of 113/113
UNIVERSITÉ DE SHERBROOKE PROPRIÉTÉS BIOCHIMIQUES, ENZYMATIQUES ET PHYSIOLOGIQUES DE LA HUMAN AIRWAY TRYPSIN-LIKE PROTEASE (HAT) Par KELLY MAURICE Département de Pharmacologie Mémoire Présenté à la Faculté de Médecine et Des Sciences de la Santé En vue de l'obtention du grade de Maître es sciences (M. Se) Membres du jury Dr André Cantin (Immunologie, Pharmacologie) Dr Richard Leduc (Pharmacologie) Dr Martin Richter (Pharmacologie) Dr Olivier Lesur (Immunologie, Physiologie, Sciences Cliniques, Pharmacologie) Janvier 2010

UNIVERSITÉ DE SHERBROOKE PROPRIÉTÉS … · universitÉ de sherbrooke propriÉtÉs biochimiques, enzymatiques et physiologiques de la human airway trypsin-like protease (hat) par

  • View
    215

  • Download
    0

Embed Size (px)

Text of UNIVERSITÉ DE SHERBROOKE PROPRIÉTÉS … · universitÉ de sherbrooke propriÉtÉs biochimiques,...

UNIVERSIT DE SHERBROOKE

PROPRITS BIOCHIMIQUES, ENZYMATIQUES ET PHYSIOLOGIQUES

DE LA HUMAN AIRWAY TRYPSIN-LIKE PROTEASE (HAT)

Par

KELLY MAURICE

Dpartement de Pharmacologie

Mmoire Prsent la Facult de Mdecine et

Des Sciences de la Sant

En vue de l'obtention du grade de

Matre es sciences (M. Se)

Membres du jury

Dr Andr Cantin (Immunologie, Pharmacologie)

Dr Richard Leduc (Pharmacologie)

Dr Martin Richter (Pharmacologie)

Dr Olivier Lesur (Immunologie, Physiologie, Sciences Cliniques, Pharmacologie)

Janvier 2010

1*1 Library and Archives Canada Published Hritage Branch

395 Wellington Street OttawaONK1A0N4 Canada

Bibliothque et Archives Canada

Direction du Patrimoine de l'dition

395, rue Wellington OttawaONK1A0N4 Canada

Yourfile Votre rfrence ISBN: 978-0-494-79764-8 Our file Notre rfrence ISBN: 978-0-494-79764-8

NOTICE:

The author has granted a non-exclusive license allowing Library and Archives Canada to reproduce, publish, archive, prserve, conserve, communicate to the public by tlcommunication or on the Internet, loan, distribute and sell thses Worldwide, for commercial or non-commercial purposes, in microform, paper, electronic and/or any other formats.

AVIS:

L'auteur a accord une licence non exclusive permettant la Bibliothque et Archives Canada de reproduire, publier, archiver, sauvegarder, conserver, transmettre au public par tlcommunication ou par l'Internet, prter, distribuer et vendre des thses partout dans le monde, des fins commerciales ou autres, sur support microforme, papier, lectronique et/ou autres formats.

The author retains copyright ownership and moral rights in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission.

L'auteur conserve la proprit du droit d'auteur et des droits moraux qui protge cette thse. Ni la thse ni des extraits substantiels de celle-ci ne doivent tre imprims ou autrement reproduits sans son autorisation.

In compliance with the Canadian Privacy Act some supporting forms may hve been removed from this thesis.

Conformment la loi canadienne sur la protection de la vie prive, quelques formulaires secondaires ont t enlevs de cette thse.

While thse forms may be included in the document page count, their removal does not represent any loss of content from the thesis.

Bien que ces formulaires aient inclus dans la pagination, il n'y aura aucun contenu manquant.

1+1

Canada

Je ddie cet ouvrage l'avancement de la recherche sur la Fibrose Kystique

Et ma merveilleuse famille

TABLE DES MATIRES

TABLE DES MATIRES iii

LISTE DES FIGURES vii

LISTE DES TABLEAUX x

LISTE DES ABBRVIATIONS x

RSUM xiii

INTRODUCTION 1

1.1 CIBLES PHARMACOLOGIQUES 1

1.2 INFLAMMATION PULMONAIRE CHRONIQUE 1

1.3 LA FIBROSE KYSTIQUE 4

1.3.1 Cystic Fibrosis Transmembrane Conductance Regulator 4

1.3.2 La pathophysiologie de la fibrose kystique 9

1.4 LA FAMILLE DES PROTEASES SERINE TRANSMEMBRANAIRE DE

TYPE II 11

1.5 HUMAN AIRWAY TRYPSIN-LIKE PROTEASE (HAT) 16

1.6 HYPOTHSE .20

MATRIEL ET MTHODES 21

2.1 MATRIEL 21

2.2 CULTURE CELLULAIRE 2%

iii

2.3 CONSTRUCTION PLASMIDIQUE DE LA HAT 23

2.4 EXPRESSION PLASMIDIQUE DE LA HAT 26

2.5 PURIFICATION DE LA HAT 28

2.5.1 Purification par IMAC (Immobilized mtal ion affinity chromatography)...2S

2.5.2 Purification par Colonne d'Affinit Benzamidine 23

2.6 TEST D'ACTIVITE DE LA HAT 3

2.7 TITRATION DE LA HAT 30

2.8 TUDES DES PROPRITS BIOCHIMQUES DE LA HAT 31

2.8.1 Dtermination du pH optimal de la HAT 31

2.8.2 Inhibiteurs synthtiques de protases 32

2.8.3 Inhibiteurs endognes de protase serine 32.

2.9 TUDES DES PROPRITS ENZYMATIQUES DE LA HAT 32

2.9.1 Nomenclature de Schechter et Berger 33

2.9.2 Internally Quenched Fluorognie peptides (peptides IQF) 35

2.10 TUDES DES PROPRIETES PHYSIOLOGIQUES DE LA HAT 38

2.10.1 chantillons et purification des expectorations de patients FK 38

2.10.2 Mesure de la concentration d'elastase dans les expectorations de patients

FK 38

2.10.3 Mesure de l'Activit Protolytique dans les Expectorations de patients FK

33

2.10.4 Couplage de l'anticorps anti-HAT sur les billes CNBr-activated Sepharose

4B 39

2.10.5 Tests de l'effet de la HAT sur la production de la cytokine IL-8 33

iv

2.10.6 Mesure de la cytokine IL-8 33

2.10.7 Statistiques 40

RSULTATS 41

3.1 EXPRESSION ET PURIFICATION DE LA PROTEASE HUMAN AIRWAY

TRYPSIN-LIKE (HAT) 41

3.1.1 Expression de la HAT dans les cellules S2 41

3.1.2 Purification par IMAC 43

3.1.3 Purification par colonne d'affinit benzamidine 4-?

3.1.4 Efficacit de la purification 43

3.2 PROPRITS BIOCHIMIQUES DE LA HAT 55

3.2.1 pH optimal de la HAT 53

3.2.2 Inhibiteurs synthtiques de protases 53

3.2.3 Inhibiteurs endognes de protases serine 5tf

3.2.4 Stochiomtrie d'Inhibition 5#

3.3 PROPRITS ENZYMATIQUES DE LA HAT 53

3.3.1 Squences prfrentielles 59

3.3.2 Efficacit catalytique (Kcat/Km) 59

3.4 PROPRITS PHYSIOLOGIQUES DE LA HAT 63

3.4.1 Activit protolytique dans les expectorations de patients FK 63

3.4.2 Immuno-prcipitation et immuno-buvardage les expectorations de patients

v

3.4.3 Effet de la HAT sur la production d'IL-8 66

DISCUSSION 68

CONCLUSION 82

REMERCIEMENTS .84

BIBLIOGRAPHIE 86

VI

LISTES DES FIGURES

FIGURE 1: Schmatisation simplifie de l'inflammation dans les poumons

FIGURE 2: Le canal CFTR la surface de l'pithlium

FIGURE 3: vacuation du mucus par les cellules pithliales cilies

FIGURE 4: Schmatisation des diffrentes mutations du CFTR

FIGURE 5: Mauvais fonctionnement des cils des cellules pithliales

FIGURE 6: Les Sous-familles des TTSP

FIGURE 7: Schmatisation de la Human Airway Trypsin-like protease

FIGURE 8: Voies de signalisation actives par la HAT

FIGURE 9: Construction de la HAT recombinante

FIGURE 10: Schmatisation de la transfection des cellules S2 par rHAT

FIGURE 11: Reprsentation schmatique de la nomenclature de Schechter et Berger

FIGURE 12: Le principe du FRET

FIGURE 13: Immuno-buvardage de type Western des milieux de cellules S2 transfectees avec

la rHAT

FIGURE 14: Graphique d'lution des protines par imidazole et immuno-buvardage de type

Western des diffrentes fractions

vii

FIGURE 15: Activit protolytique dans les chantillons contrle et HAT

FIGURE 16: Graphique de la purification de la HAT par colonne d'affinit benzamidine

FIGURE 17: Immuno-buvardage des tapes de purification

FIGURE 18: L'effet du pH sur l'activit protolytique de la HAT

FIGURE 19: Effets des inhibiteurs synthtiques de protease sur l'activit protolytique de la

rHAT

FIGURE 20: Effets des inhibiteurs endognes de protease serine sur l'activit protolytique de

la HAT

FIGURE 21: Stochiomtrie d'inhibition entre alpha-2 anti-plasmine et HAT

FIGURE 22: Clivage des peptides IQF par la HAT

FIGURE 23: Clivage d'un peptide IQF diffrentes concentrations par la HAT

FIGURE 24: Graphique de comparaison de l'efficacit catalytique de la HAT pour chaque

peptide

FIGURE 25: Concentration d'lastase dans les expectorations de patients FK

FIGURE 26: Dtection d'activit protolytique dans les expectorations de patients FK

FIGURE 27: Immuno-prcipitation de la HAT suivi d'un Immuno-buvardage de type Western

FIGURE 28: Effet de la HAT sur la production d'IL-8 dans les Calu-3

LISTE DES TABLEAUX

TABLEAU 1: Efficacit d'une deuxime purification par colonne d'affinit benzamidine

TABLEAU 2: Les sites de clivage des inhibiteurs endognes de protease serine

IX

LISTE DES ABBRVIATIONS

GPCR : Rcepteur coupl une protine G

IL-8 (CXCL8): Interleukin-8

FK: Fibrose Kystique

CFTR: Cystic Fibrosis Transmembrane Regulator

ABC: La Superfamille ATP-Binding Cassette

TTSP: Protases Serine Transmembranaire de Type II

TMPRSS: Transmembrane Protease Serine

SEA: Sea Urchin Sperm Protein, Enteropeptidase, Agrin

SRCR: Single Scavenger Receptor Cys-rich

MSPL: Mosaic Serine Protease Large Form

LDLa: Low Density Lipoprotein Receptor class A

CUB: Cls/Clr, Urchin embryonic growth factor and Bone morphogenic protein-1

MAM: Meprin, A5 Antigen, and receptor protein phosphatase p,

HAT: Human Airway Trypsin-Like Protease

S2: Cellules (Schneider) de Drosophile

TP : Temprature Pice

x

A.A.: Acide Amin

HATs: ADN codant pour la partie soluble de la HAT

ADNc: ADN complmentaire

IMAC: Immobilized Mtal ion Affinity Chromatography

MuGB: 4-methylumbelliferyl-guanidinobenzoate

BOC-Phe-Ser-Arg-AMC: t-Butyloxycarbonyl- L-phenylalanyl- L-seryl- L-arginine- 4

methylcoumaryl- 7-amide

IQFP: Internally Quenched Fluorogenic Peptides

Abz: acide ortho-aminobenzoque

MES: 2-(N-morpholino) ethanesulfonic acid

Tris: Tris (hydroxymethyl) aminomethane

CAPS: N-Cyclohexyl-3-aminopropanesulfonic acid

PEFABLOC: 4-(2-Aminoethyl)-benzenesulfonyl fluoreide, hydrochloride

SBTI: Soybean trypsin inhibitor

ai-AT: Alpha-1 anti-trypsine

HAI-1: Hepatocyte growth factor activator inhibitor-1

PAI-1: Plasminogen activator inhibitor

C12-AP: Alpha-2 anti-plasmine

xi

ai-ACT: Alpha-1 anti-chymotrypsine

AT III: Anti-thrombine III

PA: Activateurs du plasminogne (plasminogen activator)

uPA: urokinase-type plasminogen activator

tPA: tissue-type plasminogen activator

uPAR: urokinase-type plasminogen activator recepor

XII

PROPRITS BIOCHIMIQUES, ENZYMATIQUES ET PHYSIOLOGIQUES DE LA HUMAN AIRWAY TRYPSIN-LIKE PROTEASE (HAT)

Par KELLY MAURICE

Mmoire Prsent la Facult de Mdecine En vue de l'obtention du grade de

Matre es" sciences (M.Sc)

RSUM

La fibrose kystique (FK) est caractrise par une inflammation pulmonaire chronique. Cette dernire est dfinie entre autres par une augmentation importante de la production de mucus. Celui-ci s'accumule dans les bronches empchant ainsi l'ventuel passage de l'air. De plus, le mucus forme une barrire protectrice pour les bactries qui va causer l'inflammation des poumons. La protease human airway trypsin-like (HAT) a t retrouve dans les expectorations de patients atteints d'asthme et bronchite chronique, pathologies similaires la FK. Elle semble jouer un rle dans l'inflammation car elle augmente entre autres la production de MUC5AC, protine composant majoritairement le mucus.

Le but de cette tude tait de synthtiser la HAT dans une conformation active dans un systme eucaryote pour tudier ses proprits biochimiques, enzymatiques ainsi que son potentiel pro-inflammatoire dans la ligne cellulaire pulmonaire Calu-3.

L'ADNc codant pour la partie soluble de la HAT a t insr dans le vecteur pMT-BiP V5-His. Cet ADN recombinant fut ensuite transfect dans les cellules de Drosophile Schneider 2 (S2). La HAT recombinante a par la suite t purifie et son activit protolytique teste avec un substrat fluorognique. Ses proprits biochimiques et enzymatiques ont t tudies ainsi que son effet sur la production d'IL-8 et sa dtection dans les expectorations de patients.

La HAT purifie tait enzymatiquement pure, donc l'effet protolytique observ avec le substrat fluorognique est d la protease. Les analyses de ses proprits biochimiques montrent que l'activit protolytique de la HAT est inhibe par un pH acide (

INTRODUCTION

1.1 Cibles pharmacologiques

La pharmacologie est une science pouvant tre dfinie comme tant l'tude de l'effet des

drogues ou des mdicaments sur les systmes d'un organisme vivant (RANG et DALE, 2007, p.

3). Ainsi, il est important pour un pharmacologue de dterminer, en tout premier lieu, une cible

physiologique dans le but d'tudier l'effet d'un mdicament ou d'une substance chimique ou

naturelle sur l'organisme. Des exemples de cibles tudies sont les rcepteurs coupls des

protines G (GPCR) qui sont des rcepteurs sept domaines transmembranaires. Prs de 30%

des mdicaments sur le march visent les GPCR cause de leurs implications dans diffrentes

pathologies (PANETTA et GREENWOOD, 2008). Nous retrouvons aussi un autre groupe

important de protines qui est la cible de mdicaments : celle des protases (e.g: des

mdicaments tel que le captopril qui est un inhibiteur de l'enzyme de conversion de

l'angiotensine (ECA) ou encore le saquinavir qui inhibe la protease virale du VIH). Il y a de plus

en plus de besoins pour le dveloppement de drogues contre les protases car ces dernires sont

impliques dans plusieurs maladies et pathologies dont l'inflammation pulmonaire chronique

(EDE, 2009).

1.2 L'Inflammation pulmonaire chronique

En temps normal, lorsqu'un pathogne pntre les voies respiratoires, les cellules

pithliales tapissant la surface pulmonaire produisent une cytokine appele Interleukine-8 (IL-

8). Cette dernire agit comme un signal d'appel aux granulocytes neutrophiles (neutrophiles)

qui sont des globules blancs (NATHAN, 2006). Ces cellules du systme immunitaire sont

1

impliques dans l'inflammation et protgent contre les pathognes (NATHAN, 2006). La

phagocytose par les neutrophiles est rendue possible grce deux mcanismes; d'une part par la

relche d'agents oxydants et de l'autre, par la relche de protines antibactriens ou

enzymatiques (WITKO-SARSAT et al, 2000). Dans le premier cas, les bactries sont englouties

dans des phagosomes qui leur tour vont fusionner avec un lysosome. L'oxidase NADPH

permet la production d'oxydants qui vont ensuite s'assembler dans le lysosome et engendrer la

formation de la superoxide dismutase (SOD). Cette enzyme va convertir la superoxide en

peroxide d'hydrogne (H2O2) afin de tuer les bactries contenues dans les phagosomes

(BABIOR, 1984 ; NATHAN, 1987). Dans le deuxime cas, les protases des neutrophiles telle

que l'lastase contrle la virulence des bactries en ciblant leurs protines virulentes

(WEINRAUCH et al, 2002).

Lors d'une inflammation pulmonaire chronique, la concentration trop leve d'oxydants

et de protases causent souvent plus de dommages aux tissus sains qu'aux pathognes. En effet,

un excs d'oxydants ou de protases gnrent une destruction importante des tissus matriciels

des poumons (GADEK, 1992). La fibrose kystique est l'une des maladies dans laquelle nous

observons une telle inflammation pulmonaire chronique.

2

Production d'IL-8

OjO'O.

Cellules pithliales

IL-8 lastase

Neutrophiles

Production de mucus

Destruction des pathognes (bactries) et de cellules saines

Figure 1 : Schmatisation simplifie de l'inflammation dans les poumons durant la FK

Sur le ce schma ci-dessus, nous voyons les cellules pithliales du poumon, infect par les

bactries, qui produisent la cytokine IL-8. Cette dernire est une molcule chimiotactique pour

les neutrophiles. Ces cellules vont donc se rendre au site d'inflammation suivant le signal de la

cytokine. Une fois rendus, les neutrophiles relchent une enzyme, l'lastase, qui participe la

destruction des bactries et gnre la production d'IL-8 et de mucus. Le mucus contribue

permettre aux poumons d'vacuer les bactries hors de l'organisme.

3

1.3 La Fibrose Kystique

La fibrose kystique (FK) est une maladie hrditaire mortelle qui affecte environ un

enfant sur 3 600 au pays, selon les donnes de la Fondation Canadienne de la Fibrose Kystique

(2009). Elle est la maladie hrditaire mortelle la plus frquente au Canada; c'est pour cela que

plusieurs chercheurs tentent de mieux comprendre les mcanismes impliqus dans cette

pathologie.

1.3.1 Cystic Fibrosis Transmembrane Conductance Regulator

Tel qu'illustr dans la figure 2, la surface de la cellule pithliale nous retrouvons un

canal appel le Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) (figure 2). Ce

dernier fait partie de la superfamille des protines ATP-binding cassette (ABC). Il est un

transporteur d'ions de chlorure (Cl-) (figure 2, formes rondes traversant le CFTR) se retrouvant

la surface apicale des cellules pithliales d'organes tel que le poumon, le pancras, le foie, les

glandes surrnales et les organes reproducteurs (LODISH et al, 2004; JACQUOT et al, 2008).

Dans le cas de notre tude, nous nous concentrerons principalement sur le poumon car il est

l'organe affect causant la mort de la majorit des patients FK (JACQUOT et al, 2008). Tel

qu'illustr dans la figure 2, le CFTR permet la sortie d'ions de chlorure dans le milieu

extracellulaire. Cela diminue l'absorption du sodium et cela va permettre une scrtion

importante de l'eau vers le mucus situ l'extrieur de la cellule. Ce processus est important

lors de l'inflammation, car l'eau permet l'hydratation du mucus (dans lequel sont contenus les

pathognes) accumul la surface apicale des cellules pithliales et facilite ainsi son vacuation

des poumons par le mouvement des cils se trouvant la surface des cellules (figure 3) (SLEIGH

tal, 1988).

4

Figure 2: Le canal CFTR la surface de l'pithlium

Le canal du CFTR se situe la surface apicale de la membrane des cellules pithliales de

diffrents tissus incluant les poumons. Ce canal permet la circulation d'ions chlorure (Cl", en

bleu) l'intrieur et hors de la cellule. Lors de l'inflammation, il y a plus de Cl" qui sort de la

cellule ce qui cre une circulation de l'eau vers l'extrieur de la cellule et permet l'hydratation du

mucus et facilite ainsi son vacuation (Genetic Science Learning Center, Septembre 2009).

5

Voie Respiratoire Normale

ffff \ Homostasie du ^ J liquide prciliaire

Clairance du Mucus

Schma par Frizzell, Nature 2004

Figure 3 : vacuation du mucus par les cellules pithliales cilies

Lors d'une inflammation, le mucus hydrat est vacu par l'entremise du mouvement de cils des

cellules pithliales. Ce mouvement des cils est rgul par la balance entre l'absorption des ions

de sodium (Na+) par le epithelium sodium channel (ENaC) et la scrtion des anions HCO3" par

le CFTR (FRIZZELL 2004).

6

1.3.2 La pathophysiologie de la fibrose kystique

En 1989, Tsui, Riordan et leurs collgues dcouvrent l'lment qui est la source de la

maladie de la FK (TSUI, RIORDAN et al, 1989). Ils ont trouv la premire mutation du gne

codant pour la protine CFTR (cystic fibrosis transmembrane regulator) qui caractrise la FK.

Cette mutation gnre la production d'un CFTR dfectueux (LODISH et al, 2004). Depuis, plus

de 1500 mutations ont t identifies; certaines diminuent l'expression du CFTR et d'autres le

rendent dfectueux (NICHOLS et al, 2007). Ces mutations sont classes en cinq groupes

spcifiques (figure 4): (1) un arrt de la transcription du canal, (2) un mauvais repliement de

celui-ci, (3) un dfaut de l'ouverture du CFTR, (4) une slectivit anormale, et finalement, (5)

une diminution de la transcription du canal (TSUI, 1992). La mutation la plus rpandue est la

dltion du rsidu phnylalanine en position 508 (AF508) qui cause une mauvaise conformation

de la protine. Cette dernire est partiellement fonctionnelle, mais puisque qu'elle est mal

replie, elle est reconnue par les chaperonnes qui vont l'entraner vers le protasome pour y tre

dtruite (MAITRA, SHAW et al, 2001). Par consquent, dans le cas de cette mutation, le CFTR

ne peut migrer la surface apicale des cellules et cause un dfaut important du transport des

anions la surface de l'epithelium. Ainsi donc, il y a une diminution du volume du liquide de

scrtion la surface apicale des cellules pithliales (NICHOLS et al, 2007). En absence de ce

liquide de scrtion, les cils des cellules ne battent plus et donc, le mucus qui s'accumule la

surface apicale est dshydrat et ne peut tre vacu (figure 5) (WILSON & FUDENBERG,

1977). Par consquent, il y a la formation d'un environnement propice aux bactries. Le mucus

s'accumule et forme une barrire protectrice autour des pathognes empchant ainsi l'lastase

d'atteindre les bactries pour les dtruire (YOON et al, 2002). Cela cause une inflammation

7

chronique car les pathognes sont encore prsents dans l'organisme et tant et aussi longtemps

qu'il y a prsence de ces bactries, il y a plus de neutrophiles qui viennent au site d'infection.

Ces dernires relchent l'lastase qui son tour gnre la production de plus de mucus et d'IL-8

crant ainsi un cercle vicieux amenant l'obstruction des bronches par le mucus et une

augmentation de l'inflammation par les pathognes (FISCHER et VOYNOW, 2000; CHEN et al,

2004).

8

Medscape* www.medscape.com

Normal III IV

pro

HQpt&4itt,L % tn p tv s>j ^ k

Fibrose Kystique OAGs $

Chemukines, } K rowth factots '

1 Dpltion du x A ^*t V * uepienon au

rrff%%^Ty liquide prciliaire

Ni'utrophils

Elastasv

Mut us t !!

\

3 > v Accumulation du mucus

Inflammation

Infections

Schma par Fnzzel, Nature 2004

Figure 5: Mauvais fonctionnement des cils des cellules pithliales

La dshydratation du mucus, par un mcanisme inconnu, empche le fonctionnement des cils

(MEADOWS, 2009). Ces derniers ne peuvent vacuer le mucus qui s'accumule la surface de

l'pithlium. Puisque le mucus n'est pas vacu, les bactries qui y sont compris sont par

consquent toujours prsentes dans l'organisme et cela provoque l'appel de plus de neutrophiles

au site d'inflammation, et la relche de plus d'lastase qui n'arrive pas atteindre les bactries

protges par la couche de mucus qui s'accumule (YOON et al, 2002). Tout cela engendre un

cercle vicieux et donc une inflammation continue.

10

Avant que les neutrophiles n'arrivent sur le site de l'inflammation, tel que mentionn plus

tt, les cellules pithliales produisent de 1TL-8 qui va envoyer un signal ces globules blancs.

La question qui se pose est la suivante : par quels mcanismes les cellules pithliales produisent

la cytokine dans le poumon FK? La rponse cette question est importante car c'est cette tape

qui dclenche le processus inflammatoire qui va permettre l'ventuelle infiltration de

neutrophiles dans les poumons. Une des familles de molcules implique dans la libration de

1TL-8 est celle des protases. L'lastase, la cathpsine G et la protinase-3 sont des protases

serine produites par les neutrophiles (Pham 2006). Plusieurs articles sur leur implication dans la

dtrioration respiratoire de la FK ont t publis ces dernires annes (Rubio et al 2004;

Voynow et al 2008). Vu l'importance de ces protases dans l'inflammation chronique, nous nous

sommes demands s'il y avait des protases dans les cellules pithliales qui pourraient tre des

candidates potentielles pouvant aider mieux comprendre ce qui amne la cellule dclencher le

processus inflammatoire. Nous nous sommes donc concentrs sur une famille de protases

serine qui commence tre de plus en plus tudie, soit les protases serine transmembranaire

de type II.

1.4 La famille des protases serine transmembranaire de Type II

Les protases serine transmembranaire de type II (TTSPs) forment une famille

d'enzymes implique dans le dveloppement cellulaire ainsi que dans certaines

pathophysiologies (SZABO et BUGGE, 2008). Elles sont situes la surface de la cellule o

elles peuvent interagir avec d'autres protines se trouvant galement la surface de la cellule, ou

encore avec des protines solubles, des lments composant la matrice cellulaire et des protines

11

situes sur les cellules adjacentes (HOOPER et al, 2001). Le premier TTSP dcouvert a t

l'enteropeptidase, il y a plus d'une centaine d'anne, mais ce n'est que rcemment que plusieurs

autres membres ont t identifis (SZABO et BUGGE, 2008). Ces membres ont t catgoriss

en quatre sous-familles (figure 6): (1) HAT/DESC, (2) Hepsin/TMPRSS, (3) Maptristase et (4)

Corin (SZABO et al, 2003). Ce qui diffrencie ces enzymes des autres protases serine est que

leur queue N-terminale est cytoplasmique tandis que leur partie C-terminal est extracellulaire

(d'o le qualificatif de type II ). De plus, elles ont d'autres caractristiques communes. Elles

ont toutes un domaine catalytique, un domaine transmembranaire leur permettant d'tre ancres

la membrane plasmique, un court domaine cytoplasmique et finalement un ou plusieurs

domaines modulateurs liant le domaine transmembranaire au domaine catalytique (HOOPER et

al, 2001). Les domaines modulateurs forment la queue cytoplasmique qui caractrise chacune

des sous-familles. Celle de HAT/DESC constitue le groupe qui contient la plus petite queue

cytoplasmique car elle n'est compose que d'un seul domaine, soit le domaine SEA (sea urchin

sperm protein, enteropeptidase, agrin) (SZABO et BUGGE, 2008). Dans le cas de la sous-

famille Hepsin/TMPRSS, chacun des membres contient un domaine riche en cystine appel

Single Scavenger Receptor Cys-rich (SRCR) (SZABO et BUGGE, 2008). Les protases

TMPRSS2-4 et MSPL ont en plus un domaine LDLa (low density lipoprotein receptor class A)

qui prcde le domaine SRCR (SZABO et BUGGE, 2008). De son ct, l'enteropeptidase est

compose dans l'ordre des domaines SEA, SRCR, LDLa, CUB (Cls/Clr, urchin embryonic

growth factor and bone morphogenic protein-1) et MAM (meprin, A5 antigen, and receptor

protein phosphatase fi) (SZABO et BUGGE, 2008). Ensuite, il y a la sous-famille des

matriptases qui est caractrise par un domaine SEA, deux domaines CUB et trois ou quatres

domaines LDLa (SZABO et BUGGE, 2008). Finalement, la dernire sous-famille ne comprenant

12

que la corine diffre des autres TTSP en ce que sa rgion extracellulaire est compos de deux

domaines appels frizzled (friss), huit domaines LDLa et un domaine SRCR. Les domaines

semblent importants dans l'activation et la relche de certaines protases. Par exemple, dans le

domaine SEA il y a un clivage aprs l'acide amin Glyl49 permettant l'ventuelle activation du

site de clivage de la matriptase (OBERST et al, 2003).

Malgr le fait que nous sachions quel endroit ces protases sont clives pour tre

actives, le mcanisme d'activation n'est toujours pas connu. Ce qui est rapport est que

l'activit catalytique dpend de trois acides amins qui forment ce qu'on appelle la triade

catalytique; ce sont l'histidine (H), l'aspartate (D) et la serine (S) (HOOPER et al, 2001). Ils sont

prsents dans les motifs conservs de cette famille de protease (HOOPER et al, 2001). De plus,

nous savons que certaines de ces enzymes sont retrouves sous forme soluble, telles que la HAT,

TMPRSS2 et matriptase (YASUOKA et al, 1997 ; AFAR et al, 2001; LIN et al, 1999).

Une fois actives, les protases jouent diffrents rles dans le dveloppement et

l'homostasie des tissus, mais galement dans certaines pathologies. Dans l'intestin, plus

prcisment dans le duodnum, l'enteropeptidase a pour rle d'activer le trypsinogne en

trypsine qui a son tour active d'autres zymognes importants lors de la digestion (Maroux et al

1971). En ce qui trait au bon fonctionnement auditif, l'hepsine (chez la souris) et TMPRSS3

(chez l'humain) sont indispensables (GUIPPONI et al, 2007). De plus, l'hepsine et la matriptase

semblent jouer un rle dans le cancer car elles sont toutes deux surexprimes, respectivement,

dans le cancer de la prostate et dans le cancer du sein (CHEN et al, 2003; BENAUD et al, 2005).

Finalement, l'absence de la protease corin cause de l'hypertension et de l'hypertrophie cardiaque

chez les souris (CHAN et al, 2004).

13

Dans le cadre de notre recherche, notre attention s'est porte sur la sous-famille

HAT/DESC 1 dans laquelle on retrouve la Human Airway Trypsin-Like Protease (HAT),

puisqu'elle semble tre implique dans le dveloppement et dans la pathologie pulmonaire.

14

HAT/DESC subfamily

HAT N-jjJJBm^:;

DESC1

DESCZ

DESC3

0ESC4

HATL3

HATL4

HATL5

Matriptase subfamily

Matriptase

Matrlptase-2

Matriptase-3 I

Polyserase-1

Corin subfamily

Corin (LRP4)

Hepsin/TMPRSS subfamily

TMPRSS2

TMPRSS3

TMPRSS4

MSPL N

TMPRSSS (Spinesln)

Hepsin

Enteropeptidase

[1 Ttansmembrane domain

% SR domain

^ LDLRA domain

HhfflHBK: H I S H I i " i l l l W

M M B - W N jBp-HBR% '

N * } S B T - K

"-tiSBLMV-

N jj-^^^B

H-WSS-N ^~^~*4 t^^^^^^^^a

H ! * M B I

IMMMHBK

HMHHKI

4MHr BJ||.

mt

N | | - 4 H H H H * 1 H K H P

-iH*> ^

II"* MBfc-NHHM HB.:

! h * MB*. "lh* HB|. H H H N~il"S5B^^

CUB domain

] ^ ^ 9 SEA domain

Frizzlad domain

c

c

c

c

c

c

C

C

C

c

c

c

c

c

c

c

c

c

Ha*

-4M ^-W'

MAM domain

~SBJ| s Sarlna protease domain (activa)

Sarlna protease domain (Inactiva)

Figure 6: Les Sous-familles des TTSP

15

1.5 Human Airway Trypsin-like protease (HAT)

La protease HAT a t dtecte pour la premire fois dans les expectorations (scrtions

provenant des bronches) de patients asthmatiques et ceux atteints de bronchite chronique

(YASUOKA et al, 1997), qui comme la FK sont aussi caractrises par une inflammation

pulmonaire chronique menant une destruction importante des tissus du poumon (SENIOR ET

ANTHONISEN, 1998). L'quipe de Takahashi s'est ensuite charge de dterminer la

localisation de l'enzyme au niveau respiratoire et les rsultats de leur recherche dmontrent que

la HAT est principalement retrouve dans les voies respiratoires et plus spcifiquement la

surface apicale (cytoplasmique et sous-cilie) des cellules pithliales de la trache

(TAKAHASHI et al, 2001). Rcemment, la protease a galement t dtecte dans les

kratinocytes, soit des cellules pithliales de la peau (IWAKIRI et al, 2004).

La HAT est compose de quatre domaines diffrents (figure 7). Le premier tant le

domaine cytoplasmique, suivi du domaine transmembranaire qui lui est li au domaine SEA

(dont on ne connat toujours pas le rle), et finalement le domaine catalytique qui comprend

l'activit protolytique de la forme soluble de l'enzyme. Cette protease est retrouve dans sa

forme zymogne (forme pleine longueur non-clive) un poids molculaire thorique de 48kDa;

sa forme mature (active) qui ne comprend que le domaine catalytique a un poids d'environ

28kDa (YASUOKA et al, 1997). Il existe peu d'information concernant la biosynthse de la

HAT et sur le rle des trois premiers domaines.

Depuis sa dcouverte en 1997, prs d'une quinzaine d'articles ont t publis sur la HAT.

De ces publications, nous pouvons ressortir cinq rles (patho)-physiologiques. En premier lieu,

Chokki et ses collgues ont dmontr que la protease augmente l'expression du gne MUC5AC

16

et MUC2 (CHOKKI et al, 2005). Les protines MUC5AC et MUC2 sont des composantes du

mucus. Par la suite, Iwakiri et son quipe ont tabli un lien entre la HAT et l'augmentation de la

production de la cytokine IL-8 dans les cellules de la peau (IWAKIRI et al, 2004). De plus,

l'enzyme semble augmenter la prolifration des cellules pithliales bronchiques selon les

recherches effectues par Matshumina et ses collgues (MATSUSHIMA et al, 2005). Ces trois

actions gnres par la protease se font par l'activation d'une protine G couple un rcepteur

(GPCR) appel le PAR-2 comme nous pouvons le voir la figure 8. Cette anne, Bttcher et ses

collaborateurs on dmontr que la partie transmembranaire de la HAT a la proprit d'activer

l'hmagglutinine du virus de l'influenza nouvellement synthtise par la cellule ainsi que celle

provenant des virions (BTTCHER et al, 2010). Finalement, HAT empcherait la migration de

cellules inflammatoires (leukocytes) et celles des cellules pithliales impliques dans la

rparation des tissus; le tout rsulte de la dgradation du rcepteur l'urokinase (uPAR) par la

protease (BEAUFORT et al, 2007).

Tous ces effets in vitro de la HAT sur les substrats potentiels mentionns ci-haut sont

observs des concentrations situes entre 5 - 4 0 nM, soit les mmes concentrations dtectes

dans les expectorations de patients atteints de maladies inflammatoires pulmonaires

(BEAUFORT et al, 2007).

17

HfO N *

M m H

(0 00 H

00 H

1-20 Domaine Cytoplasmique

21-43 Partie Transmembranaire

44-153 Domaine SEA

186 - 418 Domaine Catalytique

Figure 7: Schmatisation de la Human Airway Trypsin-like protease

18

Augmente la production de MUC5AC dans les cellules bronchiques pithliales (Chokki eto/2004j

Augmente la production d'IL-8 dans les keratinocytes (Iwakiri et al 2004)

Augmente la prolifration cellulaire (Matsushima tal 2005)

Figure 8: Voies de Signalisation actives par la HAT

Lorsqu'elle est active, la HAT sous sa forme soluble, augmente la production de la mucine

MUC5AC dans les cellules bronchiques pithliales (CHOKKI et al, 2004), la production d'IL-8

dans les cellules de la peau (IWAKIRI et al, 2004) et la prolifration cellulaire (MATSUSHIMA

et al, 2005). Tout cela se produit par l'entremise du rcepteur PAR-2, un GPCR, activ par la

protease.

I Fixation du ligand interne

c = > >

Clivage Protolytique

19

1.6 Hypothse

Les protases sont des cibles pharmacologiques importantes d leurs implications dans

diffrentes pathologies, entre autres l'inflammation pulmonaire manifeste dans une maladie

telle que la FK. La HAT est une candidate potentielle pour l'tude sur la FK cause de ces

diffrentes actions sur des substrats jouant des rles importants dans l'inflammation (MUC5AC,

uPAR, IL-8). De plus, le fait qu'elle semble tre implique dans la pathologie de l'asthme et la

bronchite chronique est pertinent car ces deux maladies sont comparables la FK (remaniement

des tissus bronchiques lors de l'inflammation).

Ces donnes dcoulant des publications sur la HAT nous amnent conclure que cette

protease possde des caractristiques biochimiques, enzymatiques et physiologiques qui

pourraient jouer un rle important dans la maladie de la FK. Dans le but d'explorer la validit de

cette hypothse nous avons en premier lieu exprim et purifi la HAT recombinante. Par la suite

nous avons utilis la HAT recombinante afin d'tudier ses proprits biochimiques et

enzymatiques. Enfin, nous avons test l'effet de la HAT sur la production d'IL-8 sur les Calu-3,

des cellules modles de FK.

20

MATRIEL ET MTHODES

2.1 Matriel

Le substrat methoxysuccinyl alanyl-analyl-prolyl-valine />-nitroanilide (MeO-SAAPV-p-

NA), EDTA, le TNF-alpha, ortho -phenanthroline et l'hparine proviennent de Sigma-Aldrich

(Oakville, Canada); l'lastase provient d'Elastin Products Company (Owensville, MO, USA);

alpha-1 anti-trypsin (al-AT), Plasminogen Activator Inhibitor-1 (PAI-1), alpha-2 anti-plasmin

(a2-AP), alpha-1 anti-chymotrypsine (al-ACT), anti-thrombine III (ATIII) ont t achets de

Calbiochem (Darmstadt, Allemagne); le vecteur pMT-BiP V5-His, le systme d'expression DES

(Drosophila Inducible/Secreted Expression System), Cellules Schneider 2 (S2), le milieu des

cellules S2 (Schneider's Drosophila Mdium), la blasticidine, l'anticorps anti-V5 sont

d'Invitrogen (Burlington, ON, Canada) ; Hepatocyte growth factor activator inhibitor-1 (HAI-1),

kit d'ELISA Quantikine IL-8, aprotinin, leupeptin, AEBSF, soybean trypsin inhibitor, pepstatin,

bestatin et E-64 proviennent de Roche Diagnostics (Laval, QC, Canada); les substrats

fluorogniques Boc-Phe-Ser-Arg-AMC, Boc-Gln-Ala-Arg-AMC sont de Bachem (Torrance,

CA, USA); tous les kit Qiagen ont achets de Qiagen (Mississauga, ON, Canada); Sheep HRP

conjugated anti-mouse Ig et les colonnes de Ni et benzamidine sont de GE Healthcare (Baie

d'Urf, QC, Canada) et les amorces Q45KpnUp

5'CGCGGTACCTCAAAAATCTTACTTTTATAGG3' et HATRevEcoRI

3'GAATTCCGATCCCAGTTTGTTGCCTAAT 5' pour la construction de la HAT soluble

proviennent de Integrated DNA Technologies (Coralville, IA, USA). Les enzymes de restrictions

Kpnl et EcoRI sont de New England Biolabs (Pickering, ON, Canada). Tous les peptides Abz

IQF avec le groupement Tyr(3-N02) proviennent de GL Biochem (Shanghai, Chine). L'ADN

complmentaire de la HAT fut fourni par Genecopoeia (Rockville, MD, USA).

21

2.2 Culture Cellulaire

La ligne cellulaire S2 (Schneider 2), utilise pour l'expression de la HAT recombinante,

a t isole d'une culture primaire d'embryons de Drosophile Melanogaster. Les S2 provenaient

de cellules de type macrophagique. Elles ont t maintenues temprature de la pice (TP) dans

le milieu Schneider (semi-adhrente dans un flacon pour culture cellulaire et en suspension dans

un flacon-agitateur) et ce, sans CO2. Sauf lorsqu'autrement mentionn, le milieu contenait 10%

FBS, 2 mM L-glutamine 50 IU/mL pnicilline, 50 ug/mL streptomycine, et 20u.g/mL blasticidine

(SCHNEIDER, 1972).

Toutes les autres tudes cellulaires ont t ralises avec les cellules Calu-3. Les Calu-3

taient des cellules d'adnocarcinome tires de l'pithlium bronchique humain (Foster et al

2000). Le milieu DMEM fut utilis pour les Calu-3. ce milieu a t rajout 10% FBS, 1%

glutamine, 1% fungizone, 1 mM de pyruvate de sodium, 0.1 mM des acides amins essentiels,

100 U/mL de pnicilline ainsi que 100 u.g/mL de streptomycine. Les cellules ont t maintenues

37C en prsence de 5% CO2. Les Calu-3 ont t utilises pour les tudes cellulaires dans la FK

car entre autres, elles exprimaient le canal CFTR la surface apicale (FOSTER et al, 2000). Une

autre caractristique qui faisait de ces cellules des cellules de choix a t leur habilet former

une monocouche tanche en culture air-liquide caractrise par la prsence de jonctions

occlusives ( tight junctions ) entre les cellules. Les Calu-3 ont t cultives dans des plaques

inserts (Modle Costar 3516, Corning Inc, Corning, NY, USA) de six puits pour faciliter nos

expriences. L'avantage de ces plaques tait que les cellules poussaient sur la membrane

couvrant le fond de l'insert o elles formaient une monocouche. Le milieu ajout sous l'insert

nourrissait les cellules grce aux pores qui se trouvaient dans l'insert. Lorsque la monocouche de

cellules tait forme, les jonctions occlusives entre les cellules ne permettaient pas

22

l'accumulation du milieu au niveau apical de la cellule, de sorte que toute scrtion rcolte au

niveau apical tait le fruit d'une rgulation dfinie par la cellule.

2.3 Construction plasmidique de la HAT

Dans le but d'exprimer la protease, nous avons choisi la squence codant pour la partie

soluble de la HAT (HATs), soit partir de l'acide amin (a.a) Q45 jusqu' la fin. Dans le but

d'obtenir HATs, nous avons utilis les amorces suivantes: Q45KpnUp

5'CGCGGTACCTCAAAAATCTTACTTTTATAGG3' et HATRevEcoRI

3'GAATTCCGATCCCAGTTTGTTGCCTAAT 5'1 qui contenaient des sites de restriction (Kpn

en 5' et EcoRI en 3'). Ensuite, nous avons amplifi cette partie codante par PCR dans un

chantillon comprenant 0.1 ug d'ADN complmentaire (ADNc) de la HAT, 0.4mM dNTP,

20mM de chaque amorce, IX de tampon et la polymrase. Par la suite, l'ADN de HATs a t

purifi en utilisant le kit de purification Qiagen pour retirer les impurets (ADNc). Ensuite,

HATs a t mis sur gel d'agarose afin de vrifier si elle correspondait au bon poids molculaire

(1122 nuclotides). Aprs avoir ligu HATs et le vecteur pour obtenir le recombinant HAT

(rHAT), les bactries DH5a ont t transforms avec ce dernier afin d'en obtenir une plus grande

quantit. Pour ce faire, 5u.L de rHAT a t ajout 50uL de bactries et mis sur glace pendant 5

minutes, suivi de 30 secondes d'incubation 42C pour ensuite refroidir le tout sur glace pendant

2 minutes. Finalement, le cocktail a t incub une heure 37C avec agitation dans 200uL de

milieu LB (Lysogeny broth) sans antibiotique. Aprs cette heure, les bactries ont t tales

dans un ptri d'agar qui inclut un antibiotique (carbnicilline) afin de ne laisser pousser que les

1 II est noter que le stop se trouvant la fin de la protine a t retir. Un stop suivant immdiatement l'pitope His a t ajout.

23

bactries ayant le rHAT. Aprs seize heures d'incubation, le recombinant a t extrait des

bactries l'aide du kit d'extraction de plasmide Qiagen en suivant les instructions du

manufacturier Qiagen.

24

Hfl f\Ht

m m r-l

10 eo H

ce H

HAT-V5-His

N -terminal C -terminal

Figure 9: Construction de la HAT recombinante

Pour la construction du recombinant HAT (rHAT) seuls les domaines SEA et catalytiques

(HATs) ont t conservs pour faciliter l'expression et la purification de l'enzyme. HATs a

ensuite t insre entre les sites de restriction Kpn et EcoRI dans le vecteur d'expression pMT-

BiP V5-His qui contenait deux pitopes, soit V5 (pour les immuno-buvardages) suivi de His

(pour la purification de la protease) qui ont t placs en C-terminal de la protine.

25

2.4 Expression plasmidique de la HAT

Une fois la rHAT obtenue, elle a t transfecte dans les cellules Drosophile Schneider 2

(S2). Le vecteur a permis d'avoir deux types de lignes cellulaires S2 : les cellules dites

transitoires et celles dites stables. Les lignes stables ont pour caractristique l'insertion du gne

recombinant dans le gnome de la cellule hte ( l'aide d'un cofacteur, dans ce cas-ci, pCoBlast)

ce qui a permis d'avoir des cellules produisant long terme la protine recombinante. Cette

ligne a pris un minimum de deux semaines pour pouvoir engendrer que des cellules produisant

la rHAT. Quant aux lignes transitoires, le plasmide n'est point insr dans le gnome. Cette

ligne permet de savoir si la protine est exprime, et ce, deux jours aprs la transfection (versus

deux semaines pour les lignes stables). Afin d'exprimer la protine recombinante, la premire

tape a t de transfecter les S2 de manire transitoire (dans un milieu sans blasticidine). Cette

transfection a permis de confirmer que la protine tait exprime dans ce systme. Aprs

transfection, l'expression de la protine a t induite en ajoutant le sulfate de cuivre (CuSOzt)

une concentration finale de 500uM. L'expression a t ensuite vrifie par immuno-buvardage

en utilisant un anticorps (anti-V5) contre l'pitope V5. Aprs avoir confirm que l'enzyme est

exprime dans le systme cellulaire S2, la cration de lignes stables a pu commencer. Les

cellules ont t transfectees avec 19ug de l'ADN recombinant et lu.g du vecteur de slection

pCoblast en utilisant le kit de transfection calcium phosphate d'Invitrogen. Le milieu a t

ensuite chang aprs 16h pour retirer le phosphate de calcium et ajouter du milieu frais. Les

cellules incubes ont pouss pendant deux jours sans antibiotique. Par la suite, la blasticidine a

t ajoute au milieu et les cellules ont t incubes pendant deux semaines. Finalement, elles

ont t inocules dans un IL de milieu pendant 3 jours. L'expression de la rHAT a t induite

par le sulfate de cuivre, CuS04 (concentration finale de 500uM).

26

Vecteur d" Expression Culture Cellulaire

Ligne Transitoire Expression Rapide (2

7 |ours)

Pousse TP Ne requiert pas de

co2 Pousse trs bien dans un milieu sans senim

Co-Transfection avec le vecteur de slection

pCoBlast

Schma provenant du manuel DES Expression System d'Invitrogen

Figure 10: Schmatisation de la transfection des cellules S2 par rHAT

Tel qu'illustr, la premire tape est la construction du recombinant qui peut ensuite tre

transfect dans les cellules de deux manires : (1) Transitoire, ce qui permet de savoir deux jours

aprs la transfection s'il y a expression de la HAT recombinante et (2) Stable, ce qui gnre une

grande production de la protease.

27

2.5 Purification de la HAT

Le milieu des cellules a t centrifug 6 000 g pendant 15 minutes pour pouvoir y

retirer les cellules. Ensuite, le milieu a t tamponn avec 20mM de phosphate de sodium et

30mM d'imidazole pH 7.4 pendant une nuit 4C. Par la suite, le milieu a t nouveau

centrifug et filtr pour pouvoir le passer sur une colonne d'affinit pour la purification de

l'enzyme.

2.5.1 Purification par IMAC (Immobilized mtal ion affinity chromatography)

IMAC est une technique de purification qui consistait faire passer sur une colonne une

protine ayant un acide amin qui a une affinit pour des ions de mtal. Une colonne de 5 mL, de

nickel, a t utilise pour la purification de le rhHAT. L'pitope histidine a t dans notre cas

l'acide amin qui s'est li aux ions de nickel et ainsi a permis la protine recombinante de

rester accrocher la colonne tandis que toute autre protine n'ayant pas de motif poly-histidine

ou ne pouvant pas se lier aux ions du nickel n'ont pas t retenue par la colonne.

Avant chaque purification, il y a eu nettoyage de la colonne avec 15mL d'eau distille.

Ensuite, la colonne a t quilibre avec 25mL de tampon de lavage (20mM phosphate de

sodium, 30mM imidazole, 0.5M NaCl, pH 7.4) pour finalement injecter l'chantillon. Aprs

avoir tout inject, la colonne a t lave avec le tampon de lavage (50mL) et finalement la

protine a t lue avec 30mL du tampon d'lution (20mM phosphate de sodium, 0.5M

imidazole, 125mM NaCl, pH 7.4) en fraction de 2mL.2 L'imidazole a t utilis pour luer la

2 Fait important retenir pour la rHAT : cette dernire requiert une nouvelle colonne chaque purification,

car sinon la protine ne liera pas la colonne.

28

protease; mais il a fallu ensuite dialyser cet chantillon pour le retirer car il inhibe l'activit de la

HAT. Le tampon de dialyse utilis tait compos de 10% glycrol, 250mM NaCl et 50mM Tris-

HC1, pH 9.0.

2.5.2 Purification par Colonne d'Affinit Benzamidine

Dans le but d'liminer la forme non-active de l'enzyme dans l'chantillon purifi par

IMAC ainsi que toute autre protine non-dsire, le recombinant a t purifi une deuxime fois

par une colonne d'affinit contenant de la benzamidine, un inhibiteur de protases serine

Bille de Sepharose

M H 2

Ligand Benzamidine

Tel qu'illustr ci-dessus, le ligand benzamidine tait li de faon covalente des billes de

Sepharose 6B. Seules les protases serine actives pouvaient se lier au ligand car ce dernier ne

lie que le domaine catalytique des protases. Une fois lies, les protines ont t lues par pH

acide (diminution de pH 7.4 2) en fractions de 500uL. Dans chaque tube rcoltant les protines

lues se retrouvait 30uL de tampon Hepes ImM, pH 9. Le pH final tait de 9.

29

2.6 Test d'activit de la HAT

Aprs avoir purifi l'enzyme, des tests ont t raliss pour vrifier si elle tait active. Le

substrat fluorognique BOC-Phe-Ser-Arg-AMC qui a t dmontr comme tant son meilleur

substrat tri-peptidique (YASUOKA et al, 1997) a t utilis une concentration finale de 50 uM

dans un tampon de lOOmM Tris, 5mg/ml BSA, pH 9. Le groupe contrle ne contenait que le

tampon et le substrat afin de dterminer la fluorescence de base mise par le substrat et ainsi

savoir si la fluorescence mise en prsence de la protease a augment. L'activit a t teste

des longueurs d'ondes d'excitation et d'mission de 360nm et 460nm respectivement.

2.7 Titration de la HAT

Pour dterminer la concentration d'enzyme active purifie, nous avons utilis le titrant 4-

methylumbelliferyl-guanidinobenzoate (MuGB ), un inhibiteur irrversible de protases serine

se liant au site actif des protases, une concentration finale de lOOnM. Cette exprience a t

ralise une longueur d'onde d'excitation de 365nm et une longueur d'onde d'mission de

445nm une sensibilit de 65. La diffrence de fluorescence entre le groupe contrle (tampon

Tris-HCl, pH 9, MuGB) et l'chantillon (tampon Tris-HCl, pH 9, MuGB, HAT) nous donnait

une estimation de la concentration d'enzyme active dans l'chantillon. Les quations qui suivent

nous ont permis de faire cette estimation.

(1) Y2 = Yi + (((-0,25)*(pente))/1000) correction de temps environ de 15 sec.

(Z) t)UrSt Y enzyme " I contrle

30

(3) [HAT] = (Burst/14,928)/(VHAT/100) pente de la courbe standard quantit de MuGB

permet de donner une quantit de produit libr

Yi reprsente la valeur de la fluorescence lorsque X =0, tandis que Y2 correspond la vraie

valeur de Y x=0, soit celle corrige. Puisque la pente est exprime en mF.U, elle a t divise

par 1000 pour l'exprimer en F.U (unit de fluorescence/ fluorescence unit). Le burst

correspond la diffrence de fluorescence entre le contrle et l'chantillon exprimentale. Le

volume de la HAT (VHAT) est la quantit (en ul) de l'chantillon HAT utilis pour l'essai.

2.8 tudes des Proprits Biochimiques de la HAT

2.8.1 Dtermination du pH optimal de la HAT

Afin d'tudier quel pH la protine conservait une activit optimale, nous avons travaill

avec les tampons MES lOOmM (pour les pH situs entre 5 et7), Tris lOOmM (pH entre 7 et 9) et

CAPS lOOmM (pH entre 9 et 11). Chacun des tampons contenaient 500u.g/mL de BSA. Le

substrat fluorognique utilis durant ces essais a t le Boc-Gln-Ala-Arg-AMC des longueurs

d'ondes d'excitation et d'mission de 360nm et 460nm, respectivement. Ce substrat a t

prfr au BOC-Phe-Ser-Arg, car le taux de fluorescence est trop lev (plus de 1x10

mF.U./min) entre HAT et ce dernier pouvant donc fausser les donnes sur le pH optimal. Au lieu

de diminuer la concentration de Boc-Phe-Ser-Arg, nous avons prfr utilis un substrat aux

mmes concentrations testes (50uM final) mais dont la vitesse de relche d'AMC est situ entre

5xl05 - lxlO6 mF.U./min) (BLIVEAU et al, 2009). Finalement, la vitesse de relche d'AMC

31

pour les diffrentes valeurs de pH a t calcule en comparant la vitesse maximale observe pour

un mme tampon.

2.8.2 Inhibiteurs synthtiques de protases

La HAT (2nM) a t incube avec des inhibiteurs synthtiques de protases dans un

tampon Tris (pH 9, 37C) comprenant 500pg/mL BSA. Les concentrations finales pour les

inhibiteurs furent les suivantes: Bestatin, 74uM; E-64, 28uM; Leupeptin, luM; Pepstatin, luM;

O-Phenanthroline, ImM; PEFABLOC, 4mM; EDTA, ImM; Aprotinin, 0.3uM; Soybean Trypsin

Inhibitor (SBTI), 5uM. L'activit rsiduelle a t mesure avec 50uM Boc-Gln-Ala-Arg-AMC

en comparant l'activit de l'enzyme dans le groupe contrle (sans inhibiteur).

2.8.3 Inhibiteurs endognes de protease serine

Des inhibiteurs endognes de protases serines ont t tests contre la HAT afin de

dterminer s'il y en avait un ou plus qui pouvaient l'inhiber de manire efficace. Les inhibiteurs

alpha 1-Antitrypsine, alpha 1-Anti-Chymotrypsine, Antithrombine III (pr-incub avec 50 ug/mL

hparine), Plasminogen Activator Inihibitor-1 et alpha 2 Anti-plasmine ont donc t incubs

avec 2 nM HAT une concentration finale de 250nM. L'enzyme a t incube avec l'inhibiteur

pendant dix minutes dans un tampon Tris, pH 9 qui contenait 500ug/mL BSA. Ensuite, l'activit

rsiduelle a t mesure avec 50uM Boc-Gln-Ala-Arg-AMC en comparant les rsultats d'activit

de l'chantillon avec celui du contrle (sans inhibiteur).

2.9 tudes des proprits enzymatiques de la HAT

32

2.9.1 Nomenclature de Schechter et Berger

Selon cette nomenclature, une protine contient un site nomm site de clivage , c'est-

-dire, site o une enzyme peut cliver entre deux acides amins. L'acide amin pour lequel le site

de clivage se trouve du ct C-terminal est appel PI ce qui dsigne la position 1 (figure 11)

et l'acide amin prcdent est donc P2, prcd par P3 et ainsi de suite ; tandis que l'acide amin

pour lequel le site de clivage se trouve en N-terminal est nomm PI' et ce qui suit est dsign

P2', P3 \ etc. Suivant cette nomenclature, des tests ont t effectus avec des peptides de huit

acides amins ayant une arginine en PI, car les TTSP prfrent cliver aprs une arginine.

33

" HEfl 9SI lwfl ^1 B9 933 B^I B3B " N-Terminal I C-Terminai

Site de Clivage

Figure 11 : Reprsentation schmatique de la nomenclature de Schechter et Berger

Les carreaux bleus reprsentent des acides amins. Les positions de chacun de ces a.a. sont

indiques l'intrieur de ces carreaux.

34

2.9.2 Internally Quenched Fluorogenic peptides (peptides IQF)

Des peptides IQF ont t utiliss comme substrats pour des essais protolytiques avec la

HAT. Ces peptides sont conus d'aprs la thorie FRET ( Frster Rsonance Energy

Transfer ). Les peptides IQF tel que schmatis ci-dessous, possdent deux groupements: le

premier tant situ en N-terminal est le groupement (fluorognique) Abz (acide ortho amino-

benzoque) et le deuxime est le groupement (accepteur) 3-nitrotyrosine (Tyr(3-N2)) en C-

terminal (figure 12A). Lorsque excit (figure 12B, flche bleue), le groupement Abz met une

fluorescence (figure 12B, flche rouge), mais puisque le groupement 3-nitrotyrosine se trouve

assez proche (soit moins de 100 de distance), cette fluorescence est immdiatement absorbe

par ce dernier et ne peut donc tre capte par le spectrofluorimtre (LIU et al, 1999). Cette

raction est possible parce que le spectre d'ondes d'absorption du groupement 3-nitrotyrosine et

d'excitation du groupement Abz se chevauche (MELDAL et BREDDAM, 1991). Lorsque le

peptide est cliv, il y a loignement du groupe 3-nitrotyrosine de celui du groupement Abz, cela

permet au spectrofluorimtre de capter la fluorescence mise par Abz et ainsi confirmer le

clivage du peptide par l'enzyme (figure 12C).

35

(A) O H

(B)

(C)

P4 - P3 - P2 - P1 - P V - P2 - - P3" - P4" ^

H O O H

A b z (donneur) Tyr (3-N0 2 ) (accepteur)

"V - / S x=: P4 - P3 - P2 - P1 - P11 - P2" - P3' - P41

Abz (donneur) Tyr(3-N0 2 ) (accepteur) Xex = 320 nm ^om= 4 2 0 n m

* / \

p r - P ' - p y - P * .

H OH

OH

NH2

P4 - P3 - P2 - P1

Abz (donneur) Tyr(3-N02) (accepteur) Xex = 320 nm Absorbance Xmax= 420 nm Xem= 420 nm

Figure 12: Le principe du FRET

(A) Peptides IQF et ses deux groupements (B) Excitation du peptide IQF non-cliv (C)

Excitation du Peptide IQF Cliv. Lorsque le peptide IQF n'est pas cliv, la fluorescence mise

par le groupement Abz est absorbe par le groupement tyrosine ce qui empche le fluorimtre de

dtecter cette fluorescence. Par contre, si le peptide est cliv la fluorescence mise par le

groupement Abz peut tre dtect par le fluorimtre.

36

Substrat de Rfrence

La conception des peptides IQF a t base sur la squence de clivage de la TTSP

matriptase: RQAR-VVGG. Les positions P4, P3, P2 et PI ' ont t remplac par des acides

amins non-polaires (Ala, Leu), aromatique (Tyr), acide (Gin) et basique (Arg).

Squence de substrat prfrentielle de la HAT

Les squences de substrats prfres de la HAT (l./nM) ont t analyses en utilisant

50uM de chacun des peptides IQF dans un tampon de lOOmM Tris, 500ug/mL BSA, pH 9. La

vitesse de relche de la fluorescence de chacun des peptides IQF a t compare la vitesse de

relche la plus leve.

Efficacit catalytique de la HAT

Pour chacun des peptides IQF, l'efficacit de l'enzyme les cliver (Kcat) et son affinit

pour chacun d'eux (Km) ont t tudies pour dterminer l'efficacit catalytique (Kcat / Km) de la

protease. En tout premier lieu, l'enzyme ( concentrations constante) a t teste avec diffrentes

concentrations de peptides (0-200 uM) dans un chantillon de volume total de lOOuL

comprenant lOOmM Tris, pH9 et 500ug/mL BSA. La fluorescence a t mesure des longueurs

d'excitation et d'mission de 320nm et 420 nm, respectivement. Les vitesses de relche de

fluorescence pour chacune de ces concentrations ont t utilises pour faire une courbe

Michaelis-Menten. Dans certains cas, mme lorsque le substrat a t cliv, la fluorescence est en

partie absorbe par d'autres molcules voisines ou clives ce qui empche au fluorimtre de

dtecter la quantit de fluorescence qui a rellement t mise ( inner filter effect ). Afin de

remdier ce problme, il y a eu correction des valeurs de la vitesse de relche tel que dcrit par

37

Liu et son quipe (LIU et al, 1999). La courbe a permis le calcul du Vmax (qui a permis de

calculer le Kcat) et du Km par rgression non-linaire partir de l'quation Michaelis-Menten Vo

= Vmax[S]/(Km + [S]) ( l'aide du programme GraphPad Prism 5). Ensuite, Kcat a t calcul en

utilisant l'quation Kat = Vmax / [En], o En est la concentration de l'enzyme teste avec les

peptides IQF.

2.10 tudes des proprits physiologiques de la HAT

2.10.1 chantillons et purification des expectorations de' patients FK

Les expectorations (crachats) ont t obtenues de patients atteints de FK. Une fois

rcoltes, elles ont t apportes en laboratoire o elles ont t purifies avec du PBS un ratio

de 1 :1 (e.g. pour lmL de liquide d'expectoration il faut l.ml de PBS). Le tout a ensuite t

centrifug une vitesse de 27 000 g pendant 20 minutes afin de retirer le mucus. Le surnageant a

t prlev et conserv.

2.10.2 Mesure de la concentration d'lastase dans les expectorations de patients FK

L'chantillon d'expectoration purifi a ensuite t analys pour dterminer la

concentration d'lastase. Pour ce faire il a fallu utiliser le substrat fluorognique de l'lastase, le

methoxysuccinyl alanyl-analyl-prolyl-valine /?-nitroanilide (MeO-SAAPV-p-NA). Ce dernier a

t conserv une concentration de 50mM dans du DMSO. Pour dterminer la concentration

d'lastase, le substrat est dilu une concentration finale de 5mM dans un tampon appel Brij 35

(0.5M NaCl, 0.1M Hepes, 0.1% Brij, pH = 7.5). Finalement, cette dernire prparation est

utilise pour la raction entre le substrat et l'lastase active dans les expectorations (50uM final

38

de MeO-SAAPV-p-NA dans l'chantillon d'expectoration). Cette raction est effectues une

onde d'excitation de 380nm et d'mission de 440nm pendant deux minutes pour ensuite

comparer le rsultat de fluorescence une courbe standard d'lastase pralablement tablie.

2.10.3 Mesure de l'Activit Protolytique dans les Expectorations de Patients FK

Pour mesurer l'activit protolytique, un chantillon ayant un volume final de lOOuL,

contenant lOOmM de tampon Tris-HCL, pH 9, 50uM du substrat fluorognique BOC-Phe-Ser-

Arg-AMC et 50uL d'expectoration a t prpar. La mesure de la fluorescence s'est effectue

une longueur d'onde d'mission de 380nm et d'excitation de 440nm. Les deux groupes

contrles furent les suivants: (1) le premier ne contenait que le substrat et le tampon (contrle),

(2) le deuxime avait en plus 30uM d'lastase.

2.10.5 Tests de l'effet de la HAT sur la production de la cytokine IL-8

Les tests pour dterminer si la HAT avait un effet sur la production d'IL-8 ont t

effectus sur les cellules Calu-3. Des concentrations de lOnM et 15nM de HAT ont t testes

sur ces cellules car c'tait ces concentrations que les effets in vitro de la HAT on t observes

(BEAUFORT et al, 2007). Le contrle positif utilis a t le TNF-alpha une concentration de

15ng/mL. Le surnageant des cellules a t rcolt aprs 24h.

2.10.6 Mesure de la cytokine IL-8

La quantit d'IL-8 dans le surnageant de cellules traites au TNF-alpha et la HAT a t

mesure l'aide d'un kit d'ELISA IL-8 en suivant le protocole du manufacturier Roche

Diagnostics.

39

2.10.7 Statistiques

Les rsultats obtenus sont exprims selon la moyenne SEM (Standard Error of the

Mean). Les donnes sont analyses grce au programme GraphPad. Lorsque P< 0.05, le rsultat

est considr comme significatif.

40

RSULTATS

3.1 Expression et purification de la protease Human Airway Trypsin-Like (HAT)

3.1.1 Expression de la HAT dans les cellules S2

Dans le but d'tudier la protease serine HAT, la premire tape a t d'exprimer et de

purifier la protease. Afin de faciliter l'expression et la purification de la HAT seulement la partie

du gne codant pour la partie soluble (comprenant les domaines SEA et catalytique) a t

exprime. De plus, les pitopes His et V5 ont t ajout en C-terminal de la construction. Le

recombinant a t ensuite exprim dans les cellules S2 de Drosophile. En parallle, des cellules

S2 ont t transfectees avec le vecteur vide pMT-Bip-V5 His pour tre utilis comme contrle.

Un immuno-buvardage de type Western l'aide d'un anticorps contre l'pitope V5 (anti-V5) a

ensuite t ralis sur un chantillon de milieu des deux groupes. Tel qu'illustr, aucune protine

ragissant avec l'anticorps n'a t dtecte dans le milieu contrle (figure 13A), tandis que celles

transfectees avec le rHAT expriment la protine (figure 13B). La bande reprsentant la HAT

migre environ 44 kDa ce qui se rapproche de la valeur du poids molculaire thorique qui est

d'environ 41 kDa (pour la partie soluble). De plus, une augmentation de la quantit de la HAT

est observe entre le deuxime et le cinquime jour aprs la transfection.

La forme dtecte dans le milieu des cellules S2 exprimant la HAT correspond la forme

non-active de l'enzyme; la forme mature (active) ne s'y retrouve pas, car aucune bande 28kDa

n'est apparue (poids molculaire thorique du domaine catalytique). Selon les observations

provenant du laboratoire du Dr Richard Leduc, toutes les TTSP sont actives aprs purification

par un mcanisme d'auto-activation. Il a fallu alors passer l'tape suivante, celle de la

purification par colonne d'affinit pour obtenir la forme active.

41

J2 n J4 J5

TF .D "~~

J2 J3 J4 JS

Figure 13 : Immuno-buvardage de type Western des milieux de cellules S2 transfectees avec la

rHAT

Immuno-buvardage de type Western en conditions rductrices sur gel d'acrylamide 12% avec un

anticorps anti-V5. (A) Milieu de Cellules S2 transfectees avec le vecteur vide; (B) Milieu de

cellules S2 transfectees avec le plasmide encodant le gne HAT ; (J) Nombre de jours aprs

transfection. Seule la forme non-active est retrouve dans le milieu des cellules S2 transfectees

avec la HAT. La forme active (domaine catalytique) qui normalement devrait migrer environ

28kDa n'y est pas retrouve.

42

3.1.2 Purification par IMAC

La rHAT et le vecteur vide ont t traits de faon identique selon le protocole de

purification sur des colonnes de nickel. Seules les protines ayant un pitope poly-His devraient

se lier la colonne, ainsi la protine de fusion HAT devait rester accroche. Les protines qui

sont restes lies la colonne ont t ensuite lues par imidazole dans diffrentes fractions de

2mL. Le graphique de cette purification montre les diffrentes fractions lues (figure 14A).

Celles se trouvant sous le pic (figure 14A, ligne bleue) sont les fractions dans lesquelles il y a eu

une lution importante de protines. Ensuite, un immuno-buvardage (figure 14B) a t fait pour

dterminer exactement dans quelles fractions nous retrouvons la protine dsire, soit la HAT.

partir des rsultats obtenus de T immuno-buvardage, plusieurs formes de la protease sont

rcupres, dont la forme catalytique qui ici migre 30 kDa. Les diffrentes formes obtenues

dmontrent que la HAT s'est auto-active et autodgrade (lorsqu'elle tait accroche la

colonne) en clivant des sites en N-terminal car elles ont ragi avec l'anticorps anti-V5 qui lui

reconnat l'pitope V5 en C-terminal.

Nous avions utilis l'imidazole pour ensuite luer les protines qui se sont lies la

colonne. L'imidazole inhibe l'activit protolytique des TTSP, la prochaine tape tait donc de

dialyser les chantillons contrle et HAT pour enlever l'imidazole afin de pouvoir effectuer des

essais qui nous ont permis de dterminer si les fractions contenant la HAT taient

enzymatiquement pure. Aprs la dialyse, nous avons donc effectu ces essais en utilisant un

substrat fluorognique. Dans leur article publi en 1997, Yasuoka et son quipe ont dmontr

que le meilleur substrat fluorognique tri-peptidique de la HAT est le Boc-Phe-Ser-Arg-AMC.

Nos donnes dmontrent qu'il y a une importante activit dtecte dans les fractions A4 A7

contenant la HAT. Contrairement au rsultat prcdent, aucune activit protolytique n'a t

43

dtecte dans l'chantillon contrle (soit transfection avec le vecteur vide) avec le substrat

fluorognique (figure 15).

B Forme non-clive

Domaine catalytique

mAU

600-

soo-400-

300-

200-

100-

of -100-o *

lution des protines

A4 *5 AS

6 S 10

Fractions

12

Figure 14: Graphique d'lution des protines par imidazole et immuno-buvardage de type

Western des diffrentes fractions

(A) Nous voyons la ligne (avec un pic) reprsentant l'lution des protines. (B) Immuno-

buvardage avec l'anticorps anti-V5. Les rsultats nous montrent que les fractions A4 A7

contiennent la HAT active (le domaine catalytique); ces fractions ont donc t conserves. Les

mmes fractions ont t gardes pour la purification du milieu des cellules transfectees avec le

vecteur vide.

45

Activit Protolytique Dtecte dans chantillons Dialyses

7

o c O 1 -

. D V LL

2000-1

1500-

1000-

500-

<

0-L

x #

KWX-:-K%-K

fmm ^ ^

mm A

Figure 15 : Activit protolytique dans les chantillons contrle et HAT

Tel qu'observ ci-dessus, dans l'chantillon contenant la HAT nous avons dtect une activit

protolytique tandis que nous n'avons pas observ d'activit protolytique dans l'chantillon

contrle (soit le vecteur vide). Ce rsultat nous a dmontr qu'aprs purification, l'activit

enzymatique observe est due la protease HAT et non d'autres protines qui ont pu tre

prsentes dans l'chantillon. Cela nous a donc confirm que notre chantillon est

enzymatiquement pure, (n = 3 en duplicata; p < 0.0001).

46

3.1.3 Purification par colonne d'affinit benzamidine

La benzamidine, inhibiteur de protases serine, lie le domaine catalytique de protases

actives seulement. Ainsi, la purification par colonne benzamidine a permis de sparer la forme

non-active de la protease de sa forme mature et active. Le graphique ci-dessous (figure 16),

montre l'lution des protines (par pH acide). Sous le pic se trouvait les fractions avec la plus

importante quantit de protases actives (soit les fractions A6 A10 dans la figure 16).

L'enzyme a t ensuite titre l'aide du MuGB dans le but de dterminer sa concentration. Les

concentrations de la HAT aprs purification par colonne d'affinit benzamidine tait situes

entre 1.0 et 1.2 uM.

47

Fractions

Figure 16: Graphique de la purification de la HAT par colonne d'affinit benzamidine

Sur l'axe des x nous avons les diffrentes fractions rcoltes. Sous le pic se retrouvaient les

fractions A6 AlO qui contenaient les plus importantes lutions de protines. Ces protines

reprsentaient la forme mature, active de rHAT. L'lution s'est faite par diminution de pH (de

pH7.42).

48

3.1.4 Efficacit de la purification

Les rsultats des diffrentes tapes de purification ont t analyss par immuno-

buvardage. Tel que montr dans la figure 17, dans le milieu des cellules S2 seule la forme non-

active de la HAT y tait exprime (figure 17 rang 1), mais suite la premire purification et

dialyse, il y a apparition de la forme active de la protease (figure 17 rang 3). Lors de la

purification par IMAC, plusieurs formes de la HAT taient dtectes, suite la dialyse, il est

possible de voir qu'il y a eu activation de ces formes pour obtenir plus d'enzyme active de sorte

que seules les formes non-actives et matures sont prsentes (figure 17 rang 3). De plus, il ne

semble pas y avoir eu de perte de la HAT car aucune trace de cette dernire n'est retrouve dans

l'chantillon de protines non-lies la colonne de Ni (figure 17 rang 2). Finalement, la

dernire tape de purification par colonne benzamidine semble s'tre avre efficace pour

rcuprer uniquement la forme mature de la protease (figure 17 rang 4).

La prochaine tape tait d'tudier l'efficacit d'une deuxime purification. Comme

dmontr dans le tableau 1, pour chaque tape de purification les caractristiques suivantes ont

t notes ou calcules: (1) le volume total de protines rcupr aprs purification, (2) la

quantit totale de protines prsente dans l'chantillon par la mthode Bradford, (3) l'activit

totale dtecte dans l'chantillon (1 unit (U) correspond 1 umol/min d'AMC gnr par

l'enzyme dans un chantillon contenant 50 uM de BOC-FSR-AMC), (4) l'activit spcifique

correspondant l'activit par mg de protines retrouves dans l'chantillon, (5) le pourcentage

de l'activit conserv par rapport l'tape de purification prcdente et finalement (6) le facteur

de purification. Les rsultats nous rvlent que la purification par colonne d'affinit

benzamidine, quoiqu'elle ait permis de ne garder que la forme active, a t dsavantageuse sur

deux points : (1) Il y a eu une perte importante de protases entre la premire purification par

49

IMAC et la purification par colonne benzamidine (rapport de 0.26) et (2) elle n'a pas permis une

meilleure purification de l'chantillon (Facteur de purification de 0.96). Pourtant, l'immuno-

buvardage semble nous dmontrer que la prparation est pure. La seule explication possible est

qu'il y ait toujours prsence de la forme non-active dans l'chantillon. Et puisqu'il y a une

importante perte des protines, la quantit sur gel de la forme non-active est tellement faible

qu'elle ne peut tre dtecte par immuno-buvardage.

50

tape de

Purification IMAC

Benzamidine

Volume Total (mL)

6 2,1

Quantit totale de protines

(mg) 32,16

8,3

Activit Totale

(U) 31949 7924

Activit Spcifique

(U/mg) 993,44 954,7

Rapport (%)

-

26

Facteur de

Purification -

0.96

Tableau 1: Efficacit d'une deuxime purification par colonne d'affinit benzamidine

D'aprs les rsultats du tableau ci-dessus, une purification par colonne d'affinit benzamidine

s'est traduite par une importante diminution de la quantit de protine active. Nous n'avons

rcupr que 26% de la quantit provenant de la premire purification par IMAC.

51

Western Blot

25 kDa

Figure 17: Immuno-buvardage des tapes de purification

L'anticorps anti-V5 a t utilis pour dtecter les diffrentes formes de la HAT. (1) Milieu des

cellules S2 avant purification, (2) Protines non-lies la colonne de nickel, (3) Eluat de

protines provenant de la purification sur colonne d'affinit au nickel, (4) Eluat de protines

conserves aprs purification sur colonne d'affinit benzamidine. (A) HAT : forme non-active

(B) HAT : domaine catalytique

52

3.2 Proprits biochimiques de la HAT

3.2.1 pH optimal de la HAT

La caractrisation de l'enzyme a dbut par l'tude de l'influence du pH sur l'activit

protolytique de l'enzyme. Dans la figure 18, nous voyons que la HAT conservait un

pourcentage d'activit assez lev (>75%) un pH situ entre 7 et 10 lorsque test avec le

substrat Boc-Gln-Ala-Arg-AMC. Par contre, un pH acide (6.5 et moins) il y a une importante

diminution de son activit (moins de 30%). Finalement, un pH basique (10 - 11) nous avons

observ une diminution de son activit protolytique.

3.2.2 Inhibiteurs synthtiques de protases

Dans le but poursuivre la caractrisation biochimique de la HAT, des inhibiteurs

synthtiques de protases ont t tests afin d'tudier quels types d'inhibiteurs sont efficaces

contre l'enzyme. Des inhibiteurs de quatre types de protases ont t tests, soit ceux des

protases serine (aprotinine, leupeptine, PEFABLOC et SBTI), cystine (E-64), aspartate

(Pepstatin) et des mtallo-protases (EDTA, Bestatin, O-Phenanthroline). Tel qu'illustr dans la

figure 19, seuls le PEFABLOC, l'aprotinine et la leupeptine ont inhib presqu'entirement

l'activit protolytique de la HAT. Malgr son qualificatif l'associant la trypsine, l'inhibiteur

synthtique de ce dernier n'a pas t aussi efficace que les autres inhibiteurs de protases serine

en inhibant qu'un peu plus de 30% de l'activit protolytique de la HAT. Finalement, quoiqu'il

n'ait inhib qu'un peu plus de 25% l'activit protolytique de la HAT, O-Phenanthroline n'tait

pas considr comme un inhibiteur potentiel car la HAT n'est pas connue comme tant une

mtallo-protase.

53

3.2.3 Inhibiteurs endognes de protases serine

Pour faire suite l'exprience prcdente, l'efficacit des inhibiteurs endognes de

protases serine contre la HAT a t tudie. Les rsultats obtenus montrent que al-AT, HAI-

1, al-ACT ainsi que ATIII n'ont pas ou trs peu d'effet inhibiteur. De son ct, PAI-1 a inhib

un peu plus de 35% de l'activit de l'enzyme mais sans plus, tandis que a2-AP s'est avre

beaucoup plus efficace contre la HAT en inhibant 80% de l'activit protolytique de la protease

(figure 20).

54

pH optimal de la HAT

100-

o >

O

vfl>

<

Figure 18: L'effet du pH sur l'Activit Protolytique de la HAT

Sur ce graphique, nous pouvons voir que la HAT a perdu un pourcentage important de son

activit (

Inhibiteur Synthtique de Protases

Inhibiteurs de Protases Senne

Inhibiteur de Protases Cystine

Inhibiteur de Protases Aspartate

Inhibiteur de Mtallo-protases

Figure 19: Effets des inhibiteurs synthtiques de protease sur l'activit protolytique de la rHAT

Chaque inhibiteur a t incub avec 2nM de HAT et la mesure de l'activit de l'enzyme avec

50uM Boc-Gln-Ala-Arg-AMC pendant 20 minutes des longueurs d'ondes d'excitation et

d'mission de 360nm et 460nm, respectivement. L'activit rsiduelle est dtermine en

comparant l'activit protolytique du groupe contrle (sans inhibiteur) avec celle contenant

l'inhibiteur. Trois expriences indpendantes faites en duplicata ont permis de calculer l'cart-

type. Les inhibiteurs de protease serine aprotinine, leupeptine et PEFABLOC ont t les plus

efficaces pour inhiber l'activit de l'enzyme.

Inhibiteurs Aprotinine Leupeptine

PEFABLOC SBTI E-64

Pepstatin EDTA

Bestatin O-Phenanthroline

i \ctivit Rsiduelle (%) 14 13 1.8 69 88 88 90 93 74

1.1 2.7 1.3 5 7.4 16.6 4.2 9.3 3.5

Valeur de "p" 0.0001 0.0003 0.0001 0.007

0.1 0.3 0.2 0.3

0.006

56

Effets d'Inhibiteurs Endognes de Serine Protease sur l'activit de HAT

15(H

* o/ sf J . / y *

3.2.4 Stochiomtrie d'Inhibition

Inhibition de HAT par Alpha-2 Anti-Plasmine

concentration de a2-AP (nM)

Figure 23: Stochiomtrie d'inhibition entre Alpha-2 anti-plasmine et HAT

Suite aux rsultats obtenus prcdemment, une exprience pour dterminer la stochiomtrie

d'inhibition entre a2-AP et HAT a t effectue. En d'autres termes, la question qui se pose est

la suivante : quelle concentration de a2-AP cela prend t-il pour inhiber 2nM de HAT. Des essais

avec des concentrations de a2-AP de 0, 1, 2, 5, 10, 25, 50, 75, 100, 125nM ont t effectus.

rHAT a t incube avec a2-AP pendant dix minutes avant d'ajouter 50uM du substrat

fluorognique BOC-Phe-SER-Arg-AMC. Tel que dmontr dans le graphique ci-dessous, 24nM

a2-AP est ncessaire pour inhiber 2nM HAT, donc un ratio d'inhibition de 12:1.

58

3.3 Proprits enzymatiques de la HAT

3.3.1 Squences prfrentielles

Des essais ont t effectus avec la HAT et diffrents tri-peptides fluorogniques

(peptides IQF) afin d'tudier quelles sont les squences que la protease prfre. Comme le

montre le graphique ci-dessous (figure 24), contrairement la matriptase qui a une prfrence

vidente pour une squence spcifique (RQRR/VVGG), la HAT clive la grande majorit des

peptides tout comme la trypsine (donne non-incluse).

3.3.2 Efficacit Catalytique (Kcat/Km)

Le but de cette exprience est de dfinir pour quel peptide la HAT a une meilleure

affinit et meilleure capacit de clivage. Dans la figure 23, nous voyons un exemple d'un

graphique correspondant l'quation Michaelis-Menten. La courbe reprsente la vitesse initiale

de fluorescence pour chaque concentration du peptide IQF test (dans ce cas, RRAR-VVGG)

avec la rHAT. L'quation Michaelis-Menten permet de calculer les paramtres cintiques de la

HAT (soit le Vmax, Km, Kcat) pour chacun des peptides IQF. Ces paramtres ont permis de

dterminer pour quel(s) peptide(s) la rHAT a la fois une plus grande affinit et une plus grande

capacit de clivage. Les donnes du graphique de la figure 24 qui nous dmontrent que la HAT

ne semble pas capable d'hydrolyser un peptide ayant un glutamate en P4, P2 et PI ' , mais plutt,

qu'elle a une plus grande affinit et plus grande capacit de clivage pour les peptides ayant une

arginine en P4, P3 et PI (R-R-X-R).

59

Clivage de Peptides IQF par HAT et Matriptase

100-

>

a * ^ ojC 50-;> u <

I T i i i i i i i i i i i i r 0 ( 5 0 ( 5 0 0 ( 5 0 0 0 0 0 0 0 0 0 0 0 OOOCCJOOOOOOOOOOOOO

ce ce ce ce ce ce ce ce ce ce ce ce ce 2 ce a ce ce < < u j - j a : < < > -aoaaoaooaoooG ce-izccce(]ecea:ceccfa:u.ct:ce

OOOOOOOOOOCJOOOOOOO ooc iooouooooooooooo

-> :2r cececececececececececececeoecececece < < u j - j a : < < > -aaaaaagaaaaaa cececececececececeaLcececece

P4 P3 P2 P1' P4

Peptides IQF

P3 P2 pr

HAT Matriptase

Figure 22 : Clivage des peptides IQF par la HAT

Tel qu'illustr, la matriptase a eu une prfrence pour le peptide une arginine en P3, tandis que la

HAT semblait ne pas avoir de prfrence particulire. Par contre, nous avions pu observer que

cette dernire prfre beaucoup moins un peptide avec un glutamate en P4 ou encore une alanine

la mme position. L'chantillon contenait 2nM test avec 1 uM du substrat fluorognique dan

un tampon lOOmM Tris, pH 9.

60

400

4)

.2 s

ii

u o

3 >

\ 300-S p-

^ "a 200-S "o 1.100^

0 50 100 150 200 250 Abz-RRARWGG-Y(3-N02) (uM)

Figure 23: Clivage d'un peptide IQF diffrentes concentrations par la HAT

Le graphique ci-dessus est un exemple de courbe Michaelis-Menten qui montre la vitesse initiale

de fluorescence (axe des y) en fonction de la concentration initiale (axe des x) du substrat

fluorognique (dans ce cas-ci RRAR-VVGG). L'chantillon contenait 2 nM de la rHAT test

avec 0, 5, 10, 15, 20, 25, 50, 100 et 200 uM du substrat dans lOOmM de tampon Tris, pH 9.

61

Comparaison Kcat/Km

T

1 i mu 1 1 s i h I 4 mwwwi Peptides IQF

Figure 24: Graphique de comparaison de l'efficacit catalytique de la HAT pour chaque peptide

L'efficacit catalytique (Kcat/Km) de la HAT est dfinie comme tant la capacit de l'enzyme

cliver (Kcat) et son affinit (Km) pour une squence spcifique. D'aprs les rsultats ci-dessus,

la HAT a une plus grande efficacit catalytique pour un substrat ayant une arginine en P4, P3 et

PI.

62

3.4 Proprits physiologiques de la HAT

3.4.1 Activit protolytique dans les expectorations de patients FK

Nous avons pris des expectorations de patients FK afin de dtecter si nous pouvions

observer une activit protolytique spcifique des protases serine. Pour ce faire nous avons

tout d'abord class les diffrents patients en terme de la gravit de la maladie, et ce en calculant

la concentration d'lastase dans les expectorations. Plus il y a de l'lastase, plus le patient est

malade. Ensuite, pour chaque chantillon de patient, nous avons vrifi s'il y avait des protases

serine prsentes en utilisant le substrat BOC-Phe-Ser-Arg-AMC. Tel qu'illustrs dans les

graphiques ci-aprs, dans toutes les expectorations de patients FK nous dtectons uns activit lie

aux protases serine.

63

Concentration d'Elastase Dtecte dans les Expectorations de Patients FK

40-i 10 ta m 30

LU TS

C

u C o O

10-

Patients

Figure 27: Concentration d'lastase dans les expectorations de patients FK

La concentration d'lastase dans les expectorations a pu tre dtermine en utilisant le substrat

fluorognique de la protease, soit le MeO-SAAPV-p-NA. La concentration d'lastase est

proportionnelle la gravit de la maladie FK, ainsi, le patient 1 est le moins malade et le patient

6 est le plus malade.

64

Activit Protolytique Dtecte dans les Expectorations de Patients FK

Patients

Figure 28 : Dtection d'activit protolytique dans les expectorations de patients FK

Les expectorations de patients ont t incubes avec le substrat fluorognique Boc-Phe-Ser-Arg-

AMC et le End Point a t mesur. Ces donnes dmontrent la prsence d'activit

protolytique de protases dans chacun des chantillons.

3.4.3 Effet de la HAT sur la production d'IL-8

Les Calu-3 ont t testes avec la HAT pendant 24 heures dans le but de dterminer si la

HAT aura un effet sur la production de la cytokine HAT. Le TNF-alpha, une cytokine connue

pour stimuler la production d'IL-8, a t utilis comme contrle positif. Le surnageant des

cellules a t prlev dans le but de mesurer par ELISA la quantit d'IL-8 dans le surnageant.

Les rsultats obtenus montrent qu'il n'y a pas de diffrence significative entre le contrle et les

cellules traites avec la HAT en ce qui attrait la concentration de 1TL-8 dans le surnageant.

66

?

r o

'*->

a i _ t-

C o> u c o O

^-, _ i f= m Q.

Effet de la HAT sur la production d'IL-8 6000 n *

_ 4000-

2000-

* y^ p = 0.03

Figure 30: Effet de la HAT sur la production d'IL-8 dans les Calu-3

Des expriences in vitro publies sur la HAT dmontrent que cette dernire a des effets une

concentration aussi basse que 5nM (Beaufort et al 2007). Dans le cas de cette tude, les Calu-3

ont t traites avec 10nM de la HAT pour voir l'effet sur la production de la cytokine IL-8. Le

TNF-alpha fut utilis comme contrle positif. Les rsultats suggrent que la HAT n'aurait pas

ou peu d'effet sur la production de 1TL-8. N =5 en duplicata.

67

DISCUSSION

Dans cette tude, le but fut de synthtiser la HAT dans une conformation active dans un

systme eucaryote dans le but d'tudier ses proprits biochimiques, enzymatiques ainsi que son

potentiel pro-inflammatoire dans ligne cellulaire pulmonaire Calu-3.

Durant cette tude, nous nous sommes premirement concentrs sur la production de la

HAT dans un systme d'expression eucaryote, plus prcisment les cellules de Drosophile

Schneider 2 (S2) (SCHNEIDER, 1972). Ensuite, nous avons caractris biochimiquement cette

protease. Par la suite, nous avons fait une tude des squences d'acides amins scindes par la

HAT. Ensuite nous avons test l'effet des inhibiteurs synthtiques et endognes de protease sur

l'activit protolytique de la HAT. Finalement, nous avons test son effet sur la cytokine IL-8,

implique dans la pathologie respiratoire associe la FK.

Le systme eucaryote utilis (les cellules S2) prsente plusieurs avantages pour

l'expression de protines htrologues. Premirement, elles sont faciles entretenir; elles

peuvent subsister dans un environnement temprature pice qui ne requiert pas de CO2

(Schneider 1972). De plus, ce systme est compatible avec le vecteur pMT-BiP V5-His, vecteur

dans lequel est insr l'ADNc de la HAT codant pour la partie soluble non-active de la protease.

Le recombinant a t transfect dans les S2 pour obtenir des lignes stables avec intgration de

l'ADNc de la protine dans le gnome de la cellule hte. Deux jours aprs la transfection des

cellules (transitoires), nous avons dtermin si la protine dsire, HAT, a t exprime. Une fois

l'expression confirme, nous avons procd une co-transfection de l'ADNc avec le vecteur de

slection pCoBlast. Ensuite, par immuno-buvardage de type Western, nous avons analys le

milieu des cellules et avons obtenu des rsultats nous montrant que la forme soluble non-active

68

est exprime et prsente une migration environ 44kDa. Par contre, la forme soluble

correspondant au domaine catalytique, soit la forme active n'est pas visible sur l'immuno-

buvardage. Puisque dans le laboratoire nous obtenions la forme active des TTSP aprs

purification par auto-activation (BLIVEAU et al, 2009), nous avons pass le milieu sur une

colonne comprenant des ions de nickel. Cette tape permet de partiellement purifier la protine et

d'liminer des inhibiteurs potentiels des serines protases qui se retrouveraient dans le milieu.

L'immuno-buvardage nous montre la prsence plusieurs bandes indiquant que la protease s'auto-

clive plusieurs sites du ct N-terminal. Puisque l'imidazole inhibe l'activit des protases,

nous pouvons conclure que l'auto-clivage de la HAT s'est produite lorsque celle-ci tait sur la

colonne de nickel et non aprs avoir t lue de la colonne par l'imidazole. Aprs la dialyse,

nous ne voyons que deux bandes, une environ 44 kDa et l'autre es