Upload
nguyennhan
View
214
Download
0
Embed Size (px)
Citation preview
Aus dem Humangenetischen Institut der
Friedrich-Alexander-Universität Erlangen-Nürnberg Direktor: Prof. Dr. med. André Reis
Systematic mutation analysis and functional characterization of candidate genes for primary open angle glaucoma
Inaugural-Dissertation zur Erlangung der Doktorwürde
der Medizinischen Fakultät der
Friedrich-Alexander-Universität Erlangen-Nürnberg
vorgelegt von
Lorena Fernández Martínez
aus
Oviedo
ii
Gedruckt mit Erlaubnis der Medizinischen Fakultät der Friedrich-Alexander-Universität
Erlangen-Nürnberg
Dekan: Prof. Dr. J. Schüttler
Referent: Prof. Dr. A. Reis
Korreferenten: Prof. Dr. J. Brandstätter
Prof. Dr. A. Winterpacht
Tag der mündlichen Prüfung: 08. Dezember 2009
iii
a mi padre, a mi hermano, im memoriam
There is one thing that gives radiance to everything. It is the idea of finding something around the corner.
- Gilbert Keith Chesterton
When you've got it, you've got it. When you haven't, you begin again. All the rest is humbug.
-Edouard Manet
iv
v
Index
1. Summary ......................................................................................................... 1
2. Zusammenfassung .......................................................................................... 3
3. Introduction .................................................................................................... 5 3.1. Genetics of complex diseases.......................................................................................... 5
3.1.1. Monogenic versus complex diseases........................................................................ 5
3.1.2. Methods for genetic dissection of complex diseases ............................................... 6
3.1.2.1. Linkage analysis................................................................................................ 6
3.1.2.2. Association studies............................................................................................ 6
3.1.2.3. Candidate-gene approaches............................................................................... 7
3.2. Glaucoma, general aspects .............................................................................................. 7
3.2.1. Diagnostics ............................................................................................................... 8
3.2.2. Classification, prevalence and risk factors ............................................................... 9
3.2.3. Pathogenesis ........................................................................................................... 11
3.2.4. Treatment ............................................................................................................... 12
3.2.4.1. Classical treatments......................................................................................... 12
3.2.4.2. Investigational Glaucoma Treatments............................................................. 13
3.2.5. Animal models ....................................................................................................... 13
3.3. Genetics of POAG......................................................................................................... 14
3.3.1. Inheritance and implicated loci .............................................................................. 15
3.3.2. Known glaucoma genes ......................................................................................... 16
3.3.2.1. Myocilin (MYOC)........................................................................................... 16
3.3.2.2. Optineurin (OPTN) ......................................................................................... 17
3.3.2.3. WD40-Repeat 36 (WDR36)........................................................................... 18
3.3.3. Glaucoma candidate genes ..................................................................................... 19
3.4. Loci investigated ........................................................................................................... 20
3.4.1. ADCY4 (adenylate cyclase type IV)...................................................................... 21
3.4.2. BCL2L2 (B-cell/lymphoma 2- like 2).................................................................... 22
3.4.3. DAD1 (defender against cell death 1).................................................................... 22
3.4.4. ISGF3G (interferon-stimulated transcription factor 3 gamma).............................. 22
3.4.5. MMP14 (matrix metalloproteinase 14) .................................................................. 23
3.4.6. NRL (neural retina leucine zipper)......................................................................... 23
3.4.7. OXA1L (oxidase cytochrome c assembly 1-like) .................................................. 23
vi
3.4.8. SALL2 (salivary protein-like 2)............................................................................. 24
3.4.9. ZNF219 (zinc finger protein 219) .......................................................................... 24
3.4.10. RPGRIP1 (retinitis pigmentosa GTPase regulator-interacting protein 1)............ 24
3.5. The aims of this thesis ................................................................................................... 25
4. Materials and methods................................................................................. 26 4.1. Subjects ......................................................................................................................... 26
4.1.1. Patients ................................................................................................................... 26
4.1.1.1. Recruitment ..................................................................................................... 26
4.1.1.2. Diagnosis......................................................................................................... 26
4.1.2. Controls .................................................................................................................. 27
4.2. DNA standard methods ................................................................................................. 27
4.2.1. Genomic DNA isolation......................................................................................... 27
4.2.1.1. Automated DNA isolation............................................................................... 27
4.2.1.2. DNA isolation from COS-1 cells .................................................................... 27
4.2.2. Quantification of dsDNA ....................................................................................... 28
4.3. PCR (polymerase chain reaction) and sequencing........................................................ 28
4.3.1. Polymerase chain reaction (PCR) .......................................................................... 28
4.3.2. Agarose gel electrophoresis ................................................................................... 28
4.3.3. Gel extraction of PCR products ............................................................................. 29
4.3.4. Purification of PCR products ................................................................................. 29
4.3.4.1. Purification of PCR-products with magnetic beads ........................................ 29
4.3.4.2. Purification of PCR-products with Millipore Cleanup Kit ............................. 29
4.3.4.3. Purification of PCR-products with QIAquick PCR Purification Kit .............. 29
4.3.4.4. Enzymatic purification of PCR-products ........................................................ 30
4.3.5. Sequencing of purified PCR products with the Sanger method............................. 30
4.3.6. Purification of sequencing products with magnetic beads ..................................... 30
4.3.7. RT-PCR (reverse transcription polymerase chain reaction) .................................. 31
4.3.8. Microsatellite analysis............................................................................................ 31
4.4. Cloning and plasmid procedures in bacteria ................................................................. 31
4.4.1. Cloning of plasmids and PCR products in a cloning vector .................................. 31
4.4.2. Miniprep plasmid preparation ................................................................................ 32
4.4.3. Midiprep plasmid preparation ................................................................................ 32
4.4.4. Site-directed mutagenesis....................................................................................... 32
4.4.5. Gateway cloning..................................................................................................... 33
vii
4.5. Yeast two-hybrid experiments ...................................................................................... 34
4.5.1. Yeast cotransformation .......................................................................................... 34
4.5.1.1. Lithium acetate (LiAC)-mediated cotransformation of fresh growing cells... 34
4.5.1.2.1. Preparation of frozen competent cells ...................................................... 35
4.5.1.2.2. Transformation of frozen competent cells ............................................... 35
4.5.2. X-α-Galactosidase assay ........................................................................................ 35
4.5.3. β-Galactosidase assays ........................................................................................... 35
4.5.3.1. β-Galactosidase liquid assay ........................................................................... 36
4.5.3.2. β-Galactosidase colony-lift filter assay ........................................................... 36
4.6. Assays in mammalian cells ........................................................................................... 36
4.6.1. Culture conditions .................................................................................................. 36
4.6.2. Stock preparation.................................................................................................... 37
4.6.3. Cotransfection methods.......................................................................................... 37
4.6.3.1. Nucleofection .................................................................................................. 37
4.6.3.2. Cationic lipid transfection using Lipofectamine and PLUS reagents ............. 37
4.6.4. Coimmunoprecipitation.......................................................................................... 37
4.6.5. Immunofluorescence .............................................................................................. 38
4.7. Standard protein methods.............................................................................................. 38
4.7.1. Western Blot........................................................................................................... 38
4.7.2. Chemiluminiscence ................................................................................................ 39
4.8. In-situ hybridization ...................................................................................................... 39
4.8.1. Probe preparation ................................................................................................... 39
4.8.2. In-vitro transcription and whole-mount in-situ hybridization................................ 39
4.9. Bioinformatic tools........................................................................................................ 39
4.9.1. PCR primer design ................................................................................................. 39
4.9.2. Sequencing analysis ............................................................................................... 40
4.9.3. Microsatellite analysis............................................................................................ 40
4.9.4. Genome browsers................................................................................................... 40
4.9.5. Single nucleotide polymorphism (SNP) and mutation databases .......................... 40
4.9.6. Linkage disequilibrium visualization ..................................................................... 40
4.9.7. Haplotype reconstruction ....................................................................................... 41
4.9.8. Selection of haplotype tag SNPs (htSNPs) ............................................................ 41
4.9.9. Multiple sequence alignment ................................................................................. 41
4.9.10. Promotor prediction and promoter database ........................................................ 41
viii
4.9.11. Open reading frame (ORF) search ....................................................................... 41
4.9.12. Transcription factor binding site (TFBS) prediction............................................ 42
4.9.13. Statistics ............................................................................................................... 42
4.10. Nomenclature .............................................................................................................. 42
4.11 Reagents and materials................................................................................................. 42
4.11.1. Kits ....................................................................................................................... 42
4.11.2. Instruments ........................................................................................................... 43
4.11.4. Consumables ........................................................................................................ 44
4.11.5. Reagents ............................................................................................................... 45
4.11.6. Media and solutions ............................................................................................. 47
5. Results............................................................................................................ 55 5.1. Screening of MYOC and CYP1B1 in POAG patients .................................................. 55
5.2. Screening of candidate genes on chromosome 14q11-q12 ........................................... 57
5.3. RPGRIP1....................................................................................................................... 59
5.3.1. RPGRIP1 haplotype block structure ...................................................................... 59
5.3.2. Association of RPGRIP1 with POAG in German patients .................................... 60
5.3.2.1. Replication study............................................................................................. 62
5.3.3. Segregation analysis of RPGRIP1 coding variants. ............................................... 64
5.3.4. Mutations in RPGRIP1 disrupt interaction with NPHP4 in POAG patients.......... 65
5.3.4.1. Yeast two-hybrid system................................................................................. 65
5.3.4.1.1. Qualitative growth on SD-WLHA plates ................................................. 66
5.3.4.1.2. α-galactosidase activity ............................................................................ 66
5.3.4.1.3. β-galactosidase activity ............................................................................ 66
5.3.4.1.3.1. Qualitative filter lift assay ................................................................. 66
5.3.4.2. Coimmunoprecipitation................................................................................... 68
5.3.4.3. Colocalization of RPGRIP1 and NPHP4 in COS-1 cells................................ 69
5.3.4.4. Classification of the RPGRIP1 variants .......................................................... 70
5.3.5. RPGRIP1 undergoes significant alternative splicing ............................................. 72
6. Discussion ...................................................................................................... 74 6.1. Genetics of POAG as a complex disease ...................................................................... 74
6.1.1. Study design ........................................................................................................... 74
6.1.2. Common variants versus rare variants ................................................................... 76
6.2. Screening of MYOC and CYP1B1 in POAG patients .................................................. 77
6.3. RPGRIP1 as a candidate gene for POAG ..................................................................... 79
ix
6.3.1. Selection of RPGRIP1............................................................................................ 79
6.3.2. Association of RPGRIP1 with POAG.................................................................... 80
6.3.3. Expression of RPGRIP1 in retina........................................................................... 81
6.3.4. Functional characterization of RPGRIP1 mutations .............................................. 82
6.3.5. Summary .................................................................................................................... 84
6.4. Final conclusions and future perspectives..................................................................... 84
7. Bibliography.................................................................................................. 86
8. Abbreviations .............................................................................................. 101
9. Publications ................................................................................................. 103
10. Acknowledgements ................................................................................... 104
11. Curriculum vitae....................................................................................... 106
x
1
1. Summary
Background and objectives. Glaucoma is a clinically and genetically heterogeneous group
of ophthalmologic disorders leading to visual impairment and a major cause of blindness
worldwide. The most common form is primary open angle glaucoma (POAG), which is
inherited as a complex trait. Therefore, multiple genetic and environmental susceptibility
factors play a role in the disease, each with a small contribution to its aetiology. Several loci
have been linked to POAG, but only three genes (myocilin, WDR36 und optineurin) have
been identified until now, accounting for about 5% of the cases. The aim of this thesis was to
identify new glaucoma predisposing genes through systematic mutation screening of
functional candidate genes located on chromosomal regions previously linked to POAG.
Functional characterization of mutations found in RPGRIP1 was also performed. Methods. The initial study population used in the mutation screening consisted of 399
unrelated German patients with POAG and 376 control subjects without any signs of
glaucoma upon ophthalmologic examination. For the replication study, additional 383 POAG
patients and 104 controls were used. The functional studies comprised yeast two-hybrid
assays, coimmunoprecipitation, expression of fluorescent proteins and RT-PCR. Results. Association of RPGRIP1 variants with POAG was found in both cohorts of German
patients. Most of these mutations were located in or near the C2 domains of the protein. Yeast
two-hybrid experiments demonstrated that some of these amino acid alterations located in the
C2 motif of RPGRIP1 impaired the interaction between this protein and nephrocystin-4.
Coimmunoprecipitation and colocalization studies of both proteins corroborated also these
results. RT-PCR led to the discovery of three novel RPGRIP1 isoforms. These isoforms were
detected in cDNAs from whole blood, retina and sclera from a healthy donor, but not in
choroid or cornea. Conclusions. Replicated association of heterozygous RPGRIP1 variants with POAG in
German patients was found. Amino acid variants located in the C2 domain of RPGRIP1 were
functionally validated and characterised as bona fide mutations. Thus, carrying mutations in
RPGRIP1 increase the susceptibility of one individual to develop glaucoma. However, the
complete molecular pathway and the role of the protein in the pathological mechanisms
leading to glaucoma still need to be clarified. Additional functional studies should be also
2
performed in order to validate and characterize the newly identified transcripts and its
possible relevance in the aetiology of POAG.
3
2. Zusammenfassung Hintergrund und Ziele. Das Glaukom ist eine klinisch und genetisch heterogene
Augenerkrankung, die zur Beeinträchtigung des Sehvermögens führt und weltweit eine
Hauptursache der Erblindung darstellt. Die häufigste Form ist das Primäre
Offenwinkelglaukom (POWG), welches als komplexes Merkmal vererbt wird. In der
Krankheitsentstehung spielen eine Reihe von genetischen und Umweltfaktoren eine Rolle,
wobei jeder dieser Faktoren zur Ätiologie beiträgt. Einige Genloci sind mit POWG gekoppelt,
bis jetzt wurden jedoch nur in drei Genen (Myocilin, WDR36 und Optineurin)
Sequenzvarianten identifiziert, die etwa 5% der Fälle erklären. Ziel dieser Arbeit war es,
durch systematisches Mutationsscreening funktioneller Kandidatengene in mit POWG
gekoppelten chromosomalen Regionen neue Glaukomgene zu identifizieren. Des Weiteren
wurden die in RPGRIP1 gefundenen Mutationen funktionell charakterisiert.
Methoden. Für das Mutationsscreening wurde eine initiale Studienkohorte bestehend aus 399
unabhängigen deutschen Patienten und 376 augenärztlich untersuchten Kontrollpersonen ohne
Glaukomanzeichen verwendet. Zur Replikation wurden weitere 383 POWG-Patienten und
104 Kontrollen eingesetzt. Die funktionellen Studien beinhalteten yeast two-hybrid-Assays,
Co-Immunopräzipitation, Expression fluoreszierender Proteine und RT-PCR.
Ergebnisse. In beiden deutschen Patientenkohorten wurde eine Assoziation von RPGRIP1-
Varianten mit POWG gefunden. Die meisten dieser Mutationen befanden sich innerhalb bzw.
in der Nähe der C2-Domäne des Proteins. In yeast two-hybrid-Experimenten konnte gezeigt
werden, dass einige dieser Aminosäureaustausche im C2-Motiv von RPGRIP1 die Interaktion
zwischen diesem Protein und Nephrocystin-4 beeinträchtigten. Co-Immunopräzipitations- und
Co-Lokalisationsstudien mit beiden Proteinen bestätigten diese Ergebnisse. Mittels RT-PCR
wurden drei neue RPGRIP1-Isoformen entdeckt. Diese Isoformen konnten in cDNAs aus
Blut, Retina und Sklera gesunder Spender nachgewiesen werden - jedoch nicht in Choroid
oder Cornea.
Schlussfolgerungen. In deutschen Patienten wurde eine Assoziation von heterozygoten
RPGRIP1-Varianten mit POWG gefunden und repliziert. Aminosäureaustausche innerhalb
der C2-Domäne von RPGRIP1 wurden als bona fide-Mutationen funktionell validiert und
charakterisiert. Folglich erhöht sich dadurch für Mutationsträger die Suszeptibilität für die
4
Entwicklung eines Glaukoms. Der komplette molekulare Mechanismus sowie die Rolle des
Proteins in der Pathologie des Glaukoms müssen noch geklärt werden. Außerdem sollten
zusätzliche funktionelle Studien durchgeführt werden, um die neu identifizierten Transkripte
sowie ihre mögliche Relevanz in der Ätiologie des POWG zu bestätigen und zu
charakterisieren.
5
3. Introduction
Genetics has become a central strand in medical research. Since the completion in April 2003
of the Human Genome Project (www.ornl.gov) and public availability of the entire human
genome sequence, gene discovery dramatically speeded up and the haploid human genome
has been estimated to contain three billion nucleotides and close to 23,000 genes (Pennisi
2003), far fewer than had been expected before. The focus is now centred on the identification
of disease genes. Approximately 4,000 Mendelian disease phenotypes are currently known in
man, but for no more than 2,500 of these the fundamental molecular defect has been
identified at the DNA level (Hamosh et al. 2005). Different methods are currently used to
establish links between genetic disorders and specific genes; however, identifying the factors
conferring susceptibility to common complex diseases, such Primary Open Angle Glaucoma
(POAG), remains exceedingly difficult. Among the promised benefits of human genetics
research are better understanding of disease, personalised preventive medicine, gene therapy,
and pharmacogenetic drug therapy tailored to our individual genetic profiles.
3.1. Genetics of complex diseases
3.1.1. Monogenic versus complex diseases
Most genetic disorders discovered to date are monogenic and follow a simple Mendelian
inheritance pattern. In a monogenic disease the phenotype is caused by an abnormality in one
single gene, which may contain a point mutation or an insertion/deletion that changes the
coding sequence or promoter, and hence the amino acid sequence of the protein, thereby
triggering the disease. Although environmental factors, age of onset and/or allelic
heterogeneity (several different alleles of the same gene, giving rise to the same disease
phenotype) can complicate the picture, monogenic disorders usually have a high correlation
between genotype and phenotype i.e. there is a high penetrance. The penetrance is a measure
of the probability that a person carrying a specific genotype (variant allele) also expresses the
disease (displays the phenotype) (Smith and Lusis 2002).
By contrast, in a complex disease susceptibility is controlled by multiple genetic and
environmental risk factors, and potentially by interactions in and between them, where each
of these risk factors has only a modest effect on susceptibility (Cardon and Abecasis 2003).
Complicating the picture is the fact that the allelic variants predisposing for a disease are
often common variants found in a large part of the population. These people may live their
full life span without being affected by the disease, despite carrying the susceptibility allele.
6
The reduced or incomplete penetrance in these individuals is influenced by age of onset, sex,
environmental factors and other genetic variants referred to as genetic background (Lander
and Schork 1994).
3.1.2. Methods for genetic dissection of complex diseases
Among the factors that contribute to the difficult challenge of discovering complex disease
genes are the low heritability of most complex traits, the presence of incomplete penetrance,
phenocopies, underlying molecular heterogeneity and epistasis (Weeks and Lathrop 1995),
imprecise definition of phenotypes (Levy et al. 2000), inadequately powered study designs
(Blangero 2004), and the inability of standard sets of markers (single nucleotide
polymorphisms (SNPs), copy number variations (CNVs), or microsatellites) to extract
complete information about inheritance (Wiggs 2007). The full array of genetic approaches
should be used, including linkage analysis, association studies, and candidate gene analysis.
3.1.2.1. Linkage analysis Linkage analysis is based on the co-inheritance of genetic markers and phenotypes in families
over several generations, and identifies haplotypes that are inherited intact over them (Laird
and Lange 2006). A haplotype is a combination of alleles found at neighbouring loci on a
single (haploid) chromosome, sufficiently close together such that their alleles tend to
cosegregate within families (Borecki and Province 2008). In order to estimate the evidence
for linkage, the LOD (logarithm (base 10) of an odds ratio) score, a statistical test developed
by Newton E. Morton in 1955, is used. The odds ratio (OR) is the probability of observing the
specific genotypes in a family given linkage at a particular recombination fraction versus the
same probability computed conditional on independent assortment (Borecki and Province
2008). A LOD score of 3 is usually taken as statistically significant evidence for linkage,
meaning that the linkage hypothesis is 103 times more likely than the hypothesis that the two
loci are not linked; values close to 1 favor independent assortment.
This approach has good power for detecting uncommon genes with major effect, but its power
to detect the modest effects of common genetic variants on disease is more limited due to the
lack of clear genetic segregation of some DNA variants in multigenerational family material,
and by the modest contribution to disease made by individual genetic variants (Cardon and
Bell 2001).
3.1.2.2. Association studies Association studies are based on the retention of adjacent DNA variants over many
generations in specific populations. Thus, they can be regarded as very large linkage studies
7
of unobserved, hypothetical pedigrees (Cardon and Bell 2001). In association studies, allele
frequencies are compared to assess the contribution of genetic variants to phenotypes either
with a case-control design (allele frequencies between affected and healthy unrelated controls
are compared), or using a family-based approach (transmitted versus untransmitted parental
alleles) (Laird and Lange 2006).
Association studies are easier to conduct than linkage analysis, because no multicase families
or special family structure are needed, and they are also more powerful for detecting weak
susceptibility alleles (Strachan and Read 2004).
3.1.2.3. Candidate-gene approaches Candidate genes are selected for further study either by their location within a previously
determined region of linkage, or on the basis of other biologic hypotheses, like appropriate
expression pattern, appropriate function, or homology to other disease genes (Strachan and
Read 2004).
The most comprehensive analysis of candidate genes is obtained by resequencing the entire
gene in patients and controls, and searching for variants that are enriched or depleted in
disease genes. However, because such studies are laborious and expensive, they are usually
limited to the coding regions of the candidate genes (Tabor et al. 2002).
3.2. Glaucoma, general aspects
The glaucomas are the principal cause for optic nerve degeneration and the second cause of
irreversible blindness worldwide, after cataract (Resnikoff et al. 2004; Quigley and Broman
2006). This medical condition refers to a heterogeneous group of disorders characterized by
degeneration of the optic nerve, specific loss of visual field, and chronic painless progression,
usually (but not invariably) associated with an elevated intraocular pressure (IOP) (Shields, et
al., 1996).
There is some controversy relating to the true derivation of the word “glaucoma”. It goes back
to the Ancient Greeks in 400 B.C., meaning clouded or blue-green hue, but also owl. In the
Hippocratic Aphorisms the term glaucoma (γλαύκωµα) was used to describe blindness
coming on in advancing years associated with a glazed appearance of the pupil. There were
no clear distinction between cataracts and glaucoma and it is highly likely that the only type
of glaucoma recognised in ancient times was symptomatic acute glaucoma (Fronimopoulos
and Lascaratos 1991). The first association of the disease with a rise in intraocular pressure
occurs in the Arabian writings “Book of Hippocratic treatment”, of At-Tabari (10th century).
8
In European writings, it is Dr Richard Bannister (1622) who makes the first original and clear
recognition of a disease with a tetrad of features: eye tension, long duration of the disease,
absence of perception of light and presence of a fixed pupil. Dr Drance (1973) provided for
the first time the definition of glaucoma as a disease of the optic nerve (an optic neuropathy)
caused by numerous factors, called risk factors (Grewe, 1986).
It is estimated that 4.5 million persons globally are blind due to glaucoma (World Health
Organization data) and that this number will rise to 11.2 million by 2020 (Quigley and
Broman 2006). It is noteworthy that due to the silent progression of the disease, at least in its
early stages, up to 50% of affected persons in the developed countries are not even aware of
having glaucoma. This number may rise to 90% in underdeveloped parts of the world
(Sommer et al. 1991).
3.2.1. Diagnostics
Although the definition of glaucoma has not been consistent across studies, it is generally
referred to as a progressive optic neuropathy involving characteristic excavation of the optic
disc with corresponding loss of visual field (Foster et al. 2002). Since the optic nerve
transmits visual images to the brain, damage to parts of it correspondingly reduces vision. To
estimate the damage of the optic nerve, the diameter of the eye's cup is compared to that of its
disc to obtain a physical gauge of the likelihood of glaucoma. Estimates are made vertically
along an imaginary line drawn through the center of the disc from the 12 o'clock to the 6
o'clock position. The normal optic nerve has a cup-to-disc ratio of less than 0.5, indicating a
low probability of glaucoma. Moderately advanced cupping, with a cup-to-disc ratio of 0.6 to
0.8 and a neural rim starting to thin, increases the suspicion of glaucoma. Almost total cup-to-
disc ratio of 0.9, exhibiting a very thin neural rim, creates a high level of glaucoma suspicion
(Figure 3.1.). Scanning laser polarimetry, optical coherence tomography, or confocal scanning
laser ophthalmoscopy are some of the methods used for monitoring glaucoma by imaging of
the eye's optic nerve and internal structures.
9
Figure 3.1. Ophthalmoscopy of the optic nerve head. Numbers represent the cup-to-disc ratio. A
ratio of 0.3 indicates no glaucoma; 0.9 confirms glaucoma. From South Texas Retina Consultants
(www.strc.cc).
3.2.2. Classification, prevalence and risk factors
Glaucoma is subdivided depending on the presence of primary and secondary characteristics.
Primary characteristics include the status of the iridocorneal angle and the age of onset.
Secondary characteristics include IOP, pseudoexfoliations and developmental abnormalities:
- Primary Open Angle Glaucoma (POAG): primary type of glaucoma with late age of
onset, open iridocorneal angle and elevated IOP.
- Normal Tension Glaucoma (NTG): primary type of glaucoma with open iridocorneal
angle and normal IOP. This type of glaucoma is usually sorted under POAG.
- Juvenile Open Angle Glaucoma (JOAG): primary type of glaucoma with age of onset
between 33-40 years of age, open iridocorneal angle and elevated IOP.
- Primary Close Angle Glaucoma (PCAG): primary type of glaucoma with closed
iridocorneal angle and elevated IOP. Acute form of glaucoma.
- Congenital Glaucoma: primary type of glaucoma with onset prior to 3 years of age,
open iridocorneal angle and elevated IOP.
- Secondary Glaucoma: a conglomerate of forms with a secondary cause as
pseudoexfoliations, developmental abnormalities or trauma.
Primary open angle glaucoma (POAG) is the major primary type of glaucoma in most
populations worldwide, while Asian populations have a high frequency of closed angle
glaucoma (PCAG) (Foster and Johnson 2001; Lai et al. 2001). The prevalence of POAG
varies between ethnic populations. POAG is five times more common in African Americans
than in Caucasians (Tielsch et al. 1991). The prevalence in populations in predominantly
black Barbados (12.8%) and St. Lucia (8.8%) is much higher than that of most other
populations (Mason et al. 1989; Leske et al. 1994). In addition, glaucoma is six times more
10
likely to cause blindness in blacks than in whites. Blacks have thinner corneas than whites (by
about 23 microns) and this may well be the factor that puts blacks at a higher risk for
glaucoma progression (www.nei.nih.gov).
In many cases, POAG is accompanied by an elevation of intraocular pressure (IOP), but
whether this should be considered a diagnostic criterion or a risk factor is under debate. Most
of the times the elevation of IOP results from impaired drainage of aqueous humour. The
aqueous humour is produced by the ciliary body in the posterior chamber of the eye and
enters the anterior chamber through the pupil, then drains out through the trabecular
meshwork into Schlemm’s canal, which drains into the bloodstream (Figure 3.2.). If the
aqueous humour cannot drain properly, either because the drainage canals become clogged (as
in chronic glaucoma) or because the iris is pushing against the cornea (as in angle-closure
glaucoma), it backs up, exerting pressure on the gel in the vitreous cavity at the center of the
eye. Eventually the building pressure affects the optic nerve at the rear. During routine eye
exams, a tonometer is used to measure IOP, and a value over 24 mmHg can indicate
glaucoma level, but not always, as these measures are not absolute and some individuals
tolerate higher pressures than others.
Figure 3.2. Aqueous humour production and outflow. Image modified from National Eye Institute,
National Institutes of Health (www.nei.nih.gov).
The risk for POAG increases rapidly after age 40. People aged 70 and older are about four to
seven times more likely to develop glaucoma than people 40 to 50 years old (Coleman 1999).
A family history of the disease has long been recognized as a major risk factor for developing
glaucoma (Wolfs et al. 1998) (see also 3.3. Genetics of POAG).
11
The relation between primary open-angle glaucoma and gender is not clear. In the Baltimore
Eye Survey (Tielsch et al. 1991), the Beaver Dam Eye Study (Klein et al. 1992), and the Blue
Mountains Eye Study (Mitchell et al. 1996), no significant difference was found between
prevalence of POAG in men and women. However, in the Framingham Eye Study (Kahn et
al. 1977), the Barbados Eye Study (Leske et al. 1994), and the Rotterdam Study (Wolfs et al.
2000), up to a twofold higher prevalence was found in men.
Other reported risk factor for glaucoma include hypertension (Bonomi et al. 2000), corneal
thickness (www.nei.nih.gov), high myopia (Mitchell et al. 1999), diabetes (Ellis et al. 2000)
and cigarette smoking (Brandt 2008).
3.2.3. Pathogenesis
Many theories have surfaced regarding the exact mechanisms behind glaucomatous damage,
but the complex nature of the disease and the inaccessibility of the internal structures of the
human eye have limited current knowledge. The primary pathologic event in the disease, the
apoptotic death of retinal ganglion cells (RGC), is thought to be initiated by damage to their
axonal fibers at the optic-nerve head. Ischemia, excitotoxicity, autoimmunity, axonal injury
and glial activation are some of the insults that may contribute to retinal ganglion cell death
(Libby et al. 2005), as represented in Figure 1.3. The relative importance of specific damaging
processes may differ between patients.
Figure 1.3. Diverse factors contributing to the apoptotic retinal ganglion cell (RGC) death in
glaucoma. (From Libby et al. 2005).
12
The ganglion cells die as a result of apoptosis (Dreyer et al. 1996) that can be caused by
mechanical compression, nutritional insufficiency, or toxicity of intrinsic molecules affecting
neurons or blood vessels (Tielsch et al. 1994). The mechanical theory suggests that physical
alterations in the optic nerve head lead to the obstruction of the axonal fibres (Gupta 2004).
This theory tries to correlate the characteristic pattern of glaucomatous optic nerve damage
with the anatomy of the lamina cribosa and the fact that the regions with the greatest damage
corresponds to those of the lamina cribosa that have the thinnest laminar beams.
Several lines of evidence suggest that chronic oxidative stress is important in glaucoma
pathogenesis, as reflected in some of its features: age-dependent clinical onset, constant
exposure of the trabecular meshwork to H2O2 in the aqueous humor, and altered cellular and
molecular responses to H2O2 exposure in vitro (Green 1995). The trabecular meshwork (TM)
is the main target tissue of glaucoma in the anterior chamber. The development and
progression of glaucoma is accompanied by cell loss and functional impairments in this tissue
(Tian et al. 2000). In addition, the effect of reactive oxygen species (ROS) on the adhesion of
TM cells to extracellular matrix proteins results in a rearrangement of cytoskeletal structures
that may lead to TM disruption (Zhou et al. 1999). Oxidative stress can also influence
biological reactions of TM cells (Tamm et al. 1996) and may contribute to the changes
observed in ageing and in primary open-angle glaucoma such as trabecular thickening and
trabecular fusion (Hogg et al. 2000). Results of more recent investigations provide also
convincing evidence that reactive oxygen species play a key role in the pathogenesis of
POAG (Izzotti et al. 2009).
3.2.4. Treatment
Glaucoma causes irreversible blindness due to death of retinal ganglion cells that can only be
prevented by therapeutic intervention in the early stages of the disease. Since peripheral visual
damage occurs first, and because the disease is typically pain free with no obvious symptoms,
substantial visual damage can occur before diagnosis. Treatment for glaucoma is effective and
in the vast majority of cases useful sight can be retained for life if the treatments are used
properly and the agreed management regime followed.
3.2.4.1. Classical treatments The mainstay of glaucoma treatment is to lower the eye pressure, either with eye drops or
surgery. Eye drops usually form the first stage of treatment for glaucoma, and can work in
different ways: most commonly the drops act to reduce the amount of aqueous humour being
produced by the ciliary body (beta-blockers, alpha-adrenergic agonists, carbonic anhydrase
13
inhibitors), some increase the outflow of aqueous humour from the eye (prostaglandins,
parasympathomimetics, hyperosmotic agents), and some do some of each (epinephrine).
There are also a variety of types of surgery for glaucoma (trabeculectomy, aqueous shunt
procedure) depending on the individual needs of the patient. Lasers are also used to treat both
open and closed angle glaucomas with different lasers and different techniques (iridectomy,
cyclophotocoagulation, scatter panretinal photocoagulation, trabeculoplasty, peripheral
iridotomy) used according to need (Detry-Morel et al. 2008).
3.2.4.2. Investigational Glaucoma Treatments While some experimental glaucoma medications explore new ways of controlling IOP, other
treatments are directed at protecting the optic nerve (neuroprotection) to prevent eye damage,
potential vision loss or even blindness.
Many ongoing clinical studies are trying to find neuroprotective agents that might benefit the
optic nerve and certain retinal cells in glaucoma (Levin and Peeples 2008). In all optic
neuropathies including glaucoma, the initial site of injury is the axons of retinal ganglion
cells. Axonal injury triggers apoptotic mechanisms that ultimately culminate in retinal
ganglion cell death. Neuroprotective approaches are varied: 1) the prevention of apoptosis by
inhibiting TNF-α and caspase activity (Tezel 2008); 2) blocking excessive Ca2+ overload due
to overactivation of NMDA receptors (Dong et al. 2008); or 3) blocking nitric oxide toxicity
(Stefan et al. 2007). Many of the neuroprotective agents were developed from the results of
work done on other central nervous system diseases such as Parkinson's and multiple
sclerosis. Examples of neuroprotective agents under investigation for treatment of glaucoma
include Namenda (memantine), Copaxone (glatiramer acetate) (Cheung et al. 2008), and
Gingko biloba (Quaranta et al. 2003).
Other investigational treatments for glaucoma, aimed at controlling high IOP, include Retane
(anecortave acetate), and nanoparticles (Zimmer et al. 1994).
Some people with glaucoma use marijuana because research conducted in the 1970s found
that it had a small, short-term effect in lowering intraocular pressure. However, no research
has found that marijuana is anywhere near as effective as legal glaucoma medications
(Tomida et al. 2006; Kogan and Mechoulam 2007).
3.2.5. Animal models
Animal models with either induced or spontaneous diseases often permit extensive and
invasive investigations not usually possible in human patients. A variety of animal models to
understand the mechanisms of formation and evacuation of the aqueous humor as well as
14
homeostasis maintenance of intra-ocular pressure has been proposed in different animal
species like rabbits (Kolker et al. 1963), dogs (Gelatt et al. 1977), monkeys (Dawson et al.
1993), rats (Shareef et al. 1995) and pigs (Ruiz-Ederra et al. 2005) . The appearance of the
DBA/2J mouse, which develops a progressive increase of IOP that induces the death of
ganglionary cells (John et al. 1998), has given rise to a large amount of studies to establish the
existence of homologies with some type of glaucoma in humans. The increase in IOP in these
animals appears at 8 months of age and remains chronically high until their death. However,
some factors such as the reduced size of the ocular globe and the absence of lamina cribosa in
mice and rabbits, together with the diversity of structures and differences in function of
drainage angles specific to each animal species limit the use of these animal models for some
type of studies. Subsequently, the use of animal models in the glaucoma research until now
has not been highly fruitful.
3.3. Genetics of POAG
Several lines of evidence support the fact that POAG may have a genetic basis.
Family history has been revealed to be one of the most important risk factors for POAG
development (Tielsch et al. 1994). The Rotterdam Eye Study investigated the familial
aggregation of POAG and found a tenfold increased relative risk of the disease in first degree
relatives of affected compared with the general population (Wolfs et al. 1998). In the
Barbados population family study (including persons of African ancestry), 10% of living
relatives examined had open angle glaucoma (Nemesure et al. 2001).
Racial differences in prevalence of POAG exist, further supporting a genetic predisposition
for glaucoma. The prevalence in Africans is estimated to be six times higher than in
Caucasians in certain age groups (Racette et al. 2003).
Further evidence for a genetic basis of POAG stems from twins studies. It has been reported
that POAG was found to be significantly more concordant in monozygotic twin pairs (98.0%)
than their spouses (70.2%) (Gottfredsdottir et al. 1999).
The genetic basis of POAG is also supported by the fact that some non-human animal species
also develop heritable forms of POAG. Inherited spontaneous POAG has been identified in
rhesus monkeys (Macaca mulatta) and both autosomal dominant and recessive POAG is
present in dog breeds (in particular the beagle and miniature poodle) (Gelatt and MacKay
1998).
15
3.3.1. Inheritance and implicated loci
Primary open angle glaucoma is not a mendelial disease caused by a single susceptibility
allele, but a trait with a more complex mode of inheritance. Some families with glaucoma
appear to present autosomal dominant inheritance. Also, many of the individual signs of
POAG are heritable, including cup-to-disk ratio, IOP, aqueous outflow facility, and the
steroid response (Alward et al. 1996), but no single Mendelian mode of inheritance can
adequately describe POAG as a whole. Consequently, it has been proposed that POAG has a
complex or multifactorial aetiology (Newell 1986). In such a model, the interaction of several
genes and environmental factors contribute to the pathology of glaucoma, and therefore a
single underlying susceptibility gene cannot be assumed even in a single pedigree.
Alternatively, POAG may represent a collection of clinically indistinguishable simple
Mendelian disorders. Within a population, the genetic characteristics of one form of
Mendelian POAG would be obscured by the presence of others (Johnson et al. 1996). Since the first description of a heritable form of POAG by Benedict in 1842, more than 10
glaucoma loci have been identified through linkage analysis, although the disease-causing
gene is only known for three of these loci. These three known glaucoma genes are myocilin
(MYOC), optineurin (OPTN) and WD repeat domain 36 (WDR36). Of these, only MYOC is
established as directly glaucoma causative, while the roles of OPTN and WDR36 are still
unclear due to conflicting evidence. Genomewide scans using families (mainly sibpairs)
demonstrating clustering of the disease have led to the identification of a larger number of
genetic intervals containing many possible candidate genes (Wiggs et al. 2000; Nemesure et
al. 2003; Wiggs et al. 2004). Taken together, these two strategies have revealed at least 20
POAG loci (Table 3.1.). Among them, 14 loci have been designated GLC1A to GLC1N by
the HUGO Genome Nomenclature Committee (www.gene.ucl.ac.uk/nomenclature).
16
Locus Symbol Gene Reference 1q21-q31 GLC1A MYOC (Sheffield et al. 1993) 2p14 - - (Wiggs et al. 2000) 2p15-p16 GLC1H - (Suriyapperuma et al. 2007) 2cen-q13 GLC1B - (Stoilova et al. 1996) 2q33-q34 - - (Nemesure et al. 2003) 3p21-p22 - - (Baird et al. 2005) 3q21-q24 GLC1C - (Wirtz et al. 1997) 3p21-22 GLC1L - (Baird et al. 2005) 4q13-q14 - - (Wiggs et al. 2000) 5q22.1 GLC1G WDR36 (Monemi et al. 2005) 5q22.1-q32 GLC1M - (Fan et al. 2007) 7q35-q36 GLC1F - (Wirtz et al. 1999) 8q23 GLC1D - (Trifan et al. 1998) 9q22 GLC1J - (Wiggs et al. 2004) 10p12-p13 - - (Nemesure et al. 2003) 10p15-p14 GLC1E OPTN (Sarfarazi et al. 1998) 14q11 - - (Wiggs et al. 2000) 14q21-q22 - - (Wiggs et al. 2000) 15q11-q13 GLC1I - (Allingham et al. 2005) 15q22-q24 GLC1N - (Wang et al. 2006) 17p13 - - (Wiggs et al. 2000) 17q25 - - (Wiggs et al. 2000) 19q12-q14 - - (Wiggs et al. 2000) 20p12 GLC1K - (Wiggs et al. 2004)
Table 3.1. POAG susceptibility loci identified.
3.3.2. Known glaucoma genes
Until now, only three genes (myocilin, WDR36 and optineurin) have been classified as
POAG-causing genes.
3.3.2.1. Myocilin (MYOC) Myocilin (formerly referred to as the trabecular meshwork-induced glucocorticoid response
protein or TIGR) was the first POAG gene to be identified (Stone et al. 1997). It mapped to
chromosomal region 1q, where the locus for the juvenile form of POAG had previously been
identified (GLC1A) (Sheffield et al. 1993). MYOC mutations are found in 1.1-4% of late
onset POAG patients (Allingham et al. 1998; Lam et al. 2000; Pang et al. 2000; Mataftsi et al.
2001; Michels-Rautenstrauss et al. 2002; Bruttini et al. 2003; Kanagavalli et al. 2003; Melki
17
et al. 2003; Aldred et al. 2004; Sripriya et al. 2004; Weisschuh et al. 2005; Rose et al. 2007),
and in JOAG patients, MYOC mutations frequencies range from 6% to 36% in different
populations (Wiggs et al. 1998; Shimizu et al. 2000; Alward et al. 2002). To date more than
70 disease-associated mutations in MYOC have been identified (Human Gene Mutation
Database), with the p.Q368X mutation being the most common known individual glaucoma
causing variant worldwide (Fingert et al. 1999), and a founder effect has been revealed for
this frequent mutation (Faucher et al. 2002).
Myocilin is a secreted 55-57 kDa glycoprotein that forms dimers and multimers. The protein
has an amino terminal signal sequence, a myosin like domain, a leucine zipper domain, and an
olfactomedin domain. Most of the known mutations occur in the olfactomedin domain, which
is highly conserved among species (Tamm 2002).
Myocilin protein is expressed in high amounts in the trabecular meshwork, sclera, ciliary
body, and iris, and at considerable lower levels in retina and optic nerve head (Tamm 2002).
Although myocilin is found ubiquitously in the eye, it is also expressed in many extraocular
tissues, suggesting that it may not have an eye-specific function (Karali et al. 2000; Fingert et
al. 2002).
The function or functions of myocilin in the eye remain unknown. It has been postulated that
MYOC facilitates aqueous humour outflow, or that it has a protective role against stress
(Johnson 2000). However, early truncations and deletions are not pathogenic in humans (Lam
et al. 2000; Wiggs and Vollrath 2001) and mice with null alleles do not develop high IOP or
glaucoma (Kim et al. 2001). These two observations suggest that MYOC is not necessary for
normal IOP homeostasis, and that mutations in the gene do not cause the disease by a loss of
function effect. Different groups have shown in vitro that mutant MYOC forms insoluble
aggregates that are not secreted and accumulate in the intracellular space (Zhou and Vollrath
1999; Caballero et al. 2000; Jacobson et al. 2001; Joe et al. 2003; Fan et al. 2004; Gobeil et al.
2004). Such an accumulation might interfere with TM function and lead to impaired outflow.
In the TM myocilin has been shown to principally interact with optimedin, an olfactomedin-
related protein (Torrado et al. 2002), as well as binding with flotillin-1, a lipid raft protein
(Joe et al. 2005).
3.3.2.2. Optineurin (OPTN) Optineurin was originally identified in a single large British pedigree with autosomal
dominant NTG and screened in 54 additional NTG families. Three sequence variants were
considered disease causing, accounting for 16.7% of the cases, with the p.E50K mutation
being the most common one. Another change, p.M98K, was significantly more frequent in
18
patients than in controls, and was suggested to confer increased susceptibility to glaucoma
(Rezaie et al. 2002). However, a later study including 1048 POAG patients implicated only
one of these mutations with POAG and in only one patient (Alward et al. 2003). Several other
large studies found similar mutation distributions in patients and controls (Aung et al. 2003;
Leung et al. 2003; Wiggs et al. 2003; Baird et al. 2004; Toda et al. 2004; Willoughby et al.
2004; Mukhopadhyay et al. 2005; Weisschuh et al. 2005; Ariani et al. 2006; Ayala-Lugo et al.
2007). Similarly to the original work, only two studies have found significant association
between p.M98K and POAG (Willoughby et al. 2004; Sripriya et al. 2006), although several
studies did see an increased frequency within their patient populations (Alward et al. 2003;
Baird et al. 2004; Mukhopadhyay et al. 2005; Ayala-Lugo et al. 2007). It has been proposed
that p.M98K may be associated with a lower IOP at the time of diagnosis, and may even
modify MYOC glaucoma (Melki et al. 2003). The clinical importance of the other OPTN
variants remains controversial and when all studies are considered, OPTN mutations do not
appear to be a common cause of POAG.
Optineurin is a 577 amino acid protein that appears to be secreted. The protein has a bZIP
motif and alternative splicing at the 5’-UTR generates at least three different isoforms, but all
have the same reading frame (Rezaie et al. 2002). It is localized throughout the eye, including
the TM, Schlemm’s canal, ciliary epithelium, retina, and optic nerve (Rezaie et al. 2002;
Sarfarazi and Rezaie 2003). The endogenous protein is located intracellularly to the Golgi
apparatus and was detected in samples of aqueous humor from human and several other
species.
Optineurin appears to interact with proteins that regulate apoptosis and may be a component
of the tumour necrosis factor-α (TNF-α) signalling pathway (Chen et al. 1998). In addition,
the protein may interact with huntingtin, Ras-associated protein RAB8, transcription factor
IIIA and two unknown kinases (del Toro et al. 2009). Although few studies have directly
tested the function of OPTN, its expression in neuronal and glial cells of the retina and optic
nerve indicates that it could directly affect retinal ganglion cell survival, playing a
neuroprotective role in the eye and optic nerve (Rezaie et al. 2002; Sarfarazi and Rezaie
2003).
3.3.2.3. WD40-Repeat 36 (WDR36) The third glaucoma gene, WDR36, was identified at the GLCIG locus on 5q22.1 and
sequenced in 130 unrelated POAG patients. Four sequence variants were classified as disease-
causing mutations (Monemi et al. 2005). However, subsequent replication studies in larger
cohorts have failed to confirm a major role of WDR36 as a glaucoma-causing gene. A large
19
family linked to GLC1G did not present any mutations in WDR36 (Kramer et al. 2006). The
authors mentioned that the family could possibly carry a mutation in the promoter, or
alternatively, that another gene mapping to GLC1G causes glaucoma in this family. A two-
stage study with over 400 POAG patients and over 400 age-matched controls failed to
confirm the original findings (Fingert et al. 2007). The most frequent disease-associated
variant in the original study, p.D658G, was found in similar frequencies in patients and
controls. Two other variants were found in patients and not in controls, but the authors
pointed out that this finding is not statistically significant. In addition, WDR36 has been
reported to play a minor role in German (Weisschuh et al. 2007; Pasutto et al. 2008), Japanese
(Miyazawa et al. 2007), and US American (Hauser et al. 2006) glaucoma patients.
The WDR36 protein has 951 amino acids, and contains at least four predicted structural
motifs, with multiple G-beta WD40 repeats. In the eye, WDR36 is expressed in the lens, iris,
sclera, ciliary muscles, ciliary body, TM, retina and optic nerve (Monemi et al. 2005).
However, the exact physiological function of the protein remains unclear and extensive
functional studies are needed to clarify the role of WDR36 variants in the glaucoma
pathogenesis.
3.3.3. Glaucoma candidate genes
Sequence variants in at least 17 genes have been associated with POAG (Table 3.2), but most
of these genes have been reported in one single study, and for those investigated in several
studies, there is controversy as to whether they really show association or not to POAG.
Therefore, the role of these genes in the aetiology of POAG has not yet been clearly
established.
20
Gene
Symbol Gene Name
Chromosomal
Location Reference
ACP1 Acid phosphatase-1 2p25 (Abecia et al. 1996)
AGTR2 Angiotensin II receptor, type 2 Xq22-q23 (Hashizume et al.
2005)
APOE Apolipoprotein E 19q13.2 (Copin et al. 2002)
CDH1 E-cadherin 16q22.1 (Lin et al. 2006)
CDKN1A Cyclin-dependent kinase inhibitor 1A 6p21.2 (Tsai et al. 2004)
CYP1B1 Cytochrome P450, subfamily 1,
polypeptide 1 2p22-p21 (Vincent et al. 2002)
EDNRA Endothelin receptor, type A 4q31.2 (Ishikawa et al. 2005)
GSTM1 Glutathione S-transferase,
mu-1 1p13.3 (Juronen et al. 2000)
IGF2 Insulin-like growth factor II 11p15.5 (Tsai et al. 2003)
IL1A Interleukin 1-alpha 2q14 (Wang et al. 2006)
IL1B Interleukin 1-beta 2q14 (Lin et al. 2003)
MTHFR 5,10-methylenetetrahydrofolate
reductase 1p36.3 (Junemann et al. 2005)
NOS3 Nitric oxide synthase 3 7q36 (Tunny et al. 1998)
NPPA Natriuretic peptide precursor A 1p36.2 (Tunny et al. 1996)
OCLM Oculomedin1 1q31.1 (Fujiwara et al. 2003)
OPA1 Optic atrophy 1 3q28-q29 (Aung et al. 2002)
TAP1/2 Transporter, ATP-binding cassette 6p21.3 (Lin et al. 2004)
TNF-α Tumor necrosis factor alpha 6p21.3 (Lin et al. 2003)
TP53 Tumor protein 53 17p13.1 (Lin et al. 2002)
Table 3.2. Genes harbouring variants with reported association with POAG.
3.4. Loci investigated
In 2000, the first genome linkage screen for POAG was completed, using an initial pedigree
set of 113 affected sibpairs from 41 families (Wiggs et al. 2000). Twenty-five regions were
identified, with seven regions producing a lod score ≥ 2.0 using either model-dependent
(parametric) or –independent (no parametric) methods. When a second set of 69 affected
21
sibpairs was included in the analysis, five regions (chromosomes 2, 14, 17p, 17q, and 19)
continued to produce lod scores > 2.0. Sibpair multipoint analysis also showed interesting
results for the regions on chromosomes 2, 14, 17, and 19, as represented in Figure 1.4.
Figure1.4. Multipoint lod scores. The graphs for the initial pedigree set (113 sibpairs) are shown as
continuous lines. The graphs for the combined pedigree set (182 sibpairs) are shown as dashed lines
(modified from Wiggs et al. 2000).
The Barbados family study, another genome-wide scan comprising 1327 individuals and 146
families, gave also some evidence for linkage to chromosomes 1, 2, 9, 11, and 14 (Nemesure
et al. 2003).
In both studies, chromosome 14q11 was linked to POAG. Therefore, we focused this thesis
on searching for candidate genes within this region. For this purpose, genetic and biological
aspects of the following ten candidate genes were analyzed:
3.4.1. ADCY4 (adenylate cyclase type IV)
ADCY4 maps to 14q11.2 and encodes a membrane-associated enzyme member of the
adenylate/guanylate cyclases family. The protein contains 1,077 residues and presents 2
guanylate cyclase domains (Ludwig and Seuwen 2002). Guanylate cyclases catalyze the
22
formation of cyclic GMP (cGMP) from GTP. cGMP acts as an intracellular messenger,
activating cGMP-dependent kinases and regulating cGMP-sensitive ion channels. In addition
to its well established role in phototransduction (Baylor 1987), cGMP is involved in many
other physiological mechanisms in the retina. One important aspect of cGMP in the retina is
its stimulating role in the absorption of subretinal fluid by activating the retinal pigment
epithelium (RPE) pump (Marmor and Negi 1986). In the retina, cGMP-gated channels were
found in photoreceptors, ganglion cells, bipolar cells and Müller cells (Nawy and Jahr 1991;
Ahmad et al. 1994; Kusaka et al. 1996).
3.4.2. BCL2L2 (B-cell/lymphoma 2- like 2)
BCL2L2 maps to 14q11.2-q12 and encodes a 193-amino acid polypeptide member of the
BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti-
or pro-apoptotic regulators (Chao and Korsmeyer 1998). Expression of BCL2L2 in cells has
been shown to contribute to reduced cell death under cytotoxic conditions, by blocking
dexamethasone-induced apoptosis (Gibson et al. 1996). The protein is expressed in a wide
range of tissues, with highest levels in brain (O'Reilly et al. 2001).
3.4.3. DAD1 (defender against cell death 1)
DAD1 maps to 14q11.2-q12 and encodes a component of the oligosaccharyl transferase
(OST) complex (Yulug et al. 1995). Members of this family are thought to be integral
membrane proteins. DAD1 was initially identified as a negative regulator of programmed cell
death in the temperature sensitive tsBN7 cell line (Nakashima et al. 1993). The DAD1 protein
disappeared in temperature-sensitive cells following a shift to the nonpermissive temperature,
suggesting that loss of the DAD1 protein triggered apoptosis. The protein is highly expressed
in brain, and also present in retina (Wistow et al. 2002).
3.4.4. ISGF3G (interferon-stimulated transcription factor 3 gamma)
ISGF3G maps on chromosome 14, at 14q11.2 according to Entrez Gene. The 48-kDa protein
encoded by this gene contains a ring finger, a motif present in a variety of functionally
distinct proteins and known to be involved in protein-DNA and protein-protein interactions
(Suhara et al. 1996). IFN-alpha stimulates transcription by converting ISGF3 from a latent to
an active form. This conversion occurs in the cytoplasm, and only the activated factor is
transported to the nucleus (Fu et al. 1990). In its latent state, ISGF3 appears to exist as two
independent components, ISGF3-alpha, and ISGF3-gamma. ISGF3-alpha and ISGF3-gamma
associate only following exposure of cells to IFN-alpha. ISGF3-gamma is a DNA-binding
23
protein that serves as the ISRE recognition component (Fu et al. 1992). Microarray and
Northern blot results indicated that ISGF3G is preferentially expressed in young retina, but
qRT-PCR analysis has suggested preferential expression in the elderly retina (Yoshida et al.
2002).
3.4.5. MMP14 (matrix metalloproteinase 14)
Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of
extracellular matrix in normal physiological processes, such as embryonic development,
reproduction (Ueda et al. 2002), and tissue remodelling, as well as in disease processes, such
as arthritis and metastasis (Holmbeck et al. 1999). Most MMP's are secreted as inactive
proproteins which are activated when cleaved by extracellular proteinases. However, the
protein encoded by this gene is a member of the membrane-type MMP (MT-MMP)
subfamily; each member of this subfamily contains a potential transmembrane domain
suggesting that these proteins are expressed at the cell surface rather than secreted (Sato et al.
1994). This protein activates MMP2 protein, and this activity may be involved in tumor
invasion (Nagase and Woessner 1999).
3.4.6. NRL (neural retina leucine zipper)
The protein NRL is a member of the v-maf family of transcription factors (Swaroop et al.
1992). The protein is 237 amino acid residues in size and is encoded by a gene with 3 exons
(Farjo et al. 1997). It has been suggested that NRL forms a homodimer mediated by its
leucine zipper motif and that this homodimer may form the structure recognized by CRX,
another transcription factor (Mitton et al. 2000). Both of these DNA-binding proteins
recognize sequences in the promoters of photoreceptor-specific genes such as those encoding
rhodopsin and interphotoreceptor retinoid binding protein (Kumar et al. 1996; Chen et al.
1997). NRL is expressed in brain and retina, preferentially in rod photoreceptors (Liu et al.
1996; Swain et al. 2001). The protein regulates retinal development and/or differentiation by
acting as a “molecular switch” that signals the cells to develop into rods rather than cones
(Swaroop et al. 1992). Mutations in this gene have been associated with retinitis pigmentosa
and retinal degenerative diseases (Bessant et al. 1999; Nishiguchi et al. 2004).
3.4.7. OXA1L (oxidase cytochrome c assembly 1-like)
The OXA1L gene (5 kb), mapping to the 14q11.2 region (Molina-Gomes et al. 1995), is
composed of 10 exons and 9 introns and contains a 24 N-terminal amino-acid stretch (Rotig et
al. 1997). The 42kDa OXA1L protein is required for the insertion of integral membrane
24
proteins into the mitochondrial inner membrane and is also essential for the activity and
assembly of cytochrome-c oxidase, a complex of 13 proteins involved in cellular energy
metabolism (Coenen et al. 2005; Stiburek et al. 2007). The gene is expressed in several
tissues, including retina (Hillier et al. 1996).
3.4.8. SALL2 (salivary protein-like 2)
The SALL2 gene encodes a member of the spalt proteins family. In humans, mutations in
some of these genes are associated with several congenital disorders (Sweetman and
Munsterberg 2006). SALL2 has been proposed as a tumor suppressor gene as its mouse
orthologue binds to the oncogenic polyoma large T antigen and has been shown to upregulate
p21 expression (Li et al. 2001; Li et al. 2004). The protein present several zinc-finger
domains, usually present in regulatory proteins, and other proteins that interact with DNA.
The SALL2 gene is expressed in a subset of human tissues, with highest expression in brain,
probably in distinct sets of neurons (Kohlhase et al. 1996).
3.4.9. ZNF219 (zinc finger protein 219)
The ZNF219 gene is a member of the Kruppel-like zinc finger gene family. The isolated
cDNA contains an open reading frame of 2169 nucleotides encoding 723 amino acids (Sakai
et al. 2000). The ZNF219 protein contains 9 zinc finger structures and may be related to the
regulation of transcription and developmental regulation (Sakai et al. 2003). The gene is
mainly expressed in brain, but also in lens, eye anterior segment, optic nerve, retina, retinal
pigment epithelial (RPE) and choroid (Bonaldo et al. 1996).
3.4.10. RPGRIP1 (retinitis pigmentosa GTPase regulator-interacting protein 1)
The gene consists of 25 exons, encoding a 1259 amino acid protein with a predicted
molecular weight of 144 kDa (Dryja et al. 2001). As represented in Figure 3.5., RPGRIP1
encodes three structurally different regions: two predicted coiled coil domains and two
leucine zipper motifs at the N-terminal half of the protein, which possibly mediate homotypic
and/or heterotypic interactions; two protein kinase C conserved region 2 motifs (C2) in the
central domain of the protein, probably implicated in Ca2+-dependent membrane docking of
proteins and/or in mediating protein-protein interactions; and a bipartite nuclear localisation
signal and an RPGR-interacting domain (RID) at the C-terminal region (Roepman et al.
2000).
25
Figure 3.5. Structure of RPGRIP1. From Roepman R. et.al. PNAS;2005;102:18520-18525
Multiple splice variants of RPGRIP1 exist and have been found to distribute to subcellular
specific sites (Lu and Ferreira 2005). RPGRIP1 localizes to the photoreceptor outer segments
in humans and is also expressed in the inner retina, namely in the amacrine cells (Mavlyutov
et al. 2002). RPGRIP1 is also found in centrosomes during the cell cycle and in basal bodies,
which are equivalent to centrioles in post-mitotic differentiated cells like photoreceptors (Shu
et al. 2005). RPGRIP1 has been found to interact with RPGR (Boylan and Wright 2000),
RanBP2 (Castagnet et al. 2003) and NPHP4 (Roepman et al. 2005). Mutations in RPGRIP1
most commonly cause Leber congenital amaurosis (Dryja et al. 2001), although a
homozygous missense mutation in one family with late onset cone-rod dystrophy has also
been reported (Dryja et al. 2001; Ferreira 2005). Recently, altered RPGRIP1 levels were
identified in a mouse model for Fabry disease, in which patients have a vascular dysregulation
(Arts et al. 2008).
3.5. The aims of this thesis
Primary open-angle glaucoma is a complex disease, influenced by multiple genetic and
environmental factors. Several candidate genes have been investigated in this study, in order
to elucidate their role in the aetiology of this complex trait, with special emphasis on the
following aspects:
- Screening of MYOC and CYP1B1 in the patients and control collectives.
- Candidate genes selection and systematic mutational screening by direct sequencing.
- Systematic linkage disequilibrium analysis of RPGRIP1.
- Functional analysis of the variants found in RPGRIP1 through yeast two-hybrid-based
assays and immuno technics.
26
4. Materials and methods
4.1. Subjects
The study protocols were approved by the ethics review board of the Medical Faculty of the
University Hospital of Erlangen-Nuremberg, in accordance with the tenets of the Declaration
of Helsinki, and prior to inclusion all the individuals were each informed about the intentions
of these studies and gave their consent to be included.
4.1.1. Patients
4.1.1.1. Recruitment The patients included in the initial study were recruited at the Ophthalmologic Department of
the University Hospital of Erlangen-Nuremberg, Erlangen. The group of patients consisted of
399 subjects of German (Caucasian) origin: 270 with primary open-angle glaucoma (high-
pressure POAG), 47 with juvenile open-angle glaucoma (JOAG), and 82 with normal-tension
open-angle glaucoma (NTG).
The replication group comprised 383 unrelated patients: 304 with NTG and 79 presenting
POAG. The patients of this group were clinically investigated at the University Eye Hospital
in Würzburg and Tübingen following the same clinical procedure as in Erlangen.
4.1.1.2. Diagnosis All individuals underwent standardized clinical examinations for glaucoma comprising
slitlamp biomicroscopy, gonioscopy, automated visual field testing (Octopus G1; Interzeag,
Schlieren, Switzerland), fundus photography (Carl Zeiss Meditec, Oberkochen, Germany),
optional laser scanning tomography (HRT I and II; Heidelberg Engineering, Heidelberg,
Germany) of the disc and a 24-hour Goldmann-applanation intraocular pressure (IOP)
tonometry profile with five measurements. Manifest high-tension POAG was defined as the
presence of glaucomatous optic disc damage (in at least one eye), visual field defects in at
least one eye, and intraocular pressure higher than 21 mm Hg in one eye without therapy.
Causes of secondary glaucoma, such as primary melanin dispersion and pseudoexfoliation,
were excluded. Glaucomatous optic nerve damage was defined as focal loss of neuroretinal
rim or nerve fiber layer associated with a specific visual field defect. According to Jonas,
stage 0 optic disc was defined as normal, stage I with vertical elongation of the cup and
neuroretinal rim loss at the 12 and 6 o’clock positions, stage II with focal rim loss, stage III
and IV with advanced rim loss, and stage V, as absolute optic disc atrophy. Disc area was
measured with HRT or estimated with a Goldmann lens and slitlamp (Haag-Streit, Köniz,
27
Switzerland). A pathologic visual field was defined by a pathologic Bebie curve, three
adjacent test points with more than 5 dB sensitivity loss or at least one point with a more than
15-dB loss. Patients showing glaucomatous changes of the optic disc and visual field but no
IOP elevation over 21 mm Hg after a 24-hour IOP-measurement (sitting and supine body
position) without therapy, received a diagnosis of NTG. Patients were classified as having
JOAG when age at onset in the index case was below 40 years and no other ocular reason for
open-angle glaucoma was visible.
4.1.2. Controls
To aid in the detection of new disease-associated variants, 376 unrelated control subjects of
German origin were recruited at the Ophthalmologic Department of the University Hospital of
Erlangen-Nuremberg, Erlangen, and at the Ophthalmologic Department of the University
Hospital of Würzburg. At the time of examination and inclusion in this study, the age ranged
from 51 to 92 years (mean, 73.9 ± 6.4). These age- and sex-matched control subjects
underwent ophthalmic examinations: they presented IOP below 20 mm Hg, no glaucomatous
disc damage, visual acuity was at least 0.8, and the media were clear for examination. They
had neither any family history of glaucoma.
Control DNA samples for the replication study were obtained from 104 unrelated subjects of
German descent selected at the University Eye Hospital in Würzburg and Tübingen with the
same criteria described above.
4.2. DNA standard methods
4.2.1. Genomic DNA isolation
4.2.1.1. Automated DNA isolation Genomic DNA samples were extracted from peripheral blood leukocytes by automated
techniques (AutoGenFlex 3000) using Flexigene chemistry as indicated by the manufacturers.
4.2.1.2. DNA isolation from COS-1 cells To isolate genomic DNA from COS-1 cells, the Genomic DNA from Tissues and Cells kit, in
which the DNA passes through a column resin, and proteins, detergents, and low molecular
weight compounds are retained, was used according to manufacturer’s instructions.
28
4.2.2. Quantification of dsDNA
Using the formula 1 Unit Absorbance (260nm) = 50µg dsDNA/ml, concentration of DNA
samples was measured in a photometer.
4.3. PCR (polymerase chain reaction) and sequencing
4.3.1. Polymerase chain reaction (PCR)
Kary Mullis was awarded the Nobel Prize in Chemistry in 1993 (shared with Michael Smith)
for his development of the basic method for performing PCR, a technique that he invented
during a night time car ride in 1983 and is now often indispensable in medical and biological
research labs to produce copies from specific DNA fragments by means of two
oligonucleotides (primers) that are complementary to DNA sequences that flank the desired
region. These primers define the position where the DNA polymerase (usually the Taq-DNA-
Polymerase from Thermus aquaticus) should start polymerization, because they provide the
3´-OH end, on which the DNA-Polymerase is dependent. The term “chain reaction” is used
because the method is comprised of a certain number of cycles in which the number of
molecules increases exponentially. These cycles are achieved with a thermocycler and include
3 temperatures steps: denaturing (high temperature to denature the double strand helix),
annealing (calculated temperature for primer hybridization), and elongation (optimal
polymerization temperature of the polymerase).
Usually, 10-20 ng of DNA template were used, plus 100 µM each of deoxyribonucleotide
(dATP, dCTP, dGTP, dTTP), 10 pmol of each primer, 0.5 Units of Taq-DNA polymerase,
10% 5M betaine, DMSO at 5% final concentration, and PCR-Buffer, in a total reaction
volume of 25 µl. A “touchdown” cycler program was used, which consists of 5 min. at 94°C
(initial denaturation), and 10 cycles of: 20 sec. denaturation at 94°C, 1 min. annealing at 65°C
(descending 1°C in each of the following 9 cycles) and 1 min. elongation at 68°C, followed
by 30 cycles: 20 sec. at 94°C, 1 min. at 55°C and 1 min. at 68°C. Finally, a 10 min. elongation
step at 68°C. Different DNA-polymerases were used: the recombinant WinTaq-polymerase,
produced at the own Institute according to Engelke (Engelke et al. 1990), Platinum Taq DNA
polymerase or Ampli Taq Gold polymerase.
4.3.2. Agarose gel electrophoresis
In order to separate DNA molecules (PCR products) by size, agarose gel electrophoresis was
used. Negatively charged nucleic acid molecules move through an agarose matrix with an
29
electric field (usually 120V). Shorter molecules move faster and migrate further than longer
ones. Increasing the agarose concentration of the gel reduces the migration speed and enables
separation of smaller DNA molecules. The agent ethidium bromide is incorporated in the gel
and intercalates in the DNA, allowing the visualization of reddish-orange bands of DNA
when the gel is exposed to ultraviolet light. These DNA bands can also be cut out of the gel,
and then be dissolved to retrieve the purified DNA. Agarose concentration of the gel
oscillates between 1 and 2% for normal size PCR products (< 7 kb). Between 3 and 10 µl of
the PCR product were mixed with bromophenol blue before loading on the gel buffered with
TBE.
4.3.3. Gel extraction of PCR products
The QIAquick Gel extraction kit was used for cleanup of DNA fragments from agarose gels
according to manufacturer’s instructions. It is based on the dilution of the agarose and binding
of the DNA to a column, with subsequent washing and elution of the pure DNA fragment.
4.3.4. Purification of PCR products
4.3.4.1. Purification of PCR-products with magnetic beads For high throughput purification of PCR products, the AMPure system was used, as it
provides an efficient removal of unincorporated dNTPs, primers and salts used during PCR
amplification, which can interfere with downstream applications. The strategy is based on the
binding of the PCR amplification products to magnetic beads, allowing their separation from
the rest of the reaction mixture and contaminants. Finally, the PCR amplicons are separated
from the beads and transferred in a new plate. The whole process is performed automatically
with the use of the pipetting station Beckman Coulter Biomek NX.
4.3.4.2. Purification of PCR-products with Millipore Cleanup Kit Another automated PCR purification method using Millipore’s
Montage PCR96 Cleanup Kit was achieved, according to the manufacturer’s instructions.
This protocol includes one filtration step followed by resuspension and recovery of the
sample in a final volume of 100 µl. The whole process was set up automatically on a Tecan
Miniprep 75-2 station with two vacuum manifolds on the deck.
4.3.4.3. Purification of PCR-products with QIAquick PCR Purification Kit For fast purification of few PCR products, the QIAquick PCR Purification Kit was used in a
microcentrifuge, according to the manufacturer’s instructions. This system combines a spin-
column technology with the selective binding properties of a silica-gel membrane: DNA
30
adsorbs to the silica-membrane in the presence of high salt while contaminants pass through
the column. Impurities are washed away and the pure DNA is eluted with USF water.
Another kit (Plasmid DNA Purification kit ) from Macherey-Nagel was also used, following
the same principles.
4.3.4.4. Enzymatic purification of PCR-products For fast purification of few PCR products, a combination of two enzymes, exonuclease I and
antarctic phosphatase, was also used. Exonuclease I catalyzes the removal of nucleotides from
single-stranded DNA in the 3' to 5' direction, degrading excess single-stranded primer
oligonucleotide from the reaction mixture containing double-stranded extension products.
Antarctic Phosphatase catalyzes the removal of 5´ phosphate groups from DNA, removing
unincorporated dNTPs.
A 10µl mixture containing 4 units of Exonuclease I and 2 units of Antarctic Phosphatase was
added directly to the PCR reaction and then incubated in a thermocycler at 37°C during 15
minutes, followed by inactivation of the enzymes at 80°C during 15 minutes.
4.3.5. Sequencing of purified PCR products with the Sanger method
Frederick Sanger was awarded the Nobel Prize (his second) in Chemistry in 1980 for the
development of an enzymatic method to determine the precise sequence of nucleotides in a
sample of DNA. His approach utilizes 2', 3'-dideoxynucleotide triphospates (ddNTPs),
molecules that differ from deoxynucleotides by having a hydrogen atom attached to the 3'
carbon rather than an OH group. These molecules terminate DNA chain elongation because
they cannot form a phosphodiester bond with the next deoxynucleotide.
Briefly, 5 µl mixture containing 0.2 µl BigDye Terminator v3.1 (DNA polymerase, dNTPs
and 4 ddNTPs, each labelled with a different fluorophore), 2 µl of 5x Sequencing Buffer, 0,3
µl of sequencing primer (10 µM) and water are added to 5 µl of purified PCR product and
subjected to the standard sequencing reaction program: 25 cycles of 10 sec. at 96°C, 10 sec. at
55°C and 2 min. at 60°C. The samples were then analyzed on an ABI Genetic Analizer 3730.
4.3.6. Purification of sequencing products with magnetic beads
The Agencourt CleanSEQ system was used for the removal of unincorporated dye-
terminators in the sequencing reaction. Similarly to the PCR purification process (see 2.3.4.),
it is based on the binding of the sequencing products to magnetic beads, allowing their
separation from the rest of the reaction mixture. Beads are washed with 85% ethanol. Finally,
the products are separated from the beads and can be transferred in a new plate. The whole
31
process is also performed automatically with the use of the pipetting station Beckman Coulter
Biomek NX.
4.3.7. RT-PCR (reverse transcription polymerase chain reaction)
Synthesis of first-strand cDNA from purified total RNA was performed with SuperScript III
Reverse Transcriptase and oligo(dT) primers. This cDNA was then used as template for PCR,
using specific primers for the gene of interest. First, the RNA was denatured by heating to
65°C during 5 minutes a 13 µl mixture containing 1 µl oligo(dT) primer (500 µg/ml), 1 µl of
dNTP mix (10 mM each), total RNA (between 1 and 2 µg) and water. Then, 4 µl 5x First
Strand buffer, 1 µl DTT (0,1 M), 40 units RNase OUT, and 200 units Superscript III were
added, and the cDNA synthesis took place in a thermocycler by heating 60 min. at 50°C and 5
min. at 85°C (enzyme inactivation). In all cases, quality of the cDNA was controlled by co-
amplification of the housekeeping gene GAPDH.
4.3.8. Microsatellite analysis
Microsatellites are polymorphic loci present in nuclear and organellar DNA that consist of
repeating units of 1-6 base pairs in length. They are typically neutral, co-dominant and were
used as molecular markers.
Microsatellite markers were amplified in singleplex reactions in a final reaction volume of 15
µl containing 10 mM Tris, 1.5 mM MgCl2, 100 µM each dNTP, 0.35 U DNA polymerase, 7,0
pmol of each primer, and 20 ng of genomic DNA. One of the primers was end-labelled with a
fluorescent dye (FAM, TET, or TEX). For amplification, a touchdown PCR program was
used with an annealing temperature decreasing from 61°C to 55°C over 6 cycles, followed by
31 cycles with an annealing temperature of 55°C. Products were usually pooled according to
product size and fluorescent label and analyzed on an ABI Genetic Analizer 3100.
4.4. Cloning and plasmid procedures in bacteria
4.4.1. Cloning of plasmids and PCR products in a cloning vector
The TOPO TA cloning vectors pCR2.1-TOPO and pCR4-TOPO were used for different
purposes. Competent E. coli (One Shot TOP10, XL-1 Blue, or DH5α) were transformed with
0,2-0,5 µl of the desired plasmid by incubation on ice followed by heat-shock of the cells for
30 seconds (45 seconds in the case of XL-1 Blue) at 42°C. After 1 hour incubation at 37°C
and 220 rpm, the cells were spread in prewarmed selective plates and incubated overnight at
37°C. In order to clone PCR fragments, a previous ligation reaction had to be performed by
32
mixing 3 µl of PCR product, 1 µl of vector and 1 µl salt solution. Then, 2 µl of the ligation
reaction were transformed as described above. The presence of the desired cloned product in
the vector was checked by PCR of single colonies the next day.
4.4.2. Miniprep plasmid preparation
Purification of DNA plasmids from competent E. coli (One Shot TOP10, XL-1 Blue, or
DH5α) was performed with the QIAprep Miniprep Kit in a microcentrifuge, according to
manufacture’s instructions. The method is based on alkaline lysis of bacterial cells followed
by adsorption of DNA onto silica columns in the presence of high salt. Finally, the pure
plasmid DNA is washed and eluted from the columns. All the plasmids were checked by
means of sequencing prior to using them in further applications.
4.4.3. Midiprep plasmid preparation
The isolation of large amounts of plasmid DNA of high purity was performed with the
QIAGEN Plasmid Midi Kit according to the manufacturer’s instructions. Briefly, one E. coli
colony harboring the plasmid of interest was inoculated in 3ml of LB medium and incubated
at 37°C with shaking for approx. 8 hours. The 3ml pre-culture was then poured in 200 ml of
LB medium and incubated with shaking overnight. The bacteria in this culture were then
precipitated through centrifugation (4°C, 15min, 6000rpm). The plasmid purification protocol
is based on a modified alkaline lysis procedure, followed by binding of plasmid DNA to
QIAGEN anion-exchange resin under low-salt and pH conditions. RNA, proteins, dyes, and
low-molecular-weight impurities are removed by a medium-salt wash. Plasmid DNA is eluted
in a high-salt buffer and then concentrated and desalted by isopropanol precipitation. All the
plasmids were checked by means of sequencing prior to using them in further applications.
4.4.4. Site-directed mutagenesis
Michael Smith was awarded the Nobel Prize in Chemistry in 1993 (shared with Kary Mullis)
for developing this technique in which a mutation is created at a defined site in a DNA
molecule, usually a plasmid.
Site-directed mutagenesis was performed using the QuickChange II Site-Directed
Mutagenesis Kit according to the instructions of the manufacturer. The kit is based on the
replication of both plasmid strands with PfuTurbo DNA polymerase with two primers
containing the desired mutation, and subsequent digestion of the parental DNA template
through DpnI endonuclease treatment. Most of the remaining plasmids should then carry the
mutation and were used to transform XL1-Blue Supercompetent cells with a heat shock at
33
42°C. Colony selection was performed by means of PCR and sequencing of the mutagenised
site using the ABI Prism Big Dye terminator cycle sequencing kit and analyzed on an ABI
Genetic Analizer 3730 to ensure that the constructs were correct.
4.4.5. Gateway cloning
The Gateway cloning system recreates the lambda phage recombination reactions in vitro
through a cocktail of recombination proteins and a set of vectors containing the att sequences
they recognize. Two main reactions are involved (Figure 4.1.). In one, the LR reaction, a
cDNA or other DNA sequence flanked by attL sites is transferred by recombination from an
Entry Clone into a Destination Vector, which contains attR sites. In this process, the
Destination Vector conveys some functionally useful elements, such as a promoter, fusion
tag, new replicon, or selection marker, to the final recombination product. The resulting
molecule, called an Expression Clone, is a subclone of the starting DNA sequence, correctly
positioned (same orientation and reading frame) in a new vector backbone. The second
Gateway pathway is the BP reaction, in essence the reverse of the LR reaction. The BP
reaction transfers a DNA insert, flanked by 25 bp attB sites, from an Expression clone, into a
vector donated by a plasmid containing attP sites. The final product is an Entry Clone
containing the transferred DNA sequence.
Figure 4.1. The Gateway reactions. The scheme shows the four types of plasmids and the two
enzymatic reactions involved in Gateway cloning reactions. Red arrows represent the fragment of
interest. Taken from www.invitrogen.com.
In this study, expression clones carrying cDNA corresponding to the C2 domains of
RPGRIP1 were mutagenized and linearized prior to be subcloned into the Donor Vector
pDONR201 via the BP reaction to create the entry clones. Positive clones were selected from
kanamycin plates and verified by restriction enzyme digestion. The cDNA inserts of the entry
clones were subcloned into the destination vectors p3xFLAG/DEST or pcDNA3-HA/DEST
via an LR reaction, thus maintaining the correct reading frame with the fusion tags. Positive
34
clones were selected from ampicillin plates and verified by restriction enzyme digestion and
nucleotide sequencing.
4.5. Yeast two-hybrid experiments
The yeast two-hybrid system is a molecular genetic test for protein-protein interaction. The
system utilizes the product of the yeast gene GAL4, a protein with two functional domains
that activates transcription of genes involved in galactose metabolism. The DNA binding
domain (BD) of the GAL4 protein interacts with DNA sequences within the promoter region
of GAL1 and the transcriptional activating domain (AD) of the GAL4 protein stimulates
transcription (Fields and Song 1989). In this thesis, wild type and mutated RPGRIP1C2-N+C2-C
proteins (fused in frame to GAL4-AD) were assessed for interaction with NPHP4, fused to the
GAL4-BD domain.
The yeast reporter host strain used was Saccharomyces cerevisiae PJ69-4α, with the following
genotype: MATα, trp1-901, leu2-3,112, ura3-52, his3-200, gal4Δ, gal80Δ, GAL2-ADE2,
LYS2::GAL1-HIS3 met2::GAL7-lacZ (James et al. 1996). This strain contains three separate
reporter genes (HIS3, ADE2 and lacZ) each under the independent control of three different
GAL4 promoters (GAL1, GAL2 and GAL7, respectively) that provide a high level of
sensitivity with respect to detecting weak interactions, coupled with a low background of false
positives. PJ69-4α also contains an endogenous MEL1 gene, which can serve as a forth
reporter or be used as an alternative to GAL-7/lacZ. For selection of yeast clones that have
been cotransformed with the AD and BD plasmids, it carries the auxotrophic markers leucine
(leu2, to select for the AD plasmid) and tryptophan (trp1, to select for the BD plasmid).
4.5.1. Yeast cotransformation
To test for interaction, the corresponding RPGRIP1 prey and NPHP4 bait plasmids were
cotransformed into PJ69-4α following the next procedures:
4.5.1.1. Lithium acetate (LiAC)-mediated cotransformation of fresh growing cells In order to introduce the desired plasmids in the cells, yeast competent cells were prepared
and suspended in a LiAc solution with the plasmids DNA to be cotransformed (400ng each),
along with excess of carrier DNA (5 µl Herring Testes carrier DNA denatured). Polyethylene
glycol (PEG) with the appropriate amount of LiAc was then added and the mixture of DNA
and yeast was incubated at 30°C for 30 min. After the incubations, DMSO was added and the
cells were heat shocked, which allows the DNA to enter the cells. The cells, resuspended in
200 µl NaCl 0.9%, were then plated on the appropriate medium to select for cotransformants
35
containing the introduced plasmids. Because the selection was nutritional, an appropriate -WL
synthetic dropout (SD) medium was used.
4.5.1.2. Transformation of frozen competent cells Although the highest transformation efficiencies are obtained with freshly grown cultures, the
moderately efficient transformation of frozen cells was also used to save time
4.5.1.2.1. Preparation of frozen competent cells Cells were grown in YPAD until their density represented approx. 0.6-1x107 cell/ml (OD
between 0.6-1.0), washed in 0.5 vol of 1.0 sorbitol, 10mM bicine-NaOH (ph 8.35), 3%
ethylene glycol, 5% DMSO, and resuspended in 0.2 vol of the same solution. 0.1ml aliquots
were slowly frozen (to improve their viability) using a Nalgene Cryo 1*C freezing container
(Cat. No. 5100-0001) and store at -70°C until needed.
4.5.1.2.2. Transformation of frozen competent cells 5 µl carrier DNA and 400 ng of each plasmid DNA were quickly added on top of the frozen
cells. Once melting was completed, 700 µl of a 40% PEG1000, 0.2M bicine-NaOH (pH 8.35)
solution was added and incubated at 30°C for 1 hour. Cells were then spinned down and the
pellet resuspended in 200 µl of a 0.15M NaCl, 10nM Bicine-NaOH (pH 8.35) solution. 100 µl
were then plated onto the –WL medium.
4.5.2. X-α-Galactosidase assay
X-α-Gal is a chromogenic substrate for α-galactosidase (also known as melibiase), an enzyme
which enables yeast to use the disaccharide melibiose as a carbon source during growth or
fermentation. In S. cerevisiae this enzyme is encoded by the MEL1 gene which is regulated by
several GAL genes and it was included in the yeast two-hybrid system as a reporter gene of
the cotransformation. Secretion of this enzyme in response to GAL4 activation leads to
hydrolysis of X-α-Gal in the medium causing yeast colonies to turn blue. X-α-Gal was
included in the medium prior to pouring plates. One ml of X-α-Gal stock solution (20 mg/ml
in DMF) was added per 1 litre medium. Plates were incubated at 30°C until blue colonies
form.
4.5.3. β-Galactosidase assays
The gene encoding β-galactosidase (lacZ), a hydrolase enzyme that catalyzes the hydrolysis
of β-galactosides into monosaccharides, of E. coli has been used as a reporter of the
interaction of RPGRIP1 and NPHP4 proteins. When the yeast are cotransformed with the
36
expression vectors containing the interacting proteins and production of LacZ is disrupted the
cells exhibit no β-galactosidase activity, meaning that the interaction is disrupted.
4.5.3.1. β-Galactosidase liquid assay In order to quantify the β-galactosidase activity in solution directly from colonies growing on
solid medium, the Pierce Yeast β-Galactosidase Assay Kit was used according to the
manufacturer’s instructions. Briefly, the protein was extracted, and after incubation the
solution turned yellow from the hydrolysis of ONPG to ONP and galactose in a mildly
alkaline solution. The β-galactosidase activity was then calculated in average using the
equation: β-galactosidase=1000*A420/t*V*OD660. The average is taken from four readings
and four clones that contain the same bait and prey plasmids.
4.5.3.2. β-Galactosidase colony-lift filter assay Although this assay provides only qualitative results, it was a relatively sensitive method to
screen colonies for production of β-galactosidase by the activation of the lacZ reporter gene.
In this assay, the colorless X-Gal is used as a substrate by β-galactosidase, with turns it into a
blue product. To transfer the transformants to a piece of filter paper, this paper was placed
over the surface of the plate with the growing colonies. Air bubbles were carefully removed
and the filter paper was pressed firmly onto the surface of the plate to ensure contact of all
clones with the filter for 3 min. The filter paper was then carefully lifted, using forceps, and
submerged colony side up in liquid nitrogen for 10 seconds. After the filter has frozen
completely, it was removed from the liquid nitrogen, thawed at room temperature and then
incubated with another filter presoaked in 5ml of Z buffer containing 2-mercaptoethanol
(2.7ml/liter) and X-Gal stock solution. The cotransformed colonies turned blue.
4.6. Assays in mammalian cells
The cell lines used in the experiments were COS-7 and COS-1, established from CV-1
(Cercopithecus aethiops), which were transformed by an origin-defective mutant of SV-40
virus. They are fibroblast-like cells that grow as adherent monolayers.
4.6.1. Culture conditions
Cells were routinely grown in DMEM supplemented with L-glutamine, 10% foetal calf
serum, penicillin (10 U/ml) and streptomycin (10µg/ml) in T75 flasks at 37°C and 5% CO2.
When they reached 90% confluence, they were splitted 1:10 by trypsinization with 1µl
37
Trypsine-EDTA 0.5%, a pancreatic enzyme that breaks the extracelullar matrix which allows
the cells to adhere to the container.
4.6.2. Stock preparation
In order to store the cells, they were frozen at -80°C using 10% DMSO as cryoprotectant in
order to preserve them active after thawing.
4.6.3. Cotransfection methods
Different procedures were followed in order to introduce foreigner DNA into the cells:
4.6.3.1. Nucleofection This method is based on the physical procedure of electroporation, using a combination of
optimized electrical parameters with cell-type specific reagents to transfer plasmid DNA
directly into the cell nucleus and the cytoplasm. COS-7 cells were cotransfected with plasmid
DNA by nucleofection with Nucleofector kit V (Amaxa) and program A-24, according to the
manufacturer’s instructions. Twenty-four hours after transfection, the cells were washed with
PBS, lysed in 250 µl ice-cold IP lysis buffer and scraped.
4.6.3.2. Cationic lipid transfection using Lipofectamine and PLUS reagents LipofectamineTM 2000 was used to introduce the different expression vectors into COS-1
cells. The positively-charged components of this reagent form a complex with the negatively-
charged genetic material, and then "escort" it through the membranes of cells. The PLUS TM
reagent was used for pre-complexing DNA so as it enhances the transfection efficacy.
Briefly, 2.5 µg of each plasmid DNA and 20 µl PLUS reagent were diluted in 200 µl
OptiMEM, incubated at room temperature for 15 min, then mixed with 200 µl of OptiMEM
containing 10 µl Lipofectamine, and incubated at room temperature for 20 min to form DNA-
PLUS-Lipofectamine complexes. The DNA-PLUS-Lipofectamine mixture was then added to
the cells and incubated for 5 hours at 37°C, 5% (vol/vol) CO2. Then, the cell media was
replaced with normal media, and incubation was continued at 37°C, 5% (vol/vol) CO2.
Twenty-four hours after transfection, the cells were washed with PBS, lysed in 250 µl ice-
cold IP lysis buffer and scraped.
4.6.4. Coimmunoprecipitation
Coimmunoprecipitation relies on the ability of an antibody to stably and specifically bind
complexes containing a bait protein and its interacting partner. The antibody provides a means
of immobilizing these complexes on a solid matrix.
38
COS-7 or COS-1 subconfluent cells were transiently cotransfected with plasmid DNA and
proteins were expressed for 24h. The cells were subsequently washed in PBS and lysed in ice-
cold lysis buffer. Lysates were cleared by centrifugation at 4°C for 10 min at 14000rpm.
FLAG- and HA-tagged proteins were immunoprecipitated by using, respectively, ANTI-
FLAG M2 affinity gel (Sigma) and anti-HA antibody (Sigma). Immunoprecipitation was
performed overnight at 4°C accomplished through interaction with Protein A/G beads, so that
irrelevant proteins can be washed away. Beads were then washed four times with lysis buffer
and the immunocomplexes were resolved by SDS/PAGE followed by Western blot analysis
with tag-specific primary antibodies.
4.6.5. Immunofluorescence
Immunofluorescence is a technique allowing the visualization of a specific protein or antigen
in cells or tissue sections by binding a specific antibody chemically conjugated with a
fluorescent dye. Expression of fluorescent proteins was induced here to visualize the
subcellular localization of RPRIP1 and NPHP4 proteins using a fluorescence microscope.
NPHP4fl and RPGRIP1C2-C+C2-N were cloned into the vectors pDEST-733 (C-terminal
monomeric red fluorescent protein (mRFP) tag) and pDEST-501 (C-terminal enhanced cyan
fluorescent protein (eCFP) tag) respectively. Mutations were introduced in the RPGRIP1C2-
C+C2N construct by using the QuickChange site-directed mutagenesis kit. All constructs were
verified by nucleotide sequencing. The resulting vectors (2.5 µg each) were transfected in
COS-1 cells using Lipofectamine and PLUS reagents. Cells were grown overnight on glass
microscope slides, fixed in 3,7% formaldehyde for 10 min, permeabilized with 0.5% Triton-
X 100 in PBS for 10 min and stained directly with 1 µg/ml of Dapi for 3 min. Slides were
prepared with 100 µl Mowiol and analyzed by fluorescence microscopy.
4.7. Standard protein methods
4.7.1. Western Blot
A western blot is a method to detect protein in a given extract. It uses gel electrophoresis to
separate denatured protein by mass. The proteins are then transferred out of the gel and onto a
membrane, where they are “probed” using antibodies specific to the protein. The name was
given to the technique by W. N. Burnette in 1981 as a play on the name Southern blot, a
similar technique for DNA detection developed earlier by E. Southern.
39
Samples for SDS-PAGE were prepared by mixing aliquots of the cell lysate with LDS-
NuPAGE Sample Buffer and heated at 70°C for 10 min. Protein samples were run on
NuPAGE 4–12% gradient Bis-Tris gels at 200 V for 50 minutes with MOPS SDS Running
Buffer. For western blot analysis, gels were electrotransferred to a nitrocellulose membrane
for 1 hour. Non-specific binding sites were blocked by incubation in TBS containing 0.5 %
Tween-20 and 5 % non-fat dry milk powder. Proteins were detected by chemiluminescence.
4.7.2. Chemiluminiscence
Cheminiluminiscence detection methods depend on incubation of the western blot with a
substrate that will luminescence when exposed to the reporter on the secondary antibody. The
light is then detected by a photographic film.
Proteins were detected by chemiluminescence using a mouse anti-FLAG M2 monoclonal
antibody and an anti-mouse secondary antibody conjugated with rabbit peroxidase.
4.8. In-situ hybridization
4.8.1. Probe preparation
Three different fragments of GenBank accession number NM_020366 were amplified and
subcloned into the pCR4-TOPO vector using the TOPO TA Cloning Kit and sequenced to
confirm identity. These constructs were then linearized with SpeI, purified with the Qiaquick
PCR Purification Kit and used to generate antisense and sense probes. The manufacturer’s
instructions were always followed.
4.8.2. In-vitro transcription and whole-mount in-situ hybridization.
Through in-vitro transcription, the plasmid DNA was translated into RNA to be used as probe
in whole retina tissue. This work was made by A. Krysta as part of her Diploma thesis. The
human retina of the donor eye (70, man, no known eye-diseases) was isolated 6 hours after
death and fixed for 1.5 hours.
4.9. Bioinformatic tools
4.9.1. PCR primer design
For the design of the PCR primers, Primer3 was normally used with default conditions, except
reduced self complementarity. In cases where the coding sequence of a whole gene had to be
40
screened for mutations, the Exon Locator and Extractor for Resequencing program was used.
After the input of the mRNA accession number for the gene, the program can design primers
for all exons.
Primer3: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
Exon Locator and Extractor for Resequencing: http://elxr.swmed.edu/ex-lax/about.html .
4.9.2. Sequencing analysis
The program package DNA-Star (GATC Biotech), which allows several sequences to be
analyzed at once and compared to the reference sequence, was used for analysis of sequences.
First, quality of the electropherograms was controlled with Sequencing Analysis and
Chromas. Those passing quality control were then analysed with SeqMan.
4.9.3. Microsatellite analysis
The Genotyper program (Applied Biosystems, Foster City, CA, USA) was used for
genotyping of microsatellites.
4.9.4. Genome browsers
For annotation on genomes, the web-based UCSC Genome Browser and Ensembl were used.
UCSC Genome Browser: http://genome.ucsc.edu/cgi-bin/hgGateway
Ensembl: http://www.ensembl.org/index.html
4.9.5. Single nucleotide polymorphism (SNP) and mutation databases
Publicly available information on SNPs and mutations was retrieved from the following
databases.
Entrez SNP: http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp
HapMap: http://www.hapmap.org/cgi-perl/gbrowse/hapmap_B35/
HGMD: http://www.hgmd.cf.ac.uk/ac/index.php
4.9.6. Linkage disequilibrium visualization
For measure and graphical visualization of linkage disequilibrium between SNPs, either from
the HapMap data or from own sequencing or genotyping, the programs Haploview (Barrett et
al. 2005) and LDmax, as implementation of the program GOLD (Abecasis and Cookson
2000) were used. According to the LD-structure, those segments in which SNPs alleles
showed strong linkage disequilibrium (almost no ancestral recombination) were defined as
haplotype blocks (also called LD blocks).
41
4.9.7. Haplotype reconstruction
A combination of alleles at different loci on the same chromosome is a haplotype. Based on
an accelerated EM algorithm, the Haploview software (Barrett et al. 2005) estimates
haplotypes and their frequencies in a whole group of DNAs. For determination of individual
haplotypes, the software PHASE (Stephens et al. 2001), which implements a Bayesian
statistical method for reconstructing haplotypes from population genotype data, was applied.
4.9.8. Selection of haplotype tag SNPs (htSNPs)
Most of the haplotype structure (allele combination) in a particular chromosomal region can
be captured by genotyping a smaller number of markers than all of those that constitute the
haplotype. The crucial markers to type (called tagging SNPs) would be those that distinguish
one haplotype from another. Selection of the htSNPs in each block in order to cover more
than 90% of the haplotype diversity in a given population was performed either with
Haploview (Barrett et al. 2005) or with SNP tagger (Ke and Cardon 2003).
Haploview: http://www.broad.mit.edu/mpg/haploview/index.php
SNP tagger: http://www.well.ox.ac.uk/~xiayi/haplotype/
4.9.9. Multiple sequence alignment
Evolutionary conservation was investigated with protein sequence alignment generated by
ClustalW 1.8 software. The graphic representation was performed with Boxshade.
ClustalW 1.8: http://searchlauncher.bcm.tmc.edu/multi-align
Boxshade: http://www.ch.embnet.org/software
4.9.10. Promotor prediction and promoter database
Several probabilistic models have been developed to predict promotor regions in the genome.
The web sites of promotor prediction programs FirstEF and ElDorado were used.
FirstEF: http://rulai.cshl.edu/tools/FirstEF/Readme/README.html
ElDorado: http://www.genomatix.de/products/Gene2Promoter
4.9.11. Open reading frame (ORF) search
In order to find all ORFs in a sequence, the web-based tools ORF Finder was used.
ORF Finder: http://www.ncbi.nlm.nih.gov/gorf/gorf.htm
42
4.9.12. Transcription factor binding site (TFBS) prediction
Several tools have been designed for searching potential binding sites for transcription factors
in any sequence. I used the web tools Transfac, Consite, TFSearch, Match, and Pupas View
(Conde et al. 2005) in order to obtain as much information as possible.
Transfac: http://www.gene-regulation.com/cgi-bin/pub/databases/transfac/search.cgi
Consite: http://mordor.cgb.ki.se/cgi-bin/CONSITE/consite/
TFSearch: http://www.cbrc.jp/research/db/TFSEARCH.html
Match: http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi
Pupas View: http://pupasuite.bioinfo.cipf.es/
4.9.13. Statistics
Fisher's Exact Test: http://www.langsrud.com/fisher.htm
Odds ratio: http://www.hutchon.net/ConfidORnulhypo.htm
4.10. Nomenclature
GenBank accession NM_020366 was used as the cDNA reference sequence. The
nomenclature recommendations of den Dunnen and Antonarakis (den Dunnen and
Antonarakis 2001) were followed. Nucleotide +1 is the A from the ATG-translation initiation
codon. For amino acid numbering the translation initiation methionine is considered +1.
4.11 Reagents and materials
4.11.1. Kits
Cell Line Nucleofector Kit V Amaxa, Cologne
DyeEx 2.0 spin kit Qiagen, Hilden
FlexiGene DNA kit Qiagen, Hilden
GATEWAY Cloning System GibcoBRL, Karlsruhe
Genomic DNA Isolation Kit for Tissue and Cells Nexttec, Leverkusen
Montage SEQ96 kit Millipore, Schwalbach
Plasmid DNA Purification kit Macherey-Nagel, Düren
QIAGEN plasmid midi kit Qiagen, Hilden
QIAprep spin miniprep kit Qiagen, Hilden
QIAquick gel extraction kit Qiagen, Hilden
QIAquick PCR Purification Kit Qiagen, Hilden
QuikChange II Site-Directed Mutagenesis kit Stratagene, Amsterdam
43
TOPO TA Cloning Kit (pCR2.1-TOPO) Invitrogen, Karlsruhe
TOPO TA Cloning Kit (pCR4-TOPO) Invitrogen, Karlsruhe
Yeast β-Galactosidase Assay kit Pierce, Bonn
Yeastmaker Yeast Transformation System 2 Clontech, Saint-Germain-en-Laye
Zero Blunt TOPO PCR Cloning kit Invitrogen, Karlsruhe
4.11.2. Instruments
Autoclave Hiclave HV85 (HMC, Engelsberg)
Autoradiography cassettes Siemens, Erlangen
Bunsen burner Fireboy plus (Integra Biosciences, Wallisellen)
Centrifuges Centrifuge 5415D (Eppendorf, Hamburg)
Centrifuge 5415R (Eppendorf, Hamburg)
Centrifuge 5810 (Eppendorf, Hamburg)
Minifuge RF (Heraeus, Hanau)
Varifuge 20RS (Heraeus, Hanau)
Varifuge F (Heraeus, Hanau)
Electrophoresis chambers PerfectBlue Gelsystem (peqlab, Erlangen)
XCell SureLock (Invitrogen, Karlsruhe)
Film dryer Mistral 2 (Jobo, Gummersbach)
Gel documentation BioDocAnalyze 2.0 (Biometra, Göttingen)
Ice machine Ziegra, Isernhagen
Incubator BBD6220 (Heraeus, Hanau)
Incubator-shaker Innova 4000
(New Brunswick Scientific, Nürtingen)
Innova 4300
(New Brunswick Scientific, Nürtingen)
Steril benchs BSB6A (Gelaire, Meckenheim)
LaminAir HA2472GS (Heraeus, Hanau)
Magnetic stirrers Ikamag RH (Janke&Kunkel, Staufen)
KMO2 (Janke&Kunkel, Staufen)
Microscope Labovert (Leica, Solms)
Neubauer chamber Brand, Wertheim
pH-meter Knick, Mering
Pipettes Pipetman (Gilson, Bad Camberg)
Research Pro (Eppendorf, Hamburg)
Multipipette Pro (Eppendorf, Hamburg)
Easypet (Eppendorf, Hamburg)
CAPP (Dunn, Asbach)
Plates mixer Incutec, Mössingen
Platform shaker Unimax 1010 (Heidolph, Schwabach)
44
Power supply Power Pac 300 (BioRad, Munich)
EPS 3500XL (Pharmacia, Munich)
Precision balance Sartorius MC1 (Sartorius, Göttingen)
Robotics Tecan Miniprep 75-2 (Tecan, Crailsheim)
AutoGenFlex STAR (Genelimited, UK)
Coulter Biomek NX (Beckman, Krefeld)
Rotating Mixer RM5 (Assistent, Sondheim)
Spectrophotometer Ultrospec III (Biotech, Freiburg)
Tecan GENios (Tecan, Craislsheim)
Sequencer ABI Prism 3730 (Applied Biosystems, Darmstadt)
ABI Prism 3100 (Applied Biosystems, Darmstadt)
Thermocyclers MJ Research (Biozym, Hessisch Oldendorf)
MBS Satellite O.2G (Thermo, Ulm)
Thermomixer Thermomixer compact (Eppendorf, Hamburg)
Vacuum QIAvac96 manifold vacuum (Qiagen, Hilden)
Vortex Janke&Kunkel, Staufen
4.11.3. Enzymes AmpliTaq Gold Applied Biosystems, Darmstadt
Antartic Phosphatase NEB, Frankfurt am Main
DNase I, RNase free Roche, Mannheim
Exonuclease I NEB, Frankfurt am Main
Pfu Turbo DNA polymerase Stratagene, Amsterdam
PfuUltra III Fusion F DNA Polymerase Stratagene, Amsterdam
Platinum Pfx DNA polymerase Invitrogen, Karlsruhe
Platinum Taq DNA polymerase Invitrogen, Karlsruhe
Proteinase K Roche, Mannheim
Pwo DNA polymerase Roche, Mannheim
Restriction endonucleases:
AflIII, ApalI, DpnI, PstI, ScaI, SpeI NEB, Frankfurt am Main
T4 DNA ligase NEB, Frankfurt am Main
Taq DNA polymerase, recombinant Invitrogen, Karlsruhe
Trypsin-EDTA Invitrogen, Karlsruhe
WinTaq DNA polymerase own production, Erlangen
4.11.4. Consumables
Cell scrapers Joseph Peske, Aindling-Arnhoffen
Chemiluminescence film GE Healthcare, Buckinhamshire
Culture plates Greiner, Karlsruhe
Corning, New York
CryoTube vials Nunc, Roskilde
45
Filters Schleicher & Schuell, Dassel
Inoculation loops Nunc, Roskilde
Microscope slides Marienfeld, Lauda-Königshafen
Microscope slide coverslips Roth, Karlsruhe
Millipore Montage PCR Cleanup filter plates Millipore, Schwalbach
Millipore Montage SEQ Cleanup filter plates Millipore, Schwalbach
Nitrocelullose membranes Invitrogen, Karlsruhe
NuPAGE 4-12% Bis-Tris Gel Invitrogen, Karlsruhe
Parafilm Pechiney, chicago
Pasteur pipettes Joseph Peske, Aindling-Arnhoffen
Pipette Tipps Eppendorf, Hamburg
Greiner, Karlsruhe
Sarstedt, Nümbrecht
Serological pipettes Joseph Peske, Aindling-Arnhoffen
Steril tubes Greiner, Karlsruhe
Joseph Peske, Aindling-Arnhoffen
Syringes Discardit II (BD, Fraga)
Thermotubes PeqLab, Erlangen
Thermowell 96-well plates Costar, Schwerte
Thermowell sealing mats Costar, Schwerte
4.11.5. Reagents
Adenine hemisulfate Sigma-Aldrich, Taufkirchen
Agar-agar Merck, Darmstadt
Agarose Seakem LE Biozym, Hessisch Oldendorf
Agencourt Ampure Beckman, Krefeld
Agencourt CleanSEQ Beckman, Krefeld
Ampicillin Roth, Karlsruhe
Anti-FLAG M2 Monoclonal antibody Sigma-Aldrich, Taufkirchen
Anti-HA antibody Sigma-Aldrich, Taufkirchen
Betaine Sigma-Aldrich, Taufkirchen
Bicin Roth, Karlsruhe
BigDye Terminator v1.1 Cycle Sequencing Applied Biosystems, Darmstadt
Boric acid Roth, Karlsruhe
Bromophenol blue Roth, Karlsruhe
Chloroform Merck, Darmstadt
4',6-Diamidino-2-phenylindol Dihydrochlorid (DAPI) Roth, Karlsruhe
Dimethylformamide (DMF) Sigma-Aldrich, Taufkirchen
Dimethylsulfoxid (DMSO) Merck, Darmstadt
Dinatrium salz (EDTA) Roth, Karlsruhe
Dithiothreitol (DTT) Biosynth, Staad
46
dNTPs peqLab, Erlangen
Invitrogen, Karlsruhe
Dodecyl sodium sulphate (SDS) Sigma-Aldrich, Taufkirchen
Enhancing Roti-Lumin detection system Roth, Karlsruhe
Ethanol Roth, Karlsruhe
Ethidium bromide Roth, Karlsruhe
Fetal calf serum Invitrogen, Karlsruhe
Fixer for X-ray films Tetenal, Norderstedt
Formaldehyd Roth, Karlsruhe
D-Glucose Sigma-Aldrich, Taufkirchen
Glycerine Roth, Karlsruhe
Goat anti-mouse IgG-HRP Santa Cruz Biotechnology, New York
Isopropanol Roth, Karlsruhe
KCl Roth, Karlsruhe
KH2PO4 Merck, Darmstadt
LDS-NuPAGE Sample Buffer Invitrogen, Karlsruhe
Lipofectamine 2000 Invitrogen, Karlsruhe
Liquid nitrogen Linde Healthcare, Munich
Lithium acetate (LiAc) Sigma-Aldrich, Taufkirchen
β-Mercaptoethanol Sigma-Aldrich, Taufkirchen
Methanol Roth, Karlsruhe
MgCl2 Invitrogen, Karlsruhe
MgSO4 Merck, Darmstadt
Na2HPO4 Roth, Karlsruhe
NaCl Roth, Karlsruhe
NaH2PO4 Merck, Darmstadt
NaOH Roth, Karlsruhe
Non-fat dry milk Lasana, Herford
Novex Tris-Acetate SDS running buffer Invitrogen, Karlsruhe
NuPAGE Antioxidant Invitrogen, Karlsruhe
NuPAGE transfer buffer Invitrogen, Karlsruhe
Penicillin/Streptomycin Biochrom, Berlin
Penicillin/Streptomycin/L-Glutamine Invitrogen, Karlsruhe
Phenol Roth, Karlsruhe
PLUS reagent Invitrogen, Karlsruhe
Polyethylene glycol (PEG) Sigma-Aldrich, Taufkirchen
Polyvinylalkohol (Mowiol) Roth, Karlsruhe
Ponceau S Roth, Karlsruhe
Prestained Protein-Markers peqLab, Erlangen
Protease Inhibitor Cocktail Tablets Roche, Mannheim
Protein A/G PLUS-Agarose IP reagent Santa Cruz Biotechnology, New York
47
pUC Mix Marker 8 peqLab, Erlangen
Reducing Agent Invitrogen, Karlsruhe
Roentgen developer for X-ray films Tetenal, Norderstedt
Sequencing Buffer 5x Applied Biosystems, Darmstadt
Sodium azide Sigma-Aldrich, Taufkirchen
D-Sorbitol Sigma-Aldrich, Taufkirchen
Tris Roth, Karlsruhe
Tris-HCl Roth, Karlsruhe
Triton X-100 Pharmacia Biotech, Uppsala
Trypton Roth, Karlsruhe
Trypton/Pepton Merck, Darmstadt
Tween 20 Roth, Karlsruhe
X-α-Gal Glycosynth, Warrington
X-β-Gal Biosynth, Staad
Xylene cyanol Roth, Karlsruhe
Yeast extract Merck, Darmstadt
Yeast nitrogen base w/o amino acids Sigma-Aldrich, Taufkirchen
4.11.6. Media and solutions
Agar plates 20 g Agar- agar up to 1 l LB Medium DNA-Loading Buffer (6x) 0.25 % Bromophenol blue 0.25 % Xylene cyanol 30 % Glycerine Dulbecco's Modified Eagle Medium (D-MEM/F-12) Invitrogen, Karlsruhe IP Lysis Buffer 50mM Tris-HCl 150mm NaCl 0.5% Triton-X-100 LB Medium 10 g NaCl 10 g Tryptone 5 g Yeast extract; pH 7.0 up to 1l bidest. Water Opti-MEM I Reduced-Serum Medium Invitrogen, Karlsruhe PBS (10x) 80 g NaCl 14.4 g Na2HPO4 2 g KCl 2.4 g KH2HPO4 up to 1 l bidest. water SD Medium 6.7 g yeast nitrogen base w/o amino acids 182.2 g D-Sorbitol. pH 5.8 40 ml Glucose 50% up to 1 l bidest. water TBE (1x) 90 mM Tris 90 mM boric acid
48
1.25 mM EDTA; pH 8.3 TBS-Tween 24.2 g Tris 80 g NaCl 15 ml 32% HCl; pH 7.6 10 ml Tween-20 up to 1 l bidest. water; pH 7.6 TE Buffer 10 mM TrisHCl 1 mM EDTA YPAD Medium 20 g Peptone 10 g Yeast extract 0,04 g Adenine 99% 40 ml Glucose 50%; pH 6.5 up to 1 l bidest. water Z-Buffer 24.4 g Na2HPO4·2 H2O 5.5 g Na2HPO4· H2O 0.76 g KCl 0.246 g MgSO4; pH 7,0 up to 1 l bidest. water 4.11.7. Oligonucleotides (5´- 3´, for each gene in alphabetical order) From Invitrogen (Karlsruhe) or Thermo Scientific (Ulm). ADCY4 ADC1f GCTTTGAGCGGGTGAGAAA ADC1r GACAGAAACGAGAAGCATCCAG ADC2f TTCGTACTTAGGCTTGAGACACC ADC2r GCTATTCAAGGCCTGGTGAG ADC3f CTCACCAGGCCTTGAATAGC ADC3r ACTTGGAGTCACAGCTCAACAA ADC4f TGAGACCAACTCCAACTACACAC ADC4r CTCCATCCTACACTGATCACCTT ADC5f AAGGTGATCAGTGTAGGATGGAG ADC5r CACGATGTCAGCATACAGCAC ADC6f GGGAGTCAGGTATGAGGAAGAAT ADC6r TGAGGGATCTCTGTAGGTTTGAG ADC7f TCCTACCCTTCTGACCTCTAACC ADC7r AAAGAGCCTGTGTTACAGGAGGT ADC9f CCTGTAACACAGGCTCTTTCTTG ADC9r GGGCTGACAGTAAAGACCACAGAC ADC10f GATCTCTTCTGTGCCAGAGATTG ADC10r TATCTTCTCTGAGGTGAGCTGGA ADC11f TTGGGAGACAGAGAGGTCATTAG ADC11r CTCTTTGTTCTCCGTACTTCTGC ADC12.2f AAGACCCTGGCTTCCTTCAG ADC12.2r TGAAGTACAGTGTCAGTGGGTTG ADC13f GCAGAAGTACGGAGAACAAAGAG ADC13r TGTAGACCCTACCAGTTCTCCAA ADC14f TTGGAGAACTGGTAGGGTCTACA ADC14r GCTGTGTAGAAAGTCCACAGGAT ADC15f AGCTCACACAGCACCTTCATAG ADC15r TATTCTCAGTCCTGGTCGTGTG ADC16f ATAGCATCACCTTCCTCCTCTTC ADC16r CAGATGGTAGATTGCTGGAGACT ADC17f AGTGGCTCAGAGTCAGAGGAGT ADC17r GGGCATCATACACACTGATACAC ADC18f TCACACCCAGTGTGTATCAGTGT
49
ADC18r TCTGCTGTATCCCATCTCACC ADC19f GGTGAGATGGGATACAGCAGA ADC19r GCATTCAACCCTGGAGATTAGA ADC20.2f CTGCTTCCTTTCTTCTCCTTCAC ADC20.2r AATTAGGCCCTATGGCATCC ADC21f GACCTCTAGAAGGGAGAGGAACA ADC21r TGGAGATAGTGTCAGGAAGGAGA ADC22f ACCCTCTCCTTCCTGACACTATC ADC22r GTCCCACTAATAAGCCCATCAA ADC23f TGATGGGCTTATTAGTGGGACT ADC23r CTCTAAGGGCTGGAGGAATGTAG ADC24f CTACATTCCTCCAGCCCTTAGAG ADC24r GTTCGTGTCAAGTCTGTGTTCAG ADC25f ATGGAGAGTACAGGAGTCCTTGG ADC25r GGGAAGAAGAAGAATTCCCACT BCL2L2 BCLe2f CGGGAGGACAGTCATTAAACAT BCLe2r GGTCTCCTTAGTCCACACCTTCT BCLe3f CCTCATCTCACTGGGTTGGT BCLe3r AGACCAGCTTTGCAGAAGGA BCLe4p1f TCCTCTCCTGATATCCCTTTCTC BCLe4p1r AGCCCTGGAACGACTACATCT BM668528 BM668528f TCACATCAGCAACAACAGCA BM668528r GAGCACACAACTAGGCCACA CYP1B1 CYP1B1_e1f CAGTCCTTAAAACCCGGAGG CYP1B1_e1r CCACCCGCTACCTGTAATAATC CYP1B1_e2p1f ACCCAACGGCACTCAGTC CYP1B1_e2p1r CGAGTAGTGGCCGAAAGC CYP1B1_e2p2f ATAGTGGTGCTGAATGGCG CYP1B1_e2p2r GGAAGTACTGCAGCCAGGG CYP1B1_e2p3f CTACAGCCACGACGACCC CYP1B1_e2p3r GCATATTCTGTCTCTACTCCGC CYP1B1_e3p1f TTTTGCTCACTTGCTTTTCTCT CYP1B1_e3p1r TAGAAAGTTCTTCGCCAATGC CYP1B1_e3p2f GCCTGTCACTATTCCTCATGC CYP1B1_e3p2r CAGCTTGCCTCTTGCTTCTTA CYP1B1_e3p3f TGTGAATCATGACCCAGTGAA CYP1B1_e3p3r TTCATTGGGCCCTTTAAGTCT DAD1 DADe1f CTGCGCATTAGTTGTTACGC DADe1r GCAATGCAGGCTCTTCTCATA DADe2f CGGGTATGTCTGTGTTCATTAGC DADe2r CAGTCCCATCCAATTTCTCTTC ISGF3G ISGe2f CCTGTTGCCAGAATCTAGTCTCA ISGe2r CTCGAGGATGAGTGTACCAGTGT ISGe3f GCCTGTAAAGCCAGTCCTATTG ISGe3r ACAGAGAAAGGTCAGGGTCTTG
50
ISGe4f TGAGCCCTACAAGGTGTATCAGT ISGe4r CACCTCTCCCTCTGGTTACTGT ISGe5y6f CTGGGCAACAAGAGTGAAACT ISGe5y6r ACTGCCTAGGGCTATGGTAATGT ISGe7f GAGGGGAGGTGGAGTTGTTC ISGe7r GCCACACAGGATATGCAACA ISGe8f GGGTGAGTAGCACTTAGTTCCAA ISGe8r CTGCTCCATCTGTATTGGAAGAG ISGe9f TCCAGCCATACTCCACAGAA ISGe9r AGTTCTCCACCAGCCAGTGT MMP14 MMPe1f GAGAAGGGAGGGACCAGAG MMPe1r AAAGCCCTCCTCTCCGAATA MMPe2y3v2f CATTGTCGGGGAGGTAGAGG MMPe2y3v2r CCTGCATAAGCACAATGGG MMPe4v2f GAATGTTGCCCCTCTTTATCC MMPe4v2r GGGAACCACCCCTACAAATG MMPe5y6v2f GAGGCTGAGGGAAGGGAC MMPe5y6v2r ACCATGCCCAGCCCATAG MMPe7y8v2f TTGGGGACTGAACCAGAGAC MMPe7y8v2r ACTGAGGGAATTTGGGGTG MMPe9v2f CACTGGTGGATTCGGTCC MMPe9v2r CCTCAACTCCCTATTCCCATC MMPe10.1v2f TAACAGAGCTTCCCTCGCTC MMPe10.1v2r TTTACCAGCGAGGTCTGAGG MMPe10.2v2f AGGGGAACCCTGTAGCTTTG MMPe10.2v2r CTGCTTGGCTTGGCCTG MYOC MYOC_ex1aSf CTCTGTCTTCCCCCATGAAG MYOC_ex1aSr CTGGTCCAAGGTCAATTGGT MYOC_ex1bSf AGGCCATGTCAGTCATCCATA MYOC_ex1bSr AGCAGGTCACTACGAGCCATA MYOC_ex2f ATAGTCAATCCTTGGGCCATT MYOC_ex2r TCTGCTCCCAGGGAAGTTAAT MYOC_ex3aSf CTCCAGGGCTGTCACATCTAC MYOC_ex3aSr ATCCACAGCCAAGTCAATGTC MYOC_ex3bSf CTACCCCTACACCCAGGAGAC MYOC_ex3bSr TGGTCAGGGTCTTGCTGATAC MYOC_ex3cSf GACATTGACTTGGCTGTGGAT MYOC_ex3cSr GACCATGTTCATCCTTCTGGA NPHP4 N4_reseq_R GGATTCTCCATGAGCTGGAA N4fl501_1_RP_F CGACCACTACCAGCAGAACA N4fl501_1_RP_R GTACAGCCGCAACCTTTTGT N4fl501_2_RP_F TTCGGGGGACACAGACAG N4fl501_2_RP_R CAAGTTAACAACAACAATTGCATTC NRL NRL_1f CTCAGAGAGCTGGCCCTTTA NRL_1r GGAACCTGTCACCCTTGAGA NRL_2f CTGGCTTTCCCAAACTCTTG NRL_2r GAGCTCCCCTTCCTCTCTTG NRL_3_1f GCTCTGGACCGAAACAGACT
51
NRL_3_1r GTCATACAGGGCGTGGCTA NRL_3_2f TCTCTACAAGGCTCGCTGTG NRL_3_2r CCCAGAGCTCACTCTTCAGG NRL_3_3f TGTAACCTCCCCATTTTAGCA NRL_3_3r GCAAATTGTCATCCCAGGAG NRL_3_4f CCAAGAAGTCCCCAAGACAA NRL_3_4r CATTTCCATTGGCTCTCCAT NRL_Af AGCAGTGACAGCCAATGAAA NRL_Ar TACGCCTAGTTCGGCTGTCT NRL_A1f GGTTGGAGGTTGTGGAGAAA NRL_A1r GTGGGGGATGATATTGCTTG NRL_A2f ATTGTTGCCTTCCTCCACAA NRL_A2r CTCCCAAAGTGCTGGGATTA NRL_Bf CCTTCAGAGACCACCCACA NRL_Br ATCCTCCTTTCCTTCCCAGA NRL_Cf GGGTTCAAGCAATTCTCCTG NRL_Cr GGGTGACATCAGACCCACA NRL_C1f CTTACCCAGCTGCAAACACA NRL_C1r CGGCATTTGACCTTTGATTT NRL_in1.1f GGTCAGAAGGGTGAAGGTGA NRL_in1.1r GGAGGAAGAGGACAGCACAG NRL_in2.1f AGCCCAGAGGAGACAGGAG NRL_in2.1r GTGACCCTCACAGGATTTGG OXA1L OXAe1f GATAGCTAACCCAGCTCTTCAAC OXAe1r CGAGGTCATGACATTCAGGT OXAe2f GTGGGTCTGCGATAACTGAGAT OXAe2r TGGACAAGAACTCTGCTCCATA OXAe3f ACTTGCTTTGTGTTCGCTACTG OXAe3r AGGCAGAGTGCATCTAGGTATCA OXAe4f GACCTTATTTCTGGGCCTCTTAG OXAe4r CTCATTATCTACCTGGCCTCTGA OXAe5f TAGACCTAATGCTCCCAAGGAGT OXAe5r CATGTATAATCCACCACCACCTG OXAe6f AAACCTCTCATTCTCCCTGTGA OXAe6r CTACTTTACCCTCCAATCCCAGT OXAe7f GGGATTGGAGGGTAAAGTAGTTG OXAe7r GAACACAGAGAAGGGACTCAGAA OXAe8f AGTTCTGACCTTCAGTGGATGAG OXAe8r GCCTGTGTAAAGAGAAGCAAGAG OXAe9y10f AAGGTAAGGGCTCATCCTCTGT OXAe9y10r ACATCTCTGTGTGCCACAGTTC PCK2 PCK2ex2f TGCATGCAGACATGTTTTAGC PCK2ex2r GGTCTGTTTACCCCAAAGCTC RPGRIP1 RPGRIP1_e1f CCATCCCCAGAGGCTAATTT RPGRIP1_e1r GTCCATCCTCAGGCGTAGAA RPGRIP1_e2f TGCTCTCTGGACAAGATGTGA RPGRIP1_e2r TGGTGACGCATGCCTATAAT RPGRIP1_e3f TGTACTGGGGACAGAAGGCTA RPGRIP1_e3r AAGAACAAAATGGGGTGGTG RPGRIP1_e4f TCTGGCTGACTTTAGTTGCAG RPGRIP1_e4r CCTTCAACTGAGAAATGGACCT
52
RPGRIP1_e5f TCCTCGACATGTACCAAGGTT RPGRIP1_e5r ACGAGGGACTCCGTGTCTACT RPGRIP1_e6f TAAGACGGGAAGGCAAGAGA RPGRIP1_e6r CACCTTAGCAGGCAGAGCTT RPGRIP1_e7f GCAGGGGAAAAATAGCAACA RPGRIP1_e7r AATTTGCTCCAGCAATAGGC RPGRIP1_e8f TCCAGAGAAATGCTAGGGTGA RPGRIP1_e8r CTCGGAGCTTCGTTTTTGTC RPGRIP1_e9f TTTGCTGCTTCCCTAGCAGT RPGRIP1_e9r CTTCCAAAAGACTGCCGATT RPGRIP1_e10f TTCCAAGGCAGTTGGTAAATG RPGRIP1_e10r GGATCAAGTGAGGGGATTAAA RPGRIP1_e11f GGAGTGCAAGTAGTATCACCTCA RPGRIP1_e11r CCCTAGAGATATTTGCCAGAGA RPGRIP1_e12f CTGTATCATCTCCCTTCACTGCT RPGRIP1_e12r GTTGTGCTATCATTGAGGTAGGG RPGRIP1_e13f GGGTCTGCAAGGAAATCAAA RPGRIP1_e13r CTTGAACCTGGAAGGCAGAG RPGRIP1_e14f CACCCTCCTCTACCCTAAGAAAG RPGRIP1_e14r CTGGGTAGCAGAAAGTGTGAAAG RPGRIP1_e15f GCTTTGACAGGGTGCTAGAGACT RPGRIP1_e15r GAGAGTGGAAGACTGAACTGTGC RPGRIP1_e16f CCTGATCCAGTTGGGATAGC RPGRIP1_e16r GGGAGACAACACTGGGAAGA RPGRIP1_e17f ATGACTGATGACAAGCAAGCTG RPGRIP1_e17r GCCACTGCACCTACTTCAACTAT RPGRIP1_e18f CCCTCATAATGCCATGAGACTAC RPGRIP1_e18r CAGAGATAGGAGTTCACCGTGTT RPGRIP1_e19f TGGTGACGGGCTCCTGTA RPGRIP1_e19r TGCTCTTGAAAGCCTGATCTC RPGRIP1_e20f ACTCGGAACTAGTGACCAGACAG RPGRIP1_e20r ATTACAAGGACGCTCCACCAT RPGRIP1_e21f TGGGTTAATTGGATGGCGTA RPGRIP1_e21r GTGAAGAGCTGGGACAAAGG RPGRIP1_e22f TAATGAAAGTCTTGGGGCTCA RPGRIP1_e22r ATTCAGCATCAGCACAAAACC RPGRIP1_e23f TCCCATGATGTTCCCTCTTC RPGRIP1_e23r TGGGGGTAAAAATACACAACTG RPGRIP1_e24f GTGCAGATGCCTCGTTATGTC RPGRIP1_e24r CTGCCTGGTAAAGTGCTAAGGTA RPGRIP1_1Af AATCCCGCAAATGTGTTCTC RPGRIP1_1Ar TGGTGAAACCCCGTCTCTAC RPGRIP1_in18.1f CGCCTGTAATCCCAACACTT RPGRIP1_in18.1r ATGAACAGTCCAGGGGTTTG RPGRIP1_in19_2f CACAGCTTGCCATCCAGTTA RPGRIP1_in19_2r ATTGAGTGGTGGGGTCTTTG RPGRIP1_in20.1f GAATCAAGACCAGCCTGAGC RPGRIP1_in20.1r GGGCACACAAGGAAGTTTTC RPGRIP1_in22_1f TTGGCTTTCTTTTTGCCAGT RPGRIP1_in22_1r CAGAGTGCCAGGAATAGGACT RPG_g1793a_F GTTGCTTATGGCACCCAACCGTTGTCGTTATG RPG_g1793a_R CATAACGACAACGGTTGGGTGCCATAAGCAAC RPG_g2435a_F GCTGTGGCCTCCAGAGTCGATGGCTG RPG_g2435a_R CAGCCATCGACTCTGGAGGCCACAGC RPG_a2512g_F CTGACCATGACACTGCCGTCATTCCAGCCAGTAAC RPG_a2512g_R GTTACTGGCTGGAATGACGGCAGTGTCATGGTCAG RPG_c2417t_F CTGTGGATTGAAATCATCAAGTGCTGTGGCCTCC RPG_c2417t_R GGAGGCCACAGCACTTGATGATTTCAATCCACAG RPG_c2291t_F CATAAAACCCAGCCTACAGGTGTGCAATAAACGAAAGAAAG RPG_c2291t_R CTTTCTTTCGTTTATTGCACACCTGTAGGCTGGGTTTTATG RPG_g1767t_F CAAAAAAGCAGGCTCTGAACATCTCAAAGATGTTGCTTATGG RPG_g1767t_R CCATAAGCAACATCTTTGAGATGTTCAGAGCCTGCTTTTTTG
53
RPG_c1904g_F GCACATCCACCAGGGCTTCCTGACATCTG RPG_c1904g_R CAGATGTCAGGAAGCCCTGGTGGATGTGC RPG_c2510g_F CTGACCATGACACTGGCATCATTCCAGCCAG RPG_c2510g_R CTGGCTGGAATGATGCCAGTGTCATGGTCAG RPGroep2500_F TGAGACTTAGAGCCTGGCT RPGroep2501_R AGCCTCATCCAGTACTCTAGAA RPGroep2502_F GCTAGAGACTGTGGAGAAAG RPGroep2503_R CTGGTGGATGTGCAGTTCAA RPGroep2782_R CTCCAAGCACATCGGTTGAC RPGroep3106_R CATCACATACTGGGAGGTGAAGTCA RPGroep3107_R GGCTGAAGCCTCTTGAAGGTAGTG RPGroep7848_F CTATCTATTCGATGATGAAG RPGroep 7849_R CTCTGCAGTAATACGACTCAC RP-FLAG_F CCCAGGAAGAGGAGTTCAGA RP-FLAG_R ATCCGTTGGGTTTCTCTGC RP-HA_F TCAACCGATGTGCTTGGA RP-HA_R GCACTTGAATAGATCCGTTGG reseqRP-FLAG_v2_F CAAGGATGACGATGACAAGC reseqRP-FLAG_v2_R TCAGGGGGTATGTAGGGAAA reseqRP-HA_v2_F GCCACCATGTACCCTTACGA reseqRP-HA_v2_R AGATCCGTTGGGTTTCTCTG contam_int_F TCAGAACGAGCTGTGGATTG contam_int_R CAGGTCAGAGGTCACAAGCA reseq_FLAG_F CAAGGATGACGATGACAAGC reseq_HA_F TTACGATGTACCGGATTACGC RP_reseq_R TCAGGGGTATGTAGGGAAA p12 CTGCAGCGCAAAATCAAC p14b CATCTCCATGGGCTGGCAGTG cRPG_1f TGCTACCAGCCTCAAAAGGT cRPG_1r GTATTGCTGGCCATGATGTG cRPG_2f CCCAGTGAACTTGTTTCTGGTT cRPG_2r TCTCCCTGGACAGCTCAAGT RPcDi3f GCTGAGCTGGAGGACAAGAG RPcDi3r CACCAGCTCCAATCAGTGTG cRPG_4f GCCCATGGAGATGAGGATAA cRPG_4r CCACAGCACTTGGTGATTTC cRPG_5f AAGCCCAGGTCTACCTGTCA cRPG_5r TTTTGCCATGTTTTCTTCTTGA cRPG_6f TTCCTTCCCAGGATCAGATG cRPG_6r CTCCTGTGGGTCCAGGTCTA cRPG_7f TGTCTGATGAGAACATAAAACAGG cRPG_7r AAATAGCATGGAGGACAGCAG is_inicio_v3_F AGGCTGTGAGCTTGAAGAGC is_inicio_v3_R GGTGAGTGGCTGGTTCAGAT is_RP_medio_F CCGCTTCTTCACCTTTTCTG is_RP_medio_R CATCTGATCCTGGGAAGGAA is_RP_final_F TGTCTGATGAGAACATAAAACAGG is_RP_final_R AAATAGCATGGAGGACAGCAG RPc2long733_2_creo_F TGGAGCTGGTGGAGAAGAGT RPc2long733_2_creo_R CCTTCACAAAGATCCCAAGC RPc2long733_1_creo_F CACCATCGTGGAACAGTACG RPc2long733_1_creo_R ACCTGGGCTTTCTTTCGTTT RPc2long501_1_creo_F CCTGAGCAAAGACCCCAAC RPc2long501_1_creo_R ACCTGGGCTTTCTTTCGTTT RPc2long501_2_creo_F CTCTTGCTGCAGGATGGATT RPc2long501_2_creo_R CTCTGCAGGGTCAGTGAGGT SALL2 SALe1f TTACAATGGGAGCTGCAGAA SALe1r CCCTGCATCTCAACTCCTTC
54
SALe2_1f ACCCCCAACTAGCGGTTACT SALe2_1r TTCTGGAGGTAATGGGGTTG SALe2_2f GAGGAGTCTCCAGGGCATTT SALe2_2r ATGAGGCGAGGCAATCAG SALe2_3f GCATCCTTTCTCTGCTGGAG SALe2_3r GGTGCTCTGGTACTGGGTGT SALe2_4f GTGGCAACCTCAAAGTGCAT SALe2_4r CTTGCCGGTCAATCTTTTCT SALe2_5f GCCTCACCCTCTGAGACATC SALe2_5r TCCTCCTCTTCCTCCTCCTC SALe2_6f GGCTCCGAGCAATCTACAGT SALe2_6r GGTCTTCTGATGCTCCTCCA SALe2_7f AGAGAGCAGCAGCAGAAAGG SALe2_7r AAGGGTCACACCAGGGAAG ZNF219 ZNFe2f GGGTAGGGAGTGACTTTACTGCT ZNFe2r GGCAGGAGAGGGAGTATACAGTT ZNF3p1f CTTCACCCTTTGCTCTACGC ZNF3p1r GCTCTTCCAACTCCAGCAAC ZNFe3p2f GTTGCTGGAGTTGGAAGAGC ZNFe3p2r GGCCCTTGAGAAACCAAGAC ZNFe3p3f AGCCCGAACCCAGATCAGT ZNFe3p3r CCACCTCCTCTTCTTCCTCA ZNFe3p4f AAGAAGAGGAGGTGGTGGAG ZNFe3p4r AAGGAAGCTACGAGGGAGTG ZNFe4f TTCACCTCCTAGTGTTTCGGTAG ZNFe5p1f AAATCAAAGTGGGTGGGAGA ZNFe5p1r GAAGAGGCAGCGGTGGAG ZNFe5p2f AACCCCTGGACCTGTCCTT ZNFe5p2r AAGGCACTGTGACTCCCTTG Other regions M13f GTAAAACGACGGCCAG M13r CAGGAAACAGCTATGAC GAPDHf GTGGAGTCCACTGGCGTCTTC GAPDHr CTCCGACGCCTGCTTCACCAC T3 ATTAACCCTCACTAAAGGGA T7 TAATACGACTCACTATAGGG
55
5. Results This thesis was aimed to the identification of new genes predisposing to POAG in German
patients not carrying any known POAG-causing mutation. For this purpose, all patients were
screened for mutations in MYOC, CYP1B1, OPTN, and WDR36, the known glaucoma-
causing genes. In order to identify novel predisposing genes, a candidate gene approach was
followed and ten selected genes were screened for mutations by direct sequencing in an
exploratory collective of 46 patients and 46 controls. Based on the in silico characterization of
the mutations found in the coding region of these genes, RPGRIP1 was prioritized as the best
candidate. Therefore, an extended screening of 399 POAG patients and 376 controls, together
with a further replication study in 383 POAG patients and 104 controls, systematic linkage
disequilibrium analysis and functional studies for RPGRIP1 were performed.
5.1. Screening of MYOC and CYP1B1 in POAG patients
At the time this project was starting, only a small collective of 46 POAG patients was
available for the study. I performed the mutation screening of MYOC and CYP1B1 in this
collective. The rest of the cohort (399 patients) was screened for mutations in these two genes
and also in OPTN and WDR36 as soon as they were recruited. In this thesis, I report the
results of the initial mutation screening of MYOC and CYP1B1 in the first collective
comprising 46 POAG patients.
Variation in the coding sequence of MYOC was found in 8 out of 46 cases, presenting every
individual only one variant. Two patients presented the p.R76K (rs2234926) polymorphism
and one more the synonymous variant p.Y347Y. Four patients carrying a p.T243P variant
were identified and also one carrier of a p.Q368X mutation, accounting together for the
10.7% of the cases (5/46). The rest presented no mutation (Table 5.1., data not published). No
functional characterization of the variants found was performed, due to the lack of a validated
functional assay for myocilin.
Five coding SNPs (p.R48G, p.A119S, p.V432L, p.D449D and p.N453S) were found in
CYP1B1, always in heterozygous form. Three mutations (p.G61E, p.Y81N and p.E229K)
were also identified, accounting for 8.7% of the cases (4/46). The rest presented no mutation.
The results are summarized in Table 5.1.
56
Gene Coding variants Patients (46) p.R76K rs2234926 2
p.T243P 4 p.Y347Y 1
MYOC
p.Q368X 1 Total 8
p.R48G 22 p.G61E 1 p.Y81N 1
p.A119S rs1056827 22 p.E229K 2
p.V432L rs1056836 37 p.D449D 38
CYP1B1
p.N453S rs1800440 9 Total 132
Table 5.1. Sequence variants detected in MYOC and CYP1B1 in the exploratory collective. If
corresponding to a SNP, rs number is also indicated.
The extended systematic mutation screening of the whole collective of 399 POAG patients
and 376 controls led to the identification of 11 amino acid substitutions in CYP1B1, apart
from known polymorphic variants (Pasutto et al. 2009). In order to study the biological effect
of selected CYP1B1 mutations, a functional characterization of the enzymatic activity of the
protein was performed in collaboration with Gabriela Chavarría-Soley, from the group of
congenital glaucoma at the Institute of Human Genetics at the Friedrich-Alexander-
Universität Erlangen-Nürnberg. Each mutation was embedded in its corresponding founder
SNP background haplotype, consisting of 5 frequent coding SNPs (p.R48G, p.A119S,
p.V432L, p.D449D and p.N453S) in which they occur in the normal population (Stoilov et al.
2002). A marker decrease of the relative enzymatic activity (11%) was observed for variant
p.G61E which was classified as bona fide mutation. Variant p.Y81N showed an intermediate
reduction in activity (17%), thus leading to its classification as hypomorphic alleles. On the
other hand, variant p.E229K was classified as polymorphism, as its frequency was not
statistically different between POAG patients (2%) and controls (3%), despite its milder effect
(26%) on relative enzymatic activity. When including only the variants with impaired
function, a total of 13 patients (3.6%) and 1 healthy subject (0.2%) were found. Thus
57
CYP1B1 mutation frequency in POAG patients is significantly higher in patients than in
controls (p=0.0018, Fischer’s exact test; OR=5.4, 95%CI= 1.9 ±15.5), providing evidence of a
strong association of these mutations with the disease (Pasutto et al. 2009) .
5.2. Screening of candidate genes on chromosome 14q11-q12
In a genome-wide scan involving an initial pedigree set of 113 affected sib-pairs and a second
pedigree set of 69 affected sib-pairs, putative loci on 2p14, 14q11, 14q21-q22, 17p13, 17q25,
and 19q12-q14 were linked to POAG (Wiggs et al. 2000). In this thesis, the candidate region
14q11, covering 6.3 Mb between markers D14S261 and D14S121, was searched for genes
presenting adequate pattern of expression, appropriate function and/or structural similarity
with the known glaucoma-causing genes. I found a total of 10 genes out of 266 which met
these criteria (Figure 3.1.).
Figure 3.1. View of the UCSC Genome Browser for chromosome 14q11.2, showing RefSeq
Genes. Red boxes indicate the selected candidate genes.
Systematic screening of these positional and functional candidates was performed in an
exploratory collective of 46 German POAG patients. Direct sequencing of 5’-3’ UTRs, exons
58
and flanking intronic regions led to the identification of 156 SNPs, 46 of them with a minor
allele frequency (MAF) >0.15. From the 37 variants found within the coding regions, 10 were
nonsynonymous changes not previously reported in any database. Each variation was found in
one different patient. The results are summarized in Table 5.2.
Table 5.2. Summary of the variations found in the initial screening of 46 German POAG
patients.
The novel variants were further characterized. Three amino acid changes (ZNF219-p.E251-
P252del, OXA1L-p.S482dup and ADCY4-p.S373R) were identified also in a control
collective of 46 individuals. Five of the remaining variants (ZNF219-p.H462Q, SALL2-
p.D770N, OXA1L-p.I292L, OXA1L-p.R436I) affected amino acid positions not conserved
among different mammalian species (human, mouse, rat, cow and chimpanzee). In contrast,
the three missense variants found in RPGRIP1 (p.R363T, p.R812H and p.G1240E) were both
not present in controls and affecting evolutionary conserved amino acids (Figure 5.2).
Gene symbol
mRNA length
Identified SNPs
SNPs MAF>0.15
Coding variants
Novel non synonymous
variants
ZNF219 3040 6 1 4 p.E251-P252del p.H462Q
RPGRIP1 3860 84 14 10 p.R363T p.R812H p.G1240E
SALL2 1624 9 1 6 p.D770N DAD1 683 4 2 0 -
OXA1L 1717 8 5 6 p.I292L p.R436I
p.S482dup MMP14 2335 18 9 6 - BCL2L2 3510 3 1 0 -
NRL 2102 16 1 1 - ISGF3G 4798 5 0 1 - ADCY4 3415 26 12 3 p.S373R
Total 156 46 37 10
59
Figure 5.2. Interspecific alignment showing the conservation of the three amino acid positions
affected by the mutations found in RPGRIP1. (A) p.R363T-RPGRIP1, (B) p.R812H-RPGRIP1, (C)
p.G1240E-RPGRIP1
Different bioinformatics tools were also used in order to investigate in silico if these variants
altered promotor or transcription factor binding sites, but none of them seemed to affect them.
5.3. RPGRIP1
After the systematic characterization of the coding variants found in the screening of the
exploratory collective of patients, RPGRIP1 arose as a potentially good candidate, so I
focused on further characterizing this gene, both genetically and functionally.
5.3.1. RPGRIP1 haplotype block structure
A total of 84 SNPs with MAF>0.05 were identified by direct sequencing of 27 amplicons
covering a region spanning 34Kb in 46 patients. From these, the 14 SNPs showing MAF>0.15
were used to determine the haplotype block structure of RPGRIP1. Two blocks were
identified using Haploview software (Figure 3.3.A). These data correlates well with the LD
structure for this gene published by HapMap (Figure 3.3.B).
60
Figure 3.3. Linkage disequilibrium (LD) structure of RPGRIP1. Each square plots the level of
linkage disequilibrium (LD) between a pair of SNPs in the region; comparison between neighbouring
SNPs lies along the first line. Red colouring indicates strong LD, blue indicates intermediate or
uninformative LD, and white indicates weak LD. The area limited by a black line show the LD-block.
(A) LD plot constructed with the SNPs at MAF>0.15 identified in this study. (B) LD plot from the
HapMap Project. The black line corresponds to the blocks from our study.
5.3.2. Association of RPGRIP1 with POAG in German patients
Screening for mutations was extended to 399 POAG patients originating from the same
German region, leading to the identification of 14 amino acid substitutions in RPGRIP1
(Table 5.3.). Together, the missense variants accounted for 6.5% of the patient population
(26/399). Five of these variants were detected in 8 out of 376control subjects, accounting for
only 2.1% of the control group (8/376). All patients were negative for MYOC, OPTN,
CYP1B1 or WDR36 mutations. This data provided association of RPGRIP1 with POAG in
this collective (p-value=0.003, 2-Tail Fischer’s exact test) with odds ratio (OR) =2.8 (95%
CI=1.4±5.5).
61
Nucleotide alteration
Amino acid change
Patients (399)
Controls (376)
c.95T>A p.M32L 5 2 c.403A>G p.S135R 1 1 c.953C>T p.A318V 1 0
c.1088G>C p.R363T 1 0 c.1315G>T p.E439X 1 0 c.1753C>T p.P585S 1 2 c.1767G>T p.Q589H* 4 2 c.1793G>A p.R598Q* 3 0 c.1904C>G p.A635G* 2 0 c.2291C>T p.A764V* 1 0 c.2417C>T p.T806I* 1 0 c.2435G>A p.R812H* 1 1 c.2510C>G p.A837G* 2 0 c.2512A>G p.I838V* 2 0
Subtotal 16 3
Total 26 8
Table 5.3. RPGRIP1 sequence variants found in patients and control individuals from the first
collective. * indicates those variants located in or very near to the C2 domains of RPGRIP1 protein.
The group of patients carrying mutations comprised both late juvenile and adult onset POAG
with age at diagnosis varying from 24 to 81 years (Table 5.4.). Among them, 22 had elevated
maximum IOP ranging from 22 to 40 mmHg, while 6 had pressure measurements in the
normal range.
62
Subject ID
RPGRIP1 variant Phenotype
Age at diagnosis (years)
MAX IOP (mmHg;
R/L)
Optic disc (Jonas)
Disc area
(mm2) 99034 M32L POAG 44 25/26 ND ND 99440 M32L NTG 60 21/21 ND ND 13718 M32L POAG 60 30/30 IV/V 2.6/2.6 17163 M32L POAG 67 40/40 IV/IV 2.6/2.6 17483 M32L POAG 67 27/27 I/III 2.1/2.6 7191 S135R POAG 58 26/27 II/II 3.7/3.6 19418 A318V POAG 74 31/ND III/ND 2.6/ND 8562 R363T NTG 51 21/21 II/II 3.3/3.7 99435 E439X NTG 58 20/20 II/II 3.1/2.7 10554 P585S POAG 69 26/26 II/II ND 10653 Q589H POAG 75 21/24 III/IV 1.6/2.1 13652 Q589H POAG 58 26/26 II/II 2.8/3.1 99168 Q589H POAG 49 38/38 I/I 2.0/1.9 21035 Q589H JOAG 25 22/36 0/4 1.9/2.4 99192 R598Q POAG 43 24/24 ND ND 99302 R598Q POAG 44 26/26 III/II ND 99242 R598Q JOAG 24 35/35 I/I 2.9/3 14501 A635G NTG 70 21/21 II/I ND 19243 A635G POAG 81 ND ND ND 13747 A764V POAG 74 28/28 II/II 2.9/2.7 10033 T806I JOAG 29 ND ND ND 10540 R812H NTG 66 20/20 ND ND 16886 A837G POAG 67 ND V/III 2.85/2.89 10366 A837G JOAG 20 24/20 IV/IV ND 11638 I838V NTG 45 20/22 I/I 4.5/4.3 21614 I838V POAG 56 30/32 I/I 2.8/2.8
Table 5.4. Clinical data from patients harbouring a mutation in RPGRIP1.
5.3.2.1. Replication study Interestingly, more than half of the mutations (8/14) were located nearby the region coding
for the C2 domains of the protein. To replicate the observed association data, I screened the
coding region of the RPGRIP1 C2 domains in a further German cohort of 383 glaucoma
patients (304 NTG and 79 POAG) and 104 control subjects. Six amino acid substitutions were
identified in 9 patients (2.3%) and in 2 control subjects (1.9%) (Table 5.5.). Altogether, the
63
distribution of RPGRIP1 C2 domain variants found in German patients from both cohorts
remained statistically significant between patients and controls (p-value=0.013, 2-Tail
Fischer’s exact test; OR=2.5, 95% CI=1.2±5.3).
Nucleotide alteration
Amino acid change
Patients (383)
Controls (104)
c.1808G>C p.C603S 1 0 c.1913C>T p.T638I 1 0 c.2441G>T p.R814L 1 0 c.2521G>A p.A841T 1 0 c2555G>A p.R852Q 4 2 c.2648G>A p.G883D 1 0 Subtotal 9 2
(n=782) (n=480) Total *
25 5
Table 5.5. Amino acid alterations identified in the C2 domains of RPGRIP1 in patients and
control individuals from the replication cohort. * refers to the total of patients and controls from the
first screening and the replication study carrying variations in the C2 domains of RPGRIP1.
The group of patients from the replication group carrying mutations comprised late onset
POAG with age at diagnosis varying from 44 to 88 years (Table 5.6.). Among them, only one
had elevated IOP; the rest presented pressure measurements in the normal range.
64
Subject ID
RPGRIP1 variant Phenotype
Age at diagnosis (years)
MAX IOP (mmHg;
R/L)
Optic disc (Jonas)
Disc area (mm2)
154 C603S NTG 50 10/10 0/0 2.4/2.4 210 T638I NTG 65 17/16 0/I ND 58 R814L POAG ND ND ND ND 290 A841T NTG 29 23/23 I/0 0.7/0.7 24 R852Q NTG 78 19/18 I/I 0.7/0.7 47 R852Q NTG 67 18/19 III/0 2.4/2.1 148 R852Q NTG 88 15/16 ND 1.9/1.7 149 R852Q NTG 83 20/18 I/II 2.6/2.6 292 G883D NTG 44 ND ND ND
Table 5.6. Clinical data from patients from the replication cohort harbouring a mutation in the
C2 domains of RPGRIP1.
5.3.3. Segregation analysis of RPGRIP1 coding variants.
Due to the availability of some relatives, familiar segregation could be studied in 6 cases
(p.439X, p.P585S, p.Q589H, p.R812H, p.A837G and p.I838V). In most of them, no helpful
information could be extracted due to the lack of DNA from affected relatives or to the
absence of any other affected members in the families. This was not surprising, due to both
the complex character of POAG (with reduced penetrance) and the late onset of the disease
(with reduced possibility of finding elder relatives to study the segregation of the mutations).
The pedigree of patient 10540 illustrates well these problems: the index patient was the only
available case, and although one carrier was identified (Figure 5.4., individual IV:2), this
person was non affected, but still young (28) to make a certain diagnosis. This person might
still develop the disease at a later age.
65
Figure 5.4. Pedigree from patient 10540 carrying the p.R812H variation in RPGRIP1. Index
patient (10540) is marked with a red square. The sequence variant could not be found in the family
members III:12 (99044), III:15 (22639), III:16 (22709), and IV:1 (99042). Individual IV:2 (99041)
carries the variant. DNA from the rest of relatives was not available for the study.
5.3.4. Mutations in RPGRIP1 disrupt interaction with NPHP4 in POAG patients
Once the association of RPGRIP1 with POAG was established, I next focused on
investigating the functional relevance of some of the mutations found. This work was made in
collaboration with Ronald Roepman from the Nijmegen Centre for Molecular Life Sciences at
the Radboud University of Nijmegen (The Netherlands), who has previously reported
RPGRIP1 to interact with NPHP4 through its C2 domains (Roepman et al. 2005). Due to the
availability of functional assays to verify this interaction, a subset of 8 amino acid
substitutions located in or very near to the interacting domain of RPGRIP1 could be
functionally characterised. To investigate the effect of these RPGRIP1 variations in the
interaction with NPHP4, the mutations were introduced in the appropriate expressing vectors
and analyzed using the yeast two-hybrid system. To complement these results in a cell-based
assay, coimmunoprecipitation and colocalization studies were performed.
5.3.4.1. Yeast two-hybrid system The different reporter genes from the yeast two-hybrid system previously described (see 4.5.
Yeast two-hybrids experiments) were assayed in order to verify the interaction between
RPGRIP1 and NPHP4.
66
5.3.4.1.1. Qualitative growth on SD-WLHA plates Only yeast cells cotransformed with both pAD/RPGRIP1 and pBD/NPHP4 are able to grow
on dropout plates containing SD-agar –Leu –Trp –His –Ala, as result of the activation of the
HIS3 and ADE2 reporter genes. In this study, RPGRIP1 mutants p.Q589H, p.A764V, and
p.R812H retained the ability to grow on a SD-WLHA selection plate. In contrast, RPGRIP1C2-
N+C2-C carrying the mutation p.R598Q was not able to grow on the dropout selection plate,
indicating a severely decrease in the interaction of RPGRIP1 with NPHP4. Mutants p.A635G,
p.T806I, p.A837G, and p.I838V showed a mildly low ability to grow, although not much
different from the wild-type. As a negative control, a truncated RPGRIP1 construct carrying a
nonsense mutation p.R890X and therefore not able to interact with NPHP4 was used.
5.3.4.1.2. α-galactosidase activity Activation of the MEL1 reporter gene enables the yeast cells to produce α-galactosidase,
causing yeast colonies to develop a blue colour. The α-galactosidase activity of RPGRIP1
mutants p.Q589H, p.A764V, and p.R812H was not different from that of the control
RPGRIP1C2-N+C2-C when interacting with NPHP4. RPGRIP1s p.A635G, p.T806I, p.A837G
and p.I838V showed a reduced enzymatic activity. On the other hand, p.R598Q-RPGRIP1
and the negative control presented not detectable α-galactosidase activity.
5.3.4.1.3. β-galactosidase activity Qualitative and quantitative assays were performed to report the β-galactosidase activity,
which can be regarded as a measure of the binding affinity of the interaction between
RPGRIP1 and NPHP4 proteins.
5.3.4.1.3.1. Qualitative filter lift assay When a filter lift β-galactosidase assay is performed on a plate, clones produce a blue product
as result of the lacZ reporter gene activation. As shown in Figure 5.5., p.R589Q-RPGRIP1
(nr. 2) did not activate the β-galactosidase reporter in the filter lift assay, suggesting absence
of interaction between this RPGRIP1 mutant and NPHP4. As expected, the same result was
obtained for the negative control RPGRIP1-p.R890X. On the other hand, RPGRIP1 variants
p.A764V and p.R812H manifested a strong activation of the β-galactosidase and therefore
interaction between RPGRIP1 and NPHP4. The RPGRIP1 mutants p.A635G, p.T806I,
p.A837G, and p.I838V presented a reduction in the enzymatic activity in comparison with the
wild-type.
67
Figure 5.5. Specific activation of the lacZ reporter gene in the filter-lift assay. Every variant was
tested for quadruplicate.
5.3.4.1.3.2. Quantitative β-galactosidase enzyme activity assay
An ONPG assay was used to quantify the β-galactosidase activity of the yeast cells, as result
of the lacZ reporter gene activation. As a negative control, p.R890X-RPGRIP1 was used,
indicating the somewhat leaky activation of this reporter gene without selection for
transactivation. Binding with NPHP4 was severely disrupted when the RPGRIP1C2-N+C2-C
fragment contained the p.R598Q mutation. Although milder, an impaired interaction between
the two proteins was also revealed by RPGRIP1 variants p.A635G, p.T806I, p.A837G and
p.I838V. In contrast, RPGRIP1s p.Q589H, p.A764V and p.R812H did not cause any decrease
in the interaction between RPGRIP1 and NPHP4, presenting similar β-galactosidase activity
to that of the wild-type protein.
68
Figure 5.6. Quantification of NPHP4-RPGRIP1 interactions by a liquid β-Galactosidase
assay. The black bars indicate the average enzymatic activity (in arbitrary units). The error
bars show standard deviation.
5.3.4.2. Coimmunoprecipitation In order to establish if the interaction of RPGRIP1 with NPHP4 was affected by any of the
mutations, epitope-tagged full-length NPHP4 (N4FL) and RPGRIP1C2-N+C2-C constructs were
expressed in COS-1 cells and coimmunoprecipitation assays using anti-FLAG antibodies were
performed (Figure 5.7.).
As expected, HA-NPHP4FL clearly coimmunoprecipitated with FLAG-RPGRIP1C2-N+C2-C
(lane 9). The negative control, Flag-tagged leucine-rich repeat kinase-2 fragment (LRKK2LRR)
(40kDa) did not coimmunoprecipitate with HA-NPHP4FL (lane 10) indicating that the
coimmunoprecipitation of RPGRIP1C2-N+C2-C was specific. The RPGRIP1 p.R598Q alteration
severely disrupted the interaction with NPHP4 (lane 2), suggesting a pathologic character of
this variant. Introduction of the other amino acid exchanges showed no significant effect on
the RPGRIP1-NPHP4 interaction (lanes 1, 3-8).
69
Figure 5.7. Immunoprecipitation (IP) of wild-type and mutated FLAG-RPGRIP1C2-N+C2-C and
HA-NPHP4FL. Coimmunoprecipitation is shown in Top. The middle two blots show 6% input of the
COS-1 lysate protein mixtures as well as immunoprecipitation of HA-tagged NPHP4FL with anti-HA
beads.
5.3.4.3. Colocalization of RPGRIP1 and NPHP4 in COS-1 cells In COS-1 cells expressing only the full-length NPHP4 fused to mRFP, the protein was
localized in specific structures around, but not in, the nucleus. In cells only transfected with
RPGRIP1C2-N+C2-C-eCFP, the protein was localized in the nucleus. Coexpression of NPHP4FL
with RPGRIP1C2-N+C2-C fully retained the latter to the cytoplasm, resulting in the in vivo
colocalization of both proteins. Coexpression of NPHP4 with RPGRIP1 mutants p.Q589H,
p.A635G, p.A764V, p.T806I, p.R812H, p.A837G, or p.I838V resulted in the colocalization of
both proteins in the cytoplasm as well. Interestingly, in cells expressing both NPHP4 and
p.Q589H-RPGRIP1, both proteins colocalized in the cytoplasm but a substantial nuclear
signal could also be detected for the RPGRIP1 mutant, suggesting that this amino acid
substitution influenced the (co)localization results (Figure 5.8.).
70
Figure 5.8. Colocalization of RPGRIP1 and NPHP4 upon overexpression in COS-1 cells. (A)
DAPI staining of the cell nuclei (blue signal). (B) single transfection of mRFP-NPHP4 (red signal).
(C) single transfection of eCFP-RPGRIP1 (green signal). (D-F) Coexpression of both RPGRIP1 and
NPHP4 wild-type proteins in the same cell. The dashed line delimitates the nuclear compartment. (D,
mRFP signal; E, eCFP signal; F, overlay of D-E). (G-I) Coexpression of p.R598Q-RPGRIP1 and
NPHP4 in the same cell (G, mRFP signal; H, eCFP signal; I, overlay of G-H).
5.3.4.4. Classification of the RPGRIP1 variants In view of the results of the different yeast two-hybrid experiments together with the
coimmunoprecipitation and colocalization assays, I was able to determine the functional
relevance and systematically classify those RPGRIP1 variants located within the C2 domains
of the protein, as summarized in table 5.7.
71
Nucleotide alteration
Amino acid change
Patients (399)
Controls (376)
Functional classification
c.1767G>T p.Q589H 4 2 polymorphism
c.1793G>A p.R598Q 3 0 bona fide mutation
c.1904C>G p.A635G 2 0 bona fide mutation
c.2291C>T p.A764V 1 0 polymorphism
c.2417C>T p.T806I 1 0 bona fide mutation
c.2435G>A p.R812H 1 1 polymorphism
c.2510C>G p.A837G 2 0 bona fide mutation
c.2512A>G p.I838V 2 0 bona fide mutation
Table 5.7. Identified and functionally validated RPGRIP1 mutations and polymorphisms. The β-galactosidase activities of the RPGRIP1 p.Q589H, p.A764V and p.R812H variants
were similar to that of the wild-type protein, indicating that these variants probably do not
alter the interaction between RPGRIP1 and NPHP4. The results obtained in the qualitative
yeast two-hybrid and colocalization assays, suggesting interaction between both proteins,
corroborated also the classification of these variants as non pathological polymorphisms. An
impaired interaction with NPHP4 was, however, revealed by RPGRIP1 p.A635G, p.T806I,
p.A837G and p.I838V variants, which suppressed the enzymatic activity to a similar level to
that of the negative control p.R890X. In addition, variant p.R598Q resulted in an even lower
enzymatic activity than p.R890X, implying a complete disruption of the RPGRIP1-NPHP4
interaction, which could be confirmed by coimmunoprecipitation and colocalization assays.
This led to their classification as bona fide mutations.
The rest of the variants identified in the mutation screening and located far from the C2
domains of RPGRIP1 could not be characterized, as there is no functional assay available at
this time. The group of our collaborator Ronald Roepman is currently working on this issue.
To summarize, the association and functional results herein reported suggest that rare
heterozygous loss of function variants in RPGRIP1 are a risk factor for POAG and reaffirm
the hypothesis that genetic predisposition to this disease is mainly cause by rare variants
rather than common SNPs.
72
5.3.5. RPGRIP1 undergoes significant alternative splicing
Different RPGRIP1 isoforms have been reported in the literature (Mavlyutov et al. 2002;
Castagnet et al. 2003; Lu and Ferreira 2005). In order to identify novel splice variants,
primers spanning the whole genomic sequence of RPGRIP1 were used to perform RT-PCR
on cDNA from different human eye tissues and blood. Using primers complementary to exon
12 and 14 previously reported (Lu and Ferreira 2005) five alternative splicing isoforms could
be identified in sclera, retina and blood (Figure 5.9.).
Figure 5.9. RT-PCR of RPGRIP1 comprising exons 12-14 from different human cDNA eye
tissues. (1) sclera. (2) choroids. (3) cornea. (4) retina. (5) blood.
The amplicons comprised 223, 256, 330, 440 and 650 bp, with the one with 256 bp being the
most abundant and encoding the canonical exons 12, 13, and 14. Sequence analysis also
revealed that the isoform with 223 bp had exon 13 truncated by 33 nucleotides, leading to an
in-frame deletion of 11 amino acids. In isoform 650 bp, the whole intron 13 (450 bp) was
translated, resulting in an in-frame insertion of 150 amino acids. Isoforms 330 and 440
contained in each case the first 117 and 246 nucleotides of intron 12, coding for in frame
insertions of 39 and 82 amino acids respectively (Figure 5.10). A replication of these results
with a different primer pair could not be performed due to time constrains as I concentrated
on the functional validation of the variants found in the screening.
73
Figure 5.10. Summary of mRNAs detected by sequencing of RT-PCR products overlapping
coding regions of exons 12 and 13 of RPGRIP1. RefSeq exons 12-14 of RPGRIP1 (top) and five
isoforms identified (bottom) are shown.
74
6. Discussion
6.1. Genetics of POAG as a complex disease
Unlike single gene Mendelian diseases, complex genetic disorders (such as asthma, diabetes,
schizophrenia and glaucoma) are caused by the combined effect of multiple variants in a
number of genes coupled with environmental factors. Despite the recent improvements in the
throughput of genetic and genomic techniques and the increased availability of gene and
marker data, we remain largely ignorant of the overall genetic architecture of complex traits
like POAG, including the total number of genes, the typical effect sizes for risk alleles, and
the genetic interactions among them.
6.1.1. Study design
There are a number of approaches to disease gene identification and many arguments to
support the merits of one strategy over another (see also 3.1.2. Methods for genetic dissection
of complex diseases). Their relevance in dissecting glaucoma is discussed below.
The application of a linkage approach depends on the availability of large pedigrees or, if
not possible, in combining data from a large number of affected sibpairs, permitting the
identification of genes responsible for a disease without any preconception of the biological
mechanisms underlying the disorder. This strategy led to the identification of the three
currently known POAG causing genes (MYOC, OPTN and WDR36). Although these genes
with large effect were found segregating with the disease in pedigrees, in the majority of the
sporadic cases occurring in the general population the underlying genetic cause of the disease
remains unknown and these three genes do not play a significant role, due to the high
heterogeneity attributable to complex traits, in which each gene with phenotypic relevance is
thought to make a relative small contribution to the overall disease susceptibility. In the
absence of unfeasibly large sample sizes, these small effects are likely to be below the
threshold of detection (Risch 2000). In order to circumvent this problem, the threshold of
acceptable LOD score is typically relaxed from 3 to 2, or sometimes even lower (Pericak-
Vance et al. 1998). Subsequently, we would expect to see a number of hits due to chance
alone with a comprehensive genome scan at this threshold. If this first problem is solved and a
statistically significant evidence of linkage is obtained, extensive candidate gene studies are
still required to identify the causal gene within the region. Despite of being successful in the
identification of glaucoma genes until now, I consider that conventional linkage analysis is
75
not the ideal strategy for glaucoma research, as it depends on the availability of large
pedigrees, which are especially difficult to recruit for late onset diseases such as glaucoma, in
which most of the cases appear sporadically in unrelated patients. It may explain, at least
partially, why only three causative genes for POAG were identified after 16 years of research.
In the last few years, association studies based on genotyping have demonstrated potential
for identifying SNPs and haplotypes associated with a range of common clinical phenotypes,
such as myocardial infarction, breast cancer or age-related macular degeneration. Different
projects aim to identify as much as possible of the underlying genetic variation in human
populations, including the International HapMap Project (www.hapmap.org) or the 1000
Genomes Project (www.1000genomes.org). However, only a small fraction of observed
phenotypic variation is currently attributable to identified allelic variants, and only a few of
the many risk loci reported have been confirmed and replicated. Furthermore, once the
association has been identified, fine localization of the risk variants and functional
characterization of their biological effect are still needed. Reported associated alleles with
POAG show marginal p-values and subsequent studies fail to replicate the initial findings. An
adequate phenotyping and good characterization of patients and controls is also crucial in any
association study. The main sign of glaucoma is cupping of the optic nerve head, but this
observation is somewhat subjective and difficult to diagnose early in the disease.
Subsequently, young people are often not well characterised and the diagnosis can vary also
between ophthalmologists. Lack of success of the association approach in finding genes
responsible for POAG may be due to all these different factors playing together. The need of
application of objective diagnostic criteria for glaucoma worldwide and establishment of large
international collaborations to achieve the high number of patients and controls required for
such association studies becomes therefore clear in order to detect the low effects supposed to
this kind of trait.
An alternative option to the traditional linkage and association approaches are candidate gene
resequencing studies, which directly test the association between a particular allele of a gene
that may be involved in the disease (i.e., a candidate gene) and the disease itself. My search
for glaucoma genes exemplifies the pros and contras of this kind of strategy. Briefly, I looked
for candidate genes in a region with reported linkage to POAG in genome-wide linkage scans
and performed mutation analysis in a large group of patients and controls. The first difficulty
arose by the concept of candidate gene itself. The perfect candidate should play a relevant role
in the disease under investigation. However, not much is known about the cellular and
biochemical events that are necessary for retinal ganglion cell function/survival or regulation
76
of intraocular pressure. In this thesis, genes considered as potentially good candidates for
POAG are genes that modulate apoptosis, together with genes expressed in the eye and/or
sharing protein domains or interacting with known glaucoma genes, although the question of
how representative the pathogenesis of MYOC, OPTN or WDR36 glaucoma is for the
majority of sporadic POAG cases remains still open. In addition, the selected candidate genes
were also positional candidates because they map to the reported glaucoma linked locus
14q11 (Wiggs et al. 2000). The second challenge lies in discerning which sequence variants
are pathogenic and which are simply polymorphisms. Amino acid replacements found in
candidate genes were analyzed for the biochemical severity of the missense changes, the
localization and/or context of the altered amino acid in the protein sequence and their degree
of evolutionary conservation. In addition, the frequency of the variants in patients should be
statistically significant higher than in controls. However, once again the complex nature of
this trait complicates the picture, and innocent polymorphisms could show a statistically
significant association with POAG by virtue of linkage disequilibrium if they are located
within or near the causative gene. A segregation analysis in unrelated but clinically similar
families should offer the most convincing evidence for causality. However, the possibility of
genetic heterogeneity in the families, incomplete penetrance at the individual level,
phenocopies and/or gene-gene or gene-environment interactions can not be rule out so easily.
The late age of onset of the disease further complicate things, because individuals classified
as healthy at 40 may develop the disease at 50 years, and even in the same family, age of
onset can be variable. The last challenge is to explain the biological effect of the variants.
Being POAG a complex disorder, the contribution of each variant to the development or
progression of the disease is supposed to be limited. A main function of the candidate gene,
RPGRIP1, is to serve as a scaffold for a large protein complex acting in signalling pathways
of different retinal cell subpopulations (Oti et al. 2008). Through yeast two-hybrid screening
of a retinal cDNA library, RPGRIP1 was found to specifically bind through its C2 domains to
NPHP4 (Roepman et al. 2005). At this point, we started a collaboration with Ronald
Roepman from the Nijmegen Centre for Molecular Life Sciences at the Radboud University
of Nijmegen (The Netherlands) to functionally test the effect of our variants in this
interaction.
6.1.2. Common variants versus rare variants
Two theories have been proposed to understand the genetic architecture underlying common
diseases.
77
The most widely accepted common disease/common variant hypothesis (CD-CV) holds, as its
name suggest, that disease-predisposing alleles for common diseases are common alleles with
a relative high frequency (>0.01) in the population, each with a small contribution to the
pathophysiology of the disease (Lander 1996). These common susceptibility alleles are
potentially detectable in large-scale patient-control association studies using a huge number of
frequent SNPs as markers, as it has become possible nowadays due to the availability of array
genotyping platforms.
In contrast, the common disease/rare variant hypothesis (CD-RV) affirms that common
diseases are due to a large number of rare variants at many different loci. Due to their low
frequencies, rare variants will not be detectable by population association studies; their
discovery depends on extensive resequencing of carefully selected candidate genes in
relatively large numbers of carefully chosen cases, together with a thorough analysis of the
functional effects of any suspected variants (Bodmer and Bonilla 2008). POAG is
characterized by a high locus and allelic heterogeneity, with different rare variants in
numerous genes (Allingham et al. 2009). For these reasons, I sequenced the entire RPGRIP1
coding sequence in a large cohort of POAG patients, as I expect to find association to rare
variants rather than to common SNPs, in line with previous findings in other glaucoma genes
such as MYOC and WDR36.
6.2. Screening of MYOC and CYP1B1 in POAG patients
Knowledge about the genetics of glaucoma is far from complete. Together with WDR36 and
OPTN, MYOC is one of the genes with a recognized role in the pathophysiology of POAG,
although the exact mechanism remains unknown. Different large studies have shown that only
3% to 5% from POAG patients carry mutations in the MYOC gene. More than 100 potentially
disease causing mutations have been identified so far in the MYOC gene (Human Gene
Mutation Database Cardiff, HGMD), most of them located in exon 3, which contains an
olfactomedin-like domain. MYOC is secreted into the aqueous humour and expressed in the
trabecular meshwork, which is responsible for the drainage of aqueous humour. Apparently,
mutant myocilin, lacking the olfactomedin-like domain, is not correctly processed in the
endoplasmic reticulum and accumulates into insoluble aggregates (Zhou and Vollrath 1999).
The presence of increasing amounts of mutant protein induces a fraction of the soluble, native
myocilin to move to the insoluble fraction. Interestingly, mice with a targeted disruption of
the myocilin gene do not exhibit a pathological phenotype, indicating that a loss-of-function
effect does not cause the glaucomatous phenotype in humans (Tamm 2002).
78
Heterozygous mutations in CYP1B1 are associated with primary congenital glaucoma (PCG),
but their contribution to the occurrence of POAG remains controversial. CYP1B1 belongs to
the P450 gene superfamily, with more than 300 members. More than 50 PCG-causing
mutations have been described, from which around 50% cause a truncated protein, with loss
of the heme-binding domain coded in exon 3 or loss of highly conserved amino acids with
important function. CYP1B1 is assumed to participate in the normal development and
function of the anterior eye chamber (Choudhary et al. 2007) and has also a role in retinoic
acid synthesis (Chen et al. 2000). Some of the proposed functions of retinoic acid are the
establishment of cell polarity (Sen et al. 2005) and to act as an antiapoptotic factor (Ahn et al.
2005). Therefore, CYP1B1 could play a role in retinal ganglion cell survival. If this scenario
is true, it is conceivable that carrying mutations in the heterozygous state could predispose an
individual to develop adult onset glaucoma.
The objective of my thesis was to identify new genes associated with POAG. For this reason,
it was decided to screen first the whole collective of patients for mutations in MYOC,
CYP1B1, OPTN and WDR36 in order to identify those patients carrying mutations in any of
these reported glaucoma-causing genes. I performed the initial screening of MYOC and
CYP1B1 in 46 patients, the initial collective that we have recruited at the time I started
working on this project. The extended screening of the whole collective of 399 patients was
performed with the help from technical assistants.
One patient carrying the common p.Q368X glaucoma-causing mutation in MYOC and four
more patients carrying a p.T243P variant were identified in the exploratory collective of 46
POAG patients. Future studies will be required in order to elucidate if this variation represents
only a SNP or a disease-causing mutation, as currently no functional test for myocilin is
available.
Three mutations (p.G61E, p.Y81N and p.E229K) were found in CYP1B1 in 4 out of 46
patients of the initial collective (8.7%). Further screening of the whole POAG collective (399
patients) led to the identification of 11 amino acid substitutions in CYP1B1 in 13 patients. All
these variants have been reported before both in PCG and POAG cases, and some of them
also in healthy subjects (Aklillu et al. 2002; Kumar et al. 2007). The CYP1B1 mutation rate in
our POAG patient cohort resulted significantly increased over expectancy (p=0.0018,
Fischer’s exact test), confirming association of rare CYP1B1 variants with POAG (Pasutto et
al. 2009). A functional characterization of these variants was also performed. Each mutation
was embedded in its corresponding SNP haplotype and a functional analysis of their
enzymatic activities was performed. As for every other enzyme, the action of CYP1B1 at the
79
cellular level depends on its abundance as well as its activity. The relative activity of the
common CYP1B1 variants was found between 35% and 45% of the maximum activity,
implying that relative activity values of 35% are still enough to prevent an individual from
developing glaucoma. The relative activity was drastically reduced to less than 11% of the
maximum in the p.G61E mutant, confirming its role as a bona fide mutation. The reduction in
relative activity for the amino acid changes p.E229K and p.Y81N was 26% and 17%,
respectively. These are intermediate relative activity values, lying between the bona fide
mutations (with less than 11% of the maximum relative activity) and the common variant with
the weakest activity (with 35% of the maximum). This intermediate reduction led to classify
p.Y81N not as bona fide mutation but as a hypomorphic allele (Chavarria-Soley et al. 2008;
Pasutto et al. 2009). A milder effect was found for p.E229K (26%). However, this variant was
identified in similar frequency in patients and controls (2 and 3%, respectively) suggesting it
should be reclassified as a polymorphism (Pasutto et al. 2009) in contrast to previous reports
(Chavarria-Soley et al. 2008). These results supports the hypothesis that CYP1B1 has a
broader significance for glaucoma pathogenesis than initially thought, ranging from a causal
effect in autosomal recessive PCG and other anterior segment dysgenesis disorders, to a risk
factor in POAG.
6.3. RPGRIP1 as a candidate gene for POAG
6.3.1. Selection of RPGRIP1
The genes identified so far are responsible for a very small fraction of glaucoma cases. For
most patients, mutations in other loci (not identified up to now) are probably the cause of the
disease. The search for these loci by linkage analysis is complicated by the fact that most
families are too small for the analysis to have enough power. In a previous study, a two-step
affected-sib-pair (ASP) analysis was performed, with 113 ASPs from 41 families (Wiggs et
al. 2000). As a result, seven loci with a multipoint LOD score greater than 1 and five loci with
a score greater than 2 were identified. The Barbados family study of Open Angle Glaucoma,
comprising 1327 individuals and 146 families, could not reveal linkage to the MYOC locus,
but gave some evidence for six chromosomal regions (Nemesure et al. 2003). Locus 14q11
was linked to POAG in both studies, so I decided to focus my work on finding candidate
genes within this region. For this purpose, the complete exonic regions of ten carefully
selected candidate genes mapping to 14q11 were sequenced in an exploratory collective of 46
POAG patients. All these genes were positional and functional candidates, as they are
expressed in the eye, share protein domains or interact with other glaucoma genes and/or
80
affect molecular pathways that could be relevant in the pathophysiology of the disease, e.g.
apoptosis. Ten coding variants were found in five of them (ZNF219, RPGRIP1, SALL2,
OXA1L, and ADCY4). Familiar segregation studies were performed if relatives were
available and a total of 46 healthy individuals of comparable age who had normal
ophthalmologic examinations served as controls for resequencing, leading to the exclusion of
three of the variants found as disease causing. The biochemical properties of the amino acidic
substitutions and the evolutionary conservation of the affected amino acid positions were also
studied. This led to the exclusion of five more variants. The remaining three missense variants
were located in RPGRIP1. For all these reasons, RPGRIP1 was selected for further
characterization as a good candidate gene for POAG.
6.3.2. Association of RPGRIP1 with POAG
At the very beginning of the project, our strategy was to identify glaucoma genes through
systematic analysis of the linkage disequilibrium (LD) and case-controls association studies.
When I started this work, only preliminary HapMap data was available, with no information
about the RPGRIP1 locus. To solve this inconvenience, 14 SNPs with MAF>0.15 found in
our first collective of 46 POAG patients were used to construct the LD structure of RPGRIP1,
covering a region spanning 34 kb. A clear block pattern, with two different blocks was
identified. This result correlates with the current LD structure of RPGRIP1 established by
HapMap. However, lack of a big collective of patients and controls necessary to perform a
case-control association study, together with increasing evidence that this was not an adequate
approach to deal with the complex aetiology of POAG (as discussed above), prompted me to
abandon this strategy. Instead of that, I aimed to identify glaucoma-causing genes through
systematic mutation screening of ten positional and functional candidate genes, concentrating
afterwards on RPGRIP1, the best candidate gene among this subset.
This systematic mutation screening in 399 patients led to the identification of 14 amino acid
substitutions in RPGRIP1, accounting for 6.5% of the patients population (26/399). Due to the
fact that glaucoma is a complex trait, the variants are expected to be more common in the
affected patients, but they are also expected to be found in control individuals. In fact, 8 of
these variants were detected in controls, representing 2.1% (8/376) of the control collective.
These results demonstrate strong association of our rare variants in RPGRIP1 with POAG (p-
value=0.003). As most of the patients carried a mutation located in or very near to the C2
domains of RPGRIP1 (16 patients against 3 control subjects, p-value=0.007), and to replicate
the observed association data, the complete coding region of these C2 domains was screened
in a further German cohort of 383 patients and 104 controls. Also in this second group,
81
different missense variants were detected, but at a lower frequency rate (2.3%). Pooling all
the data together, the RPGRIP1 variants found in the C2 domains still showed significant
association with POAG (p-value=0.013, 2-Tail Fischer’s exact test; OR=2.5, 95%
CI=1.2±5.3).
The differences in frequency of the RPGRIP1 C2 domains variants between the exploratory
(6.5%) and the replication (2.3%) patient cohorts might indicate differential genetic factors
contributing to the development of the pathology. This fact is not surprising, as POAG is
characterized by a high locus and allelic heterogeneity. One possible factor that might
contribute to these differences is the intraocular pressure (IOP): the second cohort was
composed mostly by patients with normal-tension glaucoma (NTG), in contrast with the
discovery group, in which patients carrying RPGRIP1 mutations presented mainly high IOP.
Glaucoma is frequently associated with harmfully high IOP. In fact, experimentally elevating
IOP can induce glaucomatous neuropathy. IOP is affected by aqueous humor (AqH)
production in the ciliary body and by its drainage through the trabecular and uveoscleral
drainage pathways. Different studies suggest that high IOP can contribute to the retinal
ganglion cell death through several mechanisms, such as altering the vascular perfusion or
causing direct injury to the cellular soma or to the optic nerve head. Environmental factors
may also contribute to this difference.
6.3.3. Expression of RPGRIP1 in retina
The RPGRIP1 gene is subjected to complex alternative splicing, encoding several different
isoforms in the retina of human, bovine, rodents and dog. These distinct RPGRIP1 isoforms
present differential expression in the inner retina (specifically among the amacrine cells and
different ganglion cell populations), the outer segment of rods and cones, the cytoskeleton of
photoreceptors and decorating microtubules, and may participate selectively in different
subcellular processes, providing a rationale for the distinct phenotypes caused by genetic
lesions in RPGRIP1 in human (Castagnet et al. 2003). Further characterization of the region
between exons 12 and 14, which undergoes significant alternative splicing, was performed by
Lu and Ferreira. They conclude that the production of several RPGRIP1 isoforms underlies
the presence of isoform ratios (Lu and Ferreira 2005), which may differ among and within
neuronal cell types and could have disease implications as reported elsewhere for other genes
and diseases (Hong et al. 1998). Their studies also demonstrated that some RPGRIP1
isoforms undergo limited proteolytic processing, yielding a small fragment that can
translocate to the nucleus, although the exact mechanism of this event is not yet clear (Lu and
Ferreira 2005). Altogether, their results further strengthen the model of the selective
82
participation of distinct RPGRIP1 isoforms in different subcellular processes and molecular
pathogenesis of RPGRIP1-allied diseases.
My RT-PCR experiments detected alternative splicing, as well as expression of RPGRIP1 in
retina, sclera and blood from a healthy donor. Together with the two isoforms previously
reported (Lu and Ferreira 2005), three novel isoforms were identified between exon 12 and
14, resulting in the in-frame insertion of several amino acids. Thus, our results reflect that the
number of isoforms reported for RPGRIP1 could be underestimated. In addition, it is likely
that mutations located anywhere in this genomic region (such as variations p.P585S and
p.Q589H found in our collective of POAG patients) could lead to aberrant transcripts and
play a role in the pathophysiology of the disease. However, my preliminary results could not
be replicated due to time constrains, as I concentrated on the functional validation of the
variants found in RPGRIP1, so the novel isoforms herein reported still need to be validated
and their possible function remains to be resolved.
6.3.4. Functional characterization of RPGRIP1 mutations
Autosomal recessive mutations in RPGRIP1 most commonly cause Leber congenital
amaurosis (LCA) in human, a severe systemic retinopathy (Dryja et al. 2001). However, the
biological role of the RPGRIP1 protein in retinal function and pathogenesis is not completely
clear. The finding of different RPGRIP1 interacting partners such as RPGR (Boylan and
Wright 2000; Roepman et al. 2000), NPHP4 (Roepman et al. 2005), and RanBP2 (Castagnet
et al. 2003) and its consistent involvement in a large spectrum of different retinal phenotypes
suggest that the function of RPGRIP1 in the retina is to serve as a scaffold for a large protein
complex acting in different signalling pathways of distinct retinal cell subpopulations
(Roepman et al. 2005). Most of these interacting partners associate to the RPGRIP1 region
containing the C2 domains, which are necessary for the relocation (and proteolytic cleavage)
of the N-terminal domain of RPGRIP1 to the cell nucleus (Lu et al. 2005).
NPHP4 is one of the currently known RPGRIP1 interacting partners. This protein localized in
the cytoplasm. Interestingly, coexpression of NPHP4 with RPGRIP1 results in the
colocalization of both proteins in the cytoplasm (Roepman et al. 2005). Mutations in NPHP4
are involved in nephronophthisis type 4 and Senior-Løken syndrome (SLSN), a combination
of nephronophthisis and progressive retinal degeneration (Schuermann et al. 2002). Most of
the mutations found in our patients (16/28) were located in or very near to the C2 domains of
RPGRIP1, the region where NPHP4 and RPGRIP1 are reported to interact. In collaboration
with Ronald Roepman, from the Radboud University of Nijmegen (The Netherlands), I
characterized the effect of our RPGRIP1 mutations in the interaction of both proteins through
83
yeast two-hybrid experiments and two cell-based assays: coimmunoprecipitation and
colocalization assays with fluorescence proteins.
RPGRIP1 alteration p.R598Q severely disrupts the interaction with NPHP4. Yeast
cotransfected with both constructs were able to grow on selective plates, and the enzymatic
activity of the β-galactosidase was even lower than that of the negative control. Negative
coimmunoprecipitation results also confirmed a complete disruption of the RPGRIP1-NPHP4
interaction. Moreover, in cells coexpressing both proteins, RPGRIP1 could still translocate to
the nucleus, which indicates that the protein did not interact with NPHP4, so the latter could
not retain the first to the cytoplasm. Altogether, these results suggest that this is a bona fide
mutation, with a serious effect on RPGRIP1 function, impairing its interaction with NPHP4.
The biological significance of this disrupted interaction in the pathology of POAG still needs
to be clarified with further functional assays. The effects of RPGRIP1 mutants p.A635G,
p.T806I, p.A837G, and p.I838V on RPGRIP1-NPHP4 interaction were less pronounced. An
impaired interaction between NPHP4 and these RPGRIP1 variants was revealed through
qualitative yeast two hybrids experiments. In addition, their β-galactosidase activities were
reduced to an intermediate value lying between the wild type protein and the negative control.
These mutant proteins were able to coimmunoprecipitate with NPHP4, but less than the wild
type RPGRIP1, and all these RPGRIP1 contructs colocalized with NPHP4 in the cytoplasm
when cotransfected to COS-1 cells. For all these reasons, I conclude that these are bona fide
mutations, although their effect on protein-protein interaction is not very pronounced. This is
not surprising, being POAG a complex disease; it is unquestionable that additional risk
factors, both genetic and environmental, are needed to develop the disorder. In addition,
POAG presents a late onset, meaning that the genetic defects can be compensated for many
years before manifesting, being therefore not suitable to detection with this kind of functional
assays. Moreover, RPGRIP1 presumably acts as a scaffold for recruitment of multiple
partners, and one or more of these partners might compensate for loss of activity of one of the
other complex members (Roepman et al. 2005). Being RPGRIP1 part of such a complex
interactoma, it is plausible that these mutations could also affect its interaction with other not
yet known binding partner(s) of the C2 domains, leading to the glaucomatous phenotype
through different molecular and biochemical pathways. The importance of the elucidation of
the molecular disease mechanisms associated with both RPGRIP1 dysfunction and POAG
(patho)physiology becomes therefore clear.
On the other hand, the results obtained for RPGRIP1 variants p.Q589H, p.A764V and
p.R812H in all the experiments were not significant different from those of the wild type
84
protein, indicating that these variants do not affect the RPGRIP1-NPHP4 interaction and may
be classified as non pathological polymorphisms. In fact, RPGRIP1 variant p.Q589H was
previously reported as a polymorphism (Dryja et al. 2001), as it was found in 1/57 LCA
patients and 1/92 control subjects, so our functional assays validate this earlier classification.
Interestingly also, when considering only the C2 domain mutations causing impaired
RPGRIP1-NPHP4 interaction, a total of 5 variants in 10 patients (2.8%) was identified in the
discovery group, and none in control subjects. This represents a significant increase over
expectancy (p-value = 0.001, two-tail Fischer’s exact test; OR= 7.0, 95% CI=2.2±23.1) and
therefore strong association of these RPGRIP1 mutations with POAG. These data support as
well my finding that RPGRIP1 might be a relevant genetic factor in the pathogenesis of
POAG.
6.3.5. Summary
a) Replicated association of RPGRIP1 mutations with POAG was found in a collective
of German patients.
b) Many splicing isoforms have been identified in several tissues. Further studies to
characterize the biological role of these alternative transcripts have to be performed.
c) Functional characterization of RPGRIP1 amino acid changes p.R598Q, p.A635G,
p.T806I, p.A837G, and p.I838V led to the classification of these variants as bona fide
mutations, as they disrupt the interaction with NPHP4. None of them were identified
in the control collective. A major effect was revealed for RPGRIP1 mutation
p.R598Q.
d) RPGRIP1 variants p.Q589H, p.A764V, and p.R812H did not affect the interaction
with NPHP4. In addition, two of them (p.Q589H and p.R812H) were also found in
controls. Therefore, they seem to be non pathological polymorphisms.
6.4. Final conclusions and future perspectives
In conclusion, this study demonstrates association of RPGRIP1 with POAG and gives
functional evidences for involvement of RPGRIP1 mutations in the pathogenesis of the
disease, as part of an intricate interactoma. Dissection of this macromolecular complex will
provide further clues to the molecular pathogenesis of the disease and may identify additional
candidate genes for glaucoma.
The results herein reported also support that POAG belongs to the same category of traits
under the common disease-rare variant theory such as epilepsy (Weber and Lerche 2008) and
85
macular degeneration (Swaroop et al. 2007), reaffirming the hypothesis that genetic
predisposition to this late onset disease is mainly cause by rare variants with large effect
located in numerous genes rather than by common SNPs. According to this hypothesis, the
expectation for POAG is that many alleles involved in the aetiology of the disease will tend to
have minor allele frequencies. This could have important consequences for designing future
studies aimed at discovering new glaucoma causing genes and should encourage synergistic
collaboration between several disciplines, including genetics, proteomics, system biology,
disease biology and bioinformatics in order to provide a deeper understanding of the
glaucoma pathogenesis and elucidate the molecular causes underlying the disease.
86
7. Bibliography Abecasis, G. R. and W. O. Cookson (2000). "GOLD--graphical overview of linkage
disequilibrium." Bioinformatics 16(2): 182-3. Abecia, E., B. Martinez-Jarreta, Y. Casalod, B. Bell, I. Pinilla and F. M. Honrubia (1996).
"Genetic markers in primary open-angle glaucoma." Int Ophthalmol 20(1-3): 79-82. Ahmad, I., T. Leinders-Zufall, J. D. Kocsis, G. M. Shepherd, F. Zufall and C. J. Barnstable
(1994). "Retinal ganglion cells express a cGMP-gated cation conductance activatable by nitric oxide donors." Neuron 12(1): 155-65.
Ahn, J. H., H. H. Kang, Y. J. Kim and J. W. Chung (2005). "Anti-apoptotic role of retinoic acid in the inner ear of noise-exposed mice." Biochem Biophys Res Commun 335(2): 485-90.
Aklillu, E., M. Oscarson, M. Hidestrand, B. Leidvik, C. Otter and M. Ingelman-Sundberg (2002). "Functional analysis of six different polymorphic CYP1B1 enzyme variants found in an Ethiopian population." Mol Pharmacol 61(3): 586-94.
Aldred, M. A., L. Baumber, A. Hill, E. C. Schwalbe, K. Goh, W. Karwatowski and R. C. Trembath (2004). "Low prevalence of MYOC mutations in UK primary open-angle glaucoma patients limits the utility of genetic testing." Hum Genet 115(5): 428-31.
Allingham, R. R., Y. Liu and D. J. Rhee (2009). "The genetics of primary open-angle glaucoma: a review." Exp Eye Res 88(4): 837-44.
Allingham, R. R., J. L. Wiggs, M. A. De La Paz, D. Vollrath, D. A. Tallett, B. Broomer, K. H. Jones, E. A. Del Bono, J. Kern, K. Patterson, J. L. Haines and M. A. Pericak-Vance (1998). "Gln368STOP myocilin mutation in families with late-onset primary open-angle glaucoma." Invest Ophthalmol Vis Sci 39(12): 2288-95.
Allingham, R. R., J. L. Wiggs, E. R. Hauser, K. R. Larocque-Abramson, C. Santiago-Turla, B. Broomer, E. A. Del Bono, F. L. Graham, J. L. Haines, M. A. Pericak-Vance and M. A. Hauser (2005). "Early adult-onset POAG linked to 15q11-13 using ordered subset analysis." Invest Ophthalmol Vis Sci 46(6): 2002-5.
Alward, W. L., A. T. Johnson, D. Y. Nishimura, V. C. Sheffield and E. M. Stone (1996). "Molecular genetics of glaucoma: current status." J Glaucoma 5(4): 276-84.
Alward, W. L., Y. H. Kwon, K. Kawase, J. E. Craig, S. S. Hayreh, A. T. Johnson, C. L. Khanna, T. Yamamoto, D. A. Mackey, B. R. Roos, L. M. Affatigato, V. C. Sheffield and E. M. Stone (2003). "Evaluation of optineurin sequence variations in 1,048 patients with open-angle glaucoma." Am J Ophthalmol 136(5): 904-10.
Alward, W. L., Y. H. Kwon, C. L. Khanna, A. T. Johnson, S. S. Hayreh, M. B. Zimmerman, J. Narkiewicz, J. L. Andorf, P. A. Moore, J. H. Fingert, V. C. Sheffield and E. M. Stone (2002). "Variations in the myocilin gene in patients with open-angle glaucoma." Arch Ophthalmol 120(9): 1189-97.
Ariani, F., I. Longo, P. Frezzotti, C. Pescucci, F. Mari, A. Caporossi, R. Frezzotti and A. Renieri (2006). "Optineurin gene is not involved in the common high-tension form of primary open-angle glaucoma." Graefes Arch Clin Exp Ophthalmol 244(9): 1077-82.
Arts, H. H., F. P. Cremers, N. V. Knoers and R. Roepman (2008). "Focus on Molecules: RPGRIP1." Exp Eye Res.
Aung, T., N. D. Ebenezer, G. Brice, A. H. Child, Q. Prescott, O. J. Lehmann, R. A. Hitchings and S. S. Bhattacharya (2003). "Prevalence of optineurin sequence variants in adult primary open angle glaucoma: implications for diagnostic testing." J Med Genet 40(8): e101.
Aung, T., L. Ocaka, N. D. Ebenezer, A. G. Morris, M. Krawczak, D. L. Thiselton, C. Alexander, M. Votruba, G. Brice, A. H. Child, P. J. Francis, R. A. Hitchings, O. J.
87
Lehmann and S. S. Bhattacharya (2002). "A major marker for normal tension glaucoma: association with polymorphisms in the OPA1 gene." Hum Genet 110(1): 52-6.
Ayala-Lugo, R. M., H. Pawar, D. M. Reed, P. R. Lichter, S. E. Moroi, M. Page, J. Eadie, V. Azocar, E. Maul, C. Ntim-Amponsah, W. Bromley, E. Obeng-Nyarkoh, A. T. Johnson, T. G. Kijek, C. A. Downs, J. M. Johnson, R. A. Perez-Grossmann, M. L. Guevara-Fujita, R. Fujita, M. R. Wallace and J. E. Richards (2007). "Variation in optineurin (OPTN) allele frequencies between and within populations." Mol Vis 13: 151-63.
Baird, P. N., S. J. Foote, D. A. Mackey, J. Craig, T. P. Speed and A. Bureau (2005). "Evidence for a novel glaucoma locus at chromosome 3p21-22." Hum Genet 117(2-3): 249-57.
Baird, P. N., A. J. Richardson, J. E. Craig, D. A. Mackey, E. Rochtchina and P. Mitchell (2004). "Analysis of optineurin (OPTN) gene mutations in subjects with and without glaucoma: the Blue Mountains Eye Study." Clin Experiment Ophthalmol 32(5): 518-22.
Barrett, J. C., B. Fry, J. Maller and M. J. Daly (2005). "Haploview: analysis and visualization of LD and haplotype maps." Bioinformatics 21(2): 263-5.
Baylor, D. A. (1987). "Photoreceptor signals and vision. Proctor lecture." Invest Ophthalmol Vis Sci 28(1): 34-49.
Bessant, D. A., A. M. Payne, K. P. Mitton, Q. L. Wang, P. K. Swain, C. Plant, A. C. Bird, D. J. Zack, A. Swaroop and S. S. Bhattacharya (1999). "A mutation in NRL is associated with autosomal dominant retinitis pigmentosa." Nat Genet 21(4): 355-6.
Blangero, J. (2004). "Localization and identification of human quantitative trait loci: king harvest has surely come." Curr Opin Genet Dev 14(3): 233-40.
Bodmer, W. and C. Bonilla (2008). "Common and rare variants in multifactorial susceptibility to common diseases." Nat Genet 40(6): 695-701.
Bonaldo, M. F., G. Lennon and M. B. Soares (1996). "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res 6(9): 791-806.
Bonomi, L., G. Marchini, M. Marraffa, P. Bernardi, R. Morbio and A. Varotto (2000). "Vascular risk factors for primary open angle glaucoma: the Egna-Neumarkt Study." Ophthalmology 107(7): 1287-93.
Borecki, I. B. and M. A. Province (2008). "Linkage and association: basic concepts." Adv Genet 60: 51-74.
Boylan, J. P. and A. F. Wright (2000). "Identification of a novel protein interacting with RPGR." Hum Mol Genet 9(14): 2085-93.
Brandt, J. D. (2008). "Finding risks for glaucoma." Arch Ophthalmol 126(8): 1138-9. Bruttini, M., I. Longo, P. Frezzotti, R. Ciappetta, A. Randazzo, N. Orzalesi, E. Fumagalli, A.
Caporossi, R. Frezzotti and A. Renieri (2003). "Mutations in the myocilin gene in families with primary open-angle glaucoma and juvenile open-angle glaucoma." Arch Ophthalmol 121(7): 1034-8.
Caballero, M., L. L. Rowlette and T. Borras (2000). "Altered secretion of a TIGR/MYOC mutant lacking the olfactomedin domain." Biochim Biophys Acta 1502(3): 447-60.
Cardon, L. R. and G. R. Abecasis (2003). "Using haplotype blocks to map human complex trait loci." Trends Genet 19(3): 135-40.
Cardon, L. R. and J. I. Bell (2001). "Association study designs for complex diseases." Nat Rev Genet 2(2): 91-9.
Castagnet, P., T. Mavlyutov, Y. Cai, F. Zhong and P. Ferreira (2003). "RPGRIP1s with distinct neuronal localization and biochemical properties associate selectively with RanBP2 in amacrine neurons." Hum Mol Genet 12(15): 1847-63.
88
Chao, D. T. and S. J. Korsmeyer (1998). "BCL-2 family: regulators of cell death." Annu Rev Immunol 16: 395-419.
Chavarria-Soley, G., H. Sticht, E. Aklillu, M. Ingelman-Sundberg, F. Pasutto, A. Reis and B. Rautenstrauss (2008). "Mutations in CYP1B1 cause primary congenital glaucoma by reduction of either activity or abundance of the enzyme." Hum Mutat 29(9): 1147-53.
Chen, H., W. N. Howald and M. R. Juchau (2000). "Biosynthesis of all-trans-retinoic acid from all-trans-retinol: catalysis of all-trans-retinol oxidation by human P-450 cytochromes." Drug Metab Dispos 28(3): 315-22.
Chen, P., J. Tian, I. Kovesdi and J. T. Bruder (1998). "Interaction of the adenovirus 14.7-kDa protein with FLICE inhibits Fas ligand-induced apoptosis." J Biol Chem 273(10): 5815-20.
Chen, S., Q. L. Wang, Z. Nie, H. Sun, G. Lennon, N. G. Copeland, D. J. Gilbert, N. A. Jenkins and D. J. Zack (1997). "Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes." Neuron 19(5): 1017-30.
Cheung, W., L. Guo and M. F. Cordeiro (2008). "Neuroprotection in glaucoma: drug-based approaches." Optom Vis Sci 85(6): 406-16.
Choudhary, D., I. Jansson, K. Rezaul, D. K. Han, M. Sarfarazi and J. B. Schenkman (2007). "Cyp1b1 protein in the mouse eye during development: an immunohistochemical study." Drug Metab Dispos 35(6): 987-94.
Coenen, M. J., J. A. Smeitink, R. Smeets, F. J. Trijbels and L. P. van den Heuvel (2005). "Mutation detection in four candidate genes (OXA1L, MRS2L, YME1L and MIPEP) for combined deficiencies in the oxidative phosphorylation system." J Inherit Metab Dis 28(6): 1091-7.
Coleman, A. L. (1999). "Glaucoma." Lancet 354(9192): 1803-10. Conde, L., J. M. Vaquerizas, C. Ferrer-Costa, X. de la Cruz, M. Orozco and J. Dopazo (2005).
"PupasView: a visual tool for selecting suitable SNPs, with putative pathological effect in genes, for genotyping purposes." Nucleic Acids Res 33(Web Server issue): W501-5.
Copin, B., A. P. Brezin, F. Valtot, J. C. Dascotte, A. Bechetoille and H. J. Garchon (2002). "Apolipoprotein E-promoter single-nucleotide polymorphisms affect the phenotype of primary open-angle glaucoma and demonstrate interaction with the myocilin gene." Am J Hum Genet 70(6): 1575-81.
Dawson, W. W., D. E. Brooks, G. M. Hope, D. A. Samuelson, M. B. Sherwood, H. M. Engel and M. J. Kessler (1993). "Primary open angle glaucomas in the rhesus monkey." Br J Ophthalmol 77(5): 302-10.
del Toro, D., J. Alberch, F. Lazaro-Dieguez, R. Martin-Ibanez, X. Xifro, G. Egea and J. M. Canals (2009). "Mutant huntingtin impairs post-Golgi trafficking to lysosomes by delocalizing optineurin/Rab8 complex from the Golgi apparatus." Mol Biol Cell 20(5): 1478-92.
den Dunnen, J. T. and S. E. Antonarakis (2001). "Nomenclature for the description of human sequence variations." Hum Genet 109(1): 121-4.
Detry-Morel, M., F. Muschart and S. Pourjavan (2008). "Micropulse diode laser (810 nm) versus argon laser trabeculoplasty in the treatment of open-angle glaucoma: comparative short-term safety and efficacy profile." Bull Soc Belge Ophtalmol(308): 21-8.
Dong, C. J., Y. Guo, P. Agey, L. Wheeler and W. A. Hare (2008). "Alpha2 adrenergic modulation of NMDA receptor function as a major mechanism of RGC protection in experimental glaucoma and retinal excitotoxicity." Invest Ophthalmol Vis Sci 49(10): 4515-22.
89
Dreyer, E. B., D. Zurakowski, R. A. Schumer, S. M. Podos and S. A. Lipton (1996). "Elevated glutamate levels in the vitreous body of humans and monkeys with glaucoma." Arch Ophthalmol 114(3): 299-305.
Dryja, T. P., S. M. Adams, J. L. Grimsby, T. L. McGee, D. H. Hong, T. Li, S. Andreasson and E. L. Berson (2001). "Null RPGRIP1 alleles in patients with Leber congenital amaurosis." Am J Hum Genet 68(5): 1295-8.
Ellis, J. D., J. M. Evans, D. A. Ruta, P. S. Baines, G. Leese, T. M. MacDonald and A. D. Morris (2000). "Glaucoma incidence in an unselected cohort of diabetic patients: is diabetes mellitus a risk factor for glaucoma? DARTS/MEMO collaboration. Diabetes Audit and Research in Tayside Study. Medicines Monitoring Unit." Br J Ophthalmol 84(11): 1218-24.
Engelke, D. R., A. Krikos, M. E. Bruck and D. Ginsburg (1990). "Purification of Thermus aquaticus DNA polymerase expressed in Escherichia coli." Anal Biochem 191(2): 396-400.
Fan, B. J., W. C. Ko, D. Y. Wang, O. Canlas, R. Ritch, D. S. Lam and C. P. Pang (2007). "Fine mapping of new glaucoma locus GLC1M and exclusion of neuregulin 2 as the causative gene." Mol Vis 13: 779-84.
Fan, B. J., Y. F. Leung, N. Wang, S. C. Lam, Y. Liu, O. S. Tam and C. P. Pang (2004). "Genetic and environmental risk factors for primary open-angle glaucoma." Chin Med J (Engl) 117(5): 706-10.
Farjo, Q., A. Jackson, S. Pieke-Dahl, K. Scott, W. J. Kimberling, P. A. Sieving, J. E. Richards and A. Swaroop (1997). "Human bZIP transcription factor gene NRL: structure, genomic sequence, and fine linkage mapping at 14q11.2 and negative mutation analysis in patients with retinal degeneration." Genomics 45(2): 395-401.
Faucher, M., J. L. Anctil, M. A. Rodrigue, A. Duchesne, D. Bergeron, P. Blondeau, G. Cote, S. Dubois, J. Bergeron, R. Arseneault, J. Morissette and V. Raymond (2002). "Founder TIGR/myocilin mutations for glaucoma in the Quebec population." Hum Mol Genet 11(18): 2077-90.
Ferreira, P. A. (2005). "Insights into X-linked retinitis pigmentosa type 3, allied diseases and underlying pathomechanisms." Hum Mol Genet 14 Spec No. 2: R259-67.
Fields, S. and O. Song (1989). "A novel genetic system to detect protein-protein interactions." Nature 340(6230): 245-6.
Fingert, J. H., W. L. Alward, Y. H. Kwon, S. P. Shankar, J. L. Andorf, D. A. Mackey, V. C. Sheffield and E. M. Stone (2007). "No association between variations in the WDR36 gene and primary open-angle glaucoma." Arch Ophthalmol 125(3): 434-6.
Fingert, J. H., E. Heon, J. M. Liebmann, T. Yamamoto, J. E. Craig, J. Rait, K. Kawase, S. T. Hoh, Y. M. Buys, J. Dickinson, R. R. Hockey, D. Williams-Lyn, G. Trope, Y. Kitazawa, R. Ritch, D. A. Mackey, W. L. Alward, V. C. Sheffield and E. M. Stone (1999). "Analysis of myocilin mutations in 1703 glaucoma patients from five different populations." Hum Mol Genet 8(5): 899-905.
Fingert, J. H., E. M. Stone, V. C. Sheffield and W. L. Alward (2002). "Myocilin glaucoma." Surv Ophthalmol 47(6): 547-61.
Foster, P. J., R. Buhrmann, H. A. Quigley and G. J. Johnson (2002). "The definition and classification of glaucoma in prevalence surveys." Br J Ophthalmol 86(2): 238-42.
Foster, P. J. and G. J. Johnson (2001). "Glaucoma in China: how big is the problem?" Br J Ophthalmol 85(11): 1277-82.
Fronimopoulos, J. and J. Lascaratos (1991). "The terms glaucoma and cataract in the ancient Greek and Byzantine writers." Doc Ophthalmol 77(4): 369-75.
Fu, X. Y., D. S. Kessler, S. A. Veals, D. E. Levy and J. E. Darnell, Jr. (1990). "ISGF3, the transcriptional activator induced by interferon alpha, consists of multiple interacting polypeptide chains." Proc Natl Acad Sci U S A 87(21): 8555-9.
90
Fu, X. Y., C. Schindler, T. Improta, R. Aebersold and J. E. Darnell, Jr. (1992). "The proteins of ISGF-3, the interferon alpha-induced transcriptional activator, define a gene family involved in signal transduction." Proc Natl Acad Sci U S A 89(16): 7840-3.
Fujiwara, N., T. Matsuo and H. Ohtsuki (2003). "Protein expression, genomic structure, and polymorphisms of oculomedin." Ophthalmic Genet 24(3): 141-51.
Gelatt, K. N. and E. O. MacKay (1998). "Distribution of intraocular pressure in dogs." Vet Ophthalmol 1(2-3): 109-114.
Gelatt, K. N., R. L. Peiffer, Jr., R. M. Gwin, G. G. Gum and L. W. Williams (1977). "Clinical manifestations of inherited glaucoma in the beagle." Invest Ophthalmol Vis Sci 16(12): 1135-42.
Gibson, L., S. P. Holmgreen, D. C. Huang, O. Bernard, N. G. Copeland, N. A. Jenkins, G. R. Sutherland, E. Baker, J. M. Adams and S. Cory (1996). "bcl-w, a novel member of the bcl-2 family, promotes cell survival." Oncogene 13(4): 665-75.
Gobeil, S., M. A. Rodrigue, S. Moisan, T. D. Nguyen, J. R. Polansky, J. Morissette and V. Raymond (2004). "Intracellular sequestration of hetero-oligomers formed by wild-type and glaucoma-causing myocilin mutants." Invest Ophthalmol Vis Sci 45(10): 3560-7.
Gottfredsdottir, M. S., T. Sverrisson, D. C. Musch and E. Stefansson (1999). "Chronic open-angle glaucoma and associated ophthalmic findings in monozygotic twins and their spouses in Iceland." J Glaucoma 8(2): 134-9.
Green, K. (1995). "Free radicals and aging of anterior segment tissues of the eye: a hypothesis." Ophthalmic Res 27 Suppl 1: 143-9.
Gupta, D., Ed. (2004). Glaucoma: Diagnosis and Management, Lippincott Williams & Wilkins.
Hamosh, A., A. F. Scott, J. S. Amberger, C. A. Bocchini and V. A. McKusick (2005). "Online Mendelian Inheritance in Man (OMIM), a knowledgebase of human genes and genetic disorders." Nucleic Acids Res 33(Database issue): D514-7.
Hashizume, K., Y. Mashima, T. Fumayama, Y. Ohtake, I. Kimura, K. Yoshida, K. Ishikawa, N. Yasuda, T. Fujimaki, R. Asaoka, T. Koga, T. Kanamoto, T. Fukuchi and K. Miyaki (2005). "Genetic polymorphisms in the angiotensin II receptor gene and their association with open-angle glaucoma in a Japanese population." Invest Ophthalmol Vis Sci 46(6): 1993-2001.
Hauser, M. A., R. R. Allingham, K. Linkroum, J. Wang, K. LaRocque-Abramson, D. Figueiredo, C. Santiago-Turla, E. A. del Bono, J. L. Haines, M. A. Pericak-Vance and J. L. Wiggs (2006). "Distribution of WDR36 DNA sequence variants in patients with primary open-angle glaucoma." Invest Ophthalmol Vis Sci 47(6): 2542-6.
Hillier, L. D., G. Lennon, M. Becker, M. F. Bonaldo, B. Chiapelli, S. Chissoe, N. Dietrich, T. DuBuque, A. Favello, W. Gish, M. Hawkins, M. Hultman, T. Kucaba, M. Lacy, M. Le, N. Le, E. Mardis, B. Moore, M. Morris, J. Parsons, C. Prange, L. Rifkin, T. Rohlfing, K. Schellenberg, M. Bento Soares, F. Tan, J. Thierry-Meg, E. Trevaskis, K. Underwood, P. Wohldman, R. Waterston, R. Wilson and M. Marra (1996). "Generation and analysis of 280,000 human expressed sequence tags." Genome Res 6(9): 807-28.
Hogg, P., M. Calthorpe, M. Batterbury and I. Grierson (2000). "Aqueous humor stimulates the migration of human trabecular meshwork cells in vitro." Invest Ophthalmol Vis Sci 41(5): 1091-8.
Holmbeck, K., P. Bianco, J. Caterina, S. Yamada, M. Kromer, S. A. Kuznetsov, M. Mankani, P. G. Robey, A. R. Poole, I. Pidoux, J. M. Ward and H. Birkedal-Hansen (1999). "MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover." Cell 99(1): 81-92.
Hong, M., V. Zhukareva, V. Vogelsberg-Ragaglia, Z. Wszolek, L. Reed, B. I. Miller, D. H. Geschwind, T. D. Bird, D. McKeel, A. Goate, J. C. Morris, K. C. Wilhelmsen, G. D.
91
Schellenberg, J. Q. Trojanowski and V. M. Lee (1998). "Mutation-specific functional impairments in distinct tau isoforms of hereditary FTDP-17." Science 282(5395): 1914-7.
Ishikawa, K., T. Funayama, Y. Ohtake, I. Kimura, H. Ideta, K. Nakamoto, N. Yasuda, T. Fukuchi, T. Fujimaki, A. Murakami, R. Asaoka, Y. Hotta, T. Kanamoto, H. Tanihara, K. Miyaki and Y. Mashima (2005). "Association between glaucoma and gene polymorphism of endothelin type A receptor." Mol Vis 11: 431-7.
Izzotti, A., S. C. Sacca, M. Longobardi and C. Cartiglia (2009). "Sensitivity of ocular anterior-chamber tissues to oxidative damage and its relevance to glaucoma pathogenesis." Invest Ophthalmol Vis Sci.
Jacobson, N., M. Andrews, A. R. Shepard, D. Nishimura, C. Searby, J. H. Fingert, G. Hageman, R. Mullins, B. L. Davidson, Y. H. Kwon, W. L. Alward, E. M. Stone, A. F. Clark and V. C. Sheffield (2001). "Non-secretion of mutant proteins of the glaucoma gene myocilin in cultured trabecular meshwork cells and in aqueous humor." Hum Mol Genet 10(2): 117-25.
James, P., J. Halladay and E. A. Craig (1996). "Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast." Genetics 144(4): 1425-36.
Joe, M. K., S. Sohn, Y. R. Choi, H. Park and C. Kee (2005). "Identification of flotillin-1 as a protein interacting with myocilin: implications for the pathogenesis of primary open-angle glaucoma." Biochem Biophys Res Commun 336(4): 1201-6.
Joe, M. K., S. Sohn, W. Hur, Y. Moon, Y. R. Choi and C. Kee (2003). "Accumulation of mutant myocilins in ER leads to ER stress and potential cytotoxicity in human trabecular meshwork cells." Biochem Biophys Res Commun 312(3): 592-600.
John, S. W., R. S. Smith, O. V. Savinova, N. L. Hawes, B. Chang, D. Turnbull, M. Davisson, T. H. Roderick and J. R. Heckenlively (1998). "Essential iris atrophy, pigment dispersion, and glaucoma in DBA/2J mice." Invest Ophthalmol Vis Sci 39(6): 951-62.
Johnson, A. T., W. L. Alward, V. C. Sheffield and E. M. Stone (1996). Genetics and Glaucoma. St Louis, Mosby Year Book, Inc.
Johnson, D. H. (2000). "Myocilin and glaucoma: A TIGR by the tail?" Arch Ophthalmol 118(7): 974-8.
Junemann, A. G., N. von Ahsen, U. Reulbach, J. Roedl, D. Bonsch, J. Kornhuber, F. E. Kruse and S. Bleich (2005). "C677T variant in the methylentetrahydrofolate reductase gene is a genetic risk factor for primary open-angle glaucoma." Am J Ophthalmol 139(4): 721-3.
Juronen, E., G. Tasa, S. Veromann, L. Parts, A. Tiidla, R. Pulges, A. Panov, L. Soovere, K. Koka and A. V. Mikelsaar (2000). "Polymorphic glutathione S-transferase M1 is a risk factor of primary open-angle glaucoma among Estonians." Exp Eye Res 71(5): 447-52.
Kahn, H. A., H. M. Leibowitz, J. P. Ganley, M. M. Kini, T. Colton, R. S. Nickerson and T. R. Dawber (1977). "The Framingham Eye Study. I. Outline and major prevalence findings." Am J Epidemiol 106(1): 17-32.
Kanagavalli, J., S. R. Krishnadas, E. Pandaranayaka, S. Krishnaswamy and P. Sundaresan (2003). "Evaluation and understanding of myocilin mutations in Indian primary open angle glaucoma patients." Mol Vis 9: 606-14.
Karali, A., P. Russell, F. H. Stefani and E. R. Tamm (2000). "Localization of myocilin/trabecular meshwork--inducible glucocorticoid response protein in the human eye." Invest Ophthalmol Vis Sci 41(3): 729-40.
Ke, X. and L. R. Cardon (2003). "Efficient selective screening of haplotype tag SNPs." Bioinformatics 19(2): 287-8.
Kim, B. S., O. V. Savinova, M. V. Reedy, J. Martin, Y. Lun, L. Gan, R. S. Smith, S. I. Tomarev, S. W. John and R. L. Johnson (2001). "Targeted Disruption of the Myocilin
92
Gene (Myoc) Suggests that Human Glaucoma-Causing Mutations Are Gain of Function." Mol Cell Biol 21(22): 7707-13.
Klein, B. E., R. Klein, W. E. Sponsel, T. Franke, L. B. Cantor, J. Martone and M. J. Menage (1992). "Prevalence of glaucoma. The Beaver Dam Eye Study." Ophthalmology 99(10): 1499-504.
Kogan, N. M. and R. Mechoulam (2007). "Cannabinoids in health and disease." Dialogues Clin Neurosci 9(4): 413-30.
Kohlhase, J., R. Schuh, G. Dowe, R. P. Kuhnlein, H. Jackle, B. Schroeder, W. Schulz-Schaeffer, H. A. Kretzschmar, A. Kohler, U. Muller, M. Raab-Vetter, E. Burkhardt, W. Engel and R. Stick (1996). "Isolation, characterization, and organ-specific expression of two novel human zinc finger genes related to the Drosophila gene spalt." Genomics 38(3): 291-8.
Kolker, A. E., R. A. Moses, M. A. Constant and B. Becker (1963). "The Development of Glaucoma in Rabbits." Invest Ophthalmol 2: 316-21.
Kramer, P. L., J. R. Samples, S. Monemi, R. Sykes, M. Sarfarazi and M. K. Wirtz (2006). "The role of the WDR36 gene on chromosome 5q22.1 in a large family with primary open-angle glaucoma mapped to this region." Arch Ophthalmol 124(9): 1328-31.
Kumar, A., M. G. Basavaraj, S. K. Gupta, I. Qamar, A. M. Ali, V. Bajaj, T. K. Ramesh, D. R. Prakash, J. S. Shetty and S. K. Dorairaj (2007). "Role of CYP1B1, MYOC, OPTN, and OPTC genes in adult-onset primary open-angle glaucoma: predominance of CYP1B1 mutations in Indian patients." Mol Vis 13: 667-76.
Kumar, R., S. Chen, D. Scheurer, Q. L. Wang, E. Duh, C. H. Sung, A. Rehemtulla, A. Swaroop, R. Adler and D. J. Zack (1996). "The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures." J Biol Chem 271(47): 29612-8.
Kusaka, S., I. Dabin, C. J. Barnstable and D. G. Puro (1996). "cGMP-mediated effects on the physiology of bovine and human retinal Muller (glial) cells." J Physiol 497 ( Pt 3): 813-24.
Lai, J. S., D. T. Liu, C. C. Tham, R. T. Li and D. S. Lam (2001). "Epidemiology of acute primary angle-closure glaucoma in the Hong Kong Chinese population: prospective study." Hong Kong Med J 7(2): 118-23.
Laird, N. M. and C. Lange (2006). "Family-based designs in the age of large-scale gene-association studies." Nat Rev Genet 7(5): 385-94.
Lam, D. S., Y. F. Leung, J. K. Chua, L. Baum, D. S. Fan, K. W. Choy and C. P. Pang (2000). "Truncations in the TIGR gene in individuals with and without primary open-angle glaucoma." Invest Ophthalmol Vis Sci 41(6): 1386-91.
Lander, E. S. (1996). "The new genomics: global views of biology." Science 274(5287): 536-9.
Lander, E. S. and N. J. Schork (1994). "Genetic dissection of complex traits." Science 265(5181): 2037-48.
Leske, M. C., A. M. Connell, A. P. Schachat and L. Hyman (1994). "The Barbados Eye Study. Prevalence of open angle glaucoma." Arch Ophthalmol 112(6): 821-9.
Leung, Y. F., B. J. Fan, D. S. Lam, W. S. Lee, P. O. Tam, J. K. Chua, C. C. Tham, J. S. Lai, D. S. Fan and C. P. Pang (2003). "Different optineurin mutation pattern in primary open-angle glaucoma." Invest Ophthalmol Vis Sci 44(9): 3880-4.
Levin, L. A. and P. Peeples (2008). "History of neuroprotection and rationale as a therapy for glaucoma." Am J Manag Care 14(1 Suppl): S11-4.
Levy, D., A. L. DeStefano, M. G. Larson, C. J. O'Donnell, R. P. Lifton, H. Gavras, L. A. Cupples and R. H. Myers (2000). "Evidence for a gene influencing blood pressure on chromosome 17. Genome scan linkage results for longitudinal blood pressure
93
phenotypes in subjects from the framingham heart study." Hypertension 36(4): 477-83.
Li, D., K. Dower, Y. Ma, Y. Tian and T. L. Benjamin (2001). "A tumor host range selection procedure identifies p150(sal2) as a target of polyoma virus large T antigen." Proc Natl Acad Sci U S A 98(25): 14619-24.
Li, D., Y. Tian, Y. Ma and T. Benjamin (2004). "p150(Sal2) is a p53-independent regulator of p21(WAF1/CIP)." Mol Cell Biol 24(9): 3885-93.
Libby, R. T., D. B. Gould, M. G. Anderson and S. W. John (2005). "Complex genetics of glaucoma susceptibility." Annu Rev Genomics Hum Genet 6: 15-44.
Lin, H. J., W. C. Chen, F. J. Tsai and S. W. Tsai (2002). "Distributions of p53 codon 72 polymorphism in primary open angle glaucoma." Br J Ophthalmol 86(7): 767-70.
Lin, H. J., C. H. Tsai, F. J. Tsai, W. C. Chen, H. Y. Chen and S. S. Fan (2004). "Transporter associated with antigen processing gene 1 codon 333 and codon 637 polymorphisms are associated with primary open-angle glaucoma." Mol Diagn 8(4): 245-52.
Lin, H. J., F. J. Tsai, W. C. Chen, Y. R. Shi, Y. Hsu and S. W. Tsai (2003). "Association of tumour necrosis factor alpha -308 gene polymorphism with primary open-angle glaucoma in Chinese." Eye 17(1): 31-4.
Lin, H. J., F. J. Tsai, P. Hung, W. C. Chen, H. Y. Chen, S. S. Fan and S. W. Tsai (2006). "Association of E-cadherin gene 3'-UTR C/T polymorphism with primary open angle glaucoma." Ophthalmic Res 38(1): 44-8.
Lin, H. J., S. C. Tsai, F. J. Tsai, W. C. Chen, J. J. Tsai and C. D. Hsu (2003). "Association of interleukin 1beta and receptor antagonist gene polymorphisms with primary open-angle glaucoma." Ophthalmologica 217(5): 358-64.
Liu, Q., X. Ji, M. L. Breitman, P. F. Hitchcock and A. Swaroop (1996). "Expression of the bZIP transcription factor gene Nrl in the developing nervous system." Oncogene 12(1): 207-11.
Lu, X. and P. A. Ferreira (2005). "Identification of novel murine- and human-specific RPGRIP1 splice variants with distinct expression profiles and subcellular localization." Invest Ophthalmol Vis Sci 46(6): 1882-90.
Lu, X., M. Guruju, J. Oswald and P. A. Ferreira (2005). "Limited proteolysis differentially modulates the stability and subcellular localization of domains of RPGRIP1 that are distinctly affected by mutations in Leber's congenital amaurosis." Hum Mol Genet 14(10): 1327-40.
Ludwig, M. G. and K. Seuwen (2002). "Characterization of the human adenylyl cyclase gene family: cDNA, gene structure, and tissue distribution of the nine isoforms." J Recept Signal Transduct Res 22(1-4): 79-110.
Marmor, M. F. and A. Negi (1986). "Pharmacologic modification of subretinal fluid absorption in the rabbit eye." Arch Ophthalmol 104(11): 1674-7.
Mason, R. P., O. Kosoko, M. R. Wilson, J. F. Martone, C. L. Cowan, Jr., J. C. Gear and D. Ross-Degnan (1989). "National survey of the prevalence and risk factors of glaucoma in St. Lucia, West Indies. Part I. Prevalence findings." Ophthalmology 96(9): 1363-8.
Mataftsi, A., F. Achache, E. Heon, A. Mermoud, P. Cousin, G. Metthez, D. F. Schorderet and F. L. Munier (2001). "MYOC mutation frequency in primary open-angle glaucoma patients from Western Switzerland." Ophthalmic Genet 22(4): 225-31.
Mavlyutov, T. A., H. Zhao and P. A. Ferreira (2002). "Species-specific subcellular localization of RPGR and RPGRIP isoforms: implications for the phenotypic variability of congenital retinopathies among species." Hum Mol Genet 11(16): 1899-907.
Melki, R., A. Belmouden, O. Akhayat, A. Brezin and H. J. Garchon (2003). "The M98K variant of the OPTINEURIN (OPTN) gene modifies initial intraocular pressure in patients with primary open angle glaucoma." J Med Genet 40(11): 842-4.
94
Melki, R., A. Belmouden, A. Brezin and H. J. Garchon (2003). "Myocilin analysis by DHPLC in French POAG patients: increased prevalence of Q368X mutation." Hum Mutat 22(2): 179.
Michels-Rautenstrauss, K., C. Mardin, N. Wakili, A. M. Junemann, L. Villalobos, C. Mejia, G. C. Soley, J. Azofeifa, S. Ozbey, G. O. Naumann, A. Reis and B. Rautenstrauss (2002). "Novel mutations in the MYOC/GLC1A gene in a large group of glaucoma patients." Hum Mutat 20(6): 479-80.
Mitchell, P., F. Hourihan, J. Sandbach and J. J. Wang (1999). "The relationship between glaucoma and myopia: the Blue Mountains Eye Study." Ophthalmology 106(10): 2010-5.
Mitchell, P., W. Smith, K. Attebo and P. R. Healey (1996). "Prevalence of open-angle glaucoma in Australia. The Blue Mountains Eye Study." Ophthalmology 103(10): 1661-9.
Mitton, K. P., P. K. Swain, S. Chen, S. Xu, D. J. Zack and A. Swaroop (2000). "The leucine zipper of NRL interacts with the CRX homeodomain. A possible mechanism of transcriptional synergy in rhodopsin regulation." J Biol Chem 275(38): 29794-9.
Miyazawa, A., N. Fuse, M. Mengkegale, M. Ryu, M. Seimiya, Y. Wada and K. Nishida (2007). "Association between primary open-angle glaucoma and WDR36 DNA sequence variants in Japanese." Mol Vis 13: 1912-9.
Molina-Gomes, D., N. Bonnefoy, V. C. Nguyen, E. Viegas-Pequignot, A. Rotig and G. Dujardin (1995). "The OXA1L gene that controls cytochrome oxidase assembly maps to the 14q11.2 region of the human genome." Genomics 30(2): 396-8.
Monemi, S., G. Spaeth, A. DaSilva, S. Popinchalk, E. Ilitchev, J. Liebmann, R. Ritch, E. Heon, R. P. Crick, A. Child and M. Sarfarazi (2005). "Identification of a novel adult-onset primary open-angle glaucoma (POAG) gene on 5q22.1." Hum Mol Genet 14(6): 725-33.
Monemi, S., G. Spaeth, A. Dasilva, S. Popinchalk, E. Ilitchev, J. Liebmann, R. Ritch, E. Heon, R. P. Crick, A. Child and M. Sarfarazi (2005). "Identification of a Novel Adult-Onset Primary Open Angle Glaucoma (POAG) Gene on 5q22.1." Hum Mol Genet.
Mukhopadhyay, A., S. Komatireddy, M. Acharya, A. Bhattacharjee, A. K. Mandal, S. K. Thakur, G. Chandrasekhar, A. Banerjee, R. Thomas, S. Chakrabarti and K. Ray (2005). "Evaluation of Optineurin as a candidate gene in Indian patients with primary open angle glaucoma." Mol Vis 11: 792-7.
Nagase, H. and J. F. Woessner, Jr. (1999). "Matrix metalloproteinases." J Biol Chem 274(31): 21491-4.
Nakashima, T., T. Sekiguchi, A. Kuraoka, K. Fukushima, Y. Shibata, S. Komiyama and T. Nishimoto (1993). "Molecular cloning of a human cDNA encoding a novel protein, DAD1, whose defect causes apoptotic cell death in hamster BHK21 cells." Mol Cell Biol 13(10): 6367-74.
Nawy, S. and C. E. Jahr (1991). "cGMP-gated conductance in retinal bipolar cells is suppressed by the photoreceptor transmitter." Neuron 7(4): 677-83.
Nemesure, B., Q. He, N. Mendell, S. Y. Wu, J. F. Hejtmancik, A. Hennis and M. C. Leske (2001). "Inheritance of open-angle glaucoma in the Barbados family study." Am J Med Genet 103(1): 36-43.
Nemesure, B., X. Jiao, Q. He, M. C. Leske, S. Y. Wu, A. Hennis, N. Mendell, J. Redman, H. J. Garchon, R. Agarwala, A. A. Schaffer and F. Hejtmancik (2003). "A genome-wide scan for primary open-angle glaucoma (POAG): the Barbados Family Study of Open-Angle Glaucoma." Hum Genet 112(5-6): 600-9.
Newell, F. (1986). Ophthalmology: principles and concepts. St Louis, C.V., Mosby Company. Nishiguchi, K. M., J. S. Friedman, M. A. Sandberg, A. Swaroop, E. L. Berson and T. P. Dryja
(2004). "Recessive NRL mutations in patients with clumped pigmentary retinal
95
degeneration and relative preservation of blue cone function." Proc Natl Acad Sci U S A 101(51): 17819-24.
O'Reilly, L. A., C. Print, G. Hausmann, K. Moriishi, S. Cory, D. C. Huang and A. Strasser (2001). "Tissue expression and subcellular localization of the pro-survival molecule Bcl-w." Cell Death Differ 8(5): 486-94.
Oti, M., M. A. Huynen and H. G. Brunner (2008). "Phenome connections." Trends Genet 24(3): 103-6.
Pang, C. P., Y. F. Leung, J. K. Chua, L. Baum, D. S. Fan and D. S. Lam (2000). "Novel TIGR sequence alteration Val53Ala." Hum Mutat 15(1): 122.
Pasutto, F., G. Chavarria-Soley, C. Y. Mardin, K. Michels-Rautenstrauss, M. Ingelman-Sundberg, L. Fernandez-Martinez, B. H. Weber, B. Rautenstrauss and A. Reis (2009). "Heterozygous loss of function variants in CYP1B1 predispose to primary open angle glaucoma." Invest Ophthalmol Vis Sci.
Pasutto, F., C. Y. Mardin, K. Michels-Rautenstrauss, B. H. Weber, H. Sticht, G. Chavarria-Soley, B. Rautenstrauss, F. Kruse and A. Reis (2008). "Profiling of WDR36 missense variants in German patients with glaucoma." Invest Ophthalmol Vis Sci 49(1): 270-4.
Pennisi, E. (2003). "Human genome. A low number wins the GeneSweep Pool." Science 300(5625): 1484.
Pericak-Vance, M. A., M. L. Bass, L. H. Yamaoka, P. C. Gaskell, W. K. Scott, H. A. Terwedow, M. M. Menold, P. M. Conneally, G. W. Small, A. M. Saunders, A. D. Roses and J. L. Haines (1998). "Complete genomic screen in late-onset familial Alzheimer's disease." Neurobiol Aging 19(1 Suppl): S39-42.
Quaranta, L., S. Bettelli, M. G. Uva, F. Semeraro, R. Turano and E. Gandolfo (2003). "Effect of Ginkgo biloba extract on preexisting visual field damage in normal tension glaucoma." Ophthalmology 110(2): 359-62; discussion 362-4.
Quigley, H. A. and A. T. Broman (2006). "The number of people with glaucoma worldwide in 2010 and 2020." Br J Ophthalmol 90(3): 262-7.
Racette, L., M. R. Wilson, L. M. Zangwill, R. N. Weinreb and P. A. Sample (2003). "Primary open-angle glaucoma in blacks: a review." Surv Ophthalmol 48(3): 295-313.
Resnikoff, S., D. Pascolini, D. Etya'ale, I. Kocur, R. Pararajasegaram, G. P. Pokharel and S. P. Mariotti (2004). "Global data on visual impairment in the year 2002." Bull World Health Organ 82(11): 844-51.
Rezaie, T., A. Child, R. Hitchings, G. Brice, L. Miller, M. Coca-Prados, E. Heon, T. Krupin, R. Ritch, D. Kreutzer, R. P. Crick and M. Sarfarazi (2002). "Adult-onset primary open-angle glaucoma caused by mutations in optineurin." Science 295(5557): 1077-9.
Risch, N. J. (2000). "Searching for genetic determinants in the new millennium." Nature 405(6788): 847-56.
Roepman, R., N. Bernoud-Hubac, D. E. Schick, A. Maugeri, W. Berger, H. H. Ropers, F. P. Cremers and P. A. Ferreira (2000). "The retinitis pigmentosa GTPase regulator (RPGR) interacts with novel transport-like proteins in the outer segments of rod photoreceptors." Hum Mol Genet 9(14): 2095-105.
Roepman, R., S. J. Letteboer, H. H. Arts, S. E. van Beersum, X. Lu, E. Krieger, P. A. Ferreira and F. P. Cremers (2005). "Interaction of nephrocystin-4 and RPGRIP1 is disrupted by nephronophthisis or Leber congenital amaurosis-associated mutations." Proc Natl Acad Sci U S A 102(51): 18520-5.
Rose, R., M. Karthikeyan, B. Anandan and G. Jayaraman (2007). "Myocilin mutations among primary open angle glaucoma patients of Kanyakumari district, South India." Mol Vis 13: 497-503.
Rotig, A., B. Parfait, L. Heidet, G. Dujardin, P. Rustin and A. Munnich (1997). "Sequence and structure of the human OXA1L gene and its upstream elements." Biochim Biophys Acta 1361(1): 6-10.
96
Ruiz-Ederra, J., M. Garcia, M. Hernandez, H. Urcola, E. Hernandez-Barbachano, J. Araiz and E. Vecino (2005). "The pig eye as a novel model of glaucoma." Exp Eye Res 81(5): 561-9.
Sakai, T., K. Hino, S. Wada and H. Maeda (2003). "Identification of the DNA binding specificity of the human ZNF219 protein and its function as a transcriptional repressor." DNA Res 10(4): 155-65.
Sakai, T., A. Toyoda, K. Hashimoto and H. Maeda (2000). "Isolation and characterization of a novel zinc finger gene, ZNF219, and mapping to the human chromosome 14q11 region." DNA Res 7(2): 137-41.
Sarfarazi, M., A. Child, D. Stoilova, G. Brice, T. Desai, O. C. Trifan, D. Poinoosawmy and R. P. Crick (1998). "Localization of the fourth locus (GLC1E) for adult-onset primary open-angle glaucoma to the 10p15-p14 region." Am J Hum Genet 62(3): 641-52.
Sarfarazi, M. and T. Rezaie (2003). "Optineurin in primary open angle glaucoma." Ophthalmol Clin North Am 16(4): 529-41.
Sato, H., T. Takino, Y. Okada, J. Cao, A. Shinagawa, E. Yamamoto and M. Seiki (1994). "A matrix metalloproteinase expressed on the surface of invasive tumour cells." Nature 370(6484): 61-5.
Schuermann, M. J., E. Otto, A. Becker, K. Saar, F. Ruschendorf, B. C. Polak, S. Ala-Mello, J. Hoefele, A. Wiedensohler, M. Haller, H. Omran, P. Nurnberg and F. Hildebrandt (2002). "Mapping of gene loci for nephronophthisis type 4 and Senior-Loken syndrome, to chromosome 1p36." Am J Hum Genet 70(5): 1240-6.
Sen, J., S. Harpavat, M. A. Peters and C. L. Cepko (2005). "Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina." Development 132(23): 5147-59.
Shareef, S. R., E. Garcia-Valenzuela, A. Salierno, J. Walsh and S. C. Sharma (1995). "Chronic ocular hypertension following episcleral venous occlusion in rats." Exp Eye Res 61(3): 379-82.
Sheffield, V. C., E. M. Stone, W. L. Alward, A. V. Drack, A. T. Johnson, L. M. Streb and B. E. Nichols (1993). "Genetic linkage of familial open angle glaucoma to chromosome 1q21-q31." Nat Genet 4(1): 47-50.
Shimizu, S., P. R. Lichter, A. T. Johnson, Z. Zhou, M. Higashi, M. Gottfredsdottir, M. Othman, S. E. Moroi, F. W. Rozsa, R. M. Schertzer, M. S. Clarke, A. L. Schwartz, C. A. Downs, D. Vollrath and J. E. Richards (2000). "Age-dependent prevalence of mutations at the GLC1A locus in primary open-angle glaucoma." Am J Ophthalmol 130(2): 165-77.
Shu, X., A. M. Fry, B. Tulloch, F. D. Manson, J. W. Crabb, H. Khanna, A. J. Faragher, A. Lennon, S. He, P. Trojan, A. Giessl, U. Wolfrum, R. Vervoort, A. Swaroop and A. F. Wright (2005). "RPGR ORF15 isoform co-localizes with RPGRIP1 at centrioles and basal bodies and interacts with nucleophosmin." Hum Mol Genet 14(9): 1183-97.
Smith, D. J. and A. J. Lusis (2002). "The allelic structure of common disease." Hum Mol Genet 11(20): 2455-61.
Sommer, A., J. M. Tielsch, J. Katz, H. A. Quigley, J. D. Gottsch, J. Javitt and K. Singh (1991). "Relationship between intraocular pressure and primary open angle glaucoma among white and black Americans. The Baltimore Eye Survey." Arch Ophthalmol 109(8): 1090-5.
Sripriya, S., J. Nirmaladevi, R. George, A. Hemamalini, M. Baskaran, R. Prema, S. Ve Ramesh, T. Karthiyayini, J. Amali, S. Job, L. Vijaya and G. Kumaramanickavel (2006). "OPTN gene: profile of patients with glaucoma from India." Mol Vis 12: 816-20.
97
Sripriya, S., S. Uthra, R. Sangeetha, R. J. George, A. Hemamalini, P. G. Paul, J. Amali, L. Vijaya and G. Kumaramanickavel (2004). "Low frequency of myocilin mutations in Indian primary open-angle glaucoma patients." Clin Genet 65(4): 333-7.
Stefan, C., D. M. Dumitrica and C. Ardeleanu (2007). "[The future started: nitric oxide in glaucoma]." Oftalmologia 51(4): 89-94.
Stephens, M., N. J. Smith and P. Donnelly (2001). A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 68: 978-89.
Stiburek, L., D. Fornuskova, L. Wenchich, M. Pejznochova, H. Hansikova and J. Zeman (2007). "Knockdown of human Oxa1l impairs the biogenesis of F1Fo-ATP synthase and NADH:ubiquinone oxidoreductase." J Mol Biol 374(2): 506-16.
Stoilov, I. R., V. P. Costa, J. P. Vasconcellos, M. B. Melo, A. J. Betinjane, J. C. Carani, E. V. Oltrogge and M. Sarfarazi (2002). "Molecular genetics of primary congenital glaucoma in Brazil." Invest Ophthalmol Vis Sci 43(6): 1820-7.
Stoilova, D., A. Child, O. C. Trifan, R. P. Crick, R. L. Coakes and M. Sarfarazi (1996). "Localization of a locus (GLC1B) for adult-onset primary open angle glaucoma to the 2cen-q13 region." Genomics 36(1): 142-50.
Stone, E. M., J. H. Fingert, W. L. Alward, T. D. Nguyen, J. R. Polansky, S. L. Sunden, D. Nishimura, A. F. Clark, A. Nystuen, B. E. Nichols, D. A. Mackey, R. Ritch, J. W. Kalenak, E. R. Craven and V. C. Sheffield (1997). "Identification of a gene that causes primary open angle glaucoma." Science 275(5300): 668-70.
Strachan, T. and A. P. Read (2004). Human Molecular Genetics. New York, Garland Science. Suhara, W., M. Yoneyama, H. Yonekawa and T. Fujita (1996). "Structure of mouse interferon
stimulated gene factor 3 gamma (ISGF3 gamma/p48) cDNA and chromosomal localization of the gene." J Biochem 119(2): 231-4.
Suriyapperuma, S. P., A. Child, T. Desai, G. Brice, A. Kerr, R. P. Crick and M. Sarfarazi (2007). "A new locus (GLC1H) for adult-onset primary open-angle glaucoma maps to the 2p15-p16 region." Arch Ophthalmol 125(1): 86-92.
Swain, P. K., D. Hicks, A. J. Mears, I. J. Apel, J. E. Smith, S. K. John, A. Hendrickson, A. H. Milam and A. Swaroop (2001). "Multiple phosphorylated isoforms of NRL are expressed in rod photoreceptors." J Biol Chem 276(39): 36824-30.
Swaroop, A., K. E. Branham, W. Chen and G. Abecasis (2007). "Genetic susceptibility to age-related macular degeneration: a paradigm for dissecting complex disease traits." Hum Mol Genet 16 Spec No. 2: R174-82.
Swaroop, A., J. Z. Xu, H. Pawar, A. Jackson, C. Skolnick and N. Agarwal (1992). "A conserved retina-specific gene encodes a basic motif/leucine zipper domain." Proc Natl Acad Sci U S A 89(1): 266-70.
Sweetman, D. and A. Munsterberg (2006). "The vertebrate spalt genes in development and disease." Dev Biol 293(2): 285-93.
Tabor, H. K., N. J. Risch and R. M. Myers (2002). "Candidate-gene approaches for studying complex genetic traits: practical considerations." Nat Rev Genet 3(5): 391-7.
Tamm, E. (2002). "Myocilin and glaucoma: facts and ideas-." Prog Retin Eye Res 21(4): 395-428.
Tamm, E. R., P. Russell, D. H. Johnson and J. Piatigorsky (1996). "Human and monkey trabecular meshwork accumulate alpha B-crystallin in response to heat shock and oxidative stress." Invest Ophthalmol Vis Sci 37(12): 2402-13.
Tezel, G. (2008). "TNF-alpha signaling in glaucomatous neurodegeneration." Prog Brain Res 173: 409-21.
Tian, B., B. Geiger, D. L. Epstein and P. L. Kaufman (2000). "Cytoskeletal involvement in the regulation of aqueous humor outflow." Invest Ophthalmol Vis Sci 41(3): 619-23.
98
Tielsch, J. M., J. Katz, K. Singh, H. A. Quigley, J. D. Gottsch, J. Javitt and A. Sommer (1991). "A population-based evaluation of glaucoma screening: the Baltimore Eye Survey." Am J Epidemiol 134(10): 1102-10.
Tielsch, J. M., J. Katz, A. Sommer, H. A. Quigley and J. C. Javitt (1994). "Family history and risk of primary open angle glaucoma. The Baltimore Eye Survey." Arch Ophthalmol 112(1): 69-73.
Tielsch, J. M., A. Sommer, J. Katz, R. M. Royall, H. A. Quigley and J. Javitt (1991). "Racial variations in the prevalence of primary open-angle glaucoma. The Baltimore Eye Survey." Jama 266(3): 369-74.
Toda, Y., S. Tang, K. Kashiwagi, F. Mabuchi, H. Iijima, S. Tsukahara and Z. Yamagata (2004). "Mutations in the optineurin gene in Japanese patients with primary open-angle glaucoma and normal tension glaucoma." Am J Med Genet A 125A(1): 1-4.
Tomida, I., A. Azuara-Blanco, H. House, M. Flint, R. G. Pertwee and P. J. Robson (2006). "Effect of sublingual application of cannabinoids on intraocular pressure: a pilot study." J Glaucoma 15(5): 349-53.
Torrado, M., R. Trivedi, R. Zinovieva, I. Karavanova and S. I. Tomarev (2002). "Optimedin: a novel olfactomedin-related protein that interacts with myocilin." Hum Mol Genet 11(11): 1291-301.
Trifan, O. C., E. I. Traboulsi, D. Stoilova, I. Alozie, R. Nguyen, S. Raja and M. Sarfarazi (1998). "A third locus (GLC1D) for adult-onset primary open-angle glaucoma maps to the 8q23 region." Am J Ophthalmol 126(1): 17-28.
Tsai, F. J., H. J. Lin, W. C. Chen, H. Y. Chen and S. S. Fan (2003). "Insulin-like growth factor-II gene polymorphism is associated with primary open angle glaucoma." J Clin Lab Anal 17(6): 259-63.
Tsai, F. J., H. J. Lin, W. C. Chen, C. H. Tsai and S. W. Tsai (2004). "A codon 31ser-arg polymorphism of the WAF-1/CIP-1/p21/tumour suppressor gene in Chinese primary open-angle glaucoma." Acta Ophthalmol Scand 82(1): 76-80.
Tunny, T. J., K. A. Richardson and C. V. Clark (1998). "Association study of the 5' flanking regions of endothelial-nitric oxide synthase and endothelin-1 genes in familial primary open-angle glaucoma." Clin Exp Pharmacol Physiol 25(1): 26-9.
Tunny, T. J., K. A. Richardson, C. V. Clark and R. D. Gordon (1996). "The atrial natriuretic peptide gene in patients with familial primary open-angle glaucoma." Biochem Biophys Res Commun 223(2): 221-5.
Ueda, M., Y. Yamashita, M. Takehara, Y. Terai, K. Kumagai, K. Ueki, K. Kanda, H. Yamaguchi, D. Akise, Y. C. Hung and M. Ueki (2002). "Survivin gene expression in endometriosis." J Clin Endocrinol Metab 87(7): 3452-9.
Vincent, A. L., G. Billingsley, Y. Buys, A. V. Levin, M. Priston, G. Trope, D. Williams-Lyn and E. Heon (2002). "Digenic inheritance of early-onset glaucoma: CYP1B1, a potential modifier gene." Am J Hum Genet 70(2): 448-60.
Wang, C. Y., Y. C. Shen, F. Y. Lo, C. H. Su, S. H. Lee, K. H. Lin, H. Y. Tsai, N. W. Kuo and S. S. Fan (2006). "Polymorphism in the IL-1alpha (-889) locus associated with elevated risk of primary open angle glaucoma." Mol Vis 12: 1380-5.
Wang, D. Y., B. J. Fan, J. K. Chua, P. O. Tam, C. K. Leung, D. S. Lam and C. P. Pang (2006). "A genome-wide scan maps a novel juvenile-onset primary open-angle glaucoma locus to 15q." Invest Ophthalmol Vis Sci 47(12): 5315-21.
Weber, Y. G. and H. Lerche (2008). "Genetic mechanisms in idiopathic epilepsies." Dev Med Child Neurol 50(9): 648-54.
Weeks, D. E. and G. M. Lathrop (1995). "Polygenic disease: methods for mapping complex disease traits." Trends Genet 11(12): 513-9.
99
Weisschuh, N., D. Neumann, C. Wolf, B. Wissinger and E. Gramer (2005). "Prevalence of myocilin and optineurin sequence variants in German normal tension glaucoma patients." Mol Vis 11: 284-7.
Weisschuh, N., C. Wolf, B. Wissinger and E. Gramer (2007). "Variations in the WDR36 gene in German patients with normal tension glaucoma." Mol Vis 13: 724-9.
Wiggs, J. L. (2007). "Genetic etiologies of glaucoma." Arch Ophthalmol 125(1): 30-7. Wiggs, J. L., R. R. Allingham, A. Hossain, J. Kern, J. Auguste, E. A. DelBono, B. Broomer,
F. L. Graham, M. Hauser, M. Pericak-Vance and J. L. Haines (2000). "Genome-wide scan for adult onset primary open angle glaucoma." Hum Mol Genet 9(7): 1109-17.
Wiggs, J. L., R. R. Allingham, D. Vollrath, K. H. Jones, M. De La Paz, J. Kern, K. Patterson, V. L. Babb, E. A. Del Bono, B. W. Broomer, M. A. Pericak-Vance and J. L. Haines (1998). "Prevalence of mutations in TIGR/Myocilin in patients with adult and juvenile primary open-angle glaucoma." Am J Hum Genet 63(5): 1549-52.
Wiggs, J. L., J. Auguste, R. R. Allingham, J. D. Flor, M. A. Pericak-Vance, K. Rogers, K. R. LaRocque, F. L. Graham, B. Broomer, E. Del Bono, J. L. Haines and M. Hauser (2003). "Lack of association of mutations in optineurin with disease in patients with adult-onset primary open-angle glaucoma." Arch Ophthalmol 121(8): 1181-3.
Wiggs, J. L., S. Lynch, G. Ynagi, M. Maselli, J. Auguste, E. A. Del Bono, L. M. Olson and J. L. Haines (2004). "A genomewide scan identifies novel early-onset primary open-angle glaucoma loci on 9q22 and 20p12." Am J Hum Genet 74(6): 1314-20.
Wiggs, J. L. and D. Vollrath (2001). "Molecular and clinical evaluation of a patient hemizygous for TIGR/MYOC." Arch Ophthalmol 119(11): 1674-8.
Willoughby, C. E., L. L. Chan, S. Herd, G. Billingsley, N. Noordeh, A. V. Levin, Y. Buys, G. Trope, M. Sarfarazi and E. Heon (2004). "Defining the pathogenicity of optineurin in juvenile open-angle glaucoma." Invest Ophthalmol Vis Sci 45(9): 3122-30.
Wirtz, M. K., J. R. Samples, P. L. Kramer, K. Rust, J. R. Topinka, J. Yount, R. D. Koler and T. S. Acott (1997). "Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q." Am J Hum Genet 60(2): 296-304.
Wirtz, M. K., J. R. Samples, K. Rust, J. Lie, L. Nordling, K. Schilling, T. S. Acott and P. L. Kramer (1999). "GLC1F, a new primary open-angle glaucoma locus, maps to 7q35-q36." Arch Ophthalmol 117(2): 237-41.
Wistow, G., S. L. Bernstein, M. K. Wyatt, S. Ray, A. Behal, J. W. Touchman, G. Bouffard, D. Smith and K. Peterson (2002). "Expressed sequence tag analysis of human retina for the NEIBank Project: retbindin, an abundant, novel retinal cDNA and alternative splicing of other retina-preferred gene transcripts." Mol Vis 8: 196-204.
Wolfs, R. C., P. H. Borger, R. S. Ramrattan, C. C. Klaver, C. A. Hulsman, A. Hofman, J. R. Vingerling, R. A. Hitchings and P. T. de Jong (2000). "Changing views on open-angle glaucoma: definitions and prevalences--The Rotterdam Study." Invest Ophthalmol Vis Sci 41(11): 3309-21.
Wolfs, R. C., C. C. Klaver, R. S. Ramrattan, C. M. van Duijn, A. Hofman and P. T. de Jong (1998). "Genetic risk of primary open-angle glaucoma. Population-based familial aggregation study." Arch Ophthalmol 116(12): 1640-5.
Yoshida, S., B. M. Yashar, S. Hiriyanna and A. Swaroop (2002). "Microarray analysis of gene expression in the aging human retina." Invest Ophthalmol Vis Sci 43(8): 2554-60.
Yulug, I. G., C. G. See, E. M. Fisher and I. G. Ylug (1995). "The DAD1 protein, whose defect causes apoptotic cell death, maps to human chromosome 14." Genomics 26(2): 433-5.
Zhou, L., Y. Li and B. Y. Yue (1999). "Oxidative stress affects cytoskeletal structure and cell-matrix interactions in cells from an ocular tissue: the trabecular meshwork." J Cell Physiol 180(2): 182-9.
100
Zhou, Z. and D. Vollrath (1999). "A cellular assay distinguishes normal and mutant TIGR/myocilin protein." Hum Mol Genet 8(12): 2221-8.
Zimmer, A., E. Mutschler, G. Lambrecht, D. Mayer and J. Kreuter (1994). "Pharmacokinetic and pharmacodynamic aspects of an ophthalmic pilocarpine nanoparticle-delivery-system." Pharm Res 11(10): 1435-42.
101
8. Abbreviations °C degree Celsius A adenine AD activating domain ADCY4 adenylate cyclase 4 B.C. before Christ BCL2L2 B-cell/lymphoma 2- like 2 BD binding domain bp base pair(s) C cytosine cDNA complementary DNA cGMP cyclic guanosine monophosphate CI confidence interval CNVs copy-number variations CYP1B1 cytochrome P450 subfamily I polypeptide 1 ddNTPs 2´, 3´-dideoxynucleotide triphosphates DAD1 defender against cell death 1 DNA deoxyribonucleic acid DNase deoxyribonuclease dNTP dinucleotide triphosphate Da dalton DTT dithiothreitol ds double strand EDTA ethylene diamine tetraacetic acid e.g. for example (exempli gratia) fl full lenght g gram G guanine GAPDH glyceraldehyde-3-phosphate dehydrogenase gDNA genomic DNA h hour HW Hardy-Weinberg htSNP haplotype tagging SNP i.e. that is (id est) IFNα interferon alpha IOP intraocular pressure IP immunoprecipitation ISGF3G interferon-stimulated transcription factor 3 gamma JOAG juvenile open angle glaucoma K kilo (103) kb kilobase pair(s) l liter LB Luria Bertani medium LCA Leber congenital amaurosis LD linkage disequilibrium LOD logarithm of the odds ratio M molar (mol/liter) m meter m milli (10-3) min. Minute MMP14 matrix metalloproteinase 14 mRNA messenger RNA MYOC myocilin
102
n nano (10-9) ND not determined NMDA N-methyl-D-aspartic acid NPHP4 nephrocystin-4 NRL neural retina leucine zipper NTG normal tension glaucoma OLA oligonucleotide ligation assay OR odds ratio ORF open reading frame OPTN optineurin OXA1L oxidase assembly 1-like p pico (10-12) PCG primary congenital glaucoma PCR polymerase chain reaction POAG primary open angle glaucoma qPCR quantitative PCR RGC retinal ganglion cell RNA ribonucleic acid RNase ribonuclease ROS reactive oxigen species RPGRIP1 retinitis pigmentosa GTPase interacting protein 1 rpm revolutions per minute RT-PCR reverse transcriptase PCR SALL2 salivary protein-like 2 SD syntethic dropout SDS sodium dodecyl sulfate sec. seconds SNP single-nucleotide polymorphism T thymine TBS tris-buffered saline Tc cytotoxic T cell TDT transmission disequilibrium test TM trabecular meshwork TNF-α tumor necrosis factor alpha Tris 2-amino-2-hydroxymethyl-1,3-propanediol U.S. United States UVB ultravioletlight WDR36 WD repeat domain 36 Wt wild-type ZNF219 zinc finger protein 219 µ micro (10-9)
103
9. Publications Articles Fernández-Martínez L, Pasutto F, Letteboer S., Mardin C., Weisschuh N., Gramer E., Weber B., Rautenstrauss B., Roepman R. and Reis A. Heterozygous RPGRIP1 mutations are associated with primary open-angle glaucoma. (in preparation) Pasutto F, Chavarria-Soley G, Mardin CY, Michels-Rautenstrauss K, Ingelman-Sundberg M, Fernández-Martínez L, Weber BH, Rautenstrauss B, Reis A. Heterozygous loss of function variants in CYP1B1 predispose to primary open angle glaucoma. Invest Ophthalmol Vis Sci. 2009 Jul 30[Epub ahead of print]. Pasutto F, Sticht H, Hammersen G, Gillessen-Kaesbach G, Fitzpatrick DR, Nürnberg G, Brasch F, Schirmer-Zimmermann H, Tolmie JL, Chitayat D, Houge G, Fernández-Martínez L, Keating S, Mortier G, Hennekam RC, von der Wense A, Slavotinek A, Meinecke P, Bitoun P, Becker C, Nürnberg P, Reis A, Rauch A. Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation. Am J Hum Genet. 2007 Mar;80(3):550-60. Abstracts Pasutto F, Chavarría-Soley G, Michels-Rautenstrauss K, Mardin C, Fernández-Martínez L, Rautenstrauss B, Kruse F, Reis A. Association of functional CYP1B1 variants in German patients with primary open-angle glaucoma (POAG). European Glaucoma Society (EGS) Congress, Berlin, June 1-6, 2008 Fernández-Martínez L, Pasutto F, Chavarría-Soley G, Michels-Rautenstrauss K, Mardin C, Rautenstrauss B, Kruse F, Reis A. Association of functional CYP1B1 variants in German patients with primary open-angle glaucoma (POAG). German Society of Human Genetics (GfH) Annual Meeting, Hannover, April 8-14, 2008 Pasutto F, Sticht H, Hammersen G, Gillessen-Kaesbach G, Fitzpatrick DR, Nürnberg G, Schirmer-Zimmermann H, Tolmie JL, Chitayat D, Houge G, Fernández-Martínez L, Keating S, Mortier G, Hennekam RC, von der Wense A, Slavotinek A, Meinecke P, Bitoun P, Becker C, Nürnberg P, Reis A, Rauch A. Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation. German Society of Human Genetics (GfH) Annual Meeting, Bonn, March 7-10, 2007. Fernández-Martínez L, Mardin C, Pasutto F, Kruse F, Reis A. Systematic mutational screening of candidate genes in a putative glaucoma locus on chromosome 14q11 in German patients. German Society of Human Genetics (GfH) Annual Meeting, Heidelberg, March 8-11, 2006. Fernández-Martínez L, Pasutto F, Mardin C, Michels-Rautenstrauss K, , Kruse F, Reis A. Systematic mutational screening of RPGRIP1 in glaucoma patients. Pro Retina Research Colloquium, Annual meeting, Potsdam, April 7-8, 2006
Fernández-Martínez L, Pasutto F, Mardin C, Kruse F, Reis A. Determination of the linkage disequilibrium (LD) structure for a putative glaucoma locus on chromosome 14q11 in German patients. German Society of Human Genetics (GfH) Annual Meeting, Halle, March 9-12, 2005. Fernández-Martínez L, Pasutto F, Reis A. Systematic linkage disequilibrium (LD) analysis for screening candidate genes in glaucoma. Spanish Society of Biotechnology Annual Meeting, Oviedo (Spain), July 19-23, 2004
104
10. Acknowledgements
This thesis owes its existence to Professor André Reis, my supervisor, whose support,
knowledge and interest on the project made this work possible. My most sincere appreciation
and gratitude to him, for giving me the opportunity to do my doctoral studies as part of his
team.
Thanks to Professor Brandstätter and Professor Winterpacht for their willingness to read and
evaluate this thesis so thoroughly.
To all the members of the glaucoma group I am very grateful for the cooperative spirit and
enthusiasm on the project. My most special thanks to my Postdoc Francesca, for her support
and guidance through all these years. A special mention also for Mandy, for helping me
always to solve tedious bureaucratic issues, specially at the end of this thesis and above all for
your friendship and confidence. Also thanks to Olga, Steffen, Claudia, and Adrian.
A special mention for Ronald Roepman and Stef, our scientific collaborators from Nijmegen
(The Netherlands). Thanks for your immediate involvement and ideas regarding the project,
for giving me the opportunity to perform part of my experiments in your lab, and for your
help during my time abroad.
Thanks also to Michel Hadjihannas, from the Nikolaus Fiebiger Center, for his help with the
colocalization.
The discussions and cooperation of all of my colleagues in Erlangen have contributed
substantially to this work. Petra, thanks for introducing me to the work on the lab and for your
funny gestures in the corridor; nos vemos en Asturies. Administrator, thanks for your patience
and for all the information regarding environmental issues; anyway, I will keep on taking
aeroplanes and still miss my joystick. Herr Thiel, thanks for showing me almost all the
bioinformatic tools that I used during my work there; Macki is in debt with you. Christiane,
thanks for all your patience, good explanations and also to make me discover the aubergines
at your place in Bamberg so long ago. Tagariello, thanks for introducing me to the world of
the cellular biology, I really appreciate your help. Ingo, thank you for helping me with the
western blots and making my stays in your lab comfortable. Heike, thanks for your smiles and
for taking so good care of my plates. I also extend my appreciation to all staff members of the
Institute of Human Genetics for their assistance, support and excellent working atmosphere.
105
Special mention deserves all the patients with and without glaucoma, who so gracefully
agreed to participate in these studies and made this work possible. I sincerely hope that my
work will in some way benefit you all and contribute to future diagnostics and treatment.
And how to forget the two people that I saw most throughout these years… Jesús and Gaby.
GRACIES por todo. Por ofrecerme un colchón (un suelo, más bien) y vuestra amistad nada
más llegar a tierras bávaras, por soportar estoicamente mi “Asturies ist das beste” (espero
poder demostraros que tengo razón), por nuestras conversaciones científicas y las no tanto y
por un sinfín de cosas más imposibles de escribir aquí. MED.
I would like to mention also all my friends around the globe. Without your continuous
support, friendship and shared moments not only this thesis, but also my whole life won’t be
possible. Herzlichen Dank für die schöne Zeit da an Richard, Melli, Tobi und alle meine
Mitbe’s; Özlem, Judith, Michael, Simone und alle die Pacelli’s; Hanin, Sabine und alle die
Muay-thai Leute; Migue, Gis, Laura, Tello, Isa y todos los erlangenianos. Wir sehen uns
wieder in Erlangen, Asturies oder irgendwo, sicher! Gracies de verdad a mis nueve chicas del
foro, a mis chicarrones dominicos preferidos, a Patri, Vero, Fae, Rafota, Rrorho y todos los
amigüitos tan guachis que me sacaron a pasear todos estos años (y los que quedan). I thank
you all from the deepest part of my heart.
Finally, I want to finish this thesis as I’ve started it, dedicating this work to my family. A mi
padre, quien sin duda ha sido la persona con mayor influencia en mi vida. Él me transmitió el
amor por la naturaleza, por el ser humano como parte de ella y por el Algo que todo lo
estabiliza. A mi hermano, que espero esté orgulloso de su hermanita paliducha. Descansad en
Paz. A mi hermana y a mis sobris Jorgito y Carlangas, por haber compartido tanto juntos
todos estos años. A mis sobris mexicanitos guapetones. Y la dedicatoria más especial para mi
mami, por su infinita paciencia, bondad y amor, por creer y confiar en mí, por no desesperarse
conmigo y, ante todo, por seguir estando a mi lado.
Thank you all. Danke Leute. Gracies.
Lore
December 2009
106
11. Curriculum vitae
Personal details Surname: Fernández Martínez
Name: Lorena
Date of birth: 20th January 1977
Place of birth: Oviedo, Spain
Nationality: Spanish
Marital status: Single
Address: Luitpoldstraße 54
91052 - Erlangen, Germany
Telephone number: 0049 177 5212142
E-mail: [email protected]
Academic background 07/2005 - 08/2009 PhD in Human Biology at the Institute of Human Genetics,
University Hospital Erlangen, Friedrich-Alexander University Erlangen-Nürnberg, Germany
10/1995 - 12/2002 MSc in Biology at the University of Oviedo, Spain 10/1990 – 06/1995 Auseva High School, Oviedo, Spain Graduated (with honours) 09/1981 – 06/1990 Virgen Milagrosa School in Oviedo, Spain Professional background 05/2003 - 09/2003 Practical training period at the Molecular Genetics Laboratory,
Clinic of Rheumatology, Otto-Von-Guericke University of Magdeburg, Germany
07/2002 - 10/2002 Practical training period at the Quality Department,
Mantequerías Arias, Vegalencia, Spain 08/2001 - 11/2001 Practical training period at the Plant Genetic Engineering
Laboratory, Regional Institute for Research and Development in Food and Agriculture of Asturies (SERIDA), Villaviciosa, Spain