TitleStudies on the Effects of a Bacterial Probiotic on RuminalComponents and Cellular Immune Function in Holstein Calves(本文(Fulltext) )

Author(s) Abdul Qadir Qadis

Report No.(DoctoralDegree) 博士(獣医学) 甲第430号

Issue Date 2014-09-24

Type 博士論文

Version ETD

URL http://hdl.handle.net/20.500.12099/50400

※この資料の著作権は、各資料の著者・学協会・出版社等に帰属します。

Studies on the Effects of a Bacterial Probiotic on Ruminal

Components and Cellular Immune Function in Holstein Calves

（ホルスタイン種子牛の第一胃性状と細胞性免疫機能に対する生菌製剤の影響に関する研究）

2014

The United Graduated School of Veterinary Science, Gifu University

(Iwate University)

Abdul Qadir Qadis

i

Table of Contents

Contents ………..…………………………….………………….…..………..…….i

Abbreviation …..............................................................................................iv

General Introduction

Characterization of Probiotics …...................................................................1

History of Probiotics …..………………………….…………………………...3

Safety Aspects of Probiotics …………………………..…...........……..…….5

Probiotic Use in Ruminants…….......……………………………………….…...7

Characterization of Ruminants …………………..……..…...…….……….7

Effects of Probiotic on Ruminal Performance and Bacteria……………. 9

Probiotics and Host Immune System………………………………..…….…..10

Immune Stimulatory Mechanism of Bacterial Probiotics.....................11

Probiotics and Calf Sscouring Therapeutic ………………………………13

Figures and Tables ………………………..………………………..……………16

Objectives ……………………………..……………………...................……….21

Chapter I. Study on the Effects of a Bacterial Probiotic on Ruminal

pH, Volatile Fatty Acids and Bacterial Flora of Holstein Calves

Introduction…………………………………………………………..………...…22

Materials and Methods ………………………………………………..….….…24

Animals and Treatment ………..……………………………….……..……24

Ruminal pH Measurement …………………………………….…….……..25

Ruminal Fluid Sampling and VFA, Lactic Acid and NH3-N Assays ...26

Ruminal Bacteria Assay ………………….……..…………………….........27

ii

Statistical Analysis ………………………………….……………………....28

Results ………………………………………………………………..…………...29

Ruminal pH ………..………………...……………………………...……......29

Ruminal VFA, Lactic Acid and NH3-N …………….....………...……......30

Ruminal Bacteria …………………………..……………………..…………31

Discussion………………………………………….………………...………….…31

Figures and Tables …………………….…………………………………………37

Chapter II. Study on the Effects of a Bacterial Probiotic on

Subpopulations of Peripheral Leukocytes and Their Cytokine mRNA

Expression in Weaned Holstein calves

Introduction……………………………………………………………................47

Materials and Methods …………………………………...………………….....49

Animals and Treatment ………………..…………….……………………..49

Blood Collection and PBMC Isolation …..…………….…………………..50

Flow cytometry Assay …………………………….…….……………….…..51

Total RNA Extraction from Leukocytes and cDNA Synthesis …….…..51

Real-time PCR Assay ………………………………………..……...…….…52

Statistical Analysis …………………………………….…………..………..52

Results ……………………………………………………………..……………...53

Subpopulations of Peripheral Leukocytes and Blood Biochemistry ….53

Messenger RNA Expression of Cytokines ……………………………......54

Discussion……………………………………………..………………………......54

Figures and Tables ……………………..…….………………………………….60

iii

Chapter III. Study on the Effects of a Bacterial Probiotic on

Subpopulations of Peripheral Leukocytes and Their Cytokine mRNA

Expression Levels in Scouring Holstein Calves

Introduction…………………..……………………………………………….…..67

Materials and Methods……………………………..………….………………..69

Animals and Treatment ………………………..……………….…………..69

Blood Collection and PBMC Isolation …………….……………….…..….70

Flow cytometry Assay ………………………………….………..…...……..71

Total RNA Extraction from Leukocytes and cDNA Synthesis ……..…71

Real-time PCR Assay ………………………...…………………...…………72

Stool Assay………………………………...………………………..………....72

Statistical Analysis ………….……………………………….………...……73

Results………………………………..……………………………….…..……….74

Subpopulations of Peripheral Leukocytes and Blood Biochemistry …74

Messenger RNA Expression of Cytokines ………………..……...……….76

Discussion……………………………………………………………...….……….76

Figures and Tables ………………………………………………….……………82

Summary and Conclusions ………………………..…………………..…….....90

References ………………………………….………………………...…………...97

Acknowledgments …………………………..………………………….....……118

iv

Abbreviations

ALB…………………………………………………………………. albumin blood

APC……………………………………………….……… antigen presenting cell

BUN……………………………………………………………blood urea nitrogen

BW…......……………………………..………………………………...body weight

CFU.....……………………………….………...….….……. colony forming units

CD…………………………………………..….........………cluster of designation

CP………………………………………………….…………………. crude protein

DC ………………………………….……………………………….....dendritic cell

DM ……………………………….…..…………………………………. dry matter

DNA …………………………..……………….…………... deoxyribonucleic acid

DFM… ………………………………….…………………..direct-feed microbials

EDTA ….…………………………....…………ethylenediaminetetraacetic acid

FACS ……………….………………….…… fluorescence activated cell sorter

FITC ….................................................................. fluorescein isothiocyanate

GALT ….……………………………………….. gut-associated lymphoid tissue

GIT……….……………………………………..…. ……….gastrointestinal tract

Glu………….………………………………………………………………... glucose

IECs………….…………………………………….….... intestinal epithelial cells

IL………….………………………………………….…..……………… interleukin

INF-γ…….…………………………………………….…………interferon-gamma

LA…….…………………………………………………………..………. lactic acid

LAB…….…………………………………………….………... lactic acid bacteria

v

LBP…….…………………………….…….. lipopolysaccharide-binding protein

LPS………………….……………………….………………... lipopolysaccharide

MAMPs...…………………….. microorganism-associated molecular patterns

mRNA…………………….…………………………..messenger ribonucleic acid

NEFA..………………………………….……………… non-esterified fatty acids

NH3-N………………………………….……………………….ammonia-nitrogen

NDF……….……………………………………………….neutral detergent fiber

NFC……….……………………………...……………… non- fiber carbohydrate

PCR….……………………………………..………….polymerase chain reaction

PBMC…………………………………..……peripheral blood mononuclear cell

PBS ……………….…………………..……………….phosphate-buffered saline

PE (or RPE)………………………………………………………R-phycoerythrin

sTP…..……………………………………………...………… serum total protein

T-chol……………………………………….………………………total cholesterol

TCR………………………….………………...…...……………….. T-cell receptor

TNF-α ……………….……………………………....tumor necrosis factor-alpha

TLR…………..………………….…………………………………toll like receptor

T-RFLP…………….…..terminal-restriction-fragment length polymorphism

VFA……………………………………………………………....volatile fatty acid

WBC……………………….………………………………………..white blood cell

WC1…………………….……………………………………... workshop cluster 1

1

General Introduction

Characterization of Probiotics

Probiotics are live microbial components of bacteria or yeast that have

beneficial effects on human and animal health [1, 15, 28, 44, 55, 142]. The term

“probiotic” comes from the Greek words "pro" meaning "in favor", and "biotic"

meaning "life" [16]. The most common formulation of probiotics is as fresh

fermentation products or dried bacterial supplements [60], although the definition

of probiotics is constantly evolving. The World Health Organization (WHO) has

defined probiotics as "live microorganisms which, when administered in adequate

amounts, confer a health benefit on the host" [30]. Furthermore, the WHO has

restricted the use of the term probiotics to refer to products that consist of one or a

few well-defined microorganism strains [30]. In feed regulation, probiotics are

included in the group of feed additives for stabilization of the microbial

communities of the gastrointestinal tract (GIT) in monogastric and ruminant

animals. Probiotics are also known as digestive bioregulators or direct-fed

microbials (DFM) when they are directly ingested by chickens and ruminants [44,

91]. Bacterial probiotics (BPs) are the most frequently used type of probiotic by

humans and food animals. The most commonly used BP type is a carbohydrate-

utilizing taxon, including lactic acid-producing bacteria (LAB), especially of the

genera Lactobacillus and Bifidobacterium [28, 55, 71, 101, 115]. However, other

bacterial genera, including Enterococcus, Clostridia, and Escherichia, are also

used in BP products for animals [15, 39, 92]. The most commonly used genera of

BPs are shown in Table 1. Saccharomyces boulardii and S. cerevisiae are the most

2

commonly used yeast probiotic strains for food animals [5, 28, 96]. Protexin, SCD-

Probiotic®, Provita, and Miyarisan Ltd. are the most popular companies that

perform research and supply probiotic products for animal use globally. The best-

known examples of BP supplements in the market are supplied as single- or

multi-strain products. The product BOVACTIN®, consisting of three species of

Gram-positive bacteria (Lactobacillus plantarum strain 220, Enterococcus faecium

strain 26, and Clostridium butyricum strain Miyari), is a good example of a multi-

strain BP product that is commonly used in food animals, and is the most

recognized BP in Japan.

The beneficial effects of most BPs are derived from their origin in the normal

GIT microbiota of animals. However, oral administration of a high number of such

microbial elements has been shown to reinforce the various lines of intestinal

defense, immune exclusion, immune elimination, and immune regulation in

human and animal hosts. Recently, some probiotics have been supplemented with

prebiotics, which together are known as synbiotics [81]. The characteristics of the

GIT normal microbiota, probiotics, prebiotics, and synbiotics are provided in Table

2. The dosage of probiotics used for food animals differs among the various

microbial products; however, in farm animals a universal unit of DFM is defined

as weight units per tonne of compound feed [30]. The content of the BP

microorganisms is given in colony forming units (CFU) per gram (CFU/g) [102,

118]. In summary, the term probiotic refers to those oral microbial supplements

that promote the health and stimulate the growth of their hosts.

3

History of Probiotics

The history of probiotics is longer than that of the use of antibiotics. Since

prebiblical times BPs have been used by humans primarily in the form of

fermented milk products [14, 101, 133]. The first recorded observation of the

beneficial effects of BPs was by a Russian scientist, Elie Metchnikoff, who worked

at the Pasteur Institute [30, 101]. At the beginning of the 20th century,

Metchnikoff suggested that it would be possible to modify the GIT microbiota, and

to replace harmful microbes with useful microbes [83]. The earliest scientific

report on BPs dates back to 1907, when Metchnikoff reported a correlation

between the ingestion of LAB in yoghurt and enhanced longevity of the consumers

[133]. Metchnikoff hypothesized that BPs might be responsible for countering the

toxic effects of some proteolytic bacteria, such as Clostridia, and suggested the

interaction between BPs and the host’s normal GIT microbiota [83]. For example,

he noted that milk fermented with LAB inhibited the growth of proteolytic

bacteria because of the low pH produced by the fermentation of lactose.

Metchnikoff proposed that the consumption of fermented milk would improve the

function of the host’s intestines due to the effects of harmless LAB [83]. Japanese

scientist Minoru Shirota was inspired to begin investigating a causal relationship

between BPs and good intestinal health, which eventually led to the worldwide

marketing of Kefir (yoghurt package) and other fermented milk drinks as the first

commercial fresh probiotic products [21].

Scientific research on BPs has increased over the last several decades. In the

1920's Cheplin suggested that the term "probiotic" originally referred to

4

microorganisms that have effects on other microorganisms [14]. In the 1930s,

Rettger reported that the concept of probiotics involved the notion that substances

secreted by one microorganism stimulated the growth of another microorganism

[101]. The term probiotics was taken up by Fuller in 1974, who defined the

concept as “organisms and substances that have a beneficial effect on the host

animal by contributing to its intestinal microbial balance”. This definition was

greatly improved by Fuller in 1989 [36], and his explanation was very close to the

definition used today [30]. In 1989, Fuller described probiotics as a "live microbial

feed supplement which beneficially affects the host animal by improving its

intestinal microbial balance". He stressed two important aspects of probiotics: the

viable nature of probiotics, and the capacity to enhance the balance of the GIT

microbiota [36].

By the 1980s, researchers from around the world were coordinating their

efforts in an attempt to elucidate the mechanisms of LAB probiotics as feed

supplements in human, cattle, and other animals. However, the use of LAB as

feed supplements extends back to times when humans consumed fermented milk.

Metchnikoff performed the earliest scientific report on LAB when he isolated a

Lactobacillus strain that he called the 'Bulgarian bacillus' from soured milk [118].

This organism was originally known as Lactobacillus bulgaricus, but is now called

L. delbrueckii subsp. bulgaricus, which is one of the organisms used to ferment

milk and produce yoghurt [101]. After Metchnikoff, other scientists suggested the

use of L. acidophilus, and many LAB trials were conducted using it as a BP [36].

Interest in the studies of gut microbiota in the late 1940s encouraged research and

5

development. More recent research demonstrated that LABs are not the only BP a

wide range of organisms were studied and later used in BP products.

Bifidobacteria, which are a commonly used BP, were first isolated from a breast-

fed infant by Henry Tissier [21, 114]. The isolated bacterium Bacillus bifidus

communis was later reassigned to the genus Bifidobacterium [1, 114]. Tissier

found that bifidobacteria are dominant in the GIT microbiota, and he observed

clinical benefits from their use in treatment of diarrhea in infants [21]. Following

the discovery of antibiotics after World War II, the popularity of BPs decreased.

However, they were used to reestablish the intestinal microbiota following

aggressive antibiotic treatment in human and animals. Over time, the increased

interest in the use of probiotics has identified their beneficial effect on the GIT

microbiota, with the prerequisite that probiotics are to be effective and safe.

Safety Aspects of Probiotics

The administration of large numbers of microbial agents in a probiotic dose

requires the assurance of safety. Therefore, important selection criteria exist for

all probiotics that are intended for human consumption, whether ingested directly

through dietary supplements or indirectly through probiotic use in production

animals [5, 102, 139, 140]. The most important safety concern for BPs is antibiotic

resistance. One of the reasons for interest in the use of BPs is the concern of the

general public and scientific community about the widespread use of antibiotics

and the possibility of transfer of antibiotic resistance to pathogenic bacteria. For

that reason, the use of antibiotics for non-therapeutic purposes is banned in most

countries [30, 102]. It is therefore imperative to identify safe alternatives to

6

antibiotics. Probiotics have been established as an excellent alternative, especially

for use in food animals [92]. In contrast to antibiotics, probiotics are defined as

useful biological factors that are specifically safe for consumers [30]. It is

important that probiotic strains should be of animal origin because they are more

likely to become established in the intestinal tract, and thus have greater probiotic

effects [1, 12]. Although this is an important aspect, no firm guidelines exist for

probiotic safety when the microbe originates from an animal source [28]. However,

the safety assessment of BPs should include studies of the risk of microbial

infectivity and basic toxicology, including the development of deleterious

metabolites in the intestine and the degradation of the intestinal mucosa [30]. In

addition, epidemiological data and evidence of environmental safety should be

provided [30].

The probiotics used in ruminant feed, including bacteria and yeasts, are

strictly regulated within international legislative frameworks by the FAO and

WHO. The requirements for a novel probiotic product are similar among the

regulations for animal feed additives in most developed countries [30]. The risks of

genetic translocation result in specific safety requirements for microbes used in

oral probiotic therapy. LAB and bifidobacteria have rarely caused disease through

translocation, and their safety records are good [14, 139]. Their natural presence

on the mucosal surfaces of all animals also attests to their safety. The use of

inactivated bacteria as new BPs has been proposed [30, 140], partly because their

consumption appears to be safer than viable bacteria. Overall, the influence, long-

term effects, and safety of traditional and new probiotics on the resident GIT

7

microbiota of the hosts, and their metabolic activity and safety issues should be

characterized in well-defined surveillance studies, especially for BPs being used in

food animals.

Probiotic Use in Ruminants

For a clear understanding of the usefulness of probiotics in ruminants, we

should first start with the characterization of ruminant animals.

Characterization of Ruminants

Ruminant animals are characterized by four stomachs, and include cattle,

sheep, and goats. These animals depend principally on the microbial degradation

of their feed in the rumen [18, 19, 23], and the rumen microorganisms play a key

role in the food intake of these animals [107, 123]. In the rumen, three main

categories of living organism—bacteria, protozoa, and fungi—are present at

concentrations of 1011 CFU/ml, 106 CFU/ml, and 103–104 zoospores/ml rumen fluid,

respectively [7, 32, 127, 143]. The rumen is the key compartment for the

breakdown of plant and grain structures to produce energy in the form of volatile

fatty acids (VFA: acetate, propionate, butyrate) and other organic acids, such as

lactic acid (LA) [48, 124, 125]. Protein degradation into amino acids produces

quantities of ammonia (NH3) in the rumen, which is the primary source of

nitrogen for rumen microbial proteosynthesis [23, 106, 108]. In particular,

cellulolytic bacteria use ammonia as their principal source of nitrogen. These

bacteria allow ruminants, in contrast to monogastric animals, to use feed

components such as plant cell wall polymers [43]. Therefore, the rumen can be

8

considered a fermentation chamber, and it uses approximately 50–85% of the dry

matter from the food of ruminants [7, 19]. A newborn ruminant (calf) has only

developed an abomasum, because after birth the types of food ingested are liquids,

such as milk [45, 47, 69]. Usually a calf becomes a ruminant after fiber feeding

begins (age 8–12 weeks) [2, 19]. Rumen development is associated with the

distention of organs due to fiber intake and the appropriate placement of rumen

microbiota [7, 45, 146].

Rumen microbes are eventually digested in the small intestine and thereby

contribute to the protein supply of the ruminant [107]. Factors that result in

changes and a subsequent decrease in the activity of ruminal microorganisms,

such as a sudden change in feeding strategy, cause a decrease in the ruminal

microbiota and directly affects ruminal function and animal productivity. A

decrease in the rumen microbiota can be caused by antibiotic use as well as

environmental changes [127, 129, 143]. It is well understood that changes in

ruminal pH have a particular effect on the equilibrium of the ruminal microbiota

[18, 23]. High levels of grain feeding result in reduced ruminal pH values;

however, the saliva mixed with food plays an important role in the rumen

buffering system through pH control [10, 106, 108]. Due to intense microbial

activity, fermentation of feedstuffs in the reticulo-rumen produces a wide range of

organic acids. Some of these acids can accumulate and reduce ruminal pH if

rumen buffering systems are unable to counteract their impact [106]. Prolonged

periods of low ruminal pH levels can negatively affect feed intake, microbial

metabolism, and nutrient degradation, leading to ruminal acidosis, which results

9

in large financial losses and is a major concern for animal welfare reasons [32, 87,

91, 107]. Thus, ruminal pH regulation is a key determinant in the maintenance of

optimal rumen function.

Effects of Probiotics on Ruminal Performance and Bacterial Communities

Ruminants rely on a symbiosis between the host and the ruminal microbiota.

BPs composed of various microbial components are known to improve the GIT

microbiota [1, 2, 41], and repeated administration of BPs could be the optimum

solution for countering decreases in the GIT beneficial bacteria, particularly LAB

[5]. A decrease in the number of microorganisms occurs with GIT diseases in

calves; this affects animal growth significantly [143]. In the adult ruminant, a

balanced ruminal microbiota increases the production of enzymes such as

cellulase, amylase, urease, and protease, thereby increasing the use of fibrous

foods and the supply of proteins, vitamins, and short-chain organic acids for the

host animal [8, 106].

The use of a growth promoter, including antibiotics or DFM feed additives, in

ruminants has been common since 1940, because their use is correlated with

better health and an increase in food conversion in these animals [7, 30, 96]. The

use of antibiotics as feed additives in ruminants has an impact on animal health

and welfare [19, 23]. One issue with antibiotic feed supplements is the potential

for antibiotic resistance. The practice of using antibiotics in livestock feed as a

growth promoter has been associated with emergence of resistance to antibiotics

in zoonotic bacteria [30, 49]. Therefore, BP therapy is a novel approach in

probiotic research in ruminants with demonstrated health effects. Based on a

10

long-standing interest in probiotic use for ruminants, in recent years the use of

BPs in food animals has increased dramatically. General indications are that BPs

and other non-bacterial probiotics can modulate the balance and activities of the

GIT microbiota in ruminants [5, 41, 96]. It has been consistently reported that

BPs or live yeast supplementation increase the number and activity of the

dominant rumen bacterial populations [96, 107, 135]. In particular, BPs appear to

enhance the ruminal microbiota and subsequently increase the ability of ruminal

bacteria to metabolize LA and regulate ruminal pH [107, 144]. The administration

of novel additives, including specific BP strains, in the food of ruminants can

affect the structure and activities of the rumen and intestinal microbiota,

promoting health and improving animal performance [5, 17, 41]. Current

knowledge of the microbial composition and functional diversity of ruminant

digestive ecosystems suggests that consecutive supplementation with BPs will

have beneficial effects on the animals’ performance by altering the ruminal

microbiota and increasing digestion capability [16, 41]. This would reduce the

accumulation of organic acids and decrease the risk of ruminal acidosis [19, 106].

The use of viable BPs in ruminants has safety merits, in terms of controlling the

interaction with other components of the ruminal microbiota. Therefore,

considerable research during recent years has focused on the effects of novel BPs

on ruminal performance. Overall, BPs promote weight gain and animal growth,

and decrease the incidence of diarrhea in young ruminants [1, 92].

11

Probiotics and the Host Immune System

Probiotics have the capacity to stimulate various components of the immune

system in their hosts. In recent years, significant immune-stimulatory effects of

BPs have been reported in human and animals [13, 92]. There has been long-

standing interest in the immune stimulatory effects of probiotics in cattle,

particularly the usefulness of BPs on the development of calf immune systems [55,

57, 58, 92, 126]. Several reports have indicated immune-stimulatory effects of BPs

in feedlot steer and dairy cows [6, 29, 61]. The scientific underlying probiotic

health effects are evident in cattle nourishment, but the mechanisms underlying

the interaction of BPs and the immune system in cattle are not fully elucidated.

Unlike in monogastric animals, the direct effect of the administration of BPs on

the immune system is likely hampered by the size of the rumen and its biological

complexity in adult ruminants. However, oral administration of BPs might

directly affect intestinal microbiota and subsequently the immune system in

preweaning calves [58, 77, 92]. From a regulatory perspective, the mechanism of

the interaction between BPs and the host immune system is supported by

evidence from human and animal studies.

Immune Stimulation Mechanism of Probiotics

BPs, including LABs, have been shown to promote the innate immune

response mechanisms of hosts [12, 92, 120, 121]. A primary defense mechanism of

BPs involves interactions with the predominant GIT microbiota, which decrease

the pathogens access to gut barrier [55]. An increased and balanced intestinal

microbiota has evolved, which ptotects against infection and upregulates the local

12

intestinal immune response [75, 77]. Morover, increase in the GIT microbiota

density is vital for systemic immune function [92, 121]. A balancing of the

intestinal microbiota by BP treatment can protect against infection and increase

antigen transport across the gut mucosa, which aids in immune function [67]. In

ruminants, the influence of probiotics on the intestinal microbiota depends on the

possible effects of BPs on the ruminal components. Consecutive administration of

BPs affects the ruminal microbiota [1, 82, 122]. Furthermore, repeated

administration of a BP affects the antigenic functions of the GIT microbiota and

intestinal immune system [67, 121, 122]. The gut-associated lymphoid tissue is

the largest mass of lymphoid tissue, and includes Peyer’s patches and follicles

distributed within the mucosa, which might be involved in the immune-

stimulatory effects of BPs in cattle [28, 61]. However, the mechanism of the action

of BPs in cattle has not been elucidated. A commonly cited mechanism describes

the effect of BPs on the host immune response as a complex combination of several

different factors, including the interaction of intraepithelial T lymphocytes,

activated B cells, and macrophages, all of which are involved in the secretion of

pro-inflammatory cytokines and the stimulation of systemic immune responses

[67, 113, 120]. Cells in the lamina propria are also active in the gut, including B

lymphocytes, which fucntion predominantly as helpers and inducers [52, 121]. BPs

have been shown to enhance the humoral immune response, and to modulate both

the specific and nonspecific host immune system [40, 46, 57, 61]. Some BPs may

counteract the inflammatory process by enhancing the degradation of enteral

antigens, reducing the secretion of inflammatory mediators, and promoting the

13

normalization of indigenous flora and the exclusion of pathogens [55]. Moreover,

ingested BPs interact with intestinal epithelial cells (IECs) and dendritic cells

(DCs) [67]. The BPs can encounter DCs in two ways. DCs residing in the lamina

propria recognize bacterial antigens by passing their dendrites between the IECs

into the gut lumen [40, 113]. DCs can also interact directly with bacteria that have

gained access to the dome region of the gut-associated lymphoid tissue (GALT)

through specialized epithelial cells, termed microfold (M) cells [67]. The

interaction of the host cells with microorganism-associated molecular patterns

(MAMPs) on the surface macromolecules of BPs induces a specific molecular

response [13, 67, 121]. The host pattern-recognition receptors that perceive BP

signals include Toll-like receptors (TLRs) and DC-specific intercellular adhesion

molecules [39, 67, 86, 113]. Important responses of DCs against probiotics include

the production of cytokines, major histocompatibility complex molecules for

antigen presentation, and co-stimulatory molecules that polarize T cells into T-

helper or T-regulatory subsets in the mesenteric lymph nodes or subepithelial

dome of the GALT (Figure 2) [67].

Probiotics and Calf Scouring Therapeutic

Calves are prone to suffer from scouring, which inhibits productivity. As

calves with scour show growth retardation even after recovery following treatment,

subsequent prevention of this disease is considered a critical issue in clinical

veterinary medicine. The application of probiotics in veterinary medicine currently

focuses on reducing the risk of diseases associated with gut barrier dysfunction,

especially in newborn calves. Some BPs are known to demonstrate therapeutic

14

effects in scouring calves [54, 92, 122]. However, the mechanism of action of BP in

calves is not well understood. The primary effect of BPs is stimulation of non-

specific host resistance to microbial pathogens and thereby aid in their eradication

[42, 71, 83, 96]. In the past decade, studies of the therapeutic effects of BPs on calf

scouring indicated that the various bacterial strains demonstrated beneficial

effects on the incidence of scouring, feces consistency, and development of the GIT

microbial ratio in calves (Table 3) [122]. Modification of the types of intestinal

microbiota by BP ingestion might be the most important effect for the treatment of

gastrointestinal disorders in newborn calves, as several pathogens either alone, or

most often in combination with other pathogens, are etiologic agents of calf

scouring [54, 66]. Therefore, the most common suggestion for the mechanism

underlying the therapeutic effects of BPs is maintenance of intestinal health by

reducing the levels of harmful intestinal elements in young calves [54, 58, 92].

An important characteristic of effective BPs is their ability to prevent the

adherence, establishment, and/or replication of pathogens in the GIT [46, 55, 67].

Healthy adult ruminants have a balanced intestinal microbiota that facilitates

their growth. However, the GIT microbiota in young calves is not well developed;

thus a microbiotal imbalance might increase the risk of calf scouring, especially

when calves are under stress due to intensive rearing conditions. Therefore, the

oral administration of a BP in preweaning calves might either prevent the

pathogen from colonizing the digestive tract [36] or significantly reduce the

prevalence of scouring in young calves [1, 55, 92].

15

The use of BPs in young animals requires new criteria for strains appropriate

to specific indications. Prerequisites for the action of BPs include survival

mechanisms such as adhesion to the intestinal barrier, competitive exclusion of

pathogens or harmful antigens, and a direct or indirect immune stimulatory effect

(Figure 1) [55]. These processes may depend primarily on the specific

characteristics of individual strains, and secondlarily on the age and the

immunological state of the host animal. BPs may also arise from the use of

genetically modified bacteria demonstrating improved local intestinal immunity

[1, 12]. These include BPs engineered to produce anti-inflammatory cytokines [92,

142]. Research interest is currently directed towards the improvement of defined

physiological functions beyond the nutritional impact of BPs on the treatment or

prevention of the risk of disease in calves. Future BPs will have more thoroughly

defined mechanisms of their control of specific physiological processes in the

evolution of disease in calves or in the dietary management of specific diseases in

adult animals. In summary, BPs can be defined as products containing specific

microbes with scientifically proven clinical efficacy in terms of the development of

the GIT microbiota and a reduction in the incidence of calf scouring. Studies of the

use of BPs to treat acute infectious scouring have reported encouraging results [92,

122], but further research is necessary to confirm the reported efficacy of BP

strains for calf scouring therapy.

16

Table 1. Bacterial species most commonly applied in probiotic products [51]

Lactobacillus species

L. acidophilus, L. casei, L. crispatus, L. gallinarum, L. gasseri, L. johnsonii, L. paracasei, L. plantarum, L. reuteri, L. rhamnosus

Bifidobacterium species

B. adolescetis, B. animalis, B. bifidum, B. breve, B. infantis, B. lactis, B. longum

Other lactic acid

bacteria (LAB) species

Enterococcus faecalis, E. faecium, Lactococcus lactis, Leuconostoc mesenteroides, Pediococcus acidilactici, Sporolactotobacillus inulinus, Streptococcus thermophilus

Non-lactics species

Bacillus cereus, Escherichia coli, Propionibacterium freudenreichii

17

Table 2. Definitions of gastrointistinal tract (GIT) microbiota, probiotic, prebiotic

and synbiotics

GIT

microbiota

Total complex of microorganisms which normally inhabit in the

GIT, fulfilling a role in host nutrition, physiology, and control of

the immune system [117]

Probiotic

“Live micro-organisms which, when administered in adequate

amounts, confer a health benefit on the host” [30]

Prebiotic

A food or dietary non-digestible supplement product that confers

a health benefit on the host associated with modulating the

microbiota, in which beneficially affects the host by stimulating

the growth and/or activity of GIT microbiota [42, 81]

Synbiotic

A mixture of probiotic and prebiotic which beneficially affects

the host by improving the survival and implantation of live

microbial dietary supplements in the GIT, and therefore

improving host health and well being [81]

18

Figure 1. Bacterial probiotics action during gastrointestinal tract (GIT)

disorders [55].

19

Figure 2. Crosstalk between bacterial probiotics and the host immune system [67].

1

Table 3. Controlled trials to study the effect of bacterial probiotic in preweaning calves [122]

Year

No.

Breed

Bacterial Probiotic Strains

Treatment

(days)

Feed

Outcome

1980 10 Holstein &

Ayrshire

Lactobacillus acidophilus (human) 14 Pasteurized LCR

LCR 1980 10 Holstein Streptococcus faecium (calves) 14 Whole milk

1985 45 Swedish Red

& Withe

Lactobacillus spp. 50 Milk replacer DI, LCR

1991 56 Holstein L. acidophilus & L. lactis 42 Milk replacer FC,LCR

1991 53 Holstein Bacillus subtilis 42

1993 15 Holstein L. acidophilus & S. faecium 36 Milk replacer LCR, DI

1995 19 Holstein L. acidophilus, Bacilus thermophilum & Enterococcus faecium 56 Milk replacer DI

1996 16 Holstein L. acidophilus & L. plantarum 84 Pasteurized DI

LCR 1996 16 Holstein L. acidophilus 27CS 84 Whole milk &

milk replacer

1998 28 Holstein S. faecium, L. acidophilus, Saccharomyces cerevisor, Bacillus subtilid & Aspergillus aryzae

56 Milk replacer FC, LCR

1999 24 Holstein L. acidophilus 56 Whole milk DI, LCR

2002 51 Holstein L. acidophilus 42 Whole milk DI

DI 2002 52 Holstein L. acidophilus 42 Milk replacer

2003 22 Holstein L. plantarum, L. bulgaricus, L. acidophilus, L mamnsus, Bifidobacterium bifidum , S. thermophilus, E. faecium, A. oryza &Candida pintolopessi

60 Whole milk DI

DI

DI

2005 360 Holstein L. acidophilus, L. salivarius L. paracasi spp. Paracasi, L plantarum,L. lactis &E. faecium

14

2005 62 Holstein L. acidophilus, L. salivarius L. paracasi spp. Paracasi, L plantarum,L. lactis &E. faecium

14

2005 48 Holstein L. acidophilus, L. salivarius L. paracasi spp. Paracasi, L plantarum,L. lactis &E. faecium

56 Milk replacer DI, LCR

DI, LCR

DI, LCR

2005 48 Holstein Lactobacillus spp. 56

2005 41 Holstein L. acidophilus, L. salivarius L. paracasi spp. Paracasi, L plantarum,L. lactis &E. faecium

56

2005 41 Holstein Lactobacillus spp. 56

2007 112 Not specified B. bifidum , E. faecium, S. thermophilus, A. oryza &C. pintolopesti

90 Whole milk DI

2008 24 Holstein L. casei, L. salivarius &C. pintolopesti 35 Milk replacer DI, FC

2010 40 Holstein S. faecium 52 Milk replacer FC

2010 16 Holstein L. casei, L. salivarius &C. pintolopesti 35 Milk replacer DI, FC

DI, diarrheal incidence; FC, fecal consistency; LCR, lactic acid bacteria (LAB):coliforms ratio

20

21

Objectives

Bacterial probiotics (BPs) have benifical effects on the health and growth of

calves. The BPs are also known to modulate the GIT microbiota and have immune

stimulatory effects on their hosts. However, very few information of BP effects on

ruminal components, cellular immune function and prevention of diseases is

available in calves. The objectives of the present study projects were to clarify the

effects of a BP consisting of L. plantarum, E. faecium and C. butyricum on the

ruminal components and cellular immune function in weaned and preweaning

Holstein calves. The studies were following by three experimental projects as below:

1. Study on the effects of a bacterial probiotic on ruminal components and bacterial

populations of weaned Holstein calves.

- The aim of this study was to determine whether administration of a probiotic

containing LAB affects the ruminal pH, VFA, lactic acid and NH3-N consentrations

in conjunction with the levels of ruminal bacteria in weaned Holstein calves.

2. Study on the effects of a bacterial probiotic on subpopulations of peripheral

leukocytes and their cytokine mRNA expression in weaned Holstein calves.

- In this study, to confirm the effects of a BP on the immune function, lymphocyte

subpopulations, monocytes and cytokine mRNA expression in peripheral leukocytes

were investigated using healthy weaned Holstein calves.

3. Study on the effects of a bacterial probiotic on subpopulations of peripheral

leukocytes and their cytokine mRNA expression levels in scouring Holstein calves.

- This study was designed to examine the therapeutic and immune stimulatory

effects of the BP in the preweaning scouring and healthy Holstein calves in the field.

22

Chapter I

Study on the Effects of a Bacterial Probiotic on Ruminal pH, Volatile

Fatty Acids and Bacterial Flora of Weaned Holstein calves

Introduction

Bacterial probiotics (BPs) consisting lactic acid bacteria (LAB) promote the

stability of the ruminal microbiota [5, 16, 41, 140], which result in increased dry

matter intake and weight gain and improved health in cattle [53, 132, 140].

Among LAB, the species used most frequently as probiotic are L. plantarum and E.

faecium [139]. Nocek et al. [91] reported the decreased risk of acidosis for dairy

cows receiving a combination of BP including Lactobacillus and Enterococcus.

Furthermore, steers receiving a BP including both lactate-utilizing

Propionibacterium and lactate-producing Enterococcus had higher ruminal

concentration of acetate, and the blood variables indicated a reduced risk of

metabolic acidosis [41]. It has been hypothesized that the functionality and

efficacy of BPs can be determined by their effect on rumen microbial populations

[17, 41]. This thinking is consistent with previous reports that BP improves the

GIT microbiota in calves [1, 53, 132].

Normally, the ruminal pH of cattle decreased dramatically in the period

immediately after high concentrate feeding [70, 108]. The restitute of decreased

ruminal pH is depend on the feeding frequency, effective neutral detergent fiber

(NDF), ruminal digestion rate and absorption of volatile fatty acids (VFA) through

23

the ruminal epithelium [3, 97]. The certainly conditional causes of stability of

ruminal pH in a higher range can be due to decreased in fermentable activities of

LAB and other than carbohydrate fermenter, which are inhabited in decreased

ruminal pH [139]. On the other hand, ruminal pH greater than 6.0 is thought to

be an ideal environment for overgrowing of acid sensitive microorganisms such as

fibrolytic communities [3, 106], and decreased ruminal pH depress fibre

degradability in the rumen [108].

Ruminal components, such as pH and amounts of VFA and lactic acid (LA),

are important environmental factors for survival of ruminal microorganisms [70,

87, 106]. Decreased pH and overgrowth of acidophilic bacteria in ruminal fluid are

synchronized with an increased level of rapidly fermentable carbohydrate, which

results in prompt production and accumulation of ruminal VFAs and LA, leading

to acidosis [8, 87]. Likewise, a number of ruminal bacteria, such as fibrolytic

bacteria, decrease when the ruminal pH remained under 5.5 [68, 85, 106]. Orderly

shifts occur among the rumen-predominant amylolytic and lactate-utilizing

bacterial populations in response to gradually decreasing ruminal pH [91].

Similarly, when quantities of rapidly fermentable carbohydrates exceed the

buffering capacity of the rumen [108], accumulated VFA and LA are associated

with a decreased ruminal pH [3, 106], even in newborn calves [64].

Highly fermentable diets stimulate ruminal microbial proliferation and VFA

production in pre-weaned calves, followed by initiation of ruminal development

[69]. Rapid fermentation of ingested calf starter causes an increased concentration

of VFA and decreased pH in the incompletely developed rumen [64, 100].

24

Furthermore, consumption of a highly fermentable diet results in increased LA

levels and ruminal acidosis in weaned calves [2, 100]. Challenges, such as the

transitive ruminal microbiome and high-concentrate feeding strategies, are

related to the incidence of ruminal acidosis in young ruminants [64]. Methods

such as terminal-restriction-fragment length polymorphism (T-RFLP), PCR-

denaturing gradient gel electrophoresis and real-time analyses of the ruminal

flora, show that the most complex interactions occur between the ruminal bacteria

and other bacterial products [31, 62, 70]. However, little information on the effect

of BPs containing LAB on ruminal pH, VFA and the properties of rumen bacterial

flora in calves is available. Furthermore, the mechanism underlying the effects of

BPs on ruminal components remains unclear. The objective of this study was to

determine whether administration of a BP containing LAB affects the ruminal pH,

VFA, LA and NH3-N levels in conjunction with the levels of a number of ruminal

bacteria in weaned Holstein calves.

Materials and Methods

Animals and Treatment

This experimental design was approved by the Iwate University Laboratory

Animal Care and Use Committee (A201026). Twelve ruminally cannulated

Holstein bull calves aged 12 ± 3 weeks [95 ± 2 kg BW; mean ± SE] were housed in

a 4 × 5-m2, open-sided straw bed and naturally ventilated barn at the Cattle

Research Center of Iwate University. The calves had been weaned within 4 weeks

after birth and fed starter pellets containing ground corn. The ruminal cannula

25

(diameter; 5cm) was applied surgically 4 weeks before starting the experiment.

One week before start of the experiment, the calves were gradually adapted to the

high-grain diet containing steam-rolled corn mixed with timothy hay (standard

diet). The concentrate: hay ratio was 1:1. The percentages of ingredients and

chemical composition of the total mixed diet are shown in Table 1.1. During the

15-day experimental period, each calf received 3.2 kg of diet twice per day at 0800

hr and 1700 hr and had access to fresh water ad libitum.

The BP (Miyarisan Pharmaceutical Co., Ltd., Tokyo, Japan), which included

L. plantarum strain 220 (9 × 106 CFU/g), E. faecium strain 26 (9 × 105 CFU/g) and

C. butyricum strain Miyari (9 × 104 CFU/g) was administered daily as a single

dose of 1.5 or 3.0 g/100 kg BW to each group of four calves for 5 consecutive days.

Four additional calves fed the standard diet without BP treatment served as the

control. The BP was stored at 4°C, each dose was mixed with 50 mL of tap water

in a beaker, and the BP suspension was orally administered to each calf with a 50-

mL drencher the morning prior to feeding. No changes in the health of the calves

were observed during the experimental period.

Ruminal pH Measurement

Ruminal pH was measured using a radio transmission system, as reported

previously [111]. Briefly, the system consisted of a pH sensor attached to a

transmitter through a 60-cm wire, a data measurement receiver and a personal

computer with special software (YCOW-S; DKK-Toa Yamagata, Yamagata,

Japan). The pH sensor was inserted through the ruminal cannula and located in

26

the ventral sac of the rumen, and a small data transmitter was mounted at the

back of each calf (Figure 1.1). The standardized site for measuring ruminal pH is

the cranial and ventral sacs, because most mixing of ruminal contents occurs at

these sites, and the pH values are more stable compared to at other ruminal sites

[27]. The pH sensors were calibrated with pH 4 and 7 buffer solutions before

insertion and within two weeks interval during the experimental period. Ruminal

pH was recorded every 10 min at 1 week before experiment and during the 15-day

experimental period. The location of the pH sensor in the rumen was checked each

morning.

Ruminal Fluid Sampling and VFA, Lactic Acid and NH3-N Assays

Ruminal fluid was collected from the ventral sac of the rumen, adjacent to

the pH sensor. A manual vacuum pump was used to collect samples through the

ruminal cannula, the morning prior to feeding, at predose and on days 7 and 14.

Ruminal fluid was filtered immediately through two layers of cheesecloth and

collected into a sterile plastic tube to analyze ruminal bacteria, total and

individual VFA components (acetic acid, propionic acid and butyric acid), LA and

NH3-N. Two milliliters of ruminal fluid were immediately stored at –80°C for

assessment of the bacterial population. Ten milliliters of ruminal fluid were added

to 2 mL of 25% metaphosphoric acid in 3 N H2SO4 for assay of VFA. Total and

individual VFA components were separated and quantified by gas

chromatography (model GC-2014, Shimazu, Kyoto, Japan) using a packed-glass

column (Thermon-3,000; 3%) on a Shimalite TPA 60–80 support (Shinwa

27

Chemical Industries Ltd., Kyoto, Japan). For assay of LA, the ruminal fluid was

centrifuged immediately at 2,000 × g for 15 min, and concentrations in the

supernatant were determined using a commercial kit (F-kit; D-lactate/L-lactate, J.

K. International, Tokyo, Japan). NH3-N levels in ruminal fluid were determined

by the steam distillation method using an automatic-N analyzer (Kjeltec auto

sampler system 1035 Analyzer, Tecator, Sweden).

Ruminal Bacteria Assay

Bacterial composition of ruminal fluid was assessed using T-RFLP and real-

time PCR. The ruminal bacteria was evaluated in ruminal fluid samples collected

at predose and on days 7 and 14 from both the group given 3.0-g BP and the

control group. Bacterial DNA was extracted from 1 mL of ruminal fluid using the

bead–phenol method [80]. Extracted DNA was dissolved in TE buffer and stored at

–80°C until T-RFLP and real-time PCR analyses. T-RFLP measurements were

performed according to the method of Sakamoto et al. [109]. In brief, the complete

16S rDNA was amplified using the universal primers 27F (5'-

AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3')

for PCR amplification of the 16S rRNA gene sequences [65]. The forward primer

was labeled at the 5' end with 6'-carboxyfluorescein (Applied Biosystems, Tokyo,

Japan). The following program was used to amplify 16s rDNA: 95°C for 3 min,

followed by 30 cycles of 95°C for 30 sec and 72°C for 1.5 min, with a final extension

at 72°C for 10 min. The PCR products were purified using a High Pure PCR

Product Purification kit (Roche, Indianapolis, IN, U.S.A.) and digested using

28

either HhaI or MspI at 37°C for 3 hr. A standardized marker (1,200 LIZ) was then

added to each sample. The length of the terminal restriction fragment was

determined on an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster,

CA, U.S.A.). Fragment sizes were estimated using GeneMapper Software (Applied

Biosystems). The predicted T-RFLP patterns of the 16S rDNAs of known bacterial

species were obtained using InfoCom software (Microbiota Profiler; Infocom Co.,

Tokyo, Japan).

Bacterial species, including the BP and some ruminal bacteria, were

quantified by real-time PCR according to a previous method [80]. Briefly, DNA

extraction from ruminal fluid samples was performed using a method similar to

that for the T-RFLP measurements. Real-time PCR was carried out using a

Thermal Cycler Dice TP800 device (Takara, Otsu, Japan), using the primers

shown in Table 1.2. The quantification of DNA for each bacterial species in

ruminal fluid was performed using the SYBR Green intercalation procedure.

Standards and samples were assayed in a 25-µl reaction mixture containing 12.5

µl of SYBR Premix EX Taq II (Tli RNase H plus), 0.5 µl of each primer, 10.5 µl of

nuclease-free water, and 1 µl of DNA template. The amplification program

included an initial denaturation step at 95°C for 5 min followed by 40 cycles of

denaturation at 95°C for 5 sec, annealing/extension at 60°C for 30 sec, with a final

extension step at 72°C for 5 min.

Statistical Analysis

The calf was the experimental unit for all statistical analyses, and the

29

random effect was the calf within a treatment. The main effects included

challenge treatment, day of the experiment (predose day = 24 hr before treatment,

day 1 = 0 - 24 hr, followed until day 14) and after 0800 hr treatment and feeding.

Diurnal measurements of ruminal pH were analyzed as 24-h mean pH from 1 day

before to 14 days after treatment. Each 10-min interval of the pH data was

summarized as a 1-h mean from 0800 hr to 0700 hr the following day to assess

circadian changes. Minimum and maximum pH values during a single day were

determined on the predose day and days 7 and 14. Minimum and maximum pH

values were analyzed by the Mann–Whitney U- test. Quantities of 16S rDNA as

determined by real-time PCR were analyzed to determine significant differences

in copy number between treatment and control groups for each targeted bacterial

species. Ruminal parameters and the number of bacteria data are presented as

means ± SE. T-RFLP analyses of ruminal microbiota were expressed on an

electropherogram based on the size of the intergenic spacer and the fluorescence

intensities of the fragments. Graph Pad Prism ver. 5.01 software (La Jolla, CA,

U.S.A.) was used for the statistical calculations, and one-way repeated-measures

analysis of variance followed by the Tukey’s multiple comparison method was

used to evaluate differences among the groups. A P-value < 0.05 was considered

significant.

Results

Ruminal pH

Ruminal pH in calves received the BP at either dose exhibited a constant 24-

hr mean pH during the experimental period. A difference (P<0.01) in ruminal pH

30

was found between the BP treated and control groups on days 4 to 14. In addition,

the 24-hr mean ruminal pH decreased (P<0.01) in the control group on days 5, 9,

10 and 11 compared to predose values. Considerable disparities in the ruminal pH

values among the BP groups and control were observed 3 day after initial

administration of the BP and continued throughout the experimental period

(Figure 1.2). The circadian pattern of 1-hr mean pH was almost identical among

the probiotic groups at predose to day 14. However, a difference (P<0.01) between

the pH values of the BP groups and control was observed at similar times on days

7 and 14. The ruminal pH decreased approximately 1-hr after feeding of a

standard diet in the morning and evening. The 1-hr mean pH curve in the control

on days 7 and 14 differed (P<0.01) from the values at 0800 hr on the same day

(Figure 1.3). The minimum ruminal pH was greater (P<0.05) in probiotic groups

than that in the control on day 7. On the same day, the minimum pH in the

control calves was different (P<0.05) from that predose. The maximum ruminal

pH values approached 7.0 in the probiotic groups and did not differ from that of

control during the experimental period (Figure 1.4).

Ruminal VFA, LA and NH3-N

No difference in the concentrations of total VFA between the BP groups and

the control was observed. Concentrations of none of the individual VFA were

altered among the groups. The acetic acid and propionic acid ratios were almost

identical in all BP groups. LA concentrations remained unchanged in both

probiotic groups. However, the LA concentration increased (P<0.01) in the control

31

on day 7 compared to that predose and differed (P<0.01) from the values in the BP

groups on the same day. No difference in rumen fluid NH3-N concentration

between the BP groups was observed. However, the NH3-N concentration was

significantly high (P<0.01) in the control group on days 7 and 14, compared to

predose day and also the values in the BP groups on the same days (Table 1.3).

Ruminal Bacteria

Ruminal cellulolytic bacteria, such as Butyrivibrio fibriosolvens and

Eubacterium ruminantium, showed greater fluorescence intensity peaks in most

samples from calves given 3.0-g BP on day 7. The Bacteriodetes group bacteria

had greater peaks in the control group on days 7 and 14. However, most bacteria

were not detected by T-RFLP measurement in the BP group samples on day 14

(Figure 1.5 - 1.6). The mean number of L. plantarum by real-time PCR was less

than 2 × 103 cells/ml in ruminal fluid of BP group on days 7 and 14. In contrast,

the number of L. plantarum was unchanged in the control samples on days 7 and

14. The number of Enterococcus spp. remained unchanged in the BP treated and

control groups, while C. butyricum was not detected (less than 2 × 103 cells/ml of

ruminal fluid) in the BP groups on days 7 and 14. The numbers of Clostridium

coccoides were similar among the groups. The number of Megasphaera elsdenii

and Selenomonas ruminantium did not differ among calves given BP on days 7

and 14. However, M. elsdenii was slightly changed in the controls on days 7 and

14 (Table 1.4).

32

Discussion

Probiotics have been shown to improve anaerobiosis, stabilise pH and supply

nutrients to ruminal microbiota in their microenvironment [5, 16, 17, 41, 78]. BP

consisting of L. plantarum and E. faecium induced a change in the ruminal pH in

cows fed a high grain diet [91]. Ruminal pH decreases immediately after feeding of

a high concentrate to adult cattle and newborn calves [64, 108]. The decrease in

ruminal pH depends on feeding frequency, effective neutral detergent fiber,

ruminal digestion rate and absorption of VFA through the ruminal epithelium [3,

97]. Furthermore, changes in ruminal microbiota, increased activities of lactate-

utilizing bacteria and greater lactate consumption also affect ruminal pH [59, 74,

78]. A invariable ruminal pH may result from decreased fermentation by LAB and

other carbohydrate fermenters, which inhabit low-pH environments [139]. Nocek

et al. [91] reported that cows fed fewer BP maintained a greater pH than cows fed

high concentration without BP, and they suggested that a BP consisting of LAB

produced sufficient acid to stimulate acid utilizers. By contrast, our results

indicate that a LAB-containing BP had a marked effect on the ruminal pH of high-

concentrate-fed calves at either dose. In the present study, the ruminal VFA

concentration was not affected by the BP treatment. This is in agreement with

previous reports, in which ruminal VFA was not affected by a BP included LAB

[15, 41]. In our study, the VFA concentration was likely affected by sampling time

because the total ruminal VFA concentration in calves increases soon after feeding

[7], and the majority of VFA present have been absorbed by the following morning

[97, 100, 108]. This explains the greater ruminal pH in calves in the control group

33

in the morning. Consequently, the circadian ruminal pH was higher at the period

of morning, and this was agreed with the report of Ghorbani et al. [41]. In addition,

the size of the rumen and the effectiveness of ruminal absorption may also affect

the ruminal VFA concentration in calves [69]. Beharka et al. [7] reported, total

VFA concentration increased in calves fed pelleted basal diet soon after feeding. In

the same report, authors noted that ruminal fermentation of VFA increased when

calves aged.

The LA concentration increased in the control but not in the BP groups, and

was correlated with a significantly lower mean ruminal pH in the control group.

This indicates that control calves had a normal ruminal fermentation capacity

during feeding of high-concentrate, which was supported by the decrease in

ruminal pH and growth of LAB [64, 139]. However, the circadian ruminal pH

increased gradually in control calves, which may be attributable to the effects of

time and adaption to diet [24]. A decrease in ruminal pH is known to be related to

decreased absorption of VFA and the accumulation of LA in the few hours after

high grain feeding [3, 59, 97]. BPs including LAB affects ruminal pH by altering

the growth of lactate-utilizing bacteria in the rumen [17]. In contrast, the number

of lactate-utilizing bacteria increases only when LA accumulates, and ruminal pH

decreases [59, 78]. A common theory is that BP may prevent a decline in ruminal

pH by decreasing LA production and increasing the utilization of LA by some

microbes [5, 15; 91]. It is possible that certain BP combinations, which synthesize

LA, may sustain a tonic level of LA in the rumen. This would stimulate the rumen

predominant microbial communities, which consume LA and reduce total acidity,

34

and as a consequence the ruminal pH would remain invariable. In the present

study, the ruminal concentration of LA and the number of lactate-utilizing

bacteria (M. elsdenii) were not affected by BP treatment, whereas the number of

M. elsdenii was greater in the controls. Compared to predose day, the NH3-N level

remained unchanged in the BP groups on days 7 and 14, however, the values were

significantly lower compared to that of the control group. BPs have been reported

to have no effects on the NH3-N concentration in the rumen [17, 41]. It was also

reported that many cellulolytic bacteria used NH3 as their only source of N [107].

Therefore, a lower NH3-N concentrations and invariable ruminal pH in BP treated

calves might imply the greater growth of cellulolytic bacteria in the rumen.

The numbers of L. plantarum and Enterococcus spp. did not increase in the

ruminal fluid of the BP groups. This was likely because growth of LAB is inhibited

at pH values > 6.0 [8, 140]. It has also been suggested that orderly shifts occur

among the predominating amylolytic and lactate-utilizing bacteria in response to

changes in ruminal pH [74]. Likewise, Russell et al. [107] reported that LAB

growth and carbohydrate fermentation are more favorable at lower ruminal pH

values, whereas fiber digestion is enhanced at a ruminal pH > 6.2 [106]. According

to circadian measurements, ruminal pH was < 6.6 during the morning when the

BP was administered, which is ideal for cellulolytic bacteria [85]. In contrast, the

number of B. fibrisolvens peaked at a greater level in the most calves given 3.0-g

BP, based on the T-RFLP measurements; thus, B. fibrisolvens is the most active

and numerous cellulolytic and acid-sensitive bacterium in the rumen [85, 108].

Bacteroidetes-group organisms exhibited high growth rates only in the control

35

group; indeed, these bacteria exhibit a distinctive ability to survive at a range of

ruminal pH [107]. Recently, it was reported that increased amounts of high-

concentrate diet and a reduction in ruminal pH were less favorable to fibrolytic

bacteria in the rumen [95]. Furthermore, earlier studies noted that a ruminal pH

of 6.0 to 7.0 facilitated the growth of acid-sensitive ruminal bacteria such as

Ruminococcus flavefaciens, Ruminococcus, Butyrivibrio fibriosolvens and

Fibrobacter succinogenes [62, 107, 84]. However, because of the adhesion capacity

of bacteria to fibre contents, the exact estimation of fibrolytic bacteria in the

ruminal fluid is less practical [62]. A maintaining effect of BP on rumen-

predominant microorganisms has been reported [41, 109]. Sharp et al. [118]

reported that L. plantarum and starch-utilizing bacteria were rapidly lost from

the rumen due to protozoan predation. Although BP products contain fewer

surviving organisms, and the recommended BP composition and dose remain

obscure [31], and such bacterial products might have more enhancing effect on

instigation and nourishment of the ruminal predominate microorganism, than

that of taking part in ruminal fermentation. Therefore, such BP products likely

enhance the effectiveness of rumen-predominant microorganisms [140]. However,

a possible antagonistic interaction and inhibitory effects among the rumen-

predominant bacteria and inoculated BP strains have also been reported [17, 41].

Although the mode of action of BP in the rumen is not completely understood, the

administration of LAB- probiotics is thought to help the rumen microbiota adapt

to the presence of LA [41] and prevent lactate accumulation in rumen [106]. Same

as our results, previous studies of Ghorbani et al. [41], Nocek et al. [91],

36

Timmerman et al. [132] and Chiquette et al. [15, 17] have been supported this

hypothesis of the effects of BP on the changes in the number of rumial bacteria.

Timmerman et al. [132] reviewed the possible mechanisms underlying the

enhancing effects of BPs on the predominant microbial communities in different

hosts as well in ruminant. However, if high amounts of LAB are supplemented,

the level of ruminal acid production can exceed the rumen’s ability to consume

acid [91]. Furthermore, the certainty of diametrical agonistic pluralism effects

among the ruminal microbiota has been determined [119, 139]. The agonistic

interactions among the ruminal microbiota thought to be the key factor for

controlling the stability of the rumen biological stricture [140] and balancing the

ruminal pH [106]. In the prents study, the BP at either dose improved the reduced

24-hr mean ruminal pH in weaned Holstein calves. In both BP-treated groups,

ruminal LA concentrations remained lower than that of the control. However, the

bacteria consisting in the BP product were not changed in the ruminal fluid, and

other ruminal bacteria remained stable. These results suggest that calves given a

BP had invariable ruminal pH, presumably due to effect of the BP on stabilizing

rumen-predominant bacteria, which consume LA in the rumen.

37

Table 1.1. Ingredient and chemical components of diet

a)All except DM presented on DM basis. DM presented as

percent fed basis.

Item Quantity

Ingredients, % (DM)

Dry-rolled corn 50.0

Alfalfa pellet 7.5

Corn grain 18.0

Wheat bran 13.5

Soybean meal 10.0

Dried whey 1.0

Nutrient component a)

DM, % 87.8

CP, % 17.7

NDF, % 40.5

NFC, % 28.7

Calcium, % 0.50

Phosphorus, % 0.35

38

Figure 1.1. Ruminal pH measurement system used in this study [111]

21

Table 1.2. Species- and genus-specific primers for the quantification of ruminal bacteria using real-time PCR assay

Bacteria

Primer

Sequence (5’- 3’)

Source of

primers

Lactobacillus plantarum

Sg-Lpla-F

CTCTGGTATTGATTGGTGCTTGCAT [79]

Sg-Lpla-R GTTCGCCACTCACTCAAATGTAAA

Enterococcus spp. g-Bfra-F CCCTTATTGTTAGTTGCCATCATT [103] g-Bfra-R ACTCGGTTGTACTTCCCATTGT

Clostridium butyricum 209F25 AGTGATTGTCAGTAGTAGACGAGCG [88] R221 CATGCGCCCTTTGTAGC

Clostridium coccoides g-Coc-F AAATGACGGTACCTGACTAA [80] g-Coc-R CTTTGAGTTTCATTCTTGCGAA

Megasphaera elsdenii MegEls1F GACCGAAACTGCGATGCTAGA [59] MegEls1R CGCCTCAGCGTCAGTTGTC

Selenomonas ruminantium SelRum1F GGCGGGAAGGCAAGTCAGTC [59] SelRum1R CCTCTCCTGCACTCAAGAAAGACAG

39

40

Figure 1.2. Changes in 24-hr mean pH in the ruminal fluid of calves given

1.5 g (n=4; ▲) or 3.0 g/100 kg BW (n=4; ■) probiotic for 5 consecutive days.

Additional calves without probiotic served as control (n=4; ○). Values

represent the means ± SE. * Ruminal pH in the probiotic groups compared to

control on the same day (P<0.01). # Ruminal pH in the control group

compared to the predose day (Pre; P<0.01). The first day of probiotic

administration was regarded as day 1.

41

Figure 1.3. Circadian changes in 1-hr mean pH at predose day (Pre) and days 7

and 14 in the ruminal fluid of calves given 1.5 g (n=4; ▲) or 3.0 g/100 kg BW (n=4;

■) probiotic for 5 consecutive days. Additional calves without probiotic served as

controls (n=4; ○). Values represent the means ± SE. * Ruminal pH in the probiotic

groups compared to the controls at the same time (P<0.01). # Ruminal pH in the

control group compared to time before feeding (0800 hr; P<0.01).

42

Figure 1.4. Box plots showing maximum and minimum ruminal pH on the

predose day (Pre), and days 7 and 14 in calves given 1.5 g (n=4; grey boxes)

or 3.0 g/100 kg BW (n=4; dark boxes) probiotic for 5 consecutive days.

Additional calves not given probiotic served as control (n=4; white boxes).

Median and quartiles are displayed in the box. Upper and lower bars

represent maximum and minimum values, respectively. * Ruminal pH in

the probiotic groups compared to the controls on the same day (P<0.05). # Ruminal pH in the control group compared to the predose day (Pre;

P<0.05). The first day of probiotic administration was regarded as day 1.

40

Table 1.3. Ruminal volatile fatty acids (VFA), lactic acid (LA) and NH3-N concentrations in the probiotic-treated and

control calves

Within a row, values represent the means ± SE (n=4). a) Calves of each group (n=4) received probiotic at 1.5 or 3.0

g/100 kg BW/day for 5 days, b) Predose; day before administration, c) Acetic acid:Propionic acid. *Compared to the

values in the control group (P<0.01), # Compared to predose values in the same group (P < 0.01).

Item Item

Treatment a)

Probiotic (1.5 g)

Probiotic (0.3 g)

Control

Pre b) Day 7 Day 14 Pre Day 7 Day 14 Pre Day 7 Day 14

VFA, millimole/dL

Total 7.5 ± 0.6 8.1 ± 0.6 8.0 ± 0.4

6.8 ± 0.4 7.6 ± 0.4 7.4 ± 0.3 7.7 ± 0.2 9.2 ± 0.5 7.6 ± 0.3

Acetic acid 5.3 ± 0.5 5.8 ± 0.4 5.6 ± 0.2 5.0 ± 0.3 5.3 ± 0.2 5.1 ± 0.2 5.3 ± 0.1 6.5 ± 0.3 5.2 ± 0.2

Propionic acid 1.4 ± 0.1 1.5 ± 0.1 1.5 ± 0.1 1.3 ± 0.1 1.5 ± 0.1 1.5 ± 0.1 1.5 ± 0.1 1.8 ± 0.1 1.5 ± 0.1

Butyric acid 0.6 ± 0.1 0.7 ± 0.1 0.7 ± 0.1 0.5 ± 0.1 0.6 ± 0.1 0.6 ± 0.1 0.6 ± 0.1 0.8 ± 0.1 0.7 ± 0.1

A:P c) 3.8 ± 0.2 4.0 ± 0.1 3.8 ± 0.1 3.9 ± 0.1 3.5 ± 0.1 3.3 ± 0.1 3.8 ± 0.2 4.1 ± 0.1 4.1 ± 0.2

LA, mg/dL 2.3 ± 0.3 3.0 ± 1.1* 2.1 ± 0.4 2.5 ± 0.5 2.0 ± 0.2* 2.2 ± 0.0 2.3 ± 0.1 10 ± 2.4# 3.1 ± 0.1

NH3–N, mg/dL 7.8 ± 0.8 7.5 ± 0.6* 8.0 ± 0.3* 6.2 ± 0.8 8.1 ± 0.7* 7.0 ± 1.0* 6.8 ± 1.0 13 ± 1.3# 12 ± 1.6#

43

44

Table 1.4. Enumerated eubacteria 16S rRNA genes of some rumen bacterial

species in the probiotic-treated and control calves using real-time PCR

Within a row, values represent mean ± SE number of bacteria (×103 cells/ml) in

ruminal fluids. a) Calves of group (n = 4) received probiotic (3.0 g/100 kg BW per d)

for 5 day. b) Predose; day before administration. c) Not detected (less than 2 × 103

cells/ml).

Bacteria

Treatment a) Control

Pre b) Day 7 Day 14 Pre Day 7 Day 14

Lactobacillus plantarum 2.5 ± 0.8 ND c) ND 2.1 ± 0.7 2.8 ± 0.6 2.3 ± 0.7

Enterococcus spp. 4.8 ± 0.1 4.3 ± 0.1 4.5 ± 0.1 4.5 ± 0.1 4.8 ± 0.1 5.0 ± 0.2

Clostridium butyricum 2.1 ± 0.8 ND ND 2.9 ± 0.6 2.4 ± 0.8 ND

Clostridium coccoides group

8.8 ± 0.1 8.7 ± 0.1 8.9 ± 0.3 8.8 ± 0.1 8.7 ± 0.1 9.0 ± 0.1

Megasphaera elsdenii 4.5 ± 0.1 5.0 ± 0.1 5.6 ± 0.8 4.7 ± 0.1 6.4 ± 0.1 6.1 ± 0.1

Selenomonas ruminantium

8.2 ± 0.2 8.1 ± 0.2 8.1 ± 0.1 8.0 ± 0.3 8.2 ± 0.3 8.5 ± 0.1

45

Figure 1.5. Representative terminal-restriction-fragment length polymorphism (T-

RFLP) analysis of rumen microbiota composition using Hhal restriction enzymes

on the predose day (Pre) and days 7 and 14 in control calves given standard diet

without probiotic (A) and the calves given 3.0 g/100 kg BW probiotic (B). Each

peak represents a terminal restriction fragment of a specific length that

corresponds to a bacterial phylotype, usually a genus.

46

Figure 1.6. Representative terminal-restriction-fragment length polymorphism

(T-RFLP) analysis of rumen microbiota composition using MspI restriction

enzymes on the predose day (Pre) and days 7 and 14 in control calves given

standard diet without probiotic (A) and the calves given 3.0 g/100 kg BW

probiotic (B). Each peak represents a terminal restriction fragment of a specific

length that corresponds to a bacterial phylotype, usually a genus.

47

Chapter II

Study on the Effects of a Bacterial Probiotic on Subpopulations of

Peripheral Leukocytes and Their Cytokine mRNA Expression in

Weaned Holstein Calves

Introduction

Enhancement of the immune system is an important trait following

administration of bacterial probiotics (BPs) in human and animals. Certain multi-

strain and multi-species BP have been reported to have immune-stimulating

effects in cattle [29, 57, 61], and beneficial effects of BPs have been recognized in

improving animal health and protecting calves against infection [122, 126].

Lactobacillus strains, alone or in combination with other BPs, may reduce

scouring in neonatal calves, increase weight gain and maintain health [53, 58].

However, the interaction between BPs and the function of host peripheral blood

mononuclear cells (PBMCs) is not fully understood in calves.

BP consisted E. faecium and C. butyricum enhanced the T cells immune

response and activated monocytes in human in vitro study [52]. Recently, it was

reported that a Lactobacillus subspecies have been effected the T cell

subpopulations and resulted increased level of interferon-gamma (IFN-γ) in

infants during the weaning [142]. It has been hypothesized that BPs might impact

the host immune system in a number of ways, such as upregulation of cell-

mediated immunity, increased antibody production and epithelial barrier

integrity, enhanced dendritic cell-T cell interactions, heightened T cell association

and increased toll-like receptor (TLR) signaling [57, 67].

48

One valuable effect of BPs is that they contribute to homeostasis of the GIT

microbiota, especially in calves [5]. Thus, the immune-modulating effect of BPs in

ruminants is likely more appropriate at a young age, when the intestinal

microbiota inhabitants are less well established. Phagocytic activities of

leukocytes have been reported to be increased in peripheral blood of calves

following administration of a BP consisting of L. plantarum [57]. Increases in

acute-phase proteins, such as serum amyloid A and plasma lipopolysaccharide-

binding protein (LBP) have been recognized in feedlot steers receiving a BP

containing E. faecium and Saccharomyces cerevisiae [29]. Furthermore, LBP

binds to bacterial lipopolysaccharide (LPS) to elicit immune responses by

presenting the LPS to the important cell-surface proteins CD14 and TLR2 [86].

Recently, it was also reported that T cell subsets in peripheral blood of scouring

calves were stimulated by a BP [92]. Likewise, a BP consisting of LAB has been

shown to enhance non-specific immunity in infants, including T cell responses and

increased levels of IFN-γ and interleukin-4 (IL-4) [67, 142].

The effects of BPs on the ruminal components and possible interactions with

resident bacterial populations in cattle have been reported [5, 13, 138].

Furthermore, variation in the intistinal microbiota and subsequently immune

stimulatory effects, such as the expression of TLR, is observed in steers [13].

However, few studies have described the effects of BPs on the peripheral

leukocytes function in weaned calves. In the present study, lymphocyte

subpopulations, monocytes and cytokine mRNA expression in peripheral

leukocytes were investigated to confirm the effects of a BP on the celluer immune

49

function in the healthy weaned calves.

Materials and Methods

Animals and Treatment

The experimental design was approved by the Laboratory Animal Care and

Use Committee of Iwate University, Iwate, Japan. Eight clinically healthy

Holstein bull calves, aged 10±3 weeks, were purchased from a government farm

(National Livestock Breeding Center, Morioka, Japan) and were housed in a

4×5 m2, open-sided straw bed and naturally ventilated barn at the Cattle

Research Center, Iwate University. The calves had been weaned within 4 weeks

after birth and fed starter pellets containing ground corn (standard diet) and had

access to fresh water ad libitum.

Calves were assigned to a 4 × 2 experimental design for the BP and control

groups. The BP (Miyarisan Pharmaceutical Co., Ltd., Tokyo, Japan), which

included L. plantarum strain 220 (9×106 CFU/g), E. faecium strain 26 (9×105

CFU/g) and C. butyricum strain Miyari (9×104 CFU/g), was administered daily at

3.0 g/100 kg body weight (BW) to the calves once daily for 5 consecutive days. The

BP was mixed with 50 mL tap water in a beaker, and the BP suspension was

administered orally to each calf in a 50 mL drencher in the morning, prior to

feeding. Four additional calves given tap water alone, with no BP treatment,

served as the control. Each calf was examined clinically for normal health and

growth. No abnormal changes in the health of any calf were observed during the

experimental period.

50

Blood Collection and PBMC Isolation

Blood was drawn by jugular venipuncture from each calf at predose and on

days 7 and 14. The first administration day was considered day 1. A blood

specimen (6 mL) was collected in a heparinized tube (BD Vacutainer, Belliver

Industrial Estate, Plymouth, U.K.) and used for PBMC isolation for flow

cytometry analysis. Blood (4 mL) was collected in two EDTA tubes (BD

Vacutainer, Franklin Lakes, NJ, U.S.A.), and used for total RNA extraction from

peripheral leukocytes and white blood cell (WBC) counts. Blood (10 mL) was

collected in a serum separating tube (SST; BD Vacutainer, Franklin Lakes, NJ,

U.S.A.), and used for blood biochemistry profile measurement. WBC count was

determined using an automatic hematology analyzer device equipped with

software for bovine samples (pocH-100iV Diff, Sysmex, Kobe, Hyogo, Japan). The

percentage of PBMCs was determined using a hemogram method with the Dif-

Quick staining protocol. PBMCs were isolated as described previously [93].

Briefly, to purify PBMCs and to lyse red blood cells, 2 mL heparinized blood was

mixed with 8 mL 0.83% ammonium chloride solution. After 5 min at room

temperature, samples were centrifuged (2,000 rpm, 10 min, 4°C). PBMCs were

purified by washing twice in phosphate-buffered saline (PBS, pH 7.4) followed by

centrifugation (2,000 rpm, 5 min, 4°C). After the final wash, the cell pellet was

diluted in 500 μL PBS, and cells were counted. Then, the cell concentration was

adjusted to 1×107/mL in PBS, and the cells were kept at 4°C until used for the

flow- cytometry assay.

51

Flow cytometry Assay

The primary monoclonal antibodies used in the present study are shown in

Table 2.1. Flow cytometry analysis was performed as described previously [93].

Briefly, PBMCs were labeled with the primary antibody and incubated for 60 min

at 4°C. CD3+ T cells and each of CD4+ and CD8+ T cell subsets were additionally

labeled with CD45R monoclonal antibody to mark pan-leukocytes. After

incubation, cells were washed twice to remove unbound antibodies. Labeled cells

were stained with specific purified IgG conjugated to phycoerythrin (PE)

polyclonal secondary antibody (goat anti-mouse IgG1 RPE, AbD Serotec,

Kidlington, Oxford, U.K.) or fluorescein isothiocyanate (FITC)-conjugated

antibody (goat anti-mouse IgG or IgM FITC, Southern Biotech, Birmingham, Ala.,

U.S.A.) and incubated for 30 min at 4°C. After washing twice, stained cells were

diluted in 500 μL PBS. Flow cytometry was performed using a FACScan analyzer

(Becton Dickinson, Franklin Lakes, N.J., U.S.A.), equipped with a computer

running the Cell Quest software (Becton Dickinson, Milan, Italy).

Total RNA Extraction from Leukocytes and cDNA Synthesis

Total RNA was extracted from 1 mL whole blood leukocytes using the SV

Total RNA Isolation System (Promega, Tokyo, Japan). Trace genomic DNA in the

crude total RNA samples was removed by incubation with 4–6 units DNase I per

100 mg total RNA (Ambion, Austin, Tex., U.S.A.) for 30 min at 37°C. The

concentration of total RNA was verified on a 1% agarose gel, and purity was

determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop

52

Technologies, Rockland, Del., U.S.A.). cDNA was prepared using an oligo(dT)

primer and a thermal cycler (MyCycler; Bio-Rad, Tokyo, Japan). cDNA synthesis

was performed using the ImProm Reverse Transcription System (Promega). cDNA

was stored at -80°C until used for real-time PCR measurements.

Real-time PCR Assay

Real-time PCR analysis was carried out using the iQ SYBR Green Supermix

kit (Bio-Lad) as described previously [70]. Specific individual cytokine primer

sequences and the internal standard gene β-actin used are shown in Table 2.2.

Amplification was carried out using a Mini Opticon (Bio-Rad) thermal cycler with

the following profile: one cycle of 95°C for 2 min, followed by 45 cycles of 95°C for

30 sec, 65°C or 59°C for 30 sec and 74°C for 30 sec, followed by 74°C for 7 min.

Melting curve analysis was performed from 50°C to 95°C, read every 0.5°C holding

for 5 sec. Relative gene expression was calculated using the comparative threshold

cycle number (2-ΔCt) method, as described by Livek and Schmitge [72]. Results are

summarized as ΔCt values, where ΔCt is the difference in the threshold cycle for

the target and β-actin, as an internal control.

Statistical Analysis

The number of CD-positive or CD-negative cells was calculated from the

percentages of leukocytes gated by flow cytometry analysis and total PBMCs.

Values are expressed as means ± standard error (SE). Prism-Pad software (ver.

5.01) was used for statistical calculations, and one-way repeated-measures

analysis of variance followed by the Tukey-Kramer multiple comparison method

53

was used to evaluate differences in values among the groups. A P-value < 0.05 was

considered to indicate statistical significance.

Results

Subpopulations of Peripheral Leukocytes and Blood Biochimistry Profile

The number of CD-positive cells is shown in Figures 2.1 and 2.2. Compared to

the value on the predose day and the control value on the same day, increased

(P<0.05) numbers of CD3+ T cells (CD3+ CD45R+/CD45R–), WC1+ γδ T cells and

CD282+ monocytes were noted in the treatment group on day 7. The values

remained higher on day 14; however, the difference was not statistically

significant. Compared to the value on the predose day, CD8+ T cells were

increased (P<0.05) in the treatment group on day 7. Compared to the control value

on the same day, the CD4+ T cell subset was also increased (P<0.05) in the

treatment group on day 7. The values of CD3+, CD4+ and CD8+ cell subsets

decreased slightly from day 7 to day 14, and the differences were not statistically

significant on day 14. Discrete analysis of data indicated that the numbers of

CD45R+ and CD45R– T cells were increased (P<0.05) in the CD3+ cells in the

treatment group. However, the values were increased (P<0.05) only in the number

of CD4+CD45R+ and CD8+CD45R+ T cells on day 7 compared to the values on the

predose day and/or the control; they were not significantly different among the

groups on day 14 (Table 2.3). The numbers of CD14+ and CD21+ cells changed

slightly in the treatment group on days 7 and 14, but there was no statistically

significant difference between the treatment and control groups. In this study, the

54

blood serum total protein (sTP), albumin (ALB), blood urea nitrogen (BUN), non-

esterified fatty acids (NEFA), total cholesterol (T-chol) and glucose (Glu)

concentrations were measured. However, the values were not significant among

the BP treated and control groups (Table 2.4).

Messenger RNA Expression of Cytokines

Expression of IL-6 and IFN-γ mRNA was increased slightly in the treatment

group on day 7 compared to the control, and the values were increased (P<0.05) on

day 14 compared to the predose day (Figure 2.3). Expression of IL-8 mRNA was

similar between the treatment and control groups on days 7 and 14. Expression of

tumor necrosis factor-alpha (TNF-α) was slightly higher on days 7 and 14 in the

treatment group, but the differences were not statistically significant (P=0.07)

between the treatment and control groups.

Discussion

Certain BPs have been suggested to have immune-stimulating properties in

pre-weaned calves and adult cattle [57, 61, 92]. In the present study, TLR2 (D282)

cell surface molecule antibody was used as a marker to distinguish monocytes in

peripheral blood of healthy weaned calves receiving BP and a control group. Thus,

in addition to TLR2+ cells, the numbers of CD3+ T cells, CD4+, CD8+ and WC1+ γδ

T cell subsets and CD14+ and CD21+ cells were evaluated. Likewise, the

expression of cytokine mRNA, such as IL-6, IL-8, INF-γ and TNF-α, was examined

to assess the possible immune-stimulating effects of the BP on the activation of

peripheral leukocytes.

55

In a previous study, the number of CD4+ cells was higher after repeated

administration of a BP consisting of C. butyricum strain Miyairi in dairy cows [61].

In another study, CD8+ cells were stimulated in the peripheral blood of pre-

weaned calves by administration of a BP [92]. Furthermore, a number of in vitro

and in vivo studies on human PBMCs have suggested that a BP containing

E. faecium, C. butyricum or Lactobacillus subspecies shows enhancing effects on T

cell subsets and monocytes [52, 142]. In young mammals, most CD3+, CD4+ and

CD8+ cells express the high-molecular-weight isoform of CD45R, and an increase

in the number of T lymphocytes expressing CD45R facilitates regular activation of

T cells [37]. In the present study, the increase in the number of CD3+CD45R+ T

cells in the treatment group, compared to the predose day or control, may indicate

a nonspecific, but enhanced immune state with possibly multiple causes after the

5-day repeated administration of the BP. Similar to CD3+ cells, increased numbers

of CD4+CD45R+ and CD8+CD45R+ T cells were observed. They may be involved in

immune system responses, along with direct or indirect immune-stimulatory

effects of the BP in the calves, as suggested by previous studies in cattle [29, 61,

92].

CD3+ T cells alternatively indicating stimulation of a high proportion of γδ T

cells, which may have been derived from the WC1– γδ T cells, the minor population

which is found in bovine PBMC [73, 98, 105]. Previous studies on bovine immune

markers reported that CD4+ and CD8+ cells are slacken below adult levels from 1

to 120 days of age, and γδ T cells are highest at birth and decreased to adult levels

by 150 days of age in cattle [94]. The WC1 molecule is a member of the scavenger

56

receptor cysteine-rich (SRCR) family found on γδ T cells, which are negative for

CD4 and CD8 [136]. Furthermore, WC1+ γδ T cells of cattle represent the

inflammatory population, whereas WC1– γδ T cells are regulatory cells [99]. In

cattle, the regulatory potential of WC1+ γδ T cell subsets is comparable to that of

CD14+ cells [50], and the WC1+ T cell subpopulation is larger in calves [4]. Wang

et al. [136] was reported that WC1 phosphorylation have been required for the

WC1– mediated T cell proliferation, suggesting a role for WC1+ γδ T cells as a co-

stimulatory molecule similar to CD4 or CD8 cells. Study on calves WC1+ γδ T cells,

using monoclonal antibodies, have been suggested that the presence of these cells

is associated with development of a T helper 1 -biased acquired immune response

[4, 105]. These observations allow speculation regarding a possible role for WC1+

γδ T cells as a link between the innate and acquired immune systems [98].

Furthermore, bovine γδ lymphocyte subsets are activated indirectly through

cytokines secreted by T cells, antigen-presenting cells (APCs) and other accessory

cells [94]. As our results show, the higher number of WC1+ γδ T cells in the calves

receiving the BP was associated with an increased number of CD4+ cells, which

might suggest stimulation of cellular immunity in the calves. Although WC1+ γδ T

cells and CD14+ cells are generated comparably in bovines [50], we found that

there were more WC1+ T cells than CD14+ cells. On the other hand, WC1+ cells are

immune suppressors, secreting IFN-γ in bovines [50, 105], consistent with our

results.

TLR2 is a key molecule in host defense against gram-positive bacteria [13].

The expression of TLRs has been correlated with the population of total bacteria

57

and LAB in the GIT, including the rumen of calves, during the first 6 months of

life [76]. Moreover, the expression of TLR2 was evident on bovine antigen

presenting cells with high level expression on peripheral blood monocytes and

monocyte-derived macrophages [63]. The TLR2 cell surface molecule on bovine

monocyte-derived dendritic cells (DCs) and GIT macrophages is most responsible

for recognition of gram-positive bacteria [13, 39, 40]. Recently it was reported that

rumen and intestinal epithelial cells, and macrophages express TLR2 cell-surface

molecule as responsible for the recognition of gram-positive bacteria form that

investigated the over-activation of innate immunity [13, 112, 39]. It was reported

that TLR2 have been necessary for the development of acquired immune

responses against a variety of bacterial species [9, 35]. Furthermore, the

monocyte-derived DCs, which are positive to TLRs, are suggested to play a key

role in the mechanism of BP immunomodulation. DCs are the most potent APCs

that are primed by BP, and they are the principal stimulators of naïve T cells to

drive further immune responses [52]. Even small molecules (for example, long-

chain fatty acids) that can be generated by de novo synthesis or consumed in the

diet are known to might modulate the TLR2 activation [9]. Mechanisms indicating

a direct role of TLR2 include bacterial reorganization by epithelial macrophages in

calves [77]. The transcytosis processing of bacterial particles via ileal Peyer’s

patch M cells and the later appearance of TLRs on DCs in the lamina propria play

a key role in the mechanism of BP immunomodulation [34, 67, 76, 82]. Thus, DCs

are the principal stimulators of T cells [34, 52]. The TLR signaling pathway is

involved with the actions of a BP containing C. butyricum, and the absence of

58

TLR2 expression might indicate the need for TLR2 in the recognition of

Clostridium bacteria [39, 40]. In the present study, we provide evidence for an

increased number of TLR2+ monocytes in the peripheral blood of calves receiving a

BP consisting of three species of gram-positive bacteria, including C. butyricum.

The increased number of peripheral monocytes expressing TLR2 might be

associated with the formal reaction of innate immunity in response to increasing

and changing bacterial diversity in the GIT microbiota of calves receiving the BP.

As data in the first chapter showed, weaned calves given the BP had an invariable

ruminal pH compared to the controls. It was also reported that a significant

increase in ruminal pH was correlated with increasing taxonomic units of

Clostridia in the GIT of cattle [70]. Therefore, improved diversity and bacterial

immigration might affect intestinal bacterial populations. However, the intestinal

microbiota was not evaluated in the present study. The CD14 cell surface molecule

is essential for the response to most Gram-negative bacteria, including

lipopolysaccharides, via the TLR4 and MD2 complex [86, 113]. The TLR2 molecule

recognizes microbial-associated molecule patterns independently [13, 34].

Although in this study some differences were noted between the different

antibodies assessed the expression of TLR2 and CD14+ monocytes in bovine [63].

Moreover, TLR2 is expressed on peripheral blood B lymphocytes [20]; however, a B

cell receptor complex including the CD21 molecule is present on mature B cells

and also ileal Peyer’s patch-derived B lymphocytes in healthy calves [89]. Similar

to these reports, the numbers of CD14+ and CD21+ B cells in the present study

were slightly increased in the calves on days 7 and 14. Furthermore, independent

59

IL-6 secretion via TLR2+ was reported [35]. In this study increased number of

TLR2+ cells were correlated with a higher expression of IL-6 in BP treated calves.

The BPs including Lactobacillus and C. butyricum induce the release of

proinflammatory cytokines, such as IL-6 and TNF-α, which are involved in

nonspecific immune responses [39, 40]. A BP consisting of E. faecium and C.

butyricum upregulates the level of IFN-γ and downregulates TNF-α in the

supernatant of human PBMCs [52]. In our study, increased expression of IL-6,

INF-γ and TNF-α mRNA was observed in the treatment group on days 7 and 14.

Increased expression of IL-6, IFN-γ and TNF-α in peripheral leukocytes may be

dependent on the period after administration and numbers of activated

T lymphocytes or monocytes in the treatment group. The explanation for higher

expression of IL-6 and INF-γ in BP treated calves could be due reactions of

immune cells to rate of presence of BP. Our observations are similar to those of

Waldvogel et al. [134], in which increased expression of IFN-γ was observed only 2

weeks after trickle stimulation of cultured PBMCs of calves. Expression of IL-8 is

related to neutrophil function, and inflammatory stimulation, in bovine [6]. In the

present study, the expression of IL-8 was unchanged compared to the predose day

and the control value on the same day, likely because the calves were healthy.

These results suggest that peripheral leukocytes in healthy calves may be stimulated via the

GIT microbiota, which was increased by the oral BP treatment, with overall stability of the

ruminal microbiota. The 5-day administration of a BP may enhance cellular immune function

in weaned calves.

60

Table 2.1. Monoclonal antibodies used for flow cytometry assay

TcR, T cell receptor; PTPR, protein tyrosine phosphatase receptor; LPS,

lipopolysaccharide; CR2, complement component receptor 2; TLR2, tool-like receptor 2.

Items Target molecule Specificity mAb clone Isotype Supplier

CD3 TcR complex pan-T cells MM1A IgG1 VMRD

CD4 CD4 molecule T-helper cells CACT183A IgG1 VMRD

CD8 CD8β cytotoxic T cells BAT82A IgG1 VMRD

CD45R PTPR pan-leukocytes GC6A IgM VMRD

WC1 Unknown γδ T cells IL-A29 IgG1 VMRD

CD14 LPS receptor monocytes, macrophages CAM36A IgM VMRD

CD21 CR2 B cells BAQ15A IgG1 VMRD

CD282 TLR2 monocytes HCA151F IgG1 AbD-Serotec

61

Table 2.2. Primers used for real-time PCR

Gene

Gen Bank

access. no.

Sequence (5'–3')

Annealing

Temp (°C)

Concentration

(nM)

β-actin

AY141970

F: GGCCGAGCGGAAATCG

R: GCCATCTCCTGCTCGAAGTC

65

750

IL-6 NM173923 F: GTCTTCAAACGAGTGGGTAAAG

R: TGACCAGAGGAGGGAATGC

65 250

IL-8 NM173925 F: CACTGTGAAAATTCAGAAATCATTGTTA

R: CTTCACAAATACCTGCACAACCTTC

59 250

TNF-α Z48808 F: CGGTGGTGGGACTCGTATG

R: GCTGGTTGTCTTCCAGCTTCA

65 750

IFN-γ NM174086 F: TAGGCAAGTCTATGGGATTTC

R: GCATTCATTACATCATCAAGTG

59 250

62

Figure 2.1. Number of CD3, CD4, CD8, CD14, CD21 and WC1+ cells in the

peripheral blood of treatment (calves given 3.0 g/100 kg BW of bacterial

probiotic once daily for 5 days) and control (calves given the vehicle alone

without probiotic) groups. Numbers were counted at predose (Pre) and on days

7 and 14. Values represent means ± SE (n=8). * Values in the treatment group

compared to the predose day in the same group (P<0.05). # Values compared

to the control on the same day (P<0.05). The first administration day of the

probiotic was deemed day 1.

63

Figure 2.2. Number of TLR2+ (CD282) cells in the peripheral blood of

treatment (calve given 3.0 g/100 kg BW of bacterial probiotic once daily

for 5 days) and control (calves given the vehicle alone without bacterial

probiotic) groups. Numbers were counted at predose (Pre) and on days

7 and 14. Values represent means ± SE (n=8). * Values in the

treatment group compared to the predose day in the same group

(P<0.05). # Values compared to the control on the same day (P<0.05).

The first administration day of the probiotic was deemed day 1.

44

Table 2.3. Numbers of the peripheral blood mononuclear cell (PBMC) and CD3+, CD4

+ and CD8

+ (CD45R

+/CD45R

–) T cells

(cell/µl) in bacterial probiotic-treated and control calves

Within a row, values represent the means ± SE (n=8). a) Calves received 3.0 g/100 kg of probiotic for 5 consecutive days,

and additional calves given the vehicle alone served as the control. b) Predose day (day before administration). *

Compared to the predose (Pre) values in the same group (P<0.05). # Compared to the values in the control on the same

day (P<0.05).

Treatmenta)

Control

Preb)

Day 7 Day 14 Pre Day 7 Day 14

PBMC 5,283 ± 193 6,323 ± 318 5,650 ± 260 4,836 ± 346 4,467 ± 415 5,303 ± 513

CD3+CD45R

– 1,425 ± 117 2,199 ± 123*# 1,940 ± 136 1,321 ± 157 1,431 ± 206 1,777 ± 202

CD3+CD45R

+ 727 ± 60 1142 ± 158*# 998 ± 82 668 ± 92 729 ± 76 857 ± 106

CD4+CD45R

– 191 ± 47 315 ± 44 244 ± 52 201 ± 35 171 ± 37 228 ± 42

CD4+CD45R

+ 326 ± 62 625 ± 79*# 394 ± 39 328 ± 47 305 ± 59 333 ± 49

CD8+CD45R

– 53 ± 80 77 ± 10 65 ± 12 68 ± 13 65 ± 28 69 ± 13

CD8+CD45R

+ 209 ± 41 526 ± 89* 340 ± 41 207 ± 28 304 ± 84 280 ± 43

64

45

Table 2.4. Blood biochemistry profile in the healthy probiotic-treated and control calves

Within a row, values represent the means ± SE (n=8). a) Calves received 3.0g/100 kg of bacterial probiotic for 5

consecutive days, and additional calves given the vehicle alone served as the control. b) Predose day (day before

administration). sTP, serum total protein; ALB, albumin; BUN, blood urea nitrogen, NEFA, non-esterified

fatty acids; T-chol, total cholesterol; Glu; glucose.

Item

Treatment a)

Control

Pre b)

Day 7 Day 14

Pre Day 7 Day 14

sTP ( g/dl ) 6.9 ± 1.2 7.0 ± 1.5 7.3 ± 1.1 7.1 ± 0.2 7.1 ± 1.0 7.1 ± 1.2

Alb ( g/dl ) 3.5 ± 0.1 3.4 ± 0.2 3.4 ± 0.1 3.5 ± 0.1 3.4 ± 0.3 3.4 ± 0.1

BUN (mg/dl) 12.5 ± 0.2 11.3 ± 0.5 12 ± 0.2 10.5 ± 0.4 13.1 ± 0.5 13.4 ± 1.0

NEFA (µEq/l) 229 ± 3.1 155 ± 1.7 202 ± 2.0 218 ± 2.1 130 ± 1.8 168 ± 2.0

T-Chol (mg/dl) 77 ± 2.0 77 ± 1.4 74 ± 1.2 79 ± 1.1 74 ± 1.0 75 ± 1.4

Glu (mg/dl) 82 ± 2.4 81.1 ± 2.0 82.3 ± 2.5 78.0 ± 3.1 70.0 ± 1.4 80.4 ± 2.1

65

66

Figure 2.3. Relative mRNA expressions of IL-6, IL-8, IFN-γ and TNF-α in

peripheral leukocytes of treatment (calves given 3.0 g/100 kg BW of bacterial

probiotic once daily for 5 days) and control (calves given the vehicle alone

without bacterial probiotic) groups. Expression was measured at predose

(Pre) and on days 7 and 14. Values represent means ± SE (n=8). * Values in

the treatment group compared to the predose day in the same group

(P<0.05). The first administration day of the probiotic was deemed day 1.

67

Chapter III

Study on the Effects of a Bacterial Probiotic on Subpopulations of

Peripheral Leukocytes and Their Cytokine mRNA Expression Levels

in Scouring Holstein Calves

Introduction

Calves are born with a naive immune system, and appropriate development

of the gastrointestinal tract (GIT) microbiota in the early weeks of life is crucial

for a functional immune system [76, 93, 145]. GIT diseases are characterized by

acute intestinal inflammation, much of which is thought to be due to

inappropriate activation of the immune system in calves [57, 66]. Greater

vulnerability to invasive infections and the development of GIT disorders, such as

scouring, are associated with the immaturity of the immune system of calves at

birth, although the specific mechanism is unclear. Regulation by the immune-

stimulatory effects of bacterial probiotics (BPs) may contribute to the treatment of

scouring in calves [92]. BPs contributes to the homeostasis of GIT microbiota,

improving animal health and protecting calves against infection [122, 126]. LAB

probiotics are known to help with GIT colonization via the competitive exclusion of

undesirable microorganisms and the development of a homeostatic GIT

environment in calves [1, 46, 57]. LAB probiotics are also known to have a

beneficial impact on intestinal infections and are commonly used to treat calf

scouring [1, 58]. More recently, in vivo studies have examined their immune-

stimulatory effects in calves [92, 122, 126]. In cases of inadequate initial bacterial

colonization, BP can be used to achieve a balanced immune response [56].

68

Therefore, the immune-modulating effect of BP is likely more appropriate for

young calves, when the intestinal bacterial inhabitants are less well-established.

The phagocytic activities of leukocytes have been reported to be increased in the

peripheral blood of calves following the administration of a BP consisting of L.

plantarum [58]. A number of systemic immune markers, including CD8+ cells,

increased in response to treatment with a probiotic in scouring calves [92]. In

adult cattle, the immune-stimulatory effect of a BP containing E. faecium and

Saccharomyces cerevisiae has been recognized in feedlot steers and dairy cows [29,

61]. In the intestine, C. butyricum as a BP may increase the resistance of the gut

to pathogen invasion by inducing the secretion of anti-inflammatory cytokines [40].

The stimuli provided by BP are essential for the development of a fully functional

and balanced immune system, including the homing of B and T cells to the lamina

propria [12]. It has generally been assumed that some BP strains predominantly

induce cytokine mRNA expression in leukocytes, promote T cell development and

augment immune defense to prevent infections, thereby ameliorating

inflammatory diseases [29, 61, 120, 121]. However, the effect of BPs on

subpopulations of peripheral leukocytes in scouring and healthy preweaning

calves is unknown. In the present study, the immune-stimulatory effects of a BP

on perphiral blood mononuclear cells (PBMCs) and their mRNA expression levels

were investigated in scouring and healthy preweaning Holstein calves.

69

Materials and Methods

Animals and Treatment

The experimental design was also approved by the Laboratory Animal Care

and Use Committee of Iwate University, Iwate, Japan. Forty-two scouring and

healthy preweaning Holstein calves (mean age, 10 ± 5 days) housed in two

commercial dairy farms were used in the experiment. All calves were examined

clinically, and the scouring status of each calf was inspected. The scour condition

was watery to muddy yellow, and the physical condation and appetite of the

scouring calves were almost normal (Table 3.1). The calves were assigned to

treatment and corresponding control groups based on the type of scouring

(pathogenic or non-pathogenic) and clinically healthy (non-scouring) status. The

BP treatment groups included scouring pathogen-positive treated (PPT; n=8),

scouring pathogen-negative treated (PNT; n=8) and healthy treated (HT; n=6)

calves. The corresponding control groups included scouring pathogen-positive

control (PPC; n=6) and pathogen-negative control (PNC; n=6) calves, and healthy

control (HC; n=8) calves without BP treatment were used as the main control

group. All calves received colostrum at birth and were fed a milk replacement

twice daily.

Treatment of the calves began on the first day of scour occurrence (day 0).

After a clinical examination and the collection of blood and stool samples, a BP

(Miyarisan Pharmaceutical Co., Ltd., Tokyo, Japan) consisting of L. plantarum

strain 220 (9×106 CFU/g), E. faecium strain 26 (9×105 CFU/g) and C. butyricum

strain Miyari (9×104 CFU/g) was administered to each of the calves in the

70

treatment groups once daily at a dose of 3.0 g/100 kg BW for 5 days. The BP was

mixed with a milk replacement and fed to each calf in the morning. The scouring

calves were not treated by any other medicine or electrolyte therapy, although all

calves had access to fresh water ad libitum.

Blood Collection and PBMC Isolation

Blood samples were collected on days 0 and 7. A blood specimen (6 mL) was

collected in a heparinized tube (BD Vacutainer Systems, Plymouth, UK) and used

to isolate PBMCs for flow cytometric analysis. Blood (4 mL) was collected in two

EDTA tubes (BD Vacutainer; Becton Dickinson, Franklin Lakes, NJ, U.S.A.) and

used for total RNA extraction from peripheral leukocytes and for white blood cell

(WBC) counts. Blood (10 mL) was also collected in a serum separating tube (SST;

BD Vacutainer, Franklin Lakes, NJ, U.S.A.), and used for blood biochemistry

profile measurement. The WBC count was determined using an automatic

hematology analyzer device equipped with software for bovine samples (pocH-

100iV Diff; Sysmex, Kobe, Japan). The percentage of PBMCs was determined

using the hemogram method with the Dif-Quick staining protocol. PBMCs were

isolated as described by Ohtsuka et al. [93]. To lyse red blood cells, 2 mL of the

heparinized blood was mixed with 8 mL of 0.83% ammonium chloride solution.

After 5 min at room temperature, the samples were centrifuged (2,000 rpm, 10

min and 4°C). The PBMs were then purified by washing twice in phosphate-

buffered saline (PBS; pH 7.4) followed by centrifugation (2,000 rpm, 5 min and

4°C). After the final wash, the cell pellet was diluted in 500 μL of PBS, and the

71

cells were counted. The cell concentration was then adjusted to 1×107/mL in PBS,

and the cells were kept at 4°C until they were used for flow cytometry.

Flow cytometry Assay

The primary monoclonal antibodies used in the present study are shown in

Table 2.1. Flow cytometry was performed as described by Ohtsuka et al. [93].

PBMCs were labeled with the primary antibody and incubated for 60 min at 4°C.

CD3+ T cells and each of the CD4+ and CD8+ T cell subsets were additionally

labeled with a monoclonal antibody against CD45R to mark pan-leukocytes. After

incubation, the cells were washed twice to remove unbound antibodies. The

labeled cells were then stained with specific purified IgG conjugated to a

phycoerythrin (PE) polyclonal secondary antibody (goat anti-mouse IgG1 RPE;

AbD Serotec) or fluorescein isothiocyanate (FITC)-conjugated antibody (goat anti-

mouse IgG or IgM FITC; Southern Biotech) and incubated for 30 min at 4°C. After

washing twice, the stained cells were diluted in 500 μL of PBS. Flow cytometry

was performed using a FACScan analyzer (Becton Dickinson) equipped with a

computer running Cell Quest software (Becton Dickinson).

Total RNA Extraction from Leukocytes and cDNA Synthesis

Total RNA was extracted from 1 mL of whole blood leukocytes using the SV

Total RNA Isolation System (Promega). Trace genomic DNA in the crude total

RNA samples was removed by incubation with 4-6 U of DNase I per 100 mg of

total RNA (Ambion) for 30 min at 37°C. The concentration of total RNA was

verified on a 1% agarose gel, and the purity was determined using a NanoDrop

72

ND-1000 spectrophotometer (NanoDrop Technologies, Rockland, DE, U.S.A.).

cDNA was prepared using an oligo(dT) primer and a thermal cycler (MyCycler;

Bio-Rad). cDNA synthesis was performed using the ImProm Reverse Transcription

System (Promega). The cDNA was stored at -80°C until it was used for real-time

PCR.

Real-time PCR Assay

Real-time PCR was performed using an iQ SYBR Green Supermix Kit (Bio-

Rad) as described previously [72]. Specific individual cytokine primer sequences

and the internal standard gene used (β-actin) are shown in Table 2.2.

Amplification was performed using a Mini Opticon (Bio-Rad) thermal cycler with

the following profile: 1 cycle of 95°C for 2 min followed by 45 cycles of 95°C for 30 s,

and 65 or 59°C for 30 sec, and 74°C for 30 s followed by 74°C for 7 min. A melting

curve analysis was performed from 50 to 95°C with readings every 0.5°C (holding

for 5 sec). Relative gene expression was calculated using the comparative

threshold cycle number (2-ΔCt) method, as described by Livak and Schmitge [72].

The results are summarized as ΔCt values, where ΔCt is the difference in the

threshold cycle for the target and β-actin, as an internal control.

Stool Analysis

The common pathogens considered essential for calf scouring in the field were

examined using stool samples from the calves in the scouring groups. On the first

day of scouring, stool samples were obtained from each calf by mechanical

stimulation of the anus and preserved in a sterilized tube. Deoxycholate hydrogen

73

sulfide-lactose agar (Elken Chemical Co., Tokyo, Japan) medium was used for the

recognition of Salmonella and Escherichia coli according to the methods of

Ishihara et al. [54]. The Cryptosporidium parvum test strip BIO K 155 (Bio-X

Diagnostics, Jemelle, Belgium) was used according to the manufacturer’s

instructions with 0.1 g of stool sample and was evaluated visually. For the

detection of coccidia spores, a previously described microscopic method was used

[66]. For rotavirus, a specific test strip (SA Scientific, San Antonio, TX, U.S.A.)

was used following the product use recommendations. Among the scouring calves

diagnosed as pathogen-positive (n=16), the pathogens found were rotavirus 43 %,

coccidian Eimeria bovis and/or Eimeria zuernii 25 %, C. parvum 19 %, E. coli 13 %

and Salmonella 0% (Figure 3.1). Those calves with negative stool tests were

assigned to the non-pathogenic scouring groups, and clinically healthy calves

without scouring were placed in the healthy groups. The scouring status of each

calf was inspected every day. Reduced occurrence of scouring and an improvement

in clinical status were noted in the BP-treated calves on day 7.

Statistical Analysis

The number of CD-positive or -negative cells was calculated from the

percentages of leukocytes gated by flow cytometry and total PBMCs. The values

are expressed as means ± SE. GraphPad Prism ver.5.01 software (La Jolla, CA,

U.S.A.) was used for the statistical calculations and one-way ANOVA, and the

Kruskal-Wallis test was subsequently used to evaluate differences among the

groups. A P-value <0.05 was considered significant.

74

Results

Subpopulations of Peripheral Leukocytes and Blood Biochemistry Profile

Compared with the values of the healthy control (HC) and healthy treated

(HT) groups on day 0, a significantly lower (P<0.05) number of CD3+ T cells; CD4+,

CD8+ and WC1+ γδ T cell subsets; and CD14+ cells were noted in the peripheral

blood of scouring pathogen positive treated (PPT) and pathogen positive control

(PPC) calves. On day 0, the numbers of CD3+ T cells; the CD4+, CD8+ and WC1+ γδ

T cells subsets; and CD14+ cells were lower (P<0.05) in the PPT and PPC groups

than in the other groups. The number of CD21+ cells was similar among the

scouring and healthy groups on day 0 (Figure 3.1). Compared to the HC group,

CD3+ T cells; the CD4+, CD8+ and WC1+ γδ T cell subsets; and CD14+ and CD21+

cells were increased (P<0.05) in the scouring PPT, PNT and PPC groups on day 7.

However, the numbers of CD8+ and CD21+ cells were unchanged in the scouring

PNC group on day 7. The values among the scouring PPT and PPC, and scouring

pathogen negative treated (PNT) and pathogen negative control (PNC) groups

were not significantly different on day 7. Moreover, compared with the values on

day 0 and those of the HC group, an increased (P<0.05) number of CD3+ T cells;

the CD4+, CD8+ and WC1+ γδ T cell subsets; and CD14+ and CD21+ cells were

noted in the HT group on day 7. Compared with the value on day 0, WC1+ γδ T

cells were increased (P<0.05) in the HC group on day 7. Likewise, compared with

the values on day 0, PBMCs were increased (P<0.05) in the scouring PPT, PNT

and HT groups on day 7. A discrete analysis of the data indicated that the

numbers of CD45R+ and CD45R– T cells were increased (P<0.05) in the proportion

75

of CD3+ (CD3+CD45R+/CD45R–) T cells, CD4+ (CD4+CD45R+/CD45R–) and CD8+

(CD8+CD45R+/CD45R–) T cell subsets in the scouring PPT, PNT, PPC and HT

groups on day 7, compared to the values on day 0 in the same group or the HC

group. However, the values were increased (P<0.05) only in the number of CD3+

(CD3+CD45R+) T cells and CD4+ (CD4+CD45R+) T cell subset in the scouring PNC

group on day 7. The values were not significantly different among the scouring

PPT, PNT, PPC and PNC groups (Tables 3.2 – 3.3). Peripheral TLR2+ (CD282)

monocytes were evaluated only in the scouring PPT, PNT, HT and HC groups.

Similar to that of the T cell subpopulations, a significantly lower (P<0.05) number

of peripheral TLR2+ monocytes were noted in the scouring calves on day 0.

However, the number of TLR2+ monocytes was increased (P<0.05) in the scouring

PPT, PNT and HT groups on day 7, compared with the values on day 0 and that of

the HC group (Figure 3.3).

In this study, the serum IgG concentration didn’t measured, however we

examined the serum total protein (TP) and albumin (ALB) concentration in all

grups. The values were not significant among the groups. Furthermore, blood urea

nitrogen (BUN), non-esterified fatty acids (NEFA), total cholesterol (T-chol) and

glucose (Glu) concentrations were measured. The values were not significant

among the groups (Tables 3.4 – 3.5).

Messenger RNA Expression of Cytokines

Compared with the value for the HC calves, the mRNA expression levels of

IL-6 and IFN-γ were lower (P<0.05) in the scouring PPT, PNT, PPC and PNC

groups on day 0. The mRNA expression level of TNF-α was lower (P<0.05) in the

76

scouring PPT and PPC groups, but the values were greater in the scouring PNT,

PNC, HT and HC groups on day 0 (Figure 3.3). IL-6, IFN-γ and TNF-α mRNA

expression was increased (P<0.05) in the PPT, PNT, PPC, PNC and HT groups on

day 7. Furthermore, compared to day 0, the TNF-α mRNA expression level was

higher (P<0.05) in the HC group on day 7. The mRNA expression level of IL-8 was

similar between the scouring and healthy calves on day 0, but was elevated

(P<0.05) in the scouring PPT and PPC groups on day 7. Compared to the HC

group, the expression of IL-8 mRNA was slightly higher in the HT group on day 7,

but the differences were not statistically significant.

Discussion

Some reports have indicated that a BP including LAB reduced the rate of GIT

disorders in calves [1, 92, 122, 126]. Increased intestinal microbiota might

stimulate the gut epithelial and associated lymphoid tissues and may activate

local immune responses in the intestine [67]. It was also suggested that a

decreased number of peripheral leukocytes, including CD8+ and WC1+ γδ T cells,

might result in a high risk of calf scouring [93]. Similarly, a lower number of CD4+

and CD8+ cells and reduced cytokine mRNA expression levels were noted in

neonates with diarrhea, compared with healthy children [38, 137]. In agreement

with a previous report by Ohtsuka et al. [93], the numbers of CD4+, CD8+ and

WC1+ γδ T cell subsets and of CD14+ and TLR2+ cells were significantly lower in

scouring calves in the present study. BPs are known to affect the host immune

system in different ways, such as inducing greater antibody production and

increasing epithelial barrier integrity, the upregulation of cell-mediated

77

immunity, increased TLR signaling, enhanced dendritic cell (DC)-T cell

interactions and heightened T cell associations [25, 57, 61, 110]. The immune-

stimulating properties of a Bacillus-based probiotic were suggested by the increase

in peripheral blood CD8+ cells in scouring calves compared with controls [92].

Furthermore, the number of CD4+ cells increased in response to a BP consisting of

C. butyricum in dairy cows [61]. In a study of calf PBMCs, the phagocytic

activities of leukocytes were increased by a BP consisting of L. plantarum [57]. In

addition, selective effects of a BP including Lactobacillus were reported for T cell

activation, CD8+ cell activity and cytokine production [25]. Most peripheral T cell

subpopulations have expressed CD3 on their surface, which might appear as a

signal-transducing unit for the T cell receptor (TCR) [110]. Similar to study in the

chapter one, the proportion of CD3+CD45R+ T cells was marginally higher in the

systemic circulation of preweaning scouring and HT calves. Alike to previous

reports, a greater presence of CD45R+ T cells might facilitate the regular

activation of T cell subsets in BP-treated calves [92]. In contrast, bovine WC1+ γδ

T cells are known to be immune suppressors and are involved in secreting IFN-γ

[50, 94, 99]. WC1+ γδ T cells can respond to stimulation via the TCR and through

CD3, leading to the induction of IFN-γ expression in these cells [110]. Early

production of IFN-γ by γδ T cells may have a role in linking innate and adaptive

immune responses [99]. Furthermore, bovine γδ T lymphocyte subsets are

activated indirectly through cytokines secreted by T cells, APCs and other

accessory cells [50, 94, 105]. Our results show that the number of WC1+ γδ T cells

were increased in both the scouring and healthy treated groups compared to the

78

controls, and was associated with increased IFN-γ expression. In addition, WC1+

γδ T cells were also greater in number in the healthy control group. This is in

accordance with a previous report, which noted that γδ cell subsets were

significantly larger in fetal and maturing calves than in mature animals [145].

BP including Lactobacillus and C. butyricum induce the releases of IL-6 and

TNF-α, which are involved in nonspecific immune responses [40]. It was

previously reported that preweaning calves given a BP had increased serum IgG

and IFN-γ levels [122]. Furthermore, BP including E. faecium and C. butyricum or

Lactobacillus induced the production of pro- and anti-inflammatory cytokines,

including IL-6, IFN-γ and TNF-α, in human PBMCs [25, 52]. In the present study,

increased IL-6, INF-γ and TNF-α mRNA expression was observed in the scouring

treated, healthy treated and control groups. In contrast, IL-8 mRNA expression

was unchanged, but it was elevated in the scouring groups. Greater expression of

IL-8 is likely related to neutrophil function and inflammatory stimulation in

bovines [6]. Therefore, IL-8 mRNA expression was changed only in scouring

calves, but not in healthy calves. It was reported that TNF-α mRNA expression

was related to age-related changes in intracellular cytokine production [38]. In

the present study, a higher TNF-α mRNA expression level was also noted in the

healthy control calves.

TLR expression is associated with bacterial immune stimulators, including

LAB, in the GIT of calves [77]. In bovines, the expression of TLR2 was obvious

on PACs with a high level expression on peripheral monocytes and GIT

macrophages [57, 63, 76]. Moreover, bovine TLR2 cell surface molecules on

79

monocyte-derived DCs and intestinal macrophages are most responsible for the

recognition of Gram-positive bacteria [11, 26, 57]. In human PBMCs, monocytes

presenting TLRs played an important role in Lactobacillus-induced immunological

responses [25]. Mechanisms indicating a direct role for TLR2 include bacterial

reorganization by epithelial macrophages in calves [77]. However, CD14+ cells are

involved with the TLR4 and MD2 complex, which is essential for the response to

most Gram-negative bacteria [57, 63, 77, 131]. Among BPs, Lactobacillus strains

having a rigid cell wall that is resistant to intracellular digestion and can

stimulate intestinal macrophages presenting TLR2 to secrete a large quantity of

cytokines [120]. In the present study, the numbers of CD14+ and TLR2+ cells were

increased in the scouring and HT calves compared to the controls. A B-cell

receptor complex including CD21 is present on mature B cells and ileal Peyer’s

patch-derived B lymphocytes in young calves [89]. The stimulation of CD21+ cells

is related to intestinal immune stimuli, and BPs are known to trigger naive

plasma cells to become IgA-producing CD21+ B cells [46, 75, 141]. In our study, the

number of CD21+ cells was increased in the scouring and healthy BP-treated

calves on day 7. An interaction between BPs and the host immune system leads to

the interface of intestinal immune cells, such as CD14+ and TLR+ cell

macrophages or DCs and to the release of cytokine stimulators by T and B cells

[26, 34]. The activation and balanced response of T cells is an important

component of the recovery from GIT disease in cattle [77, 141]. BPs contribute to

homeostasis of the intestinal bacterial flora and result in scouring recovery in

young calves [92, 122, 126].

80

In the present study, a BP was administrated to preweaning scouring calves

for 5 days, and stool samples were examined to discover the underlying cause of

scouring. The scouring PPT and PPC or PNT and PNC groups revealed a greater

number of peripheral leukocytes and higher cytokine mRNA expression levels on

day 7, although the immune marker values were slightly higher in the PPT and

PPC groups compared with PNT and PNC groups. Higher immune marker values

on day 7 in the both pathogen-positive and pathogen-negative scouring groups

(PPT and PNT) might be induced by BP administration and scouring causers.

Because calves were in the pre-ruminant stage of life, and the BP was mixed with

milk replacer for 5 consecutive days. Therefore, it was contented that a high

amount of BP might reach to the intestine and affected the intestinal immune

system. Furthermore, the increased numbers of circulating immune cells in HT

group indicated the immune-stimulatory effects of the BP, as suggested by

previous studies [29, 61]. On the other hand, the scouring calves given no BP (PPC

and PNC groups) exhibited greater expression of immune markers on day 7, which

might be associated with the usual reaction of immune system through the GIT

disorders [137]. Recently the effects of a BP was examined on the immune

markers in scouring calve [92], but the scouring etiology was not concerned. In

this study, we examined the stool sample to demonstrate the etiology of scouring

and variations of cellular immune function in both pathogenic and non-pathogenic

scour conditions. However, it was unknown that which pathogen specifically was

related to calf scour. The recovery of scouring in the calves given BP was in

agreement with that in previous reports [1, 46, 58, 92]. In this study, most

81

scouring cases examined had a slight to moderate diarrhea, even pathogen

positive calves didn’t show a severe scouring on day 0. The calves were entered to

experiment soon after scouring noted, and were treated by 5-days (d 0-5) repeated

doses of BP. Therefore, a developing condition and scouring recovery was noted in

the treatment groups on day 7. In addition, unlike to the pathogen negative or

healthy groups, a significant reduced number of immune markers in the pathogen

positive groups on day 0, which might support a potential cause for inducement of

pathogenic scouring. The higher immune markers in the scouring pathogen-

positive calves on day 7 might be due to a natural reaction of immune system in

response to the scour cases. From these findings, BP administration to the

scouring calves might be effective in both pathogen-positive and pathogen-

negative cases. In this study, serum IgG was not analyzed. However, it was

previously suggested that the serum IgG concentration was increased by BP

administration in preweaning calves [126]. As calf scour is related with the

various GIT disorders, the cellular immunity reaction is thought to be most

important for recovery or prevention of scouring. This is concluded that a

significantly smaller number of peripheral leukocytes and decreased cytokine

mRNA expression level might induce by scouring. Repeated administration of a

BP might stimulate cellular immune function and encourage the recovery of

scouring in preweaning Holstein calves.

66

Table 3.1. Scouring and healthy Holstein preweaning calves used in this study

a) Days, mean ± SD; b) Physical condition and appetite of all calves were almost good. PPT, pathogen positive treated; PNT,

pathogen negative treated; PPC, pathogen positive control; PNC, pathogen negative control; HT, healthy treated; HC,

healthy control.

Holstein calves

Clinical Status

Groups

No.

Age a)

Sex

Treatment

(days)

Recovery

(days) Male Female Scour condition b)

PPT n=8 12 ± 5 n=7 n=1

Watery-moderate (n=2), mucosal

(n=1) and muddy diarrhea (n=3)

5 ≤ 7

PNT n=6 15 ± 1 n=5 n=1

Watery-moderate (n=4) and muddy

diarrhea (n=2)

5 < 5

PPC n=8 12 ± 3 n=6 n=2

Watery-moderate (n=5) and mucosal

Diarrhea (n=3)

0 > 7

PNC n=6 10 ± 5 n=6 n=0

Moderate diarrhea (n=6) 0 5

HT n=6 8 ± 3 n=6 n=0

Normal 5 __

HC n=8 10 ± 6 n=8 n=0 Normal 0 __

82

82

83

Figure 3.1. Number of CD3, CD4, CD8, CD14, CD21, and WC1 cells in the

peripheral blood of scouring pathogen positive treated (PPT; n=8), pathogen-

negative treated (PNT; n=6), and healthy calves healthy treated (HT; n=6)

preweaning calves. Each calf in treatment groups given 3.0 g/100 kg BW of probiotic

once daily for 5 days. Scouring pathogen-positive control (PPC; n=8), pathogen-

negative control (PNC; n=6), and healthy control (HC; n=8) calves without probiotic

were served as control groups. Values represented the means ± SE. * Compared to

day 0 in the same group, # Compared to the HC group (P<0.05). The first day

scouring occurrence, and probiotic treatment was deemed day 1.

84

Figure 3.2. Number of TLR2 (CD282) cells in the peripheral blood of scouring

pathogen positive treated (PPT; n=8), pathogen-negative treated (PNT; n=6),

and healthy treated (HT; n=6) preweaning calves. Each calf in treatment

groups given 3.0 g/100 kg BW of probiotic once daily for 5 days. Healthy

control (HC; n=8) calves without probiotic were served as control group.

Values represented the means ± standard errors. * Compared to day 0 in the

same group, # Compared to the HC group (P<0.05). The first day scouring

occurrence, and probiotic treatment was deemed day 1.

83

Table 3.2. The numbers of peripheral blood mononuclear cell (PBMC) and CD3+, CD4+ and CD8+ (CD45R– / CD45R+) T cells (cell/µl) in

the scouring probiotic-treated and scouring control calves

Within a row, values represent the means ± SE. a) pathogen negative treated (n=6); b) pathogen positive control (n=8); c) pathogen

negative treated (n=6); d) pathogen negative control (n=8). * Compared to day 0 in the same group (P<0.01). # Compared to the values

in the control groups (P<0.05).

PPTa)

PPCb)

PNTc) PNC

d)

Day 0 Day 7 Day 0 Day 7 Day 0 Day 7 Day 0 Day 7

PBMC 3822 ± 313 5947 ± 554* 4231 ± 430 5658 ± 952* 4140 ± 422 5610 ± 393* 4427 ± 495 5126 ± 425

CD3+CD45R– 1064 ± 85 2342 ± 282* 1088 ± 103 2656 ± 565* 1375 ± 127 2228 ± 268* 1185 ± 79 2558 ± 401*

CD3+CD45R+ 564 ± 27 1394 ± 150* 361 ± 28 1305 ± 288* 552 ± 60 1419 ± 131*# 678 ± 85 968 ± 160*

CD4+CD45R– 73 ± 14 320 ± 47* 133 ± 18 377 ± 53* 155 ± 41 205 ± 25* 111 ± 17 287 ± 75*

CD4+CD45R+ 264 ± 23 963 ± 151* 177 ± 29 978 ± 144* 344 ± 63 1049 ± 130*# 450 ± 98 654 ± 58*

CD8+CD45R– 80 ± 43 201 ± 22* 67 ± 15 284 ± 41* 44 ± 12 113 ± 32* 58 ± 7.0 96 ± 15

CD8+CD45R+ 204 ± 16 710 ± 142*# 238 ± 41 409 ± 73* 328 ± 46 505 ± 52*# 290 ± 51 305 ± 60

85

86

Table 3.3. The numbers of peripheral blood mononuclear cell (PBMC) and CD3+,

CD4+ and CD8+ (CD45R– / CD45R+) T cells (cell/µl) in healthy probiotic-treated

and healthy control calves

Within a row, values represent the means ± SE, a) healthy treated calves

(received 3.0 g/100 kg of probiotic for 5 days; n=6); b) healthy control calves

without treatment (n=8). *Compared to day 0 in the same group (P<0.01).

# Compared to healthy control on the same day (P<0.05).

HTa)

HCb)

Day 0 Day 7

Day 0 Day 7

PBMC 3808 ± 258 7218 ± 365*

4500 ± 238 5148 ± 476

CD3+CD45R– 1498 ± 98 2003 ± 491*

1621 ± 116 1725 ± 198

CD3+CD45R+ 1042 ± 45 1815 ±

105*#

979 ± 71 1114 ± 152

CD4+CD45R– 108 ± 21 284 ± 22*

128 ± 34 219 ± 51

CD4+CD45R+ 501 ± 71 1307 ± 96*#

482 ± 81 439 ± 81

CD8+CD45R– 50 ± 7.5 101 ± 14*

52 ± 12 68 ± 11

CD8+CD45R+ 421 ± 22 693 ± 66*

409 ± 50 502 ± 70

87

Figure 3.3. Relative mRNA expression of IL-6, IL-8, TNF-α, and IFN-γ in the

peripheral blood of scouring pathogen positive treated (PPT; n=8), pathogen-

negative treated (PNT; n=6), and healthy treated (HT; n=6) preweaning calves. Each

calf in treatment groups given 3.0 g/100 kg BW of probiotic once daily for 5 days.

Scouring pathogen-positive control (PPC; n=8), pathogen-negative control (PNC;

n=6), and healthy control (HC; n=8) calves without probiotic were served as control

groups. Values represent the means ± SE.* Compared to day 0 in the same group, # Compared to the HC group (P<0.05). The first day scouring occurrence and

probiotic treatment was deemed day 1.

86

Table 3.4. Blood biochemistry profile in scouring probiotic-treated and scouring control calves

Within a row, values represent the means ± SE. a) pathogen negative treated (n=6); b) pathogen positive control (n=8); c)

pathogen negative treated (n=6); d) pathogen negative control (n=8). sTP, serum total protein; ALB, albumin; BUN,

blood urea nitrogen, NEFA, non-esterified fatty acids; T-chol, total cholesterol; Glu, glucose.

Item

PPT a) PPC b) PNT c) PNC d)

Day 0 Day 7 Day 0 Day 7 Day 0 Day 7 Day 0 Day 7

sTP ( g/d ) 6.1 ± 0.1 5.5 ± 0.2 6.0 ± 01 5.2 ± 0.5 5.6 ± 0.2 5.3 ± 0.1 5.4 ± 0.1 6.0 ± 0.1

ALB ( g/d ) 3.1 ± 0.1 3.1 ± 0.2 3.2 ± 0.1 2.8 ± 0.3 3.3 ± 0.1 3.2 ± 0.1 3.1 ± 0.1 3.3 ± 0.1

BUN (mg/dl) 11.2 ± 1.8 10.2 ± 1.6 10.6 ± 0.6 8.5 ± 1.0 11 ± 0.1 9.5 ± 0.5 11.2 ± 1.0 10.2 ± 0.3

NEFA (µEq/l) 311 ±11.9 242 ± 5.6 188 ± 17 149 ± 22 200 ± 9.2 194 ± 7.6 263 ± 4.0 225 ± 11.0

T-chol (mg/dl) 60 ± 7.8 57.8 ± 7.6 56 ± 5.4 73 ± 9.0 69 ± 6.6 57 ± 4.5 80 ± 2.4 79 ± 6.7

Glu (mmol/l) 112 ± 4.0 96.2 ± 3.4 92 ± 3.2 86 ± 12 103 ± 2.0 101± 3.2 923 ± 4.8 94 ± 2.7

88

89

Table 3.5. Blood biochemistry profile in healthy probiotic treated and control calves

With a row, values represent the means ± SE. a) healthy treated calves (n=8); b)

healthy control calves (n=8). sTP, serum total protein; ALB, albumin; BUN,

blood urea nitrogen, NEFA, non-esterified fatty acids; T-chol, total cholesterol;

Glu; glucose

Item

HT a) HC b)

Day 0 Day 7 Day 0 Day 7

sTP ( g/d ) 5.2 ± 0.1 4.0 ± 0.1

5.7 ± 0.2

5.6 ± 0.2

ALB ( g/d ) 3.2 ± 0.1 2.5 ± 0.5

3.0 ± 0.1

3.1 ± 0.1

BUN (mg/dl) 10.1 ± 1.0 10.7 ± 1.4

10.2 ± 1.0

8.8 ± 0.7

NEFA (µEq/l) 249 ± 3.7 245 ± 1.7

141 ± 2.2

159 ± 4.1

T-chol (mg/dl) 80 ± 1.3 70 ± 1.7

74 ± 1.2

93 ± 1.7

Glu (mmol/l) 116 ± 3.0 79 ± 1.6

138 ± 4.1

115 ± 6.5

90

Summary and Conclusions

Probiotic originally refers to the microorganisms that have beneficial effects

on their hosts. The effects of viable bacterial probiotics (BPs) in ruminants are

involved in increased ruminal performance and animal health. It is known that

BPs are induce their beneficial effects by improvement of the host gastrointestinal

tract (GIT) microbiota. BPs contributes the host intestinal microbiota balance, as

useful biological factors, resulting in the development of the host immune system.

Lactic acid bacteria (LAB) are commonly used BPs in ruminants. Most LABs used

for ruminants as probiotic are the animal origin organisms, and therefore such

microbial products increase the animal health and growth. A repeated oral

administration of LAB probiotics is a best solution for promoting decreases in the

GIT microbiota of newborn calves. For the recent years, several studies have

revelaed the usefulness of BPs on development of local and systemic immune

system in calves. However, the interaction mechanism between BPs and the host

immune system is not fully understood in ruminants. In newborn calves, a

decrease in the number of GIT microbiota and frail immune system is almost

related with GIT disorders. In contrast, a balanced GIT microbiota promotes

animal growth, stimulates the host immune system and decreases GIT disorders

in newborn calves. PBs have been used for the treatment of calf scouring, and the

studies on this treatment have revealted encouraging results. Therefore, BP

therapy with demonstrated health effects is a novel approach of probiotic research

in ruminants. A certain BPs are reported to develop the ruminal performance and

animal health, however, very few information on the effects of a multi-strain BP

91

on the ruminal components and also cellular immune function is available in

calves.

In the first chapter, to confirm the effects of a BP on ruminal components and

to evaluate changes in the number of bacteria consisting in the BP product in the

rumen, ruminal properties of weaned calves were studied. Twelve ruminally

cannulated Holstein calves (age, 12 ± 3 weeks) were adapted to a standard diet for

1 week, and then the BP consisting of L. plantarum, E. faecium and C. butyricum

was given once daily for 5 consecutive days (day 1–5) at 1.5 or 3.0 g/100 kg BW to

groups of four calves each. Four additional calves fed the standard diet without BP

served as the corresponding control. Ruminal pH was measured continuously

throughout the 15-day experimental period. Ruminal fluid was collected via a

fistula at a defined time predose and on days 7 and 14 to assess volatile fatty acids

(VFA), lactic acid (LA) and NH3-N concentrations, as well as the rumen bacterial

communities were evaluated by real-time PCR and terminal-restriction-fragment

length polymorphism (T-RFLP) methods. The BP at either dose improved the

reduced 24-hr mean ruminal pH (6.6 – 6.8) in calves. The circadian patterns of the

1-h mean ruminal pH were identical between the BP doses. In both BP-treated

groups, ruminal LA concentrations remained significantly lower than that of the

control. BP did not affect ruminal VFA concentrations. Bacteria consisting in the

BP product were not detected in the rumen of calves, however other predominate

rumen bacteria remained stable. These results suggest that calves given a BP had

invariable ruminal pH levels, presumably due to the effects of the BP treatment

on stabilizing rumen-predominant bacteria, consuming LA in the rumen.

92

In the second chapter, to comprehends the effects of the BP on the immune

function in calves, changes in the number of peripheral leukocytes, including CD3+

T cells, CD4+, CD8+ and WC1+ T cell subsets, and TLR2+, CD14+ and CD21+ cells

were examined. Furthermore, mRNA expression of cytokines such as IL-6, IL-8,

TNF-α and INF-γ of peripheral leukocytes were evaluated. The BP consisting of L.

plantarum, E. faecium, and C. butyricum was administered orally at 3.0 g/100 kg

BW to healthy weaned Holstein calves (mean age, 10±3 weeks) once daily for 5

consecutive days. Calves given the vehicle alone with no BP served as the control.

In the treatment group, increases in numbers of TLR2+ monocytes, CD3+ T cells

and CD4+, CD8+ and WC1+ γδ T cells were noted on day 7 post-placement

compared to predose day and the control group. Expression of IL-6, INF-γ and

TNF-α was elevated in peripheral leukocytes on days 7 and 14. The results of this

study suggest that peripheral blood leukocytes in healthy weaned calves may be

stimulated via the GIT microbiota, which was increased by the oral BP treatment,

with overall stability of the ruminal microbiota.

In the third chapter, the study was designed to examine the immune-

stimulatory and scouring therapeutic effects of the BP agent in the preweaning

scouring and healthy calves in the field. Similar to the first chapter, changes in

the numbers of peripheral leukocytes and their cytokine mRNA expression were

evaluated. Preweaning Holstein calves (mean age, 10 ± 5 days, n=42) were

assigned to the scouring and healthy BP treated and the control groups. Each

group was subdivided into pathogen-positive treated (n=8), pathogen-positive

control (n=8), pathogen-negative treated (n=6), pathogen-negative control (n=6),

93

healthy treated (n=6) and healthy control (n=8) groups. A single dose (3.0 g/100 kg

BW) of the BP consisting of L. plantarum, E. faecium and C. butyricum was given

to each calf in the treatment groups for 5 consecutive days. Blood samples were

collected on the first day of scour occurrence (day 0) and on day 7. In the scouring

calves, significantly decrease in peripheral leukocyte subpopulations and cytokine

mRNA expression levels were noted on day 0. The numbers of CD3+ T cells; CD4+,

CD8+ and WC1+ γδ T cell subsets; and CD14+, CD21+ and TLR2+ cells were

significantly increased in the scouring and healthy treated calves on day 7.

Furthermore, IL-6, TNF-α and INF-γ mRNA expression was elevated in the

peripheral leukocytes of the scouring and healthy treated calves on day 7.

Scouring was recovered in calves given the BP on day 7. In this study, it was

concluded that a significantly decreased number of peripheral leukocytes and

lower cytokine mRNA expression level in the scouring calves might be induced by

scouring. However, repeated BP administration might stimulate cellular

immunity and encourage the recovery from scouring in preweaning calves. These

data provides new knowledge on the effects of a BP on the peripheral leukocytes

function in scouring and healthy preweaning Holstein calves.

In general conclusions, healthy weaned Holstein calves revelated invariable

ruminal pH values correlated with the significant lower LA concentrations in BP

treated calves compared to the controls. From the data presented and the previous

studies on the effects of probiotic, it was concluded that the repeated BP treatment

affected ruminal pH due the modulation of the rumen predominant bacteria.

Moreover, it was suggested that the significant lower LA concentration resulted

94

from the increased LA consumption in the rumen due to modulation of the

predominant bacteria after BP treatment in the weaned calves. The invariable

ruminal pH (6.6 – 6.8) is thought to provided a favor environment for the growth

of acid-sensitive bacteria in the rumen. The present studt also provided the

evidence that the BP treatment increased immune markers by effects of the

rumen predominant bacteria in weaned calves. Therefor, it is possible to conclude

that the modulation and colonization of rumen predominant bacteria result in the

stimulation of the cellular immune function in healthy weaned calves (Figure 3),

although the effect of BP on the number of intestinal microbiota is unknown in

this study.

Regarding the effect of the same BP product on the immune markers levels in

preweaning Holstein calves, repeated BPs administration resulted in increased

number of peripheral leukocytes and their cytokine mRNA expression in scouring

pathogen positive, scouring pathogen negative and healthy treated groups

compared with their pre-treatment valuse (day 0) and the the levels of the control

groups. Finally, BP-treatment encouraged scouring recovery in preweaning

Hostein calves. Therfore, the repeated treatment of healthy calves with a 5-day

BP regimen could elevate the levels of reduced cellular immune markers; thereby

reducing the incidence of scouring in young calves.

The results in this study project give an additional knowledge a new insight in

understanding the effects of a multi-strain BP on the ruminal components of

weaned calves. These results would be used to mark the value of BP-treatment for

preventing reduced ruminal pH, which might diminish the incidence of ruminal

95

acidosis in high concentrated feed calves. Studies of the BP effects on the calves’

immune markers provide additional knowledge to understand the interaction

between BP and cellular immune system in the ruminants. Furthermore, the

study on the field preweaning scouring calves provided the evidence that reduce in

the number of peripheral leukocytes might be the cause of scouring in newborn

calves. BP-treatment resulted in scouring recovery through stimulation and

alerted cellular immune faction in preweaning Holstein calves. Therefore, the

course of 5-day repeated BP might reduce decrease in the number of immune

markers and prevent incidence of scouring in newborn healthy calves. Additional

research is needed to determine whether possible linked effects and interaction of

individual bacteria of the multi-strain BP products on the GIT microbial

communities associated to the stimulation of cellular immune function in calves.

96

Figure 3. Schematic of bacterial probiotic effect on the stimulation of immune system

in weaned and pre-weaning calves

97

References

1. Abe, F., Ishibashi, N. and Shimamura S. 1995. Effect of administration of

bifidobacteria and lactic acid bacteria to newborn calves and piglets. J. Dairy

Sci. 78: 2838–2846.

2. Anderson, K. L., Nagaraja, T. G., Morrill, J. L., Avery, T. B., Galitzer, S. J. and

Boyer, J. E. 1987. Ruminal microbial development in conventionally or early-

weaned calves. J. Anim. Sci. 64:1215–1226.

3. Aschenbach, J. R., Penner, G. B., Stumpff, F. and Gäbel, G. 2011. Ruminant

nutrition symposium: Role of fermentation acid absorption in the regulation of

ruminal pH. J. Anim. Sci. 89:1092–1107.

4. Baldwin, C. L., Sathiyaseelan, T., Rocchi, M. and McKeever, D. 2000. Rapid

changes occur in the percentage of circulating bovine WC1+ γδ Th1 cells. Res.

Vet. Sci. 69:175–180.

5. Beauchemin, K. A., Yang, W. Z., Morgavi, D. P., Ghorbani, G. R., Kautz, W.

and Leedle, J. A. 2003. Effects of bacterial direct-fed microbials and yeast on

site and extent of digestion, blood chemistry, and subclinical ruminal acidosis

in feedlot cattle. J. Anim. Sci. 81: 1628–1640.

6. Beecher, C., Daly, M., Berry, D. P., Klostermann, K., Flynn, J., Meaney, W.,

Hill, C., McCarthy, T. V., Ross, R. P. and Giblin, L. 2009. Administration of a

live culture of Lactococcus lactis DPC 3147 into the bovine mammary gland

stimulates the local host immune response, particularly IL-1 beta and IL-8

gene expression. J. Dairy Res. 76: 340 –348.

98

7. Beharka, A. A., Nagaraja, T. G., Morrill, J. L., Kennedy, G. A. and Klemm, R.

D. 1998. Effects of form of the diet on anatomical, microbial, and fermentative

development of the rumen of neonatal calves. J. Dairy Sci. 81:1946–1955.

8. Belanche, A., Doreau, M., Edwards, J. E., Moorby, J. M., Pinloche, E. and

Newbold, C. J. 2012. Shifts in the rumen microbiota due to the type of

carbohydrate and level of protein ingested by dairy cattle are associated with

changes in rumen fermentation1-3. J. Nutr. 142:1684–1692.

9. Beutler, B., 2004. Inferences, questions and possibilities in toll–like receptor

signalling. Nature, 430: 257–263.

10. Bevans, D. W., Beauchemin, K. A., Schwartzkopf-Genswein, K. S., McKinnon,

J. J. and Mcallister, T. A. 2005. Effect of rapid or gradual grain adaptation on

subacute acidosis and feed intake by feedlot cattle. J. Anim. Sci. 83:1116–1132.

11. Boneca, I. G., Dussurgetc, O., Cabanesc, D., Nahori, M. A., Sousac, S., Lecuit,

M., Psylinakis, E., Bouriotis, V., Hugot, J. P., Giovannini, M., Coyle, A., Bertin,

J., Namane, A., Rousselle, J. C., Cayet, N., Pre´vost, M. C., Balloy, V.,

Chignard, M., Philpott, D. J., Cossart, P. and Girardin, S. E. 2007. A critical

role for peptidoglycan N-deacetylation in Listeria evasion from the host innate

immune system. Proc. Natl. Acad. Sci. U.S.A. 104: 997–1002.

12. Borchers, A. T., Selmi, C., Meyers, F. J., Keen, C. L. and Gershwin, M. E. 2009.

Probiotics and immunity. J. Gastroenterol. 44: 26–46.

13. Chen, Y., Masahito, O. and Guan, L. L. 2012. Variation of bacterial

communities and expression of Toll-like receptor genes in the rumen of steers

99

differing in susceptibility to subacute ruminal acidosis. Vet. Microbiol. 159:

451–459.

14. Cheplin, H. A. and Rettger, L. F. 1920. Studies on the transformation of the

intestinal flora, with special reference to the implantation of bacillus

acidophilus: II. Feeding Experiments on Man”. Proc. Nati. Acad. Sci. U. S. A. 6:

704–705.

15. Chiquette, J. M., J. Allison, and M. A. Rasmussen. 2008. Prevotella bryantii 25

A used as a probiotic in early lactation dairy cows: Effect on ruminal fermentat

ion characteristics, milk production, and milk composition. J. Dairy Sci. 91:353

6–3543.

16. Chiquette, J. 2009. The role of probiotics in promoting dairy production. Weste

rn Canadian Dairy Siminar, Advances in Dairy Technology, 21: 143–157.

17. Chiquette, J., M. J. Allison, and M. Rasmussen. 2012. Use of Prevotella bryanti

i 25A and a commercial probiotic during subacute acidosis challenge in midla

ctation dairy cows. J. Dairy Sci. 95:5985–5995.

18. Church, D. C. 1988. The ruminant animal: Digestive physiology and nutrition.

prentice- Hall, Inc. Englewood Cliffs, New Jersey. U.S.A. pp 21, 28.

19. Church, D. C. 1993. Ruminant animal: digestive physiology and nutrition.

Prentice-Hall, Inc. Englewood Cliffs, New Jersey, U.S.A. pp 112, 133.

20. Dasari, P., Nicholson, I. C., Hodge, G., Dandie, G. W. and Zola, H. 2005.

Expression of Toll-like receptors on B lymphocytes. Cell. Immunol. 236: 140–

145.

100

21. David, E. Gumbert. 2009. The raw milk revolution: Behind america's emerging

battle over food rights, 1st Edition, Edited by, Watson, B. and Jorstad, L.

Chelsea Green Publishing: U.S.A. pp 107–108.

22. David, F. T. and Sprent, J. 1994. Turnover of naïve- and memory- phenotype T

cells. J. Exp. Med. 179: 1127–1135.

23. Dijkstra, J., Forbes, J. M., France, J. 2005. Quantitative aspects of ruminant

digestion and metabolism. 2nd Edition, Wallingford, Oxfordshire, UK. CABI

Publishing, p. 736.

24. Dohme, F., DeVries, T. J. and Beauchemin, K. A. 2008. Repeated ruminal

acidosis challenges in lactating dairy cows at high and low risk for developing

acidosis: Ruminal p. J. Dairy Sci. 91:3554–3567.

25. Dong, H., Rowland, I., Tuohy, K. M., Thomas, L. V. and Yaqoob, P. 2010.

Selective effects of Lactobacillus casei Shirota on T cell activation, natural

killer cell activity and cytokine production. Clin. Exp. Immunol. 161: 378–388.

26. Drakes, M., Blanchard, T. and Czinn, S. 2004. Bacterial probiotic modulation

of dendritic cells. Infect. Immun. 72: 3299–3309.

27. Duffield, T., Plaizier, J. C., Fairfield, A., Bagg, R., Vessie, G., Dick, P., Wilson,

J., Aramini, J. and McBride, B. 2004. Comparison of techniques for

measurement of rumen pH in lactating dairy cows. J. Dairy Sci. 87:59–66.

28. Durand, F. C., Chevaux, E., Martin, C. and Forano, E. 2012.

Chapter 7: Probiotic in Animals, Use of yeast probiotics in ruminants: Effects

and mechanisms of action on rumen pH, fibre degradation, and microbiota

101

according to the diet. Edited by Rigobelo, E. C., Publisher, InTech, France, pp.

121, 125.

29. Emmanuel, D. G., Jafari, A., Beauchemin, K. A., Leedle, J. A. and Ametaj, B.

N. 2007. Feeding live cultures of Enterococcus faecium and Saccharomyces

cerevisiae induces an inflammatory response in feedlot steers. J. Anim. Sci. 85:

233–239.

30. FAO / WHO, 2006. Probiotics in food Health and nutritional properties and guidelines for

evaluation. Published by World Health Organiazation (WHO) and Food and Agriculture Or

ganiz-ation of the United Nation (FAO), Food and Nutration Paper 85, Rome.

31. Fasoli, S., Marzotto, M., Rizzotti, L., Rossi, F., Dellaglio, F. and Torriani, S.

2003. Bacterial composition of commercial probiotic products as evaluated by

PCR-DGGE analysis. Int. J. Food Microbiol. 82:59–70.

32. Fernando, S. C., Purvis, H. T., Najar, F. Z., Sukharnikov, L. O., Krehbiel, C. R.

Nagaraja, T. G., Roe, B. A. and DeSilva, U. 2010. Rumen microbial population

dynamics during adaptation to a high grain diet. Appl. Environ. Microbiol. p.

7482–7490.

33. Fischer, J., Suire, C. and Hale-Donze, H. 2008. Toll-like receptor 2 recognition

of the Microsporidia Encephalitozoon spp. Induces nuclear translocation of NF-

kappaB and subsequent inflammatory responses. Infection and Immunity,

76:4737–4744.

34. Foligne, B., Zoumpopoulou1, G., Dewulf, J., BenYounes, A., Chareyre, F.,

Sirard, J. C., Pot, B. and Grangette, C. 2007. A key role of dendritic cells in

probiotic functionality. PLoS One 3: e313.

102

35. Friis, L. M., Keelan, M. and Taylor, D. E. 2009. Campylobacter jejuni drives

MyD88-independent interleukin-6 secretion via Toll-like receptor 2. Infect.

Immun. 77:1553–1560.

36. Fuller, R. 1989. "Probiotics in man and animals". J. Appl. Bacteriol. 66 (5):

365–78.

37. Gabaev, I., Steinbrück, L., Pokoyski, C., Pich, A., Stanton, R. J., Schwinzer, R.,

Schulz, T. F., Jacobs, R., Messerle, M. and Kay-Fedorov, P. C. 2011. The

human cytomehalovirus UL11 protein interacts with the receptor tyrosine

phosphatase CD45 resulting in functional paralysis of T cells. PLoS Pathog. 7:

e1002432.

38. Gasparoni, A., Ciardelli, L., Avanzini, A., Castellazzi, A.M., Carini, R., Rondini,

G. and Chirico, G. 2003. Age-related changes in intracellular TH1/TH2

cytokine production, immunoproliferative T lymphocyte response and natural

killer cell activity in newborns, children and adults. Biol. Neonate. 84:297–303.

39. Geo, Q., Lili, Q., Tianxing, W. and Wang, J. 2012a. Clostridium butyricum

activates TLR2-mediated MyD88-independent signaling pathway in HT-29

cells. Mol. Cell Biochem. 361: 31–37.

40. Geo, Q., Lili, Q., Tianxing, W. and Wang, J. 2012b. An important role of

interleukin-10 in counteracting excessive immune response in HT-29 cells

exposed to Clostridium butyricum. BMC Microbiol. 12:100.

41. Ghorbani, G. R., Morgavi, D. P., Beauchemin, K. A. and Leedle, J. A. Z. 2002.

Effects of bacterial direct-fed microbials on ruminal fermentation, blood

103

variables, and the microbial populations of feedlot cattle. J. Anim. Sci.

80:1977–1985.

42. Gibson, Glenn R. 2004. Fibre and effects on probiotics: The prebiotic

concept. Clinical Nutrition Supplements 1: 25–31.

43. Greenwood, R. H., Morrill, J. L., Titgemeyer, E. C. and Kennedy, G. A. 1997. A

new method of measuring diet abrasion and its effect on the development of the

forestomach. J. Dairy Sci. 80:2534–2541.

44. Gutierrez-Fuentes C. G., Zuñiga-Orozco L. A., Vicente J, L., Hernandez-

Velasco X., Menconi, A., Kuttappan V. A., Kallapura, G., Latorre, J., Layton, S.,

Hargis, B. M. and Téllez, G. 2013. Effect of a lactic acid bacteria based

probiotic, Floramax-B11, on performance, bone qualities and morphometric

analysis of broiler chickens: an economic analysis. Biol. Syst. 2:113.

45. Harrison, H. N., R. G. Warner, E. G. Sander, and J. K. Loosli. 1960. Changes in

the tissue and volume of the stomachs of calves following the removal of dry

feed or consumption of inert bulk. J. Dairy Sci. 43:1301–1312.

46. Heczko, P. B., Strus. M. and Kochan. P. 2006. Critical evaluation of probiotic

activity of lactic acid bacteria and their effects. J. Physiol. Pharmacol. 57:5–12.

47. Heinrichs J. 2005. Rumen development in the dairy calf. Advances in Dairy

Technology Seminar, 17:179 –187.

48. Hinders, R. G., and F. G. Owen. 1965. Relation of ruminal parakeratosis

development to volatile fatty acid absorption. J. Dairy Sci. 48:1069 –1073.

49. Hobson, P. N. and Stewart C. S. 1997. The rumen microbial ecosystem, 2nd

Edition, New York: Springer, pp. 123, 214.

104

50. Hoek, A., Rutten, V. P., Kool, J., Arkesteijn, G. J., Bouwstra, R. J., Van Rhijn,

I. and Koets, A. P. 2009. Subpopulations of bovine WC1(+) gammadelta T cells

rather than CD4(+)CD25(high) Foxp3(+) T cells act as immune regulatory cells

ex vivo. Vet. Res. 40: 06.

51. Holzapfel, W. H., Haberer, P., Snel, J., Schillinger, U. and Huis in’t Veld, J. H.

1998. Overview of gut flora and probiotics. Int. J. Food Microbiol.41: 85-101.

52. Hua, M. C., Lin. T. Y., Lai, M. W., Kong, M. S., Chang, H. J. and Chen, C. C.

2010. Probiotic Bio-Three induces Th1 and anti-inflammatory effects in PBMC

and dendritic cells. World J. Gastroenterol. 16: 3529–3540.

53. Indart, M., Cerone, S., Esteban, E. N., Yaniz, G., Inza, A. G., Landi, H., Mogni,

S. and Igarza, L. 2012. Multispecies multistrain probiotic effects on calves

development and health. Open J. Vet. Med. 2: 225–229.

54. Ishihara, N., Chu, D. C., Akachi, S. and Juneja, L. R. 2001. Improvement of

intestinal microflora balance and prevention of digestive and respiratory organ

diseases in calves by green tea extracts. Livest. Prod. Sci. 68: 217–229.

55. Isolauri, E., Kirjavainen, P. V. and Salminen, S. 2002. Probiotics: a role in the

treatment of intestinal infection and inflammation? Cut 50: 54–59.

56. Kalliomaki, M. A. and Walker, W. A. 2005. Physiologic and pathologic

interactions of bacteria with gastrointestinal epithelium. Gastroenterol. Clin.

North. Am. 34: 383–99.

57. Kawakami, S., Tomoya, Y. and Naota, N. 2010. Leukocyte phagocytic activity

with or without probiotics in Holstein calves. Res. J. Biol. Sci. 5: 13–16.

105

58. Kawakami, S., Tomoya, Y., Naota, N. and Cia, Y. 2010. Feeding of lactic acid

bacteria and yeast on growth and diarrhea of Holstein calves. J. Anim. Vet.

Adv. 9: 1112–1114.

59. Khafipour, E., Li, S., Plaizier, J. C. and Krause, D. O. 2009. Rumen microbiome

composition determined using two nutritional models of subacute ruminal

acidosis. Appl. Environ. Microbiol. 75:7115–7124.

60. Kleerebezem, M., Hols, P., Bernard, E., Rolain, T., Zhou, M., Siezen, R. J. and

Bron, P. A. 2010. The estraceluler biology of the lactobacilli. FEMS Microbiol.

Rev. 34:199–230.

61. Kohiruimaki, M., Ohtuka, H., Tanami, E., Kitagawa, M., Masui, M., Ando, T.

and Kawamura, S. 2008. Effects of active egg white product/ Clostridium

butyricum Miyairi 588 additive on peripheral leukocyte populations in

periparturient dairy cows. J. Vet. Med. Sci. 70: 321–323.

62. Koike, S., Pan, J., Kobayashi, Y. and Tanaka, K. 2003. Kinetics of in sacco

fiber-attachment of representative ruminal cellulolytic bacteria monitored by

competitive PCR. J. Dairy Sci. 86:1429–1435.

63. Kwong, L. S., Parsons, R., Patterson, R., Coffey, T. J., Thonur, L., Changd, J.

S., Russell, G., Haig, D., Werling, D. and Hope, J. C. 2011. Characterisation of

antibodies to bovine toll-like receptor (TLR)-2 and cross-reactivity with ovine

TLR2. Vet. Immunol. Immunopathol. 139: 313–318.

64. Laarman, A. H., Sugino, T. and Oba, M. 2012. Effects of starch content of calf

starter on growth and rumen pH in Holstein calves during the weaning

transition J. Dairy Sci. 95:4478–4487.

106

65. Lane, D. J. 1991. 16S/23S rRNA sequencing in nucleic acid techniques in

bacterial systematic. Edited by Stackebrandt, E. and Goodfellow, M. Wiley,

New York. pp 115–175.

66. Lassena, B., Viltrop, A., Raaperi, K. and Ja¨rvis, T. 2009. Eimeria and

Cryptosporidium in Estonian dairy farms in regard to age, species, and

diarrhea. Vet. Parasitol. 166: 212–219.

67. Lebeer, S., Vanderleyden, J. and DeKeersmaecker, S. C. 2010. Host

interactions of probiotic bacterial surface molecules: comparison with

commensals and pathogens. Nat. Rev. Microbiol. 8: 171–184.

68. Leedle, J. A. Z., Barshun, K. and Hespell, R. B. 1986. Postprandial trends in

estimated ruminal digesta polysaccharides and their relation to changes in

bacterial groups and ruminal fluid characteristics. J. Anim. Sci. 62:789–803.

69. Lesmeister, K. E. and Heinrichs, A. J. 2004. Effects of corn processing on

growth characteristics, rumen development, and rumen parameters in

neonatal dairy calves. J. Dairy Sci. 87:3439–3450.

70. Li, M., Penner, G. B., Sanabria, E. H., Oba, M. and Guan, L. L. 2009. Effects of

sampling location and time, and host animal on assessment of bacterial

diversity and fermentation parameters in the bovine rumen. J. Appl. Microbiol.

107:1924–1934.

71. Lilly, D. M. and Stillwell, H. 1965. Probiotics: Growth-promoting factors

produced by microorganisms. Science, 147: 747–748.

72. Livek, K. and Schmitge, T. D. 2001. Analysis of relative gene expression data

using real-time quantitative PCR and the 2-ΔΔCt method. Methods 25: 402–08.

107

73. MacHugh, N. D., Mburu, J. K., Carol, M. J., Wyatt, C. R., Orden, J. A. and

Davis, W. C. 1997. Identification of two distinct subsets of bovine γδ T cells

with unique cell surface phenotype and tissue distribution. Immunology,

92:340–345.

74. Mackie, R. I. and Gilchrist, F. M. C. 1979. Changes in lactateproducing and

Lactate-utilizing bacteria in relation to pH in the rumen of sheep during

stepwise adaptation to a high-concentrate diet. Appl. Environ. Microbiol.

38:422–430.

75. Macpherson A. J. and Uhr, T. 2004. Induction of protective IgA by intestinal

dendritic cells carrying commensal bacteria. Science 303:1662–5.

76. Malmuthuge, N., Li, M., Friesb, P., Griebel, P. J. and Guan, L. L. 2012.

Regional and age dependent changes in gene expression of Toll-like receptors

and key antimicrobial defence molecules throughout the gastrointestinal tract

of dairy calves. Vet. Immunol. Immunopathol. 146: 18–26.

77. Malmuthuge, N., Li, M., Goonewardene, L. A., Oba, M and Guan, L. L. 2013.

Effect of calf starter feeding on gut microbial diversity and expression of genes

involved in host immune responses and tight junctions in dairy calves during

weaning transition. J. Dairy Sci. 96:3189–3200.

78. Martin, S. A. and Nisbet, D. J. 1992. Effect of direct-fed microbials on rumen

microbial fermentation. J. Dairy Sci. 75:1736–1744.

79. Matsuda, K., Tsuji, H., Asahara, T., Matsumoto, K., Takada, T. and Nomoto, K.

2009. Establishment of an Analytical System for the Human Fecal Microbiota,

108

Based on Reverse Transcription-Quantitative PCR Targeting of Multicopy

rRNA Molecules. Appl. Environ. Microbiol. 75:1961–1969.

80. Matsuki, T., Watanabe, K., Fujimoto, J., Kado, Y., Takada, T., Matsumoto, K.

and Tanaka, R. 2004. Quantitative PCR with 16S rRNA-gene-targeted species-

specific primer for analysis of human intestinal bifidobacteria. Appl. Environ.

Microbiol. 70:167–173.

81. Maxwell, F. J., Duncan, S. H., Hold, G. and Stewart, C. S. 2004. Isolation,

growth on prebiotics and probiotic potential of novel Bifidobacteria from pigs.

Anaerobe 10: 33–39.

82. McAllister, T. A., Beauchemin, K. A., Alazzeh, A. Y., Baah, J., Teather, R. M.

and Stanford, K. 2011. Review: The use of direct fed microbials to mitigate

pathogens and enhance production in cattle. Can. J. Anim. Sci. 91: 193–211.

83. Metchnikoff, E. 1907. Essais optimistes. Paris. The prolongation of life:

Optimistic studies. Translated and Edited by P. Chalmers Mitchell. London:

Heinemann, 1907. . pp 230–235.

84. Miron, J., Ben- Ghedalia, D. and Morrison, M. 2001. Invited review: Adhesion

mechanisms of rumen cellulolytic bacteria. J. Dairy Sci. 84:1294–1309.

85. Mourino, F., Akkarawongsa, R. and Weimer, P. J. 2001. Initial pH as a

determinant of cellulose digestion rate by mixed ruminal microorganisms in

vitro. J. Dairy Sci. 95:5067–5074.

86. Muta, T. and Takeshige, K. 2001. Essential roles of CD14 and

lipoplysaccharide- binding protein for activation of tool-like receptor (TLR) 2 as

109

well as TLR4.recostitution of TLR2 and TLR4 activation by distinguishable

ligands in LPS preparations. Eur. J. Biochem. 268: 4580–9.

87. Nagaraja, T. G. and Titgemeyer, E. C. 2007. Ruminal acidosis in beef cattle:

The current microbiological and nutritional outlook. J. Dairy Sci. 90 (E.

Suppl.):E17–E38.

88. Nakanishi, S., Kuwahara, T., Nakayama, H., Tanaka, M. and Ohnishi, Y. 2005.

Rapid species identification and partial strain differentiation of Clostridium

butyricum by PCR using 16S-23S rDNA intergenic spacer regions. Microbiol.

Immunol. 49:613–621.

89. Neill, J. D., Ridpath, J. F. and Liebler-Tinorio, E. 2006. Global gene expression

profiling of bovine immature B cells using serial analysis of gene expression.

Anim. Biotechnol. 17: 21–31.

90. Nocek, J. E., C. W. Heald, and C. E. Polan. 1984. Influence of ration physical

form and nitrogen availability on ruminal morphology of growing bull calves. J.

Dairy Sci. 67:334–343.

91. Nocek, J. E., Kautz, W. P., Leedle, J. A. Z. and Allman, J. G. 2002. Ruminal

supplementation of direct-fed microbials on diurnal pH variation and in situ

digestion in dairy cattle. J. Dairy Sci. 95:5985–5995.

92. Novak, K. N., Davis, E., Wehnes, C. A., Shields, D. R., Coalsonb, J. A., Smitha

A. H. and Rehberger, T. G. 2012. Effect of supplementation with an electrolyte

containing a Bacillus-based direct-fed microbial on immune development in

dairy calves. Res. Vet. Sci. 92: 427–434.

110

93. Ohtsuka, H., Ono, M., Saruyama, Y., Mukai, M., Kohiruimaki, M. and

Kawamura, S. 2011. Comparison of the peripheral blood leukocyte population

between Japanese Black and Holstein calves. Anim. Sci. J. 82: 93–98.

94. Park, Y. H., Yoo, H. S., Yoon, J. W., Yang, S. J., An, J. S. and Davis, W. C.

2000. Phenotypic and functional analysis of bovine gammadelta lymphocytes.

J. Vet. Sci. 1: 39–48.

95. Petri, R. M., Forster, R. J., Yang, W., McKinnon, J. J. and McAllister, T. A.

2012. Characterization of rumen bacterial diversity and fermentation

parameters in concentrate fed cattle with and without forage. J. Appl.

Microbiol. 112:1152–1162.

96. Pinloche, E., McEwan, N., Marden, J. P., Bayourthe, C., Auclair, E., Newbold,

J. 2013. The effects of a probiotic yeast on the bacterial diversity and

population structure in the rumen of cattle. PLoS One 8:e67824.

97. Pitt, R. E. and Pell, A. N. 1997. Modeling ruminal pH fluctuations: Interactions

between meal frequency and digestion rate. J. Dairy Sci. 80:2429–2441.

98. Pollock, J. M. and Welsh, M. D. 2002. The WC1+ γδ T-cell population in cattle:

a possible role in resistance to intracellular infection. Vet. Immunol.

Immunopathol. 89:105–114.

99. Price, S. J., Sopp, P., Howard, C. J. and Hope, J. C. 2006. Workshop cluster 1+

gammadelta T-cell receptor+ T cells from calves express high levels of

interferon-gamma in response to stimulation with interleukin-12 and -18.

Immunology 120: 57–65.

111

100. Quigley, J. D., Steen, T. M. and Boehms, S. I. 1992. Postprandial changes in

ruminating calves of selected blood and ruminal metabolites fed diet with or

without hay. J. Dairy Sci. 75:228-325.

101. Rettger, L. F., Levy, W. N., Weinstein, L. and Weiss, J. E. 1935. Lactobacillus

acidophilus and its therapeutic application. Yale University Press, New Haven.

pp 61–62.

102. Rijkers, G. T., de-Vos W. M., Brummer, R. J., Morelli, L., Corthier, G. and

Marteau, P. 2011. Health benefits and health claims of probiotics: bridging

science and marketing. Br. J. Nutr. 106: 1291–1296.

103. Rinttila, T., Kassinen, A., Malinen, E., Krogius, L. and Palva, A. 2004.

Development of an extensive set of 16S rDNA-targeted primers for

quantification of pathogenic and indigenous bacteria in faecal samples by real-

time PCR. J. Appl. Microbiol. 97:1166–1177.

104. Robert, W. L., Sonstegard, T. S., Tassell C. P. and Gasbarre, L. C. 2007. Local

inflammation as a possible mechanism of resistance to gastrointestinal

nematodes in Angus heifers. Vet. Parasitol. 145: 100–107.

105. Rogers, A. N., Vanburen D. G., Hedblom E. E., Tilahun M. E., Telfer J. C. and

Baldwin C. L. 2005. Gammadelta T cell function varies with the expressed

WC1 coreceptor. J. Immunol. 174: 3386–3393.

106. Russell, J. B. and Wilson, D. B. 1996. Why are ruminal cellulolytic bacteria

unable to digest cellulose at low pH? J. Dairy Sci. 79:1503–1509.

112

107. Russell, J. B., O'Connor, J. D., Fox, D. G., Van Soest, P. J. and Sniffen, C. J.

1992. A net carbohydrate and protein system for evaluating cattle diets:

Ruminal fermentation. J. Anim. Sci. 70:3551–3561.

108. Rustomo, B., AlZahal, O., Cant, J. P., Fan, M. Z., Duffield, T. F., Odongo, N.

E. and cBride, B. W. 2005. Acidogenic value of feeds. II. Effects of rumen acid

load from feeds on dry matter intake, ruminal pH, fibre degradability and milk

production in the lactating dairy cow. Can. J. Anim. Sci. 86:119–126.

109. Sakamoto, M., Hayashi, H. and Benno, Y. 2003. Terminal restriction

fragment length polymorphism analysis for human fecal microbiota and its

application for analysis of complex bifidobacterial communities. Microbiol.

Immunol. 47:133–142.

110. Sathiyaseelan, T., Rogers, A. and Baldwin C. L. 2002. Response of bovine

gammadelta T cells to activation through CD3. Vet. Immunol. Immunopathol.

90:155–68

111. Sato, S., Mizuguchi, H., Ito, K., Ikuta, K., Kimura, A. and Okada, K. 2011.

Technical note: Development and testing of a radio transmission pH

measurement system for continuous monitoring of ruminal pH in cows. Prev.

Vet. Med. 103:274–279.

112. Satta, N., Kruithof, E. K., Reber, G. and deMoerloose, P. 2008. Induction of

TLR2 expression by inflammatory stimuli is required for endothelial cell

responses to lipopeptides. Mol. Immunol. 46:145–147.

113. Sauter, K. S., Brcic, M., Franchini, M. and Jungi, T. W. 2007. Stable

transduction of bovine TLR4 and bovine MD-2 into LPS-nonresponsive cells

113

and soluble CD14 promote the ability to respond to LPS. Vet. Immunol.

Immunopathol. 118: 92–104.

114. Scardovi, V. 1981. The genus Bifidobacterium: the prokaryotes. A handbook

on habitats, isolation and identification of bacteria. Vol. 2. Springer-Verlag,

New York, U.S.A. pp 1230–1235.

115. Scardovi, V. 1986. Section 15. Irregular nonsporing gram-positive rods.

Genus Bifidobacterium Orla Jensen. 1924. Editors: Sneath, P. H. A., N. S.

Mair, M. E. Sharpe and J. G. Holt. Bergey’s Manual of Systematic

Bacteriology. 9th Edition, Williams and Wilkins Co., Baltimore 2:1418–1434.

116. Schlau, N., Guan, L, L. and Oba, M. 2012. The relationship between rumen

acidosis resistance and expression of genes involved in regulation of

intracellular pH and butyrate metabolism of ruminal epithelial cells in steers.

J. Dairy Sci. 95:5866–5875.

117. Sears, C. L. 2005. A dynamic partnership: Celebrating our gut

flora". Anaerobe 11: 247–51.

118. Sharpe, M. E. 1979. Identification of the lactic acids bacteria. In

identification methods for microbiologists. 2nd Edition, Edited by Skinner, F. A.

and Lovelock, D. W., Academic Press: London, pp: 246–255.

119. Sharp, R., Hazlewood, G. P., Gilbert, H. J. and O’Donnell, A. G. 1994.

Unmodified and recombinant strains of Lactobacillus plantarum are rapidly

lost from the rumen by protozoal predation. J. Appl. Bacteriol. 76:110–117.

120. Shida, K., Kiyoshima-Shibata, J., Kaji, R., Nagaoka, M. and Nanno, M. 2009.

Peptidoglycan from lactobacilli inhibits interleukin-12 production by

114

macrophages induced by Lactobacillus casei through Toll-like receptor 2-

dependent and independent mechanisms. Immunology 128: 858–69.

121. Shida, K., Nanno, M. and Nagata, S. 2011. Flexible cytokine production by

macrophages and T cells in response to probiotic bacteria: a possible

mechanism by which probiotics exert multifunctional immune regulatory

activities. Gut Microbes 2: 109–114.

122. Signorini, M. L., Soto, L. P., Zbrun, M. V., Sequeira, G. J., Rosmini, M. R. and

Frizzo, L. S. 2012. Impact of probiotic administration on the health and fecal

microbiota of young calves: A meta-analysis of randomized controlled trials of

lactic acid bacteria. Res. Vet. Sci. 93: 250–258.

123. Stewart, C. S., Flynt, H. J. and Bryant, M. P. 1997. The rumen bacteria: The

rumen microbial ecosystem. Edited by, Hobson, P. N. and Stewart, C. S.,

Blackie Academic and Professional, New York, NY. pp. 10–72.

124. Stobo, I. J. F., Roy, J. H. B. and Gaston, H. J. 1966. Rumen development in

the calf. 1. The effect of diets containing different proportions of concentrates to

hay on rumen development. Br. J. Nutr. 20:171–188.

125. Strobel, H. J. and Russell, J. B. 1986. Effect of pH and energy spilling on

bacterial protein synthesis by carbohydrate-limited cultures of mixed rumen

bacteria. J. Dairy Sci. 69:2941–2947.

126. Sun, P., Wang, J. Q. and Zhang, H. T. 2010. Effects of bacillus subtilis natto

on performance and immune function of preweaning calves. J. Dairy Sci. 93:

5851–5855.

115

127. Tajima, K., Aminov, R. I., Nagamine, T., Matsui, H., Nakamura, M. and

Benno. Y. 2001. Diet-dependent shifts in the bacterial population of the rumen

revealed with real-time PCR. Appl. Environ. Microbiol. 67:2766–2774.

128. Tajima, K., Aminov, R. I., Nagamine, T., Ogata, K., Nakamura, M., Matsui,

H. and Benno, Y. 1999. Rumen bacterial diversity as determined by sequence

analysis of 16S rDNA libraries. FEMS Microbiol. Ecol. 29:159–169.

129. Tajima, K., Arai, S., Ogata, K., Nagamine, T., Matsui, H., Nakamura, M.,

I.Aminov, R. and Benno, Y. 2000. Rumen bacterial community transition

duringadaptation to high-grain diet. Anaerobe, 6:273–284.

130. Takeuchi, O., Hoshino, K. and Akira, S., 2000. Cutting edge: TLR2 deficient

and MyD88-deficient mice are highly susceptible to Staphylococcus aureus

infection. J. Immunol. 165:5392–5396.

131. Takeuchi, O., Kawai, T., Muhlradt, P. F., Morr, M., Radolf, J. D., Zychlinsky,

A., Taeda, K. and Akira, S. 2001. Discrimination of bacterial lipopeptides by

Toll-like receptor 6, International Immunology, 13:933–940.

132. Timmerman, H. M., Mulder, L., Everts, H., van Espen, D. C., van der Wal, E.,

Klaassen, G., Rouwers, S. M. G., Hartemink, R., Rombouts, F. M. and Beynen,

A. C. 2005. Health and growth of veal calves fed milk replacers with or without

probiotics. J. Dairy Sci. 88:2154–2165.

133. Vaughan, R. B. 1965. The romantic rationalist: A study of Elie Metchnikoff.

Medical History 9: 201–215.

134. Waldvogel, A. S., Lepage, M. F., Zakher, A., Reichel, M. P., Eicherc, R. and

Heussler, V. T. 2004. Expression of interleukin 4, interleukin 4 splice variants

116

and interferon gamma mRNA in calves experimentally infected with Fasciola

hepatica. Vet. Immunol. Immunopathol. 97: 53–63.

135. Wallace, R. J. 1992. Rumen microbiology, biotechnology and ruminant

nutrition: the application of research findings to a complex microbial

ecosystem. Fems Microbiol. Lett. 79: 529–534.

136. Wang, F., Herzig, C., Ozer, D., Cynthia, L. B. and Janice C. T. 2009. Tyrosine

phosphorylation of scavenger receptor cysteine-rich WC1 is required for the

WC1-mediated potentiation of TCR-induced T-cell proliferation. Eur. J.

Immunol. 39: 254–266.

137. Wang, Y., Dennehy P. H., Keyserling, H. L., Tang, K., Gentsch J. R., Glass, R.

I. and Jiang B. 2007. Rotavirus infection alters peripheral T-cell homeostasis

in children with acute diarrhea. J. Virol. 81: 3904–3912.

138. Weimer, P. J., Stevenson, D. M., Mantovani, H. C. and Man, S. L. 2010. Host

specificity of the ruminal bacterial community in the dairy cow following near-

total exchange of ruminal contents. J. Dairy Sci. 93: 5902–5912.

139. Weinberg, Z. G., Muck, R. E. and Weimer, P. J. 2003. The survival of lactic

acid bacteria in rumen fluid. J. Appl. Microbiol. 94:1066–1071.

140. Weinberg, Z. G.., Muck, R. E., Weimer, P. J., Chen, Y. and Gamburg, M. 2004.

Lactic acid bacteria used in silage inoculants as probiotics for ruminants. Appl.

Biochem. Biotechnol. 118:1–10.

141. Weiss, D. J., Evanson, O. A. and Souza, C. D. 2006. Mucosal immune

response in cattle with subclinical johne’s disease. Vet. Pathol. 43:127–135.

117

142. West, C. E., Hernell, O., Andersson, Y., Sjostedt, M. and Hammarstrom, M.

L. 2012. Probiotic effects on T-cell maturation in infants during weaning. Clin.

Exp. Allergy 42: 540–549.

143. Whitford, M. F., Forster, R. J., Beard, C. E., Gong, J. H. and Teather, R. M.

1998. Phylogenetic analysis of rumen bacteria by comparative sequence

analysis of cloned 16S rRNA genes. Anaerobe, 4:153–163.

144. Williams, P. E. V., Tait, C. A. G., Innes, G. M. and Newbold, C. J. 1991.

Effects of the inclusion of yeast culture (Saccharomyces-Cerevisiae plus growth

medium) in the diet of dairy- cows on milk yield and forage degradation and

fermentation patterns in the rumen of steers. J. Anim. Sci. 69: 3016–3026.

145. Wilson, R. A., Zolnai, A., Rudas, P. and Frenyo, L.V. 1996. T-cell subsets in

blood and lymphoid tissues obtained from fetal calves, maturing calves, and

adult bovine. Vet. Immunol. Immunopathol. 53: 49–60.

146. Zitnan, R., Voigt, J., Schonhusen, U., Wegner, J., Kokardova, M.,

Hagemeister, H., Levkut, M., Kuhla, S. and Sommer, A. 1998. Influence of

dietary concentrate to forage ratio on the development of rumen mucosa in

calves. Arch. Anim. Nutr. 51:279–291

118

Acknowledgments

It is my pleasure to gratefully acknowledge many people who helped me

and made this thesis possible. Here I would like to give my particular

acknowledgment to the most important people during my study time in Japan.

First and foremost, I want to thank my PhD course supervisor Dr. Shigeru

Sato, professor on large animal internal medicine, Department of Veterinary

Medicine, Faculty of Agriculture, Iwate University. It has been an honor to be a

member of his research team during the four years of study time at Iwate

University. I appreciate all his contributions of time, ideas, and funding to

make my PhD possible. The joy and enthusiasm he has for his work was

motivational for me, even during tough winter time in Morioka city, northern

Japan.

I would like to acknowledge my first academic advisor Dr. Norio

Yamagishi, professor on large animal surgery at Iwate University. I thank for

all his educational supports and advance training and laboratory experiment

courses, also I am grateful for the time reviewing my thesis and giving

helpfully comments. I acknowledge and thank my second academic advisor Dr.

Hisashi Inokuma, professor on large animal internal medicine at Obihiro

University of Agriculture and Veterinary Medicine, for his educational supports,

giving advance laboratory experiment courses and the time reviewing my

thesis. I would also like to thank the other two members of my thesis reviewing

and oral defense committee members, Professor Kazuaki Takehara from Tokyo

University of Agriculture and Technology (TUAT) and Professor Yasunori Ohba

119

from Gifu University, for their time and insightful questions.

I am grateful to associate professor Keiji Okada who kept our research

team organized and was always ready to help for large animal clinical practice

at Iwate University. I would like to acknowledge the members of my research

team, whom have contributed to my personal and professional time at Iwate

University. The members had a source of friendships as well as good

collaboration. I would like to acknowledge honorary research team member Dr.

Atsushi Kimura, whom is now working with Veterinary Clinical Center of

Morioka Federation of Agricultural Mutual Aid Association (Iwate NOSI,

Japan). I am grateful for the time we worked together at the field on large

animal clinical practice, and I appreciated his enthusiasm, intensity,

willingness to do practical work on large animal clinic, and amazing ability to

cleave and manipulate large animal surgery. Also, I am thankful for Dr.

Kimura and his family for making nice neighborhood time with kind supports

to my family, especially during the 2011 earthquake disaster in north Japan. I

would like to acknowledge other past and present research team members that

I had the pleasure to work with Dr. Takuma Kato, Dr. Satoru Goya, Dr. Akira

Okubo, Dr. Katsunori Nagahama, Dr. Rie Nagata, Dr. Natsuki Otani and Dr.

Kim Yohan. The other veterinary undergraduate students at Iwate University,

who have come through the research at the laboratory of internal medicine, are

a part of my good memory from Iwate. I also acknowledge the technical support

of Professor Kazuhisa Furuhama, Professor Yoshiaki Izaike, Dr. Toshihiro

Ichijo, Dr. Minoru Yatsu, Dr. Kentaro Ikuta, Dr. Chika Seki and Dr. Noriko

120

Kobayashi, whom give me excellent comments and make possible my research.

In my past work of research student, I am particularly indebted to

Professor Iwasaki Toshiro, Professor Koji Nishifuji and Dr. Kaouri Ide at

laboratory of small animal internal medicine, TUAT. I am fully appreciated

Professor Iwasaki and his laboratory members for making a great time during

the small animal clinical practice and research at TUAT. I would like to thank

Professor. Kazuyoshi Taya from TUAT for providing supports for making

possible the educational scholarships for Afghan students. I also acknowledge

the funding of the Ministry of Education, Culture, Sport, Science and

Technology of Japan (MEXT), that made my PhD work possible. I would like to

thank Professor Hiroshi Tsunemitsu and Prof. Yukio Yagi at National Institute

of Animal Health (NIAH), and Professor Shigeru Morikawa and Professor

Shuetsu Fukushi, at National Institute of Infectious Diseases in Japan, for

providing useful training programs and kind hospitality in Tsukuba and Tokyo.

My time at Morioka city was made enjoyable in large part due to the

many friends and groups that became a part of my life. I am grateful for the

time spent with roommates and friends, especially for making memorable

Hanami parties. Lastly, I would like to thank my family for all their love and

encouragement. And most of all for my loving, supportive, encouraging, and

patient wife whose faithful support is so appreciated. I am grateful for my

parents who raised me with love and supported me in all my pursuits.

Thank you. Abdul Qadir Qadis

Iwate University - UGSVS

September 30, 2014