycosyl hydrolase

Protein phosphatase 2C

Pathogenesis-related 10-like protein

Page 42: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Reverse Transcription

The enzyme is encoded and used by reverse-transcribing viruses, which use the enzyme during the process of replication. Reverse-transcribing RNA viruses, such as retroviruses, use the enzyme to reverse-transcribe their RNA genomes into DNA, which is then integrated into the host genome and replicated along with it.

Human Immunodeficiency Virus (HIV) and Human T-Lymphotropic virus (HTLV).

Page 43: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

As HIV uses reverse transcriptase to copy its genetic material and generate new viruses (part of a retrovirus proliferation circle), specific drugs have been designed to disrupt the process and thereby suppress its growth. Collectively, these drugs are known as reverse transcriptase inhibitors and include the nucleoside and nucleotide analogues zidovudine (trade name Retrovir), lamivudine (Epivir) and tenofovir (Viread), as well as non-nucleoside inhibitors, such as nevirapine (Viramune).

Page 45: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

cDNA synthesis

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

AAAAAAAA

TTTTTTTT

TTTTTTTT

TTTTTTTT

RT

Glycosyl hydrolases

WRKY protein

Peroxidase

Heat shock protein 70

RNA-dependent RNA polymerase

Calcium-binding protein

Calmodulin-binding protein

No apical meristem () protein

RNase3-like protein

Myb-like DNA-binding protien

Plastocyanin-like protein

NBS-LRR resistance gene analogue

Glycosyl hydrolases

Seed-storage protease inhibitor

Glycosyl hydrolase

Protein phosphatase 2C

Pathogenesis-related 10-like protein

Page 46: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Liver

Page 47: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Soybean Arabidopsis PFAM Fold change

Glyma01g31750.1 At5G49040.1 Dirigent-like protein 27.3 ± 20.0

Glyma15g02490.1 At1G51800.1 LRR stress-induced receptor kinase 21.9 ± 2.6

Glyma10g33710.1 At5G51100.1 Iron/manganese superoxide dismutases 18.2 ± 5.5

Glyma05g38130.1 At4G11650.1 Thaumatin-like protein 15.2 ± 3.1

Glyma03g02470.1 At2G45510.1 Putative cytochrome P450 8.7 ± 3.1

Glyma09g40860.1 At2G34930.1 Cf-2-like LRR resistance gene analogue 8.2 ± 1.1

Glyma06g03830.1 At2G23450.1 Protein tyrosine kinase 7.8 ± 2.6

Glyma09g03250.1 At5G11720.1 Glycosyl hydrolases 7.1 ± 1.1

Glyma06g06530.1 At1G80840.1 WRKY protein 6.7 ± 1.5

Glyma15g13500.1 At2G38380.1 Peroxidase 5.9 ± 1.4

Glyma15g09430.1 At1G16030.1 Heat shock protein 70 5.6 ± 1.4

Glyma02g09470.1 At1G14790.1 RNA-dependent RNA polymerase 5.2 ± 1.2

Glyma04g42280.1 At1G21270.1 Calcium-binding protein 4.7 ± 1.6

Glyma09g31450.1 At1G73805.1 Calmodulin-binding protein 4.7 ± 1.2

Glyma11g18770.1 At5G22380.1 No apical meristem () protein 3.9 ± 1.1

Glyma09g02930.1 At3G03300.1 RNase3-like protein 3.7 ± 0.9

Glyma14g08620.1 At5G42630.1 Myb-like DNA-binding protien 3.5 ± 1.0

Glyma17g12150.1 At5G26330.1 Plastocyanin-like protein 3.2 ± 0.4

Glyma17g36400.1 At4G33300.2 NBS-LRR resistance gene analogue 3.0 ± 0.4

Glyma12g02410.1 At3G57260.1 Glycosyl hydrolases 2.7 ± 0.5

Glyma05g09160.1 At3G18280.1 Seed-storage protease inhibitor 2.4 ± 0.1

Glyma11g04210.1 At4G17090.1 Glycosyl hydrolase -2.2 ± 0.1

Glyma05g23870.1 At2G35350.1 Protein phosphatase 2C -2.2 ± 0.2

Glyma15g42970.1 At1G70890.1 Pathogenesis-related 10-like protein -2.3 ± 0.1

Page 48: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Soybean Microarrays

• Microarray

construction

An Introduction

By Steve Clough

November 2005

Page 49: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

cDNA: spotted collection of PCR products from different

cDNA clones, each representing a different gene

Oligo: spot collections of oligos, usually 50-70 bp long

Common Microarray platforms

that span known/predicted ORFs. May have

one or more oligos representing each gene.

Affy: Affymetrix gene chips, 25 bp oligos

11 per gene predicted to span ORF

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 50: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Soybean cDNA Microarrays

• Microarray

construction Produced in the lab of

Dr. Lila Vodkin, U of Illinois

[email protected]

Page 51: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

AAAAAAAA

cDNA Library Synthesis (represents expressed genes)

T T T T T T T T AAAAAAAA

cDNA synthesis T T T T T T T T

AAAAAAA

Clone cDNA into vector

AAAAAAAAAAAAAA

AAAAAAAAAA

AAAAAAAA

extract RNA from

variety of tissues and conditions

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 52: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

T T T T T T T T AAAAAAA

cDNA clone

T T T T T T T T AAAAAAA

Sequence cDNA

GCTCTAAGTCATCGTACTAGATCT

= protein kinase

Compare EST sequence to database to identify

Eliminate duplicates to generate set of unique clones

T T T T T T T T AAAAAAA

PCR amplify insert of unique clone set

Pipette PCR products into microtiter plates to print onto slides

A

C T G

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 53: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Printing microarrays – picking up PCR samples

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 54: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Printing PCR products on glass slides

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 55: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Pin Washing Between PCR Samples

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 56: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

TT

CT

AG

TA

CA

TT

CT

AG

TA

CA

TT

CT

AG

TA

CA

ACG

TG

TCCA

A

ACG

TG

TCCA

A

ACG

TG

TCCA

A

CA

AG

AG

AT

ACCG

CA

AG

AG

AT

ACCG

CA

AG

AG

AT

ACCG

Typically 10-25,000 spots are printed on a standard 1” x 3” microscope slide

Spots of single-stranded DNA adhered to glass surface

Note: DNA does not bind well to glass so glass is specially coated to allow ionic binding (poly-lysine slides) or covalent binding (amine or aldehyde slides)

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 57: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Fluorescently label cDNA from tissue of interest to hybridize to spots on the slide

AAAAAAAAAAAAAA

AAAAAAAAAA

AAAAAAAA

TTTTTTTTT

TTTTTTTTT

TTTTTTTTT

cDNA synthesis and fluorescent labelling

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 58: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Labelling with Reverse Transcriptase

RNAse

mRNA5? 3?

AAAAAAAA

dTTTTTTTRT

dATPdCTPdGTP

dTTP

dUTP

AAAAAAAART

3?5?mRNAcDNA TTTTTTT

3? 5?

TTTTTTT3? 5?cDNA

Direct labelling with Reverse Transcriptase

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 59: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Indirect labelling with aa-dUTP and Reverse Transcriptase

AAAAAAAAAAAAAA

aa-dUTP

dTTP dGTP

dATP

dCTP RT

dTTTTTTTT

AAAAAAAAAA

* * TTTTTTTTT

* * * * *

* *

*

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 60: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Indirect labelling with Klenow

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 61: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Hybridization Chamber

Flourescently labelled sample is pipetted under the coverslip and allowed to hybridize to spots on slide

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 62: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Hybridization in Water Bath

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 63: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Washing After Hybridization

1X SSC 0. 2 % SDS

0.2X SSC 0.2% SDS

0.1X SSC Spin dry 2 minute 500 rpm

1 2 3

15 minutes with shaking for each

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 64: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Scan on a Fluorescent Scanner

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 65: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Theory: Spot A will fluoresce 3 times brighter than Spot B

ACG

TG

TCCA

A

ACG

TG

TCCA

A

AC

GT

GT

CCA

A

TG

CA

CA

GG

TT

*

Spot Gene B

TT

CT

AG

TA

CA

TT

CT

AG

TA

CA

TT

CT

AG

TA

CA

AA

GA

TCA

TG

T*

Spot Gene A

AA

GA

TCA

TG

T*

AA

GA

TCA

TG

T*

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 66: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

+

+

+

+

+

+

+

+ + +

+ + + + +

+ + + +

+

+

+

+ + + +

+

+

+

+ + + + + + + +

+ + + + + + + + + +

+ + + + +

+ + +

+ + + + + + +

+ + + + + +

+

+ + + + + + +

+ +

+ + +

+ +

+ + + +

DNA DNA DNA DNA +

Blocking slides to reduce background.

Example, positively charged amine sli

des.

Wash with SDS to block charges and to remove excess DNA.

Then place in hot water to generate single strands.

Repeat SDS wash.

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 67: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

False Coloring of Fluorescent Signal

Scale of increasing fluorescent intensities

Stronger signal (16 bit image)

2 65,536

2 1

2 16

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 68: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

mRNA Fluorescent cDNA

PFK1

UNK

UNK

DND1

CRC1

XPR1

EPS2

PRP1

UNK

UNK

CHS1

PHC1

Labelled representation of all recently expressed genes Fluorescent intensity of spot is proportional to expression level Hybridized to array of individual spots of different genes

Principles behind gene expression analysis

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 69: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Fluorescent intensities from quality data (Background ~80)

115 126 826 730

50,580 53,485 45,239 49,334

15,916 15,986 7,327 7,577

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 70: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

12,605 12,338 4,455 4,560

5,989 6,427 4,552 3,824

1,262 1,233 19,990 22,899

Fluorescent intensities from quality data (Background ~80)

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 71: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

GSI Lumonics

2 dyes with well separated emission spectra allow direct comparison of two biological samples on same slide

Page 72: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Cells from condition A Cells from condition B

mRNA

Label Dye 1 Label Dye 2

Ratio of Expression of Genes from Two Sources

cDNA

equal higher in A higher in B Steve Clough, USDA-ARS University of Illinois, Urbana

Page 73: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Cy3 Scan Cy5 Scan Overlay

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 74: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Example: Cy3 scan of Uninoculated control

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 75: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Example: Cy5 scan of Pathogen inoculated sample

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 76: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Composite image of Inoculated vs control

CHS control gene often induced by pathogens

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 77: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Use software such as GenePix to extract data from image

1. Locate spots, define spot area, collect data from pixels within spots

2. Flags bad spots (ex: dust in spot) 3. Calculates ratio Cy5 fluorescent intensity over Cy3 intensity for each spot 4. Produces tab-delineated tables for import to analysis programs

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 78: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Value of pixels within spot equals the raw data. Software will give pixel value related to fluorescence from both Cy3 and Cy5 scans

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 79: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Quick view of expression results per slide can be seen

by examining scatter plots of Cy5/3 intensity ratios per

spot

6 hr 18 hr 48 hr 0 hr

Cy5

Cy3 Cy3 Cy3 Cy3

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 80: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Oligo-based Microarrays

every ORF

Design

oligos for specific

Spotted Microarray

Synthesize with 5’-amino linker

Design one to multiple oligos/ORF

Collect in 384-well plates

Spot on aldehyde coated slides

Affymetrix Gene Chips

Spotted oligo termed the ‘probe’

Synthesize oligo directly on chip

Proprietary photolithography synthesis

11 oligo/ORF plus mismatches

Perfect match oligos

1-base mismatch oligos

Steve Clough, USDA-ARS University of Illinois, Urbana

Page 81: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

GeneChip® Probe Arrays

11 µm

Millions of copies of a specific oligonucleotide probe

Image of Hybridized Probe Array

> 1,200,000 different complementary probes

Single stranded, labeled RNA target

Oligonucleotide probe

* *

* *

*

1.28cm

GeneChip Probe Array Hybridized Probe Cell

Courtesy of Mike Lelivelt

Page 82: Transcription of DNA to RNA - KOCWcontents.kocw.net/KOCW/document/2015/chungnam/... · 2016-09-09 · RNA transcription(전사) • Transcription is 5′ to 3′ on a template that

Cloning Virus and mRNA Gene