Epidemiology of extended-spectrum β-lactamase-producing Escherichia coli in Sweden 2007–2011

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1469-0691.12413 This article is protected by copyright. All rights reserved.

Received Date : 05-Jul-2013

Revised Date : 28-Aug-2013

Accepted Date : 25-Sep-2013

Article type : Original Article

Original article

Epidemiology of ESBL-producing Escherichia coli in Sweden 2007-2011

Alma Brolund1,2, Petra J Edquist1, Barbro Mäkitalo1, Barbro Olsson-Liljequist1, Tomas Söderblom1, Karin Tegmark Wisell1,2 and Christian G Giske1,2,3

1. Swedish Institute for communicable Disease Control, Solna, Sweden 2. Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden 3. Department of Clinical Microbiology, Karolinska University Hospital, Solna, Sweden

Corresponding author: Alma Brolund, Swedish Institute for Communicable Disease Control, SE-17182, Solna, Sweden. E-mail address: [email protected]. Tel.: +46 8 4572462; fax: +46 8 328330.

Abstract

ESBL-producing Enterobacteriaceae are notifiable according to the Swedish communicable disease

act since 2007. A major increase of the number of cases has been observed, with 2,099 cases in 2007

and 7,225 cases in 2012. The majority of the isolates are Escherichia coli. Additionally, Swedish data

on the prevalence of ESBL-producing invasive isolates of E. coli are available through EARS-Net, and

through biannual point prevalence studies, where molecular characterization of isolates from the

Acc

epte

d A

rtic

le

This article is protected by copyright. All rights reserved.

entire country is carried out. This paper describes major trends in the Swedish epidemiology of ESBL-

producing E. coli in the period 2007-2012. Isolates from the point prevalence studies were subjected

to antimicrobial susceptibility testing, ESBL genotyping, pulsed-field gel electrophoresis, multi-locus

sequence typing and phylogenetic grouping with PCR. The distribution of sequence types, resistance

genes, and susceptibility levels were all stable over the three study periods. The dominating

resistance gene conferring ESBL was blaCTX-M-15 found in 54-58% of the isolates. ST131 represented

34-38% of the isolates. Other major STs were ST38, ST69, ST405, ST617 and ST648, each

representing 2-6% of the isolates. Phylogenetic group B2 was the most common, and observed in

41-47% of the isolates. However, amongst ST131 isolates the B2 phylogenetic group represented 90-

98% of the isolates. The most important epidemiological difference seen over time was that the

median age of infected women decreased from 62 to 52 years (p<0.0001) and infected men from 67

to 64 years. A potential explanation might be the shift towards a higher proportion of community-

acquired infections in individuals lacking comorbidities.

Introduction

Extended-Spectrum β-Lactamase (ESBL)-producing Enterobacteriaceae (EPE) are increasing rapidly

all over Europe. In Sweden, all cases of EPE are notifiable according to the communicable disease act

since February 2007. The systematic reporting to the surveillance system SmiNet, which is

monitored by the Swedish Institute for Communicable Disease Control (SMI), has resulted in a large

and comprehensive national data set covering a period of more than five years. The number of

reports to SmiNet has been steadily increasing, from 2,099 cases in 2007 (Feb-Dec) to 7,225 cases in

2012 (http://www.smittskyddsinstitutet.se/in-english/statistics/extended-spectrum-beta-lactamase-

esbl/ last accessed 11th of May 2013).

Other sources of systematic surveillance data are the Swedish EARS-Net data, with

susceptibility data for invasive isolates of E. coli and K. pneumoniae derived from laboratories

covering approximately 80% of the population in Sweden, and the biannual point prevalence surveys

Acc

epte

d A

rtic

le


conducted by SMI, in which isolates were collected from most clinical laboratories in Sweden. Such

collections are available from 2007, 2009 and 2011, and provide possibilities of detailing not only

baseline epidemiology, but also in-depth analysis of circulating clinical isolates.

At present, EPE are a growing threat to public health. These bacteria constitute a

burden on health care systems conferring excess mortality and prolonged hospital stay [1]. A major

reason for the increase of ESBL-producing E. coli is the worldwide expansion of the successful clone

ST131, often associated to blaCTX-M. Elevated virulence of ST131 strains have been discussed but the

evidence is not entirely clear. In a zebrafish model Lavigne et al. [2] described decreased virulence

and improved persistence during infection in CTX-M-producing ST131 and non CTX-M-producing

ST131 compared to non-ST131 E. coli, which could be the key for the great success of this clone.

In other Swedish studies the ESBL epidemiology in different settings and in different

geographic areas has been described. Helldal et al described the prevalence of ESBL-producing E. coli

in South Western Sweden during 2004-2008 with a higher increase in nosocomially acquired isolates

in comparison to community-acquired, 0.2 to 2.5% and 0.2 to 1.6% respectively [3]. A study from the

county of Östergötland indicated an increased prevalence of EPE from 2002 to 2007, yet the

numbers were very low (<1%) [4]. An investigation of the faecal carriage of ESBL-producing bacteria

in both Primary Health Care Units and University Hospital setting in Southern Sweden was

conducted in 2008-2010. The only species found was E. coli and the authors described the

prevalence as higher than expected in both groups; 2.1 - 3% and 1.8 - 6.8% respectively [5]. A recent

study from Uppsala investigated the prevalence of EPE in healthy preschool children compared to

patients in the same age group. The authors found a carrier rate of 2.9% in healthy children

compared to 8.4% in patients of the corresponding age group [6].

In this study we present the epidemiology of ESBL-producing E. coli from the national

surveillance system SmiNet and the Swedish data from EARS-Net. In addition we describe the

detailed molecular epidemiology and stability of resistance genes and epidemiological strain types

over time by examining isolates from point prevalence studies performed in 2007, 2009 and 2011.

Acc

epte

d A

rtic

le


Materials and methods

SmiNet for surveillance of pathogens regulated by the Communicable Disease Act

Since February 1 2007 EPE are notifiable for Swedish laboratories according to the Communicable

Disease Act. Notifications are promptly made to the SmiNet database. Since 2009 an extended

definition of ESBL which include all beta-lactamases with an extended spectrum and not only those

that are inhibited by clavulanic acid (referred to as ESBLA according to Giske et al. [7]) is advocated in

Sweden. Consequently Enterobacteriaceae with plasmid-mediated AmpC enzymes (ESBLM) and

carbapenemase enzymes (ESBLCARBA) are also notifiable. Since 2012 a clinical notification is required

for Enterobacteriaceae with ESBLCARBA (or carbapenemase-producing Enterobacteriaceae (CPE)).

The reporting to SmiNet uses a unique personal identification number issued to all Swedish residents

which is used in all contacts with the health care system. A case record is created after the arrival of

the first notification. Any subsequent notifications are merged with the initial case record. The

epidemiologic notification form data are validated by SMI. The validated variables used in the study

were age and gender. In this study, SmiNet reporting of Enterobacteriaceae isolates producing ESBLA

or ESBLM from 2007, 2009 and 2011 were included. Special attention has been given analysis of the

E. coli isolates which are dominating the materials.

Surveillance of invasive pathogens, the Swedish EARS-Net cohort

At the SMI national data is collected each year monitoring invasive E. coli isolates. Each reporting

laboratory regularly submits data files containing gender, age, resistance profile, referring clinic. This

data is also reported together with invasive surveillance data on several other species to EARS-Net

which is a European surveillance system monitored by the ECDC (European Centre for Disease

Prevention and Control) ( http://ecdc.europa.eu/en/activities/surveillance/EARS-Net/). In Sweden

the catchment population for the participating laboratories has always exceeded 75% of the Swedish

population, and in 2011 it even exceeded 80% due to the merging of a few laboratories, thereby

increasing their catchment population further.

Acc

epte

d A

rtic

le


Bacterial isolates

National point prevalence studies of consecutive ESBL-producing E. coli isolated from urine were

carried out nationally in Sweden in 2007, 2009 and 2011, and 20/21 of the Swedish counties have

participated all three years. During 2007 isolates were collected during a three month period. Since

the number of ESBL-producing E. coli was increasing rapidly we adjusted the 2009 and 2011 year

collection period to one month only. This resulted in 236 isolates in 2007, 304 isolates 2009 and 463

isolates in 2011. The selection criteria for the isolates were urinary E. coli resistant to cefadroxil

(used in Sweden as a screening marker for EPE), and resistance or intermediate susceptibility to

cefotaxime and/or ceftazidime following EUCAST guidelines (Clinical breakpoints - bacteria (v 3.1)

www.eucast.org). E. coli isolates positive in phenotypic tests for ESBLA, ESBLM and ESBLCARBA (none in

this collection) constitute the ESBL-producing E. coli in this study.

Antimicrobial susceptibility testing

Susceptibility testing was performed by disc diffusion (Oxoid, Basingstoke, UK) or Etest (bioMerieux,

Marcy l'Etoile, France) according to the EUCAST guidelines and breakpoints valid at the time of

testing. The agents tested were: cefadroxil, cefotaxime, ceftazidime, mecillinam, piperacillin-

tazobactam, ciprofloxacin, trimethoprim, nitrofurantoin, gentamicin, tobramycin and amikacin. In

2009 and 2011 also meropenem, tigecycline and colistin were tested. In 2011 fosfomycin was added

to the test panel. Screening for ESBL-producing E. coli was performed with combination disc testing

using clavulanic acid as inhibitor for blaCTX-M, blaSHV or blaTEM (Becton-Dickinson, Cockeysville, MD,

USA) and cloxacillin as inhibitor for blaAmpC (Rosco Diagnostica A/S, Taastrup, Denmark).

Statistically significant variations in antimicrobial susceptibility test results between CTX-M-15 and

other ESBL genotypes were determined using Fisher’s exact test (p<0.05). A non-parametric test for

trend among ordered groups (extension of Wilcoxon rank-sum test) was used for trend analysis of

changes in median age. Calculations were done with Stata v.12 (StataCorp LP, Texas, USA).

Acc

epte

d A

rtic

le


PCR detection and sequencing of ESBL genotypes

Phenotypic positive ESBL isolates were verified by screening for blaCTX-M and acquired blaAmpC genes

with real-time multiplex PCR as previously described [8, 9]. Standard PCR was used to detect blaSHV

and blaTEM [10] and was applied on all blaCTX-M negative isolates that expressed an ESBL phenotype.

To amplify the genes prior to sequence analysis PCR was performed using M13-tagged primers (IDT,

Leuven, Belgium) sequences stated below. AmpliTaq® DNA Polymerase with buffer II (Life

technologies, Stockholm, Sweden) was used for standard PCR reactions. The primers for

amplification of CMY-genes for sequence analysis were CIT-F: ATGATGAAAAAATCGTTATGCTSC and

CIT-R: CATGGGATTTTCCTTGCTGT. The annealing temperature used was 55°C. AmpliTaq Gold® 360

Master Mix (Life Technologies, Stockholm, Sweden) was used for FAST PCR reactions proceeding

sequencing conducted for detection of CTX-M genes. The primers used were: CTX-M-gr1-F:

CAGAATAAGGAATCCCATGGTT, CTX-M-gr1-R: GGCGATAAACAAAAACGGAAT [11], CTX-M-gr2-F:

ATGATGACTCAGAGCCATTCG, CTX-M-gr2-R: TGGGTTACGATTTTCGCC, CTX-M-gr9-F:

ATGGTGACAAAGAGAGTGCA, CTX-M-gr9-R: CCCTTCGGCGATGATTCTC [12]. The annealing

temperature of all CTX-M amplifications was 60°C.

Sequence reactions, sample clean up and single read sequencing was performed by GATC Biotech

(Konstanz, Germany). Universal M13 primers were used for all sequencing reactions, M13-F:

GTTTTCCCAGTCACGACGTTGTA, M13-R: TTGTGAGCGGATAACAATTTC.

Pulsed-Field Gel Electrophoresis (PFGE)

PFGE analysis was performed according to standard procedures [13, 14]. Briefly, XbaI digested DNA

was electrophoresed in 1% agarose in 0.5 x TBE at 14°C for 26 h, using the CHEF Mapper XA system

(Bio-Rad Laboratories, Hercules, CA, USA) set at 6 V/cm, with pulse times linearly increased from 12

s initial switch time to 40 s final switch time. XbaI digested DNA from Salmonella Braenderup H9812

was included as normalisation standard on every gel. DNA banding patterns were analysed using the

Acc

epte

d A

rtic

le


BioNumerics software, version 6.6 (Applied Maths NV, Sint-Martens-Latem, Belgium), choosing the

Dice coefficient for calculating pair-wise similarities and the UPGMA algorithm for constructing

dendrograms. Position tolerance and optimization were both set at 1%. Bands within the size range

669-33 kb were included in the analysis, and each indistinguishable banding pattern (> 90% pair-wise

Dice similarity) identified in at least two unique isolates was assigned a PFGE pattern name [15].

Phylogenetic grouping

Phylotyping was performed using a triplex standard PCR according to Clermont et al [16]. The PCR

products were analysed using MultiNa, Shimadzu Corporation.

pabB screening and MLST

All isolated were subjected to pabB screening [17]. This PCR method predicts the E. coli MLST type

ST131. Representative isolates from the different PFGE patterns (1-2 depending on cluster size) were

selected for MLST according to the protocol developed by Wirth, T et al [18]. All PCR-primers were

tagged with M13 universal sequences (the same as described above). Annealing temperatures were

adjusted to 60° C. The MLST data analysis, including ST assignment and minimal spanning trees [18],

was performed using BioNumerics v.6.6 and the MLST online plug-in.

Results and discussion

Summarised data on E. coli from the SmiNet and EARS-Net surveillance systems are presented in

Table 1. The data show that the number of EPE has been steadily increasing in Sweden mostly

represented by ESBL-producing E. coli. Figure 1 illustrates the number of ESBL-producing E. coli cases

in Sweden during the selected time periods distributed per age categories. To be able to interpret

the fluctuations seen correctly the demographic age distribution for the same time periods are also

included in the figure. In Figure 1 we see a peak for acquisition of ESBL-producing E. coli in women

aged 20-30 years. This is probably due to urinary tract infections being more common in these ages

Acc

epte

d A

rtic

le


and amongst women. This peak is seen in all three time periods, but intensified over time which

indicates a trend that coincides with EPE to a higher extent being community-acquired [19]. This is

also supported by Table 1 where it is demonstrated that the median age of acquiring ESBL-producing

E. coli is decreasing significantly according to the trend analysis (p<0.0001). There are several studies

describing acquisition of ESBL-producing E. coli during travel from Sweden to high endemic countries

[20, 21].The decreasing median age in combination with reports of high prevalence in travellers

indicate that the typical patient with ESBL-producing E. coli is shifting from multi-ill hospitalized

patients to younger people with no co-morbidities, but with frequent travels to regions were ESBL-

producing E. coli are endemic.

Antimicrobial susceptibility testing

The susceptibility profile of Swedish ESBL-producing E. coli was stable over the three time periods

(Table 2). Low resistance rates were observed for mecillinam, nitrofurantoin and amikacin.

Nitrofurantoin and mecillinam are both recommended treatment alternatives for uncomplicated

urinary tract infections in Sweden, and had very high activity also against the circulating ESBL-

producing E. coli clones in Sweden. Among the aminoglycosides, amikacin was by far the drug with

the highest activity, and should be considered as the most appropriate aminoglycoside for empiric

treatment when targeting a spectrum also covering ESBL-producing E. coli isolates. A slow decline in

resistance rates was seen for ciprofloxacin. The trimethoprim resistance was high among the ESBL-

producing E. coli, around 70% (50-60% amongst ESBLM), which makes this compound unsuitable for

empirical treatment if such infections are suspected. Ceftazidime susceptibility was 60-80% for non-

CTX-M-15 and acquired AmpC ESBL-producers, meaning it could theoretically be a treatment

alternative in a relatively high number of patients. Generally there was a higher resistance rate

among blaCTX-M-15 producers than for the other ESBL genotypes (Table 2).

Acc

epte

d A

rtic

le


ESBL genotypes

The ESBL-genotypes were highly stable during the three time periods (data not shown). The

dominating genotype was blaCTX-M-15. This genotype is reported the most prevalent on all continents.

The second most common genotype is blaCTX-M-14, but the numbers are significantly lower in Sweden

compared to blaCTX-M-15. The CTX-M enzymes are assigned to phylogroups where blaCTX-M-15 belongs to

phylogroup 1 and blaCTX-M-14 to phylogroup 9. In Sweden 626 (62%) of all E. coli, phenotypic positive

ESBLA or ESBLM isolates (n=1,003), have enzymes of phylogroup 1 and 209 isolates (21%) of

phylogroup 9. One isolate had CTX-M-enzymes of both phylogroups 1 and 9 (blaCTX-M-15 and blaCTX-M-

14). Only two isolates belonged to the CTX-M phylogroup 2 (blaCTX-M-2 genotype). In this collection we

also found 15 isolates (1%) blaSHV producers, blaSHV-12 being the most common. No blaTEM with

extended- spectrum activity were found.

Acquired plasmid-mediated AmpC-production was seen in 50 isolates (5%), blaCMY-2 being the

dominating type, which is also in line with reports from most other countries [22-25]. In the total

collection 86 isolates (9%) had putative chromosomal AmpC (phenotypic AmpC-test positive, but

negative in PCR for plasmid-mediated AmpC) and were not defined as ESBLM-producers in this study

[7]. Among all collected isolates 16 isolates (2%) were negative in both phenotypic genotypic ESBL-

tests.

Molecular epidemiology

PFGE was performed on all confirmed ESBL-producing isolates (n=901) (Figure 2a-c). The typability of

the strains was 94%. Among the isolates, 43% were singletons. The most common PFGE-types were

seen in strains collected from all years and seem to be common types circulating in Sweden. New

types were only observed in low numbers and differed between the collections. These are more

likely to be sporadic cases that are less likely to persist in the hospital environment. The high number

of singletons confirms a high diversity among ESBL-producing E. coli in Sweden.

Acc

epte

d A

rtic

le


MLST was performed on a subset of the material. One or two isolates were selected from each

PFGE-type depending on the size of the PFGE-cluster. The MLST results were then extrapolated to

the other isolates in the respective PFGE-cluster. The PFGE singletons were not tested. However the

entire collection was subjected to PCR screening for the specific pabB genotype that can predict

inclusion in ST131. Some PFGE singletons were found to be ST131. In total 574 of 913 isolates were

assigned to an ST.

The minimal spanning trees in Figure 3a-c show the MLST-types in relation to year of isolation,

resistance gene conferring ESBL activity and phylogenetic grouping.

The MLST that clearly dominated in this Swedish material was ST131 (Figure 3a-c), including 34-38%

of the isolates. This percentage was stable over time. The other ST found representing 2-6% of the

isolates were ST38, ST69, ST405, ST617 and ST648. There was no variation over time suggesting that

the three collections indeed represent the ESBL-producing E. coli circulating in Sweden.

Besides ST131, which is reported from all over the world, ST38, ST405 and ST648 have been

reported as some of the most common ST-types in Canada [26]. A report from Belgium states ST131,

ST617, ST48 (which is lacking completely in our collection) and ST405 as the most common amongst

ESBL-producing E. coli [27]. ST617 is together with ST131 reported as the predominant ST-type in

Nigeria [28]. A recent Danish study report ST131 in 38% of the ESBL-producing E. coli. They found the

ST131 isolates associated to community acquisition, with extensive virulence profiles and having a

great variety of capsular antigens [29]. On the contrary a study from US, Minnesota describe ST131

as being healthcare associated and mostly found in elderly hosts [30].

Phylogenetic grouping was, just like PFGE, performed on all ESBL-confirmed isolates (n=913). This

typing method assigns E. coli to the phylogenetic groups A, B1, B2 and D. All strains were typable. In

the entire point prevalence study collection the B2 type dominated our material with 42-47% of the

isolates. Phylogroup D was the second most common, present in 28-29% of the isolates.

Acc

epte

d A

rtic

le


Phylogenetic group A was represented by 15-21% of the isolates and B1 by 9-10%. The phylogenetic

groups correlated to ST as shown in Figure 3c. Isolates classified as phylogenetic group B2 has been

reported in strains with higher virulence [16]. It is further supported by the fact that phylogenetic

group B2 is almost the only phylogenetic group seen among Swedish the ST131 strains (Figure 3c).

The distribution of ESBL-encoding genes is illustrated in Figure 4. The results were highly similar also

when separating the collections by year of isolation (data not shown).

Concluding remarks

In this study we report that the number of ESBL-producing E. coli is steadily increasing in Sweden.

The combination of data from the national reporting systems and from biannual point prevalence

studies provides a detailed overview of the ongoing development. The genotypes and

epidemiological strain types were stable during the entire period of observation. The most striking

change was the decrease in median age of infected men and women, which could possibly be

explained by the general trends observed in the world today, with increasing community-acquisition,

and also acquisition during foreign travel.

Acknowledgements

We would like to thank Maj Anttila Ringman and Lena Gezelius at the Swedish Institute for

Communicable Disease Control for excellent laboratory assistance. We thank Joakim Isendahl at the

Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet for assistance with the

statistical analysis. We thank the Swedish clinical microbiology laboratories for their contribution of

isolates and data to the surveillance systems of SMI.

Transparency declaration

C. G. Giske has received conference support from Calixa Therapeutics Inc and AB Biodisk, and

speaker's honoraria from Wyeth, AstraZeneca and Meda. Other authors: None to declare.

Acc

epte

d A

rtic

le


References

1 de Kraker ME, Davey PG, Grundmann H, group Bs. Mortality and hospital stay associated with resistant Staphylococcus aureus and Escherichia coli bacteremia: Estimating the burden of antibiotic resistance in Europe. PLoS medicine. 2011; 8: e1001104.

2 Lavigne JP, Vergunst AC, Goret L, et al. Virulence potential and genomic mapping of the worldwide clone Escherichia coli ST131. PLoS One. 2012; 7: e34294.

3 Helldal L, Karami N, Floren K, Welinder-Olsson C, Moore ER, Ahren C. Shift of CTX-M genotypes has determined the increased prevalence of extended-spectrum beta-lactamase-producing Escherichia coli in south-western Sweden. Clin Microbiol Infect. 2013; 19: E87-90.

4 Ostholm-Balkhed A, Tarnberg M, Nilsson M, et al. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae and trends in antibiotic consumption in a county of Sweden. Scandinavian journal of infectious diseases. 2010; 42: 831-838.

5 Stromdahl H, Tham J, Melander E, Walder M, Edquist PJ, Odenholt I. Prevalence of faecal ESBL carriage in the community and in a hospital setting in a county of southern Sweden. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology. 2011; 30: 1159-1162.

6 Kaarme J, Molin Y, Olsen B, Melhus A. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae in healthy Swedish preschool children. Acta paediatrica. 2013; 102: 655-660.

7 Giske CG, Sundsfjord AS, Kahlmeter G, et al. Redefining extended-spectrum beta-lactamases: Balancing science and clinical need. J Antimicrob Chemother. 2009; 63: 1-4.

8 Birkett CI, Ludlam HA, Woodford N, et al. Real-time taqman PCR for rapid detection and typing of genes encoding CTX-M extended-spectrum beta-lactamases. J Med Microbiol. 2007; 56: 52-55.

9 Brolund A, Wisell KT, Edquist PJ, Elfstrom L, Walder M, Giske CG. Development of a real-time sybrgreen PCR assay for rapid detection of acquired AmpC in Enterobacteriaceae. J Microbiol Methods. 2010; 82: 229-233.

10 Rasheed JK, Jay C, Metchock B, et al. Evolution of extended-spectrum beta-lactam resistance (SHV-8) in a strain of Escherichia coli during multiple episodes of bacteremia. Antimicrobial agents and chemotherapy. 1997; 41: 647-653.

11 Hamidian M, Tajbakhsh M, Walther-Rasmussen J, Zali MR. Emergence of extended-spectrum beta-lactamases in clinical isolates of Salmonella enterica in Tehran, Iran. Japanese journal of infectious diseases. 2009; 62: 368-371.

12 Onnberg A, Molling P, Zimmermann J, Soderquist B. Molecular and phenotypic characterization of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum beta-lactamases with focus on CTX-M in a low-endemic area in Sweden. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica. 2011; 119: 287-295.

13 Maslow JN SA, Arbeit RD. Application of pulsed-field gel electrophoresis to molecular epidemiology. ASM Press, Washington, D.C., 1993.

14 Persing DH. Diagnostic molecular microbiology. Current challenges and future directions. Diagn Microbiol Infect Dis. 1993; 16: 159-163.

15 Brolund A, Haeggman S, Edquist PJ, et al. The diversilab system versus pulsed-field gel electrophoresis: Characterisation of extended spectrum beta-lactamase producing Escherichia coli and Klebsiella pneumoniae. J Microbiol Methods. 2010; 83: 224-230.

16 Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Applied and environmental microbiology. 2000; 66: 4555-4558.

17 Clermont O, Dhanji H, Upton M, et al. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J Antimicrob Chemother. 2009; 64: 274-277.

Acc

epte

d A

rtic

le


18 Wirth T, Falush D, Lan R, et al. Sex and virulence in Escherichia coli: An evolutionary perspective. Mol Microbiol. 2006; 60: 1136-1151.

19 Pitout JDD, Nordmann P, Laupland KB, Poirel L. Emergence of Enterobacteriaceae producing extended-spectrum beta-lactamases (ESBLs) in the community. J Antimicrob Chemoth. 2005; 56: 52-59.

20 Tangden T, Cars O, Melhus A, Lowdin E. Foreign travel is a major risk factor for colonization with Escherichia coli producing CTX-M-type extended-spectrum beta-lactamases: A prospective study with Swedish volunteers. Antimicrobial agents and chemotherapy. 2010; 54: 3564-3568.

21 Tham J, Odenholt I, Walder M, Brolund A, Ahl J, Melander E. Extended-spectrum beta-lactamase-producing Escherichia coli in patients with travellers' diarrhoea. Scandinavian journal of infectious diseases. 2010; 42: 275-280.

22 Denisuik AJ, Lagace-Wiens PR, Pitout JD, et al. Molecular epidemiology of extended-spectrum beta-lactamase-, AmpC beta-lactamase- and carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolated from Canadian hospitals over a 5 year period: CANWARD 2007-11. J Antimicrob Chemother. 2013; 68 Suppl 1: i57-i65.

23 Voets GM, Platteel TN, Fluit AC, et al. Population distribution of beta-lactamase conferring resistance to third-generation cephalosporins in human clinical Enterobacteriaceae in the Netherlands. PLoS One. 2012; 7: e52102.

24 Kiiru J, Kariuki S, Goddeeris BM, Butaye P. Analysis of beta-lactamase phenotypes and carriage of selected beta-lactamase genes among Escherichia coli strains obtained from Kenyan patients during an 18-year period. BMC microbiology. 2012; 12: 155.

25 Matsumura Y, Yamamoto M, Higuchi T, et al. Prevalence of plasmid-mediated AmpC beta-lactamase-producing Escherichia coli and spread of the ST131 clone among extended-spectrum beta-lactamase-producing E. coli in Japan. International journal of antimicrobial agents. 2012; 40: 158-162.

26 Peirano G, Sang JH, Pitondo-Silva A, Laupland KB, Pitout JD. Molecular epidemiology of extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae over a 10 year period in Calgary, Canada. J Antimicrob Chemother. 2012; 67: 1114-1120.

27 Smet A, Martel A, Persoons D, et al. Characterization of extended-spectrum beta-lactamases produced by Escherichia coli isolated from hospitalized and nonhospitalized patients: Emergence of CTX-M-15-producing strains causing urinary tract infections. Microbial drug resistance. 2010; 16: 129-134.

28 Aibinu I, Odugbemi T, Koenig W, Ghebremedhin B. Sequence type ST131 and ST10 complex (ST617) predominant among CTX-M-15-producing Escherichia coli isolates from Nigeria. Clin Microbiol Infect. 2012; 18: E49-51.

29 Olesen B, Hansen DS, Nilsson F, et al. Prevalence and characteristics of the epidemic multiresistant Escherichia coli ST131 clonal group among extended-spectrum beta-lactamase-producing E. coli isolates in Copenhagen, Denmark. J Clin Microbiol. 2013; 51: 1779-1785.

30 Banerjee R, Johnston B, Lohse C, Porter SB, Clabots C, Johnson JR. Escherichia coli sequence type 131 is a dominant, antimicrobial-resistant clonal group associated with healthcare and elderly hosts. Infection control and hospital epidemiology : the official journal of the Society of Hospital Epidemiologists of America. 2013; 34: 361-369.

Acc

epte

d A

rtic

le


Figure 1. The incidence per age-category of ESBL-producing E. coli. The demografic distribution of

05000

0

1000

00

1500

00

2000

00

2500

00

3000

00

3500

00

4000

00

020406080100

120

140

160

180

200

0-4

5-9

10-1

415

-19

20-2

425

-29

30-3

435

-39

40-4

445

-49

50-5

455

-59

60-6

465

-69

70-7

475

-79

80-8

4>8

5

Number of individuals/age category

Number of E.coli cases/100 000 inhabitants

Age

cate

gory

E.c.

wom

en (2

007)

E.c.

men

(200

7)E.

c. w

omen

(200

9)E.

c. m

en (2

009)

E.c.

wom

en (2

011)

E.c.

men

(201

1)w

omen

(200

7)m

en (2

007)

wom

en (2

009)

men

(200

9)w

omen

(201

1)m

en (2

011)

Acc

epte

d A

rtic

le


age in Sweden is also illustrated for the same time periods.

Figure 2. Circle diagrams illustrating PFGE-types in ESBL-producing E. coli from the three point

prevalence collections.

a)

b)

c)

2007 EC-05 EC-09

EC-11 EC-17

EC-18 EC-21

EC-27 EC-35

EC-44 like EC-65 like

EC-74 EC-81


Singletons NT

2009 EC-05 EC-09

EC-11 EC-17

EC-18 EC-21

EC-27 EC-35


EC-74 EC-81


Singletons NT

2011 EC-05 EC-09

EC-11 EC-17

EC-18 EC-21

EC-27 EC-35


EC-74 EC-81


Singletons NT

Acc

epte

d A

rtic

le*Only the most frequent PFGE-types are named, all other PFGE-types are represented by ≥5 isolates

in the same year.

Figure 3. Minimal-spanning tree (MST) of ESBL-producing E. coli subjected to MLST. Each circle

corresponds to a ST. The MST circle size is correlated to number of isolates included. The length and

characteristic of the lines connecting the circles correspond to the relationship between STs. Thick

lines represent single-locus variants, thin lines corresponds to double locus variants and broken lines

describes three to seven allele differences between the ST-types. Grey fields surrounding the circles

are illustrating ST-types of the same clonal complex (cc).

a. Minimal-spanning tree (MST) describing ESBL-genotypes in association to ST-type.

ST167ST167ST167ST167ST167ST167ST167ST167ST167









ST90, ST410ST90, ST410ST90, ST410ST90, ST410ST90, ST410ST90, ST410ST90, ST410ST90, ST410ST90, ST410ST500ST500ST500ST500ST500ST500ST500ST500ST500

ST977ST977ST977ST977ST977ST977ST977ST977ST977 ST351ST351ST351ST351ST351ST351ST351ST351ST351

ST3665, ST648ST3665, ST648ST3665, ST648ST3665, ST648ST3665, ST648ST3665, ST648ST3665, ST648ST3665, ST648ST3665, ST648







ST778ST778ST778ST778ST778ST778ST778ST778ST778ST68, ST69ST68, ST69ST68, ST69ST68, ST69ST68, ST69ST68, ST69ST68, ST69ST68, ST69ST68, ST69










CTX-M-15CTX-M-14 CTX-M-9 (1 snp) CTX-M-27 CTX-M-1 SHV-12 CMY-2 CTX-M-9

Acc

epte

d A

rtic

le

b. MST illustrating STs in relation to year of E. coli ESBL isolation.







ST1603ST1603ST1603ST1603ST1603ST1603ST1603ST1603ST1603ST58ST58ST58ST58ST58ST58ST58ST58ST58
























2011 2009 2007

Acc

epte

d A

rtic

lec. MST illustrating phylogenetic groups amongst STs.

Figure 4. Distribution of ESBL genotypes amongst E. coli phylogenetic groups in the total collection of

913 ESBL-producing isolates.
































ST372ST372ST372ST372ST372ST372ST372ST372ST372B2 D B1 A

Acc

epte

d A

rtic

le


Table 1: Results from all reported cases of ESBL-producing Enterobacteriaceae in Sweden during

selected time-points.

Surveillance system 2007 2009 2011 Women Men All Women Men All Women Men All

SmiNet Total number of cases

1,396 694 2,098* 2,413 1,247 3,691** 3,699 1,967 5,666

Total number of E. coli cases

1,171 516 1,693 2,125 1,014 3,160 3,379 1,689 5,068

E. coli from urine

917 (78 %)

294(57 %)

1,214(72 %)

1,683(79 %)

535(53 %)

2,225(70 %)

2,497 (74 %)

796(47 %)

3,293(65 %)

Invasive E. coli (blood and CSF)

34 (3 %)

47(9 %)

81(5 %)

67(3 %)

83(8 %)

150(5 %)

101 (3 %)

151(9 %)

252(5 %)

E. coli from screening (faeces and rectum)

144 (12 %)

98(19 %)

242(14 %)

265(12 %)

246(24 %)

523(15 %)

556 (16 %)

543(32 %)

1,099(22 %)

Median age E. coli****

60 63 62 55 64 59 50 64 57

EARS-Net***

E. coli 2,049 1,739 3,788 2,225 2,057 4,282 2,688 2,472 5,160E. coli ESBL 38 (2%) 47

(3%) 85 (2%)

49 (2%)

62 (3%)

111(3%)

76 (3%)

109 (4%)

185(4%)

* Data missing for 8 cases regarding gender. ** Data missing for 31 cases regarding gender.

0

50

100

150

200

250

300

350

400

450

A B1 B2 D

SHV-12SHV-5SHV-1CTX-M-96CTX-M-65CTX-M-55CTX-M-32CTX-M-27CTX-M-24CTX-M-16CTX-M-15CTX-M-14CTX-M-13CTX-M-9 (1snp)CTX-M-9CTX-M-3CTX-M-2CTX-M-1CMY-57CMY-42CMY-5CMY-2

Acc

epte

d A

rtic

le


*** The EARS-Net data for E. coli have been revised and the numbers do not agree completely with the data on the ECDC website. **** Statistically significant trend of decreasing median age (p<0.0001)

Table 2: Antimicrobial susceptibility and resistance in ESBL-producing E. coli in Sweden 2007, 2009 and

2011.

Antimicrobial

Resistance (%) per year

2007 2009 2011

CTX-M-15 n=136

Acquired AmpC

n=7

Other ESBL¤ n=70

CTX-M-15 n=176

Acquired AmpC n=16

Other ESBL¤ n=86

CTX-M-15 n=250

Acquired AmpC n=27

Other ESBL¤ n=132

Cefadroxil 136 (100) 7 (100) 70 (100) 176 (100) 16 (100) 86 (100) 250 (100) 27 (100) 132 (100)

Cefotaxime 136 (100) 6 (86) 69 (99) 176 (100) 16 (100) 86 (100) 250 (100) 27 (100) 131 (99)

Ceftazidime 129 (95) 7 (100) 12 (17) 158 (90) 16 (100) 18 (21) 228 (91) 27 (100) 49 (37)

Piperacillin-tazobactam

2 (1) 4 (36) 1 (1) 46 (26) 4 (25) 7 (8) 45 (18) 4 (15) 9 (7)

Mecillinam 4 (3) 0 6 (8) 16 (9) 4 (25) 15 (17) 15 (6) 4 (15) 8 (6)

Ciprofloxacin 116 (85) 0 42 (60) 142 (81) 5 (31) 31 (36) 187 (75) 8 (30) 46 (35)

Gentamicin 45 (33) 1 (14) 22 (31) 81 (46) 2 (13) 36 (42) 118 (47) 6 (22) 35 (27)

Tobramycin 42 (31) 0 4 (6) 113 (64) 1 (6) 26 (30) 150 (60) 6 (22) 31 (23)

Amikacin 0 0 0 12 (7) 0 2 (2) 0 0 3 (2)

Nitrofurantoin 12 (9) 2 (29) 7 (10) 19 (11) 0 2 (2) 10 (4) 1 (4) 0

Trimethoprim 96 (71) 4 (57) 54 (77) 130 (74) 9 (56) 61 (71) 183 (73) 13 (48) 88 (67)

Meropenem* NT*** NT NT 0 0 0 0 0 0

Fosfomycin** NT NT NT NT NT NT 9 (4) 0 7 (5)

Tigecycline* NT NT NT 0 0 0 0 0 1 (1)

Colistin* NT NT NT 2 (1) 0 0 2 (1) 0 1 (1)

Aminoglycoside and fluoroquinolone

54 (40) 1 (14) 12 (17) 108 (61) 2 (13) 18 (21) 131 (52) 3 (11) 6 (5)

¤ Other ESBLs include CTX-Ms other than CTX-M-15 and SHVs. Bold face: statically significant difference between prevalence of resistance in CTX-M-15 vs other summarized genotypes (p<0.05). * Only tested on the isolates from 2009 and 2011 ** Only tested on the isolates from 2011 ***NT = not tested

Documents

Epidemiology of extended-spectrum β-lactamase-producing Escherichia coli in Sweden 2007–2011