Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

ScienceDirect

www.e l sev i e r . com / l oca te / s c r

Stem Cell Research (2013) 11, 990–1002

Self-renewal and multilineage differentiationof mouse dental epithelial stem cells

Julia Yu Fong Changa,b,⁎, Cong Wanga,c, Chengliu Jina,1, Chaofeng Yanga,2,Yanqing Huanga, Junchen Liua, Wallace L. McKeehana,Rena N. D'Souzab, Fen Wanga,⁎

a Center for Cancer and Stem Cell Biology, Institute of Biosciences and Technology, Texas A&M University, Houston,TX 77030–3303, USAb Department of Biomedical Sciences, Baylor College of Dentistry, Texas A&M University, Houston, TX 77030–3303, USAc College of Pharmacy, Wenzhou Medical University, PR China

Received 9 February 2013; received in revised form 20 June 2013; accepted 21 June 2013Available online 1 July 2013

Abstract Understanding the cellular and molecular mechanisms underlying the self-renewal and differentiation of dentalepithelial stem cells (DESCs) that support the unlimited growth potential of mouse incisors is critical for developing novel toothregenerative therapies and unraveling the pathogenesis of odontogenic tumors. However, analysis of DESC properties andregulation has been limited by the lack of an in vitro assay system and well-documented DESC markers. Here, we describe anin vitro sphere culture system to isolate the DESCs from postnatal mouse incisor cervical loops (CLs) where the DESCs arethought to reside. The dissociated cells from CLs were able to expand and form spheres for multiple generations in the culturesystem. Lineage tracing indicated that DESC within the spheres were epithelial in origin as evident by lineage tracing. Uponstimulation, the sphere cells differentiated into cytokeratin 14- and amelogenin-expressing and mineral material-producingcells. Compared to the CL tissue, sphere cells expressed high levels of expression of Sca-1, CD49f (also designated as integrinα6), and CD44. Fluorescence-activated cell sorting (FACS) analyses of mouse incisor CL cells further showed that the CD49fBright

population was enriched in sphere-forming cells. In addition, the CD49fBright population includes both slow-cycling and Lgr5+

DESCs. The in vitro sphere culture system and identification of CD49fBright as a DESC marker provide a novel platform forenriching DESCs, interrogating how maintenance, cell fate determination, and differentiation of DESCs are regulated, anddeveloping tooth regenerative therapies.

© 2013 Elsevier B.V. All rights reserved.

Abbreviations: FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; DESC, dental epithelial stem cell; CL, cervicalloop; SC, stem cell; OEE, outer enamel epithelium; IEE, inner enamel epithelium; SR, stellate reticulum; SI, stratum intermedium; Alp,alkaline phosphatase⁎ Correspondence to: F. Wang, Center for Cancer and Stem Cell Biology, Institute of Biosciences and Technology, Texas A&M University,

Houston, TX, 77030-3303, USA. Tel.: +1 713-677-7520; fax: +1 713 677 7512 or J.Y.F. Chang, Oral & Maxillofacial Surgery, School ofDentistry, University of Washington, Seattle, WA 98195, USA. Tel.: +1 206 221 3960.

E-mail addresses: fwang@ibt.tamhsc.edu (F. Wang), jyfchang@uw.edu (J.Y.F. Chang).1 Current address: Transgenic and Gene Targeting Core, Georgia State University, Atlanta, GA 30302-4010, USA.2 Current address: Division of Endocrinology, The University of Texas Southwestern Medical Center, Dallas, TX 75390, USA.

1873-5061/$ - see front matter © 2013 Elsevier B.V. All rights reserved.http://dx.doi.org/10.1016/j.scr.2013.06.008

991Self-renewal and multilineage differentiation of mouse dental epithelial stem cells

Introduction tissues, such as intestine and hair follicle, expression of the

Stem cells (SCs) that have the capacity to self-renew and togive rise to differentiated progeny are of broad interestbecause of their potential in regenerative therapy and theirpurported role in tumor initiation and relapse. The ability toidentify and isolate SCs is essential for understandingmolecular mechanisms underlying SC self-renewal andexpansion, as well as their roles in tumorigenesis. Severalapproaches have been used to isolate or define SCs from avariety of organs. These include cell sorting based on SCsurface markers (Stingl et al., 2006; Lawson et al., 2007;Spangrude et al., 1988), bromodeoxyuridine (BrdU) or otherlong-term label retention for slow cycling activities(Bickenbach and Chism, 1998; Tumbar et al., 2004), sphere-forming assays for the self-renewal property (Reynolds andRietze, 2005; Dontu et al., 2003; Xin et al., 2007), and lineagetracing for their progeny (Snippert and Clevers, 2011).Emerging evidence shows that two types of SCs exist invarious tissues, in separate yet adjoining locations. Theslow-cycling SCs can be identified by long-term labelretention and active SCs that do not retain labels due torapid cell divisions can be identified by expression of Lgr5(Leucine-rich repeat-containing G protein-coupled recep-tor5) (Snippert and Clevers, 2011; Barker et al., 2007, 2012;Huch et al., 2013).

Teeth are highly mineralized organs derived from thedental epithelium and the underlying mesenchymal cellsoriginally from neural crest, which undergo a series ofsequential and tightly regulated processes to form a tooth(Grobstein, 1967; Thesleff and Hurmerinta, 1981; Thesleff etal., 1995). Five different lines of dental stromal cells thatpossess SC properties have been established from developingor mature human teeth (Gronthos et al., 2002; Miura et al.,2003; Sonoyama et al., 2008; Seo et al., 2004; Morsczeck etal., 2005). However, progressing in characterizing dentalepithelial stem cells (DESCs) has been slow. It has beenproposed that adult human teeth do not have DESCs sinceameloblasts, the terminally differentiated dental epithelialcells, shed after tooth eruption in humans. Moreover, thelack of culture systems and well-accepted surface markersfor DESCs further impede this research. Rodent incisors growcontinuously throughout life, which is made possible by theexistence of DESCs in the cervical loop (CL) region (Tummersand Thesleff, 2003; Yokohama-Tamaki et al., 2006; Haradaet al., 1999; Harada and Ohshima, 2004). The presence ofDESCs in the CL region is evidenced by the gradualdifferentiation of ameloblast-lineage cells apical to theincisal direction (Mitsiadis et al., 2007), the directional cellmigration demonstrated by vital carbocyanine dye DiItracking, long-term BrdU retention, cell cycle kineticsstudies (Harada et al., 1999), and in vivo lineage trace ofSox2 expressing cells (Juuri et al., 2012).

It has been proposed that slow cycling DESCs within theCL mainly reside in the stellate reticulum (SR) (Harada etal., 1999; Harada and Ohshima, 2004; Suomalainen andThesleff, 2010). Recently, however, by tracing the long-term retention of H2B-GFP fusion protein (Tumbar et al.,2004), it has been shown that slow cycling DESCs are mainlylocated in the outer enamel epithelium (OEE) (Seidel et al.,2010). Interestingly, similar to rapidly renewing adult

active SC marker Lgr5 has been found in the SR region of theCL (Suomalainen and Thesleff, 2010). Several other SCmarkers, such as Bmi-1, Oct 3/4, and Sox2 have recentlybeen reported to be expressed in the CL (Li et al., 2011;Juuri et al., 2012). In vivo lineage tracing experimentsfurther shows that the Sox2 positive DESCs give rise tomultiple lineages of tooth epithelial cells (Juuri et al.,2012). However, to date the isolation of DESCs is stillproblematic because of the lack of DESC surface markers andthe paucity of in vitro assay systems for isolating and testingDESC properties.

To address these critical issues, we established anin vitro sphere culture system for DESCs isolated from theCL. Thorough analyses indicated that the DESC sphere cellsdisplayed SC properties and expressed high levels of SCmarkers, including Sca-1, CD49f (also designated asintegrin α6), and CD44. Furthermore, it was demonstratedthat CD49fBright was a suitable cell surface marker foridentifying and isolating DESCs. Therefore, our studyestablishes a foundation for enriching and expandingDESCs for dental regenerative treatments and for under-standing DESC-related pathogenesis.

Materials and methods

Animals and isolation of tissues

All animals were housed in the Program of Animal Resourcesof the Institute of Biosciences and Technology, Texas A&MHealth Science Center, and were handled in accordance withthe principles and procedure of the Guide for the Care andUse of Laboratory Animals. All experimental procedureswere approved by the Institutional Animal Care and UseCommittee. Mice carrying the Nkx3.1Cre knock-in alleles (Linet al., 2007), ROSA26LacZ (Soriano, 1999), ROSA26EYFP

(Srinivas et al., 2001) reporter alleles, K5rtTA (Diamond etal., 2000), H2B-GFP (Tumbar et al., 2004), Lgr5LacZ,Lgr5EGFP-ires-CreERT2 (Barker et al., 2007), and Lgr4LacZ (Wenget al., 2008) transgenes were maintained and genotyped asdescribed elsewhere. Inducible K5rtTA-H2BGFP expressionwas achieved by administration of regular chow containing0.0625% doxycycline (Harlan Teklad).

Dissociation of the CL epithelial cells for DESCsphere culture

The CL regions defined as the apical tissue distal to the toothmineralized portion (Fig. 1A) were dissected from postnatalday (P) 7 mice unless otherwise indicated. The dissectedtissue was first incubated in a solution containing 1 mg/mldispase and 1 mg/ml collagenase I (Life Technologies, GrandIsland, NY) for 30 min at 37 °C. Tissues were furtherdissociated by incubation in 0.005% trypsin for 25 min at37 °C with gentle pipetting. Cells were sieved through a40 μm cell strainer (Falcon) to obtain a single-cell suspen-sion. The cells were suspended in 50 μl oral epithelialprogenitor medium (CnT-24) (Cellntec Advanced cell sys-tems, Switzerland), and mixed with Matrigel (BD Biosci-ences) at a 1:1 ratio at a density of 50,000 cells/mlin primary cultures and 10,000 cells/ml in subsequent

Figure 1 Identification of label retaining slow-cycling and Lgr5-expressing active dental epithelial stem cells (DESC) in the mouseincisor cervical loop (CL). A. Representative fluorescent microscopy pictures of K5-H2BGFP mouse maxillary incisor at postnatal 28 day(P28) before (a) or after (b) doxycycline treatment for 7 days. Left box, the mature ameloblast region of the same tooth; right box,confocal image of a frozen section of the labial CL shows GFP retaining cells. B. Wholemount X-gal staining of wildtype and Lgr5LacZ

maxillary incisor. C. Section of the same tissues in (B) with eosin counterstaining showing that Lgr5-expressing cells were scarce andlocated in the SR opposite to the OEE. D. Wholemount of X-gal staining of Lgr4LacZ maxillary incisor (a) and section of the same tissuewith eosin counterstaining (b) showing Lgr4-expressing cells. Dashed lines outline the CL; arrow heads indicate labial and arrows indicatethe lingual CLs; SR, stellate reticulum; OEE, outer enamel epithelium; F, follicular; and P, dental papillary stromal cells.

992 J.Y.F. Chang et al.

passages. The mixtures were plated around the rims of wellsin a 12-well plate and allowed to solidify at 37 °C for 30 min.After adding 1 ml of CnT-24 medium to each well, the cellswere cultured in a CO2 incubator at 37 °C. The medium wasreplenished every 3 days. Ten to fourteen days after plating,spheres with a diameter of over 50 μm were counted. To

passage spheres, the medium was aspirated off and Matrigelwas digested by incubation in 500 μl of dispase solution(1 mg/ml, dissolved in DPBS) for 30 min at 37 °C. Digestedcultures were collected, pelleted, resuspended, and incu-bated in 0.005% Trypsin/EDTA (Life Technologies) for 25 minat 37 °C, and passed through a 40 μm filter. Cells were

993Self-renewal and multilineage differentiation of mouse dental epithelial stem cells

counted and replated. The differentiation medium wascomposed of DMEM + 10%FBS with 3.0 mM Calcium, 100 nMdexamethasone, 10 mM β-glycerolphosphate, and 50 μg/mlL-ascorbic acid. LS8 cells (Chen et al., 1992) derived fromenamel organ and human 293 cells were maintained in 5%FBS-DMEM.

Histology and histochemical analyses

Spheres were fixed with 4% paraformaldehyde (PFA) solutionfor 30 min at 4 °C. Postnatal mouse heads were fixed with4% PFA solution at 4 °C overnight, and then decalcified byincubation in the decalcifying solution containing 12.5%EDTA and 2.5% PFA for 2 weeks at 4 °C. The decalcifyingsolution was changed twice a week. Fixed tissues wereserially dehydrated with ethanol, embedded in paraffin, andcompletely sectioned according to standard procedures.Immunohistochemical analyses were performed on paraffinsections (5 μm) or frozen sections (10 μm) mounted onSuperfrost/Plus slides (Fisher Scientific, Pittsburgh, PA).Antigens were retrieved by boiling in citrate buffer (10 mM)for 20 min or as suggested by the manufacturers. Frozenincisor CL tissue sections, spheres, and cytospins were fixedin cold acetone for 5 min. The sections were incubated withprimary antibodies diluted in PBS at 4 °C overnight. Thesources and concentrations of primary antibodies are: rabbitanti-amelogenin (1:1000 for tissue section, Western blot and1:2000 for spheres and cells, a generous gift from Dr. JanC.C.-Hu, University of Michigan, School of Dentistry); mouseanti-CK14 (1:400 for tissue section and cells, 1:3000 forWestern blot, Santa Cruz Biotechnology (Santa Cruz, CA);anti-human/mouse CD49f (GoH3; 1:100, BioLegend, SanDiego, CA), anti-human/mouse CD44 (1:100, eBioscience,San Diego, CA; clone IM7), and rat anti-Sca-1 (1:100, BDPharmingen, San Diego, CA; clone D7). Specifically boundantibodies were detected with the ExtraAvidin PeroxidaseSystem from Sigma (Saint Louis, MO) or with FITC- orAPC-conjugated secondary antibodies (Life Technologies,Grand Island, NY), and visualized on a Zeiss LSM 510 ConfocalMicroscope.

To assess alkaline phosphatase activity, the sphere cellswere fixed with 4% PFA for 10 min and washed with the APbuffer (100 mM Tris–HCl, pH 9.5, 100 mM NaCl, 10 mMMgCl) for 10 min, followed by color development for8–10 min in the solution containing NBT/BCIP substrate.

Alizarin red S staining was used to assess mineralization incells and tissue sections. Briefly, cells were fixed with 4%PFA for 10 min and washed with distilled water and thenstained with 2% alizarin red S, pH 4.2 for 1–2 min. Cells orsections were dehydrated in acetone and acetone–xylene(1:1) solution (20 dips each), cleared with xylene, andmounted.

For BrdU labeling assays, BrdU (Sigma, St. Louis, MO) wasadded to the culture medium at a final concentration of10 nM after seeding. After incubation for 24 h, the cellswere washed with PBS three times. New culture media werethen added to each well. Incorporated BrdU was detected byimmunostaining with anti-BrdU antibody (1:500 dilution,Sigma Co, St. Louis, MO). For LacZ staining, the tissues andspheres were first lightly fixed with 0.2% glutaraldehyde for1 h or 15 min, respectively and then incubated overnight

with 1 mg/ml X-Gal at room temperature. The tissues weredehydrated and processed according regular procedures forparaffin embedding after a wash with PBS for 10 min,post-fixed with 4% PFA at room temperature overnight, anddecalcified as aforementioned.

In situ hybridization

Rehydrated paraffin-embedded tissue sections or frozensections were digested with 20 μg/ml protease K for 7 minat room temperature. After prehybridization at 65 °C for2 h, the hybridization was carried out by overnightincubation at 65 °C with 0.5 μg/ml digoxigenin labeledRNA probes for the indicated genes. Non-specificallybound probes were removed by washing four times with0.1 x DIG washing buffer at 60 °C for 30 min. Specificallybound probes were detected using alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche, Indianapo-lis, IN). The Olfm4 probe was constructed as described(Barker et al., 2007).

Flow cytometry and cell sorting analysis

Tooth CL or sphere cells were stained with: APC conjugatedanti-CD49f (BioLegend, clone GoH3, 20 μl/100ul), APCconjugated anti-Sca-1 (BD Pharmingen and Miltenyi Biotec,Auburn, CA; clone D7, 1 mg/ml), or FITC or APC conjugatedanti-CD44 (BD Pharmingen and eBioscience; clone IM7,1 mg/ml), as well as PE. All antibody incubations, washes,and flow cytometric analyses were performed in cell sortingbuffer (1× PBS, 2% FBS). Analyses were conducted on a BDFACSAria I SORP or BD Accuri C6 Flow cytometer, and aminimum of 10,000 counts was acquired for each experi-mental condition. Fluorescence-activated cell sorting (FACS)was performed on a BD FACSAria I SORP, and cells weresorted into DMEM + 20% FBS. Primary antibody labelingfor flow cytometry and cell sorting was conducted usinga 20-min ice-cold incubation with antibody dilutionaccording to manufacturer's suggestions in a volume of100 μl per 1 million cells in cell sorting buffer. The cellswere washed in 1 ml ice-cold cell sorting buffer, re-suspended in 0.5 ml cell sorting buffer, and analyzed.Proper isotype controls were used according tomanufacturer's suggestions.

Gene expression analysis

Total RNA was extracted with the Ribopure RNA isolationreagent (Ambion, TX). Reverse transcription was carried outwith SuperScript III (Life Technologies, Grand Island, NY) andrandom primers. Real-time PCR was performed on Mx3000(Strategene), using the SYBR Green JumpStart Taq ReadyMix(Sigma, St. Louis, MO) with pairs of primers specific for eachtranscript and following the manufacturer's protocol. Theratio between expression levels in the two samples wascalculated by relative quantification, using β-actin as areference transcript for normalization. The primer se-quences are listed in Table 1.

Table 1 Nucleotide sequence of primers.

Genes Primers

Abcg 5′ GGGTGGCTTTTGTGGCAGGC 3′5′ ACTTGCCTCCGCCTGTGGGT 3′

CD44 5′ AATTCCGAGGATTCATCCCA 3′5′ CGCTGCTGACATCGTCATC 3′

Sca-1 5′ ATGGACACTTCTCACACTACAAAG 3′5′ TCAGAGCAAGGTCTGCAGGAGGACTG 3′

CD49f 5′ GTGGCCCAAGGAGATTAGC 3′5′ GTTGACGCTGCAGTTGAGA 3′

CD133 5′ ACCAACACCAAGAACAAGGC 3′5′ GGAGCTGACTTGAATTGAGG 3′

Klf4 5′ CACCATGGACCCGGGCGTGGCTGCCAG AAA 3′5′ TTAGGCTGTTCTTTTCCGGGGCCACGA 3′

Lgr4 5′ TACAGATGCAGCAAATGCCAC 3′5′ GGCAGTGATGAACAAGACGCA 3′

Lgr5 5′ CCTCTGCTTCCTAGAAGAGTTAC 3′5′ CTAGTTCCTTAAGGTTGGAGAGT 3′

CK14 5′ GACTTCCGGACCAAGTTTGA 3′5′ CTTGAGGCTCTCAATCTGC 3′

Amg 5′ CCTGCCTCCTGGGAGCAGCTT 3′5′ CACGGGCTGTTGAGCTGGCA 3′

Amb 5′ TGGGGCTCAAGGCATGGCAC 3′5′ TGCAGCAGTGGGCTGGAGGA 3′

Jagged1 5′ GCACCCGCGACGAGTGTGAT 3′5′ TCCCAGGCCTCCACCAGCAA 3′

Notch 1 5′ CCCACTGTGAACTGCCCTAT 3′5′ CACCCATTGACACACACACA 3′

Notch 2 5′ TGCAGCTCAGAGGGCAGCCT 3′5′ GCCACGGCACAAGTCCCTCC 3′

ALP 5′ CATGGGTGGCGGCCGGAAAT 3′5′ CCTGGAGGGGTCAAGGGCCA 3′

EMSP-1 5′ CCCACCTCTCCATCCAGCAC 3′5′ GGCCTTGTAGTCAGTCCATAGC 3′

Tuftelin 1 5′ CTGCCTGCAGAAGCTCCGGG 3′5′ GGTCTGACTGGTGTCGCCGC 3′

β-actin 5′ GCACCAAGGTGTGATGGTG 3′5′ GGATGCCACAGGATTCCATA 3′

994 J.Y.F. Chang et al.

Western blotting analysis

Dissected teeth or cultured cells were homogenized in thecell lysis buffer (0.5% Triton X-100-PBS), and the lysateswere harvested by centrifugation. Western blot analyseswere performed as previously described (Zhang et al., 2008).Quantification of the band intensities was performed usingNIH Image J software (http://rsb.info.inh.gov/ij).

Statistical analyses

Except specified in the Results or figure legends, all datawere collected from three independent experiments andexpressed as means ± standard deviation. The statisticalsignificance between means of multiple groups was assessedby ANOVA and between means of two groups was assessed byt-test. Data was analyzed by using SPSS 16.0 software.p ≤ 0.05 was considered significant.

Results

Mouse incisor CLs contain both slow-cycling andLgr5+ DESCs

To determine whether mouse incisors had slow-cycling SCs,the tetracycline-regulated K5-H2BGFP reporter system wasutilized to trace the label retaining cells. Expression of thehistone 2B-green fluorescent protein (H2B-GFP) fusionprotein was driven by the keratin 5 (K5) promoter underthe control of tetracycline-suppressor (Tumbar et al., 2004).All dental epithelial cells were H2B-GFP positive withoutbeing treated with doxycycline (Fig. 1A). After doxycyclinetreatment to turn off H2B-GFP expression for 7 days, theinner enamel epithelium (IEE) where transit amplifying (TA)cells were located was GFP negative. The slow-cycling GFPretaining cells only were present at the labial and lingual CLsand differentiated ameloblast areas (Fig. 1A). Furthermore,the GFP retaining cells in the labial CL were mainly locatedin the OEE, which was similar to previously reported results(Seidel et al., 2010). As the Lgr5LacZ reporter alleles hadbeen widely used to identify active SCs (Barker et al., 2007),we then used the mice carrying Lgr5LacZ alleles to identityactive DESCs in the CL. Wholemount LacZ staining revealedthat only a few cells in the labial CL were weakly Lgr5+

(Fig. 1B). Tissue section staining showed that the Lgr5LacZ

positive cells were mainly located in the SR within the zoneadjacent to the OEE (Fig. 1C), which was consistent with insitu hybridization data showing Lgr5 expression in the SR ofembryonic incisors (Suomalainen and Thesleff, 2010). Unlikelabel retaining/slow-cycling SCs in both labial and lingualCLs, Lgr5 expression was identified only in the labial, but notthe lingual, CLs (Fig. 1C). Lgr4 is expressed in slow cyclingSCs, active (Lgr5+) SCs, TA cells, and stromal cells surround-ing SC niches of dermal papillae and intestine (Snippert etal., 2010; de Lau et al., 2011). We then used the Lgr4LacZ

reporter to identify the Lgr4-expressing cells in the CL(Fig. 1D). Strong and broad X-gal stained cells were found inboth epithelial and stromal cells surrounding the CL.Sections of the wholemount X-gal stained tissues furthershowed that the Lgr4 expressing cells were located in theOEE and SR regions of the labial CL, as well as the dentalfollicular and dental papillary stromal cells. Together, thesedata suggest that similar to other actively renewing organs,the mouse incisor CL contains both slow-cycling and Lgr5+

SCs.

Establishing a sphere culture system suitable forpropagating DESCs

Since the in vitro sphere-forming capacity is a common wayto assess the self-renewal property of SCs from various organs(Reynolds and Rietze, 2005; Dontu et al., 2003; Xin et al.,2007), a sphere culture system optimized for propagatingDESCs was established. The CL regions defined as the apicaltissue distal to the tooth mineralized portion (Fig. 1A) weredissected from postnatal day (P) 7 mice. The dissociated cellswere cultured in Matrigel (Fig. 2Aa). The cells formedspheres within 7–10 days after inoculation with an efficiencyof 0.0513% ± 0.0133%. The average diameter of the sphereswas 100 μmor larger. Under the same conditions, immortalized

Figure 2 DESC spheres contain both label retaining and Lgr5-expressing DESCs. A. Morphology of DESC spheres. Phase contrastimages of DESC spheres (a); H&E staining of a DESC sphere section (b). B. Cell-lineage tracing with Nkx3.1cre-ROSA26LacZ (a) orK5-H2BGFP reporter showing the epithelial origin of DESC spheres (b). C. BrdU (a) or H2BGFP (b) label retaining cells in DESC spheres.Arrows indicate label retaining cells. Insert is a negative control carrying only the H2BGFP transgene. D. In situ hybridization showingOlfm4 (representing Lgr5)-expressing cells in DESCs (a) and sense probe as negative control (b). E. X-gal staining with eosincounterstaining of DESC spheres bearing Lgr4LacZ (a) or wildtype Lgr4 animals (b). F. RT-PCR analyses of total RNAs extracted from14-day cultured DESC spheres derived from maxillary (uS) or mandibular (lS) incisors or the cervical loop (CL). -, no RT for negativecontrol. To-Pro3 (TP3) was used for nuclear counter staining. Scale bar, 100 μm.

995Self-renewal and multilineage differentiation of mouse dental epithelial stem cells

LS8, tooth epithelial cells derived from enamel organ (Chen etal., 1992), and a differentiated tooth epithelial cell linedeveloped in our laboratory did not form spheres (data notshown). H&E staining of sphere sections revealed that themajority of spheres had an organized, concentric structure(Fig. 2Ab). The cells at the periphery were small, hadhyperchromatic nuclei and a high nuclear to cytoplasmic ratio.The cells in the middle were larger with abundant cytoplasmand had a low nuclear/cytoplasmic ratio. The center of thesphere, however, was devoid of cells, but nearly full ofnon-cellular material possibly secreted by the cells althoughthe composition remained uncharacterized. Cell lineage tracingwith Nkx3.1cre-ROSA26lacZ or K5-H2BGFP reporter alleles dem-onstrated that the sphere cells were epithelial in origin(Fig. 2B). To determine whether the DESC spheres containedlabel retaining cells that represented slow-cycling DESCs, BrdUlabeling was used to trace the slow-cycling cells in the spheres.There were a few BrdU positive cells in the peripheral regioneven at day 7 after BrdUwithdraw, demonstrating the presenceof long-term label retaining cells in DESC spheres (Fig. 2Ca). Inaddition, the tetracycline regulated K5-H2BGFP reporter

system was also used to trace the label-retaining cells in DESCspheres. Without the doxycycline treatment, the K5-H2BGFPbearing DESC sphere cells had strong GFP signals (Fig. 2Bb anddata not shown), but not those bearing the H2BGFP controltransgene (Fig. 2Cb, insert). However, only 0.94 ± 0.33% of thesphere cells had retained GFP signals randomly distributed in theperipheral region of the spheres in the presence of doxycycline(Fig. 2Cb). The GFP signals were restricted to the nucleus, whichmade it distinguishable from dead cells that normally had GFPhomogenously distributed throughout the cell. Since the sphereswere derived from a single cell, the retained nuclear H2B-GFPsignal indicated that the cells were early progeny of thesphere-forming cells. They did not undergo multiple divisioncycles that would dilute the nuclear H2B-GFP signal.

Since expression of Lgr5 is widely used to identify activeSCs of various tissue origins (Snippert and Clevers, 2011;Barker et al., 2007, 2012; Huch et al., 2013), we thenexamined Lgr5 expression in DESC spheres. However, theexpression of Lgr5 was too weak to be clearly demonstrated.Therefore, we examined the expression of Olfactomedin 4(Olfm4), an olfactomedin-related glycoprotein coexpressed

996 J.Y.F. Chang et al.

with Lgr5 and broadly used for tracing Lgr5+ SCs (van derFlier et al., 2009). In situ hybridization revealed thatOlfm4 was expressed in the cells at the junction betweenouter and middle cell layers of the spheres (Fig 2D). Lgr4 isanother marker expressed in SCs and TA cells (Snippert etal., 2010; de Lau et al., 2011). X-gal staining of Lgr4LacZ

positive spheres revealed that Lgr4 was expressed in asimilar but slightly broader region than that of Olfm4(Fig. 2E). RT-PCR analyses further demonstrated that DESCspheres and CLs expressed multiple SC markers, includingATP-binding cassette transporter gene (Abcg), CD44,Sca-1, CD49f, CD133, Klf4, Lgr4, and Lgr5 (Fig. 2F).Together, these results suggest that the DESC spherescontain both slow-cycling and Lgr5+ SCs located atseparate, yet adjacent, regions. To date, the DESC sphereshave been maintained in culture for more than 10 monthsand have been subcultured for more than 18 passages.These long-term culture experiments have been repeatedthree times. In contrast, the lifespan of ameloblasts inprimary culture is about 2–3 passages or 8 weeks (Li et al.,2006).

Figure 3 Multiple dental epithelial cell lineages from DESC sphereCK14 or amelogenin (Amg) antibodies as indicated. No primary antisphere cells were immunostained with anti CK14 or Amg antibodies aof 2D-cultured passage 7 DESC sphere-derived cells for expression lecontrol. The expression levels in (b) were normalized with β-actin loMatrigel cultured spheres as 1. Data are means ± sd from 4 replicate2D-culture of P8 sphere cells. E. Alizarin Red staining demonstratingor human 293 cells cultured in differentiation medium. F. RT-PCR ancells (A), 14-day cultured DESC sphere cells derived from maxillaryexpression of cell lineage-specific markers. -, no RT for negative coindicate ALK positive cells inside the spheres. Jag1, Jagged 1; EMSP1*, p b 0.05; scale bar: 100 μm.

Differentiation of DESC sphere cells into dentalepithelium

To determine whether DESC-containing spheres exhibiteddifferentiated dental epithelial cells, immunostaining withanti-cytokeratin and anti-amelogenin was carried out.Although mainly expressed in basal cells in other organs,CK14 is expressed in the whole rodent dental epitheliumwith the highest expression in fully differentiated cells(Kawano et al., 2004). The results revealed weak expressionof CK14 and scanty or no amelogenin expression in DESCsphere cells (Fig. 3A). To further evaluate the differentia-tion capability of DESC sphere cells, the spheres weredisassociated, plated in regular tissue culture dishes, andcultured in the epithelial medium until confluence wasreached. The medium was then changed to the differenti-ation medium and the cultures were continued for another2 weeks. The monolayer cultured cells demonstrated differ-ent morphology ranging from tightly adherent, small round,to large flattened cells. The majority of the cells expressedCK14 and amelogenin (Fig. 3B). To avoid contamination of

cells. A. Sections of DESC spheres were immunostained with antibody served as a negative (Neg) control. B. 2D cultures of DESCs indicated. C. Western blot (a) or real-time RT-PCR (b) analysesvels of CK14 and Amg. Protein extracts of teeth (T) were used aading controls and presented as relative expression ratios usingd samples. D. RT-PCR analyses of Amg and ameloblastin (Amb) incalcified cells and products in the 2D-cultured DESC spheres cellsalyses of total RNAs extracted from 2D cultured sphere-derived(uS), mandibular (lS) incisors, and cervical loop (CL), showingntrol. G. Alkaline phosphatase staining of DESC spheres. Arrows, enamel matrix serine proteinase 1; ALP, alkaline phosphatase.

997Self-renewal and multilineage differentiation of mouse dental epithelial stem cells

pre-existent ameloblasts that would diminish after 2–3passages, high passage sphere cells were used for theWestern blot and semi-quantitative real-time RT-PCR anal-yses for the expression of CK14 and amelogenin. The resultsdemonstrated that both CK14 and amelogenin wereexpressed in 2-D cultures of sphere cells, although theexpression level of amelogenin was much lower than in toothtissues (Fig. 3C). Furthermore, the 2-D cultures alsoexpressed ameloblastin, another characteristic proteinexpressed during amelogenesis (Fig. 3D). Ameloblastin isnormally expressed in early stages of amelogenesis. There-fore, it was not surprising to see ameloblastin expression washigher than that of amelogenin.

Enamel is a highly mineralized tissue, which is primarilycomposed of crystalized calcium phosphate. To determinewhether cells in DESC sphere had the potential to producemineralized materials, the 2-D cultures of DESC cells weremaintained in high calcium differentiation medium for twoweeks and then subject to Alizarin Red staining (Fig. 3E).The results showed that the DESC cells were highly enrichedin calcium and also were able to produce calcified matrixmaterials. Under the same conditions, human 293 cells didnot exhibit calcium deposits, indicating that the calciumdeposition in 2D cultured OESC sphere cells was not due toprecipitation of medium calcium, although it had not beenexamined whether the calcified materials were hydroxyap-atite or calcium phosphate. Together, the results demon-strate that DESC sphere cells have the potential todifferentiate into ameloblasts.

The DESCs give rise not only to the IEE that laterdifferentiate to ameloblasts, but also the OEE, SR, and SI(stratum intermedium). To determine whether DESC spherecells expressed these indicators of differentiation, RT-PCRanalyses were carried out to detect the characteristicdifferentiation markers for these four lineages (Fig. 3F).Clearly, the DESC spheres expressed specific markers ofameloblasts at different maturation stages, includingameloblastin, enamel matrix serine proteinase 1 (EMSP1),and Tuftelin (early secretory to late maturation, earlymaturation stage, preameloblast, respectively). In addition,DESC spheres also expressed several characteristic mole-cules of various dental epithelial cells, including Jagged1 ofthe IEE, Notch1 of the SR and SI, Notch2 of the OEE and SR,and alkaline phosphatase (ALP) of the SI. Although ALP wasexpressed in the SI and stromal cells, the spheres were onlycomposed of epithelial lineage cells. Thus, the ALP express-ing cells in the spheres were the SI lineage cells (Fig. 3G).Therefore, the results indicated that the DESC spherescontained cells expressing markers of various differentiationstages and lineages. Further experiments are needed todetermine whether there are distinct populations of cells inthe spheres representing each individual lineage.

The CD49fBright subpopulation is enriched insphere-forming cells

Since the commonly used SC surface markers, CD44, Sca-1,and CD49f were expressed in the CL and DESC spheres(Fig. 2D), we then examined whether these surface markerswere suitable for assessing enrichment of DESCs by evaluat-ing the sphere-forming activity of CD44+, Sca-1+, and CD49f+

cells. FACS analyses revealed that CD44, Sca-1, and CD49fwere expressed in 2.4 ± 0.3%, 4.8 ± 0.7%, and 39.1 ± 0.4% ofmaxillary CL cells (Fig. 4A) and 1.8 ± 1.3%, 86.9 ± 3.2%, and95.2 ± 0.6% of sphere cells (Fig. 4B). Surprisingly, CD44+ orSca-1+ sorting did not enrich cells with high sphere-formingactivities; only the CD49f+ cells had high sphere-formingcapacity (Fig. 5A). Cell lineage tracing with Nkx3.1Cre andROSA26YFP reporter alleles revealed that only a fraction ofCD49f+ cells in the CL were YFP expressing epithelial cells(Fig. 5B), suggesting that CD49f was also expressed instromal cells that did not express Nkx3.1Cre. Yet, all DESCspheres were epithelial in origin (Fig. 2A). Therefore, CD49fis a suitable surface marker for enriching sphere-formingDESCs.

About 23% of cells in both maxillary and mandibular CLswere weak CD49f+ and 13% of cells were strong CD49f+

(Fig. 5C). Therefore, the CD49f+ population was furtherseparated into CD49fBright and CD49fDim groups. Sphere-forming analyses revealed that CD49fBright cells were 200folds more efficient in forming spheres than the CD49fDim

group (0.14 ± 0.13% versus 0.0007 ± 0.00001%, p b 0.001)(Fig. 5D). The CD49fBright cell-derived spheres had beenpassaged for more than 10 generations, and the sphere-forming efficiency was similar to those derived fromunfractionated CL cells. These results suggest that the cellsexpressing high CD49f also have higher sphere-formingcapacity than those non- or low CD49f expressing cells, andthat CD49fBright can be used as a surface marker for enrichingand identifying DESCs.

To determine whether CD49f was expressed in slow-cycling DESCs, we then utilized the tetracycline-regulatedK5-H2BGFP reporter to trace slow-cycling DESCs. Immuno-staining revealed that CD49f was primarily expressed in thebasement membrane opposite to the OEE, where thelong-term H2B-GFP retaining cells resided (Fig. 6A). Inaddition, there were some scattered but bright CD49fstaining cells in the SR adjoining the OEE, where Lgr5+ cellsresided, which was consistent with a previous report(Kieffer-Combeau et al., 2001). Similarly, bright CD49fstained cells were also found in the middle layer of DESCspheres where the Lgr5+ DESCs were located, as well as atthe sphere periphery where the slow cycling cells werefound (Fig. 6B). Thus, the results suggest that bothslow-cycling and Lgr5+ DESCs were CD49f+.

To further confirm that CD49fBright cells included bothslow-cycling and Lgr5+ DESCs, two-color FACS analyses werecarried out to determine the expression level of CD49f inK5-H2BGFP retaining and Lgr5+ DESCs (Fig. 6C). Beforedoxycycline treatment, the K5-H2BGFP CL cells had high(105.5–107 units) GFP fluorescence. The CL cells isolatedfrom 7 day doxycycline chased K5-H2BGFP transgenic micehad 18.40 ± 3.02%cells displaying a broad range (104 to 107

units) of GFP expression. Among them, 3.2 ± 0.95%exhibited high (105.5–107 units) GFP (GFPhigh) fluorescence.The majority of the GFPhigh cells were CD49fBright, indicatingthat the majority of slow-cycling DESCs exhibited high CD49fexpression, similar to label retaining SCs in other organs. CLcells isolated from the mice carrying the Lgr5EGFP-ires-CreERT2

reporter allele had 0.35 ± 0.15% of Lgr5+ cells in themaxillary incisor CL. The results were consistent with thosederived from Lgr5LacZ reporter mice that Lgr5 was onlyweakly expressed in a limited number of cells. Interestingly,

Figure 4 DESC sphere culture enriches Sca-1 and CD49f expressing cells. FACS analyses of freshly dissociated CL cells (A) or P0 DESCsphere cells (B) labeled with anti-CD44, Sca-1, or CD49f antibodies, demonstrating that the populations of cells expressing Sca-1 orCD49f were significantly increased by sphere culture.

998 J.Y.F. Chang et al.

nearly all GFP positive cells in the Lgr5EGFP-ires-CreERT2 CLwere CD49fBright cells (Fig. 6D), indicating that active DESCsexhibited high CD49f expression. Together, the resultsindicate that the CD49fBright subpopulation includes bothlabel retaining slow-cycling and Lgr5+ DESCs.

Discussion

By using the tetracycline-regulated K5-H2BGFP model thatmarks slow-cycling SCs and the Lgr5LacZ model that labelsactive SCs, we showed the existence of both slow-cyclingand Lgr5+ DESCs in mouse incisor CLs. We also demonstratedthat the locations of slow-cycling and Lgr5+ SCs were notoverlapping but were adjacent to each other as shown inFig. 7. Since the sphere-forming ability is a unique propertyof many tissue SCs, Matrigel sphere cultures have beenestablished for many tissue SCs, including those from theprostate, mammary gland, and neural tissues. Using a similarstrategy, we established a sphere culture system for DESCsand demonstrated that DESC spheres contained bothslow-cycling and Lgr5+ SCs. Similar to the CL, the two typesof DESCs also were located at different areas in the sphere(Fig. 7). We further demonstrated that sphere cells wereable to express differentiation markers of different dentalepithelial lineages, including the IEE, OEE, SR, and SI.Emerging evidence validates the finding that the slow-cycling SCs can be identified by long-term label retentionand active SCs can be identified by expression of Lgr5

(Li and Clevers, 2010). Therefore, this is the first in-depth study that delineates slow-cycling and activeDESCs in vivo and the first report of an in vitro DESCculture system that can be used for DESC characteriza-tion and related studies.

RT-PCR analyses revealed that several common SCssurface markers, including Sca-1, CD49f, and CD44 wereexpressed in both CLs and DESCs. CD49fBright CL epithelialcells were able to self-renew by forming spheres and toexpress characteristic genes of all four tooth epitheliallineages. This suggests that the CD49fBright cells representDESCs and that CD49fBright based FACS can be used to enrichDESCs. The expression of CD49f is remarkably conserved inSCs in different organs, such as prostate (Lawson et al.,2007), mammary gland (Stingl et al., 2006), skin (Tani et al.,2000), and DESCs as shown in this study. Moreover, the dataherein further demonstrated that CD49f expressing cellsinclude the majority of slow-cycling and Lgr5+ DESCs.Therefore, although CD49f is expressed in DESCs and stromalcells, it can be used to enrich DESCs when combined with thesphere-culture system since only DESCs form spheres. CD49f,also called integrin α6, is a receptor for laminin α5 that is amajor laminin in the basement membrane of tooth germs.Intense expression of CD49f mRNA and protein has beenfound localized in the dental epithelium during early stagesof tooth morphogenesis (Salmivirta et al., 1996). CD49f wasfirst described as cell surface marker for epidermal stemcells by Li et al. (1998). In addition to being a surfacemarker, CD49f also plays an important role in maintaining

Figure 5 Cell sorting based on CD49fBright enriches sphere-forming DESCs. A. Sphere-forming analyses for FACS sorted cells based onCD44, Sca-1, or CD49f, showing that only CD49f+ cells consistently form DESC spheres. B. Two color FACS analyses of freshlydissociatedCLcells fromNkx3.1cre-ROSAEYFPmice showingCD49fwasexpressed in bothepithelial (YFP+) and stromal (YFP-) cells.C. CD49f+

cells were arbitrary divided into Dim and Bright groups based on fluorescence intensity. Two third of CD49f+ cells (23% of total population)only exhibit weak CD49f expression. About 13% cells forma separate population exhibiting high CD49f expression.D. Sphere-forming assayshowing that only CD49fBright cells have high sphere forming activity. Unsorted freshly dissociated cells wereused as the control; *p b 0.05.

999Self-renewal and multilineage differentiation of mouse dental epithelial stem cells

the stemness property of SCs. Laminin α5 null mice developsmall tooth germs with defective epithelial proliferation anddisturbed cell polarity. Although the function of CD49f inDESCs remains to be investigated, treating tooth germ organcultures with anti-CD49f antibody inhibits tooth germdevelopment (Fukumoto et al., 2006), suggesting thatCD49f may also play a role in maintaining DESCs.

Although Sca-1 is another conservedmarker present in bothstromal and epithelial SCs of many tissues, including hemato-poietic cells (Spangrude et al., 1988), mouse incisor pulpprogenitor cells (Balic et al., 2010), lung (Kim et al., 2005),prostate (Lawson et al., 2007), and pancreas (Rovira et al.,2010) SCs, Sca-1 based sorting did not enrich the sphere-forming DESCs. Moreover, immunostaining demonstrated thatSca-1 was mainly expressed in the middle and center of DESCspheres where TA cells resided (Fig. 6B). This suggests thatSca-1 is expressed more in TA cells instead of DESCs in thedental epithelium, although it cannot be excluded that theDESC sphere culture described herein did not provide asuitable environment for propagating Sca-1+ DESCs. Thesphere-forming efficiency varied considerably between dif-ferent populations. CD49fBright cells consistently had a 2.8 foldhigher sphere-forming activity than unsorted cells (0.05%unsorted, 0.14% CD49fBright). Although Lgr5-GFP+ cells were

scarce (0.4%) in the CL, wewere able to isolate Lgr5-GFP+ cellsfor sphere-forming assays and the sphere-forming efficiencywas 0.6%, which was a 12-fold increase compared to unsortedcells. No K5-H2BGFP retaining cells could form spheres inculture, suggesting that the sphere culture system did notcontained factors needed to activate slow-cycling DESCs.

FACS analyses showed that only around 2% of cells in theCL region are CD44+. CD44 is intensively expressed inpresecretory ameloblasts, the SI, odontoblasts, and thewall of blood vessels, but not in the OEE or at the IEE-OEEjunction in developing human tooth germ (Felszeghy et al.,2001). The enzyme-based cell dissociation process mayremove surface markers and it takes longer than 3 h toreplenish, which may affect the quantity and quality ofsurface marker based cell sorting. However, this influence isenzyme- and surface marker-specific (Mulder et al., 1994;Ford et al., 1996). It appears that dispase and collagenasedissociation does not affect the cell sorting based on surfacemarker in SCs of other organs, such as prostate, breast, andskin (Stingl et al., 2006; Lukacs et al., 2010; Szabo et al.,2012). Our data here also showed that dispase andcollagenase treatments did not affect CD49fBright-based cellsorting for DESCs. However, it cannot be ruled out that thenegative results for CD44 and Sca-1 based sorting were due

Figure 6 Distribution of CD49f+ cells in the labial CL and DESC spheres. A. Confocal images of CD49f immunostaining of the labial CLof K5-H2BGFP mice 7 days post doxycycline treatment, showing CD49f+ cells at the basement membrane opposite to OEE (arrow head)and scattered CD49f +cells in the stellate reticulum (arrows). B. Confocal images of CD49f and Sca-1 immunostaining of DESC spheres,demonstrating CD49fBright cells in the peripheral region (arrow), scattered CD49f+ cells in the middle of the spheres, and Sca-1+ cellsin the middle to center areas of the spheres. TP3 was used for nuclear counterstaining. Scale bar: 100 μm. C. Two-color FACS analysesof freshly prepared CL cells of K5-H2BGFP before and after 7 days doxycycline treatment, showing the majority of GFPhigh cells werealso CD49fBright as marked by red box. D. Two-color FACS analyses of freshly prepared CL cells of Lgr5EGFP-IRES-CreERT2, showing themajority of GFP+ cells were also CD49Bright as marked by the box. Scale bar: 100 μm.

Figure 7 Schematic of localization of label retaining and Lgr5+ DESC in the CL and DESC spheres. Label retaining cells (LRC) andLgr5+ DESCs coexist in the mouse incisor CL and DESC spheres at separate yet adjoining locations. Am, ameloblasts; D, dentin;E, enamel; IEE, inner enamel epithelium; F, dental follicular stromal cells; O, odontoblasts; OEE, outer enamel epithelium; P, dentalpapilla stromal cells; SI, stratum intermedium; and SR, stellate reticulum.

1000 J.Y.F. Chang et al.

1001Self-renewal and multilineage differentiation of mouse dental epithelial stem cells

to the removal of these two surface markers by dispase andcollagenase.

In summary, this is the first report on both in vivo andin vitro characterization of slow-cycling and Lgr5+ DESCs inthe mouse incisor CL. As the majority of both slow-cyclingand Lgr5+ DESCs highly expressed CD49f, CD49fBright canserve as a surface marker for identifying and isolating DESCs.Furthermore, the in vitro DESC sphere culture systemprovides a new venue to expand and maintain DESCs forexploring the potential of DESCs in tooth regeneration.

Acknowledgments

We thank Allan Prejusa and Jonathan Lei for the help in FACScell sorting and analysis; Drs. Elaine Fuchs, Adam Glick, HansClevers, Mingyao Liu, Michael M. Shen, and Frank Costantinifor providing H2B-GFP, K5rtTA, Lgr5LacZ, Lgr5EGFP-ires-CreERT2,Lgr4LacZ, Nkx3.1Cre, and ROSA26EYFPmice; Dr. Jan C.C. Hu foramelogenin antibody; Dr. Hidemitsu Harada for sharing the CLdissection experience; Drs. Nick Barker and Hans Clevers formLgr5, hLgr5, and mOlfm4 cDNAs; and Dr. Stefan Siwko forcritical reading of the manuscript. This work was supported bythe National Institutes of Health K08DE020883 (to JYC),T32DE018380 (RD), CA96824 (FW), CA140388 (WLM, FW),CPRIT110555 (FW, WLM), Komen Breast Cancer Foundation(WLM), and the John S. Dunn Research Foundation (WLM).

References

Balic, A., Aguila, H.L., Caimano, M.J., Francone, V.P., Mina, M.,2010. Characterization of stem and progenitor cells in the dentalpulp of erupted and unerupted murine molars. Bone 46,1639–1651.

Barker, N., van Es, J.H., Kuipers, J., Kujala, P., van den Born, M.,Cozijnsen, M., Haegebarth, A., Korving, J., Begthel, H.,Peters, P.J., Clevers, H., 2007. Identification of stem cellsin small intestine and colon by marker gene Lgr5. Nature 449,1003–1007.

Barker, N., Rookmaaker, M.B., Kujala, P., Ng, A., Leushacke, M.,Snippert, H., van de Wetering, M., Tan, S., Van Es, J.H., Huch,M., Poulsom, R., Verhaar, M.C., Peters, P.J., Clevers, H., 2012.Lgr5(+ve) stem/progenitor cells contribute to nephron forma-tion during kidney development. Cell Rep. 2, 540–552.

Bickenbach, J.R., Chism, E., 1998. Selection and extended growthof murine epidermal stem cells in culture. Exp. Cell Res. 244,184–195.

Chen, L.S., Couwenhoven, R.I., Hsu, D., Luo, W., Snead, M.L., 1992.Maintenance of amelogenin gene expression by transformedepithelial cells of mouse enamel organ. Arch. Oral Biol. 37,771–778.

de Lau, W., Barker, N., Low, T.Y., Koo, B.K., Li, V.S., Teunissen, H.,Kujala, P., Haegebarth, A., Peters, P.J., van de Wetering, M.,Stange, D.E., van Es, J.E., Guardavaccaro, D., Schasfoort, R.B.,Mohri, Y., Nishimori, K., Mohammed, S., Heck, A.J., Clevers, H.,2011. Lgr5 homologues associate with Wnt receptors andmediate R-spondin signalling. Nature 476, 293–297.

Diamond, I., Owolabi, T., Marco, M., Lam, C., Glick, A., 2000.Conditional gene expression in the epidermis of transgenic miceusing the tetracycline-regulated transactivators tTA and rTAlinked to the keratin 5 promoter. J. Invest. Dermatol. 115,788–794.

Dontu, G., Abdallah, W.M., Foley, J.M., Jackson, K.W., Clarke,M.F., Kawamura, M.J., Wicha, M.S., 2003. In vitro propagation

and transcriptional profiling of human mammary stem/progen-itor cells. Genes Dev. 17, 1253–1270.

Felszeghy, S., Modis, L., Tammi, M., Tammi, R., 2001. Thedistribution pattern of the hyaluronan receptor CD44 duringhuman tooth development. Arch. Oral Biol. 46, 939–945.

Ford, A.L., Foulcher, E., Goodsall, A.L., Sedgwick, J.D., 1996.Tissue digestion with dispase substantially reduces lymphocyteand macrophage cell-surface antigen expression. J. Immunol.Methods 194, 71–75.

Fukumoto, S., Miner, J.H., Ida, H., Fukumoto, E., Yuasa, K.,Miyazaki, H., Hoffman, M.P., Yamada, Y., 2006. Laminin alpha5is required for dental epithelium growth and polarity and thedevelopment of tooth bud and shape. J. Biol. Chem. 281,5008–5016.

Grobstein, C., 1967. Mechanisms of organogenetic tissue interac-tion. Natl. Cancer Inst. Monogr. 26, 279–299.

Gronthos, S., Brahim, J., Li, W., Fisher, L.W., Cherman, N., Boyde,A., DenBesten, P., Robey, P.G., Shi, S., 2002. Stem cellproperties of human dental pulp stem cells. J. Dent. Res. 81,531–535.

Harada, H., Ohshima, H., 2004. New perspectives on toothdevelopment and the dental stem cell niche. Arch. Histol.Cytol. 67, 1–11.

Harada, H., Kettunen, P., Jung, H.S., Mustonen, T., Wang, Y.A.,Thesleff, I., 1999. Localization of putative stem cells in dentalepithelium and their association with Notch and FGF signaling.J. Cell Biol. 147, 105–120.

Huch, M., Dorrell, C., Boj, S.F., van Es, J.H., Li, V.S., van deWetering, M., Sato, T., Hamer, K., Sasaki, N., Finegold, M.J.,Haft, A., Vries, R.G., Grompe, M., Clevers, H., 2013. In vitroexpansion of single Lgr5+ liver stem cells induced by Wnt-drivenregeneration. Nature 494, 247–250.

Juuri, E., Saito, K., Ahtiainen, L., Seidel, K., Tummers, M.,Hochedlinger, K., Klein, O.D., Thesleff, I., Michon, F., 2012.Sox2+ stem cells contribute to all epithelial lineages of the toothvia Sfrp5+ progenitors. Dev. Cell 23, 317–328.

Kawano, S., Saito, M., Handa, K., Morotomi, T., Toyono, T., Seta,Y., Nakamura, N., Uchida, T., Toyoshima, K., Ohishi, M.,Harada, H., 2004. Characterization of dental epithelial progen-itor cells derived from cervical-loop epithelium in a rat lowerincisor. J. Dent. Res. 83, 129–133.

Kieffer-Combeau, S., Meyer, J.M., Lesot, H., 2001. Cell-matrixinteractions and cell–cell junctions during epithelial histo-morphogenesis in the developing mouse incisor. Int. J. Dev.Biol. 45, 733–742.

Kim, C.F., Jackson, E.L., Woolfenden, A.E., Lawrence, S., Babar, I.,Vogel, S., Crowley, D., Bronson, R.T., Jacks, T., 2005.Identification of bronchioalveolar stem cells in normal lung andlung cancer. Cell 121, 823–835.

Lawson, D.A., Xin, L., Lukacs, R.U., Cheng, D., Witte, O.N., 2007.Isolation and functional characterization of murine prostatestem cells. Proc. Natl. Acad. Sci. U. S. A. 104, 181–186.

Li, L., Clevers, H., 2010. Coexistence of quiescent and active adultstem cells in mammals. Science 327, 542–545.

Li, A., Simmons, P.J., Kaur, P., 1998. Identification and isolation ofcandidate human keratinocyte stem cells based on cell surfacephenotype. Proc. Natl. Acad. Sci. U. S. A. 95, 3902–3907.

Li, W., Machule, D., Gao, C., DenBesten, P.K., 2006. Growth ofameloblast-lineage cells in a three-dimensional Matrigel envi-ronment. Eur. J. Oral Sci. 114 (Suppl. 1), 159–163 (discussion164–155, 380–151).

Li, L., Kwon, H.J., Harada, H., Ohshima, H., Cho, S.W., Jung, H.S.,2011. Expression patterns of ABCG2, Bmi-1, Oct-3/4, and Yap inthe developing mouse incisor. Gene Expr. Patterns 11, 163–170.

Lin, Y., Liu, G., Zhang, Y., Hu, Y.P., Yu, K., Lin, C., McKeehan, K.,Xuan, J.W., Ornitz, D.M., Shen, M.M., Greenberg, N., McKeehan,W.L., Wang, F., 2007. Fibroblast growth factor receptor 2tyrosine kinase is required for prostatic morphogenesis and the

1002 J.Y.F. Chang et al.

acquisition of strict androgen dependency for adult tissuehomeostasis. Development 134, 723–734.

Lukacs, R.U., Goldstein, A.S., Lawson, D.A., Cheng, D., Witte, O.N.,2010. Isolation, cultivation and characterization of adult murineprostate stem cells. Nat. Protoc. 5, 702–713.

Mitsiadis, T.A., Barrandon, O., Rochat, A., Barrandon, Y., De Bari, C.,2007. Stem cell niches inmammals. Exp. Cell Res. 313, 3377–3385.

Miura, M., Gronthos, S., Zhao, M., Lu, B., Fisher, L.W., Robey, P.G.,Shi, S., 2003. SHED: stem cells from human exfoliated deciduousteeth. Proc. Natl. Acad. Sci. U. S. A. 100, 5807–5812.

Morsczeck, C., Gotz, W., Schierholz, J., Zeilhofer, F., Kuhn, U.,Mohl, C., Sippel, C., Hoffmann, K.H., 2005. Isolation of precursorcells (PCs) from human dental follicle of wisdom teeth. MatrixBiol. 24, 155–165.

Mulder, W.M., Koenen, H., van de Muysenberg, A.J., Bloemena, E.,Wagstaff, J., Scheper, R.J., 1994. Reduced expression of distinctT-cell CD molecules by collagenase/DNase treatment. CancerImmunol. Immunother. 38, 253–258.

Reynolds, B.A., Rietze, R.L., 2005. Neural stem cells andneurospheres — re-evaluating the relationship. Nat. Methods2, 333–336.

Rovira, M., Scott, S.G., Liss, A.S., Jensen, J., Thayer, S.P., Leach,S.D., 2010. Isolation and characterization of centroacinar/terminal ductal progenitor cells in adult mouse pancreas. Proc.Natl. Acad. Sci. U. S. A. 107, 75–80.

Salmivirta, K., Gullberg, D., Hirsch, E., Altruda, F., Ekblom, P.,1996. Integrin subunit expression associated with epithelial–mesenchymal interactions during murine tooth development.Dev. Dyn. 205, 104–113.

Seidel, K., Ahn, C.P., Lyons, D., Nee, A., Ting, K., Brownell, I., Cao, T.,Carano, R.A., Curran, T., Schober, M., Fuchs, E., Joyner, A., Martin,G.R., de Sauvage, F.J., Klein, O.D., 2010. Hedgehog signalingregulates the generation of ameloblast progenitors in the contin-uously growing mouse incisor. Development 137, 3753–3761.

Seo, B.M., Miura, M., Gronthos, S., Bartold, P.M., Batouli, S.,Brahim, J., Young, M., Robey, P.G., Wang, C.Y., Shi, S., 2004.Investigation of multipotent postnatal stem cells from humanperiodontal ligament. Lancet 364, 149–155.

Snippert, H.J., Clevers, H., 2011. Tracking adult stem cells. EMBORep. 12, 113–122.

Snippert, H.J., Haegebarth, A., Kasper, M., Jaks, V., van Es, J.H.,Barker, N., van de Wetering, M., van den Born, M., Begthel, H.,Vries, R.G., Stange, D.E., Toftgard, R., Clevers, H., 2010. Lgr6marks stem cells in the hair follicle that generate all cell lineagesof the skin. Science 327, 1385–1389.

Sonoyama, W., Liu, Y., Yamaza, T., Tuan, R.S., Wang, S., Shi, S.,Huang, G.T., 2008. Characterization of the apical papilla and itsresiding stem cells from human immature permanent teeth: apilot study. J. Endod. 34, 166–171.

Soriano, P., 1999. Generalized lacZ expression with the ROSA26 Crereporter strain. Nat. Genet. 21, 70–71.

Spangrude, G.J., Heimfeld, S., Weissman, I.L., 1988. Purificationand characterization of mouse hematopoietic stem cells. Science241, 58–62.

Srinivas, S., Watanabe, T., Lin, C.S., William, C.M., Tanabe, Y.,Jessell, T.M., Costantini, F., 2001. Cre reporter strains producedby targeted insertion of EYFP and ECFP into the ROSA26 locus.BMC Dev. Biol. 1, 4.

Stingl, J., Eirew, P., Ricketson, I., Shackleton, M., Vaillant, F., Choi,D., Li, H.I., Eaves, C.J., 2006. Purification and unique propertiesof mammary epithelial stem cells. Nature 439, 993–997.

Suomalainen, M., Thesleff, I., 2010. Patterns of Wnt pathwayactivity in the mouse incisor indicate absence of Wnt/beta-catenin signaling in the epithelial stem cells. Dev. Dyn. 239,364–372.

Szabo, A.Z., Fong, S., Yue, L., Zhang, K., Strachan, L.R.,Scalapino, K., Mancianti, M.L., Ghadially, R., 2012. TheCD44+ ALDH + population of human keratinocytes is enrichedfor epidermal stem cells with long-term repopulating ability.Stem Cells 31, 786–799.

Tani, H., Morris, R.J., Kaur, P., 2000. Enrichment for murinekeratinocyte stem cells based on cell surface phenotype. Proc.Natl. Acad. Sci. U. S. A. 97, 10960–10965.

Thesleff, I., Hurmerinta, K., 1981. Tissue interactions in toothdevelopment. Differentiation 18, 75–88.

Thesleff, I., Vaahtokari, A., Kettunen, P., Aberg, T., 1995.Epithelial–mesenchymal signaling during tooth development.Connect. Tissue Res. 32, 9–15.

Tumbar, T., Guasch, G., Greco, V., Blanpain, C., Lowry, W.E.,Rendl, M., Fuchs, E., 2004. Defining the epithelial stem cellniche in skin. Science 303, 359–363.

Tummers, M., Thesleff, I., 2003. Root or crown: a developmentalchoice orchestrated by the differential regulation of theepithelial stem cell niche in the tooth of two rodent species.Development 130, 1049–1057.

van der Flier, L.G., Haegebarth, A., Stange, D.E., van de Wetering,M., Clevers, H., 2009. OLFM4 is a robust marker for stem cells inhuman intestine and marks a subset of colorectal cancer cells.Gastroenterology 137, 15–17.

Weng, J., Luo, J., Cheng, X., Jin, C., Zhou, X., Qu, J., Tu, L., Ai, D.,Li, D., Wang, J., Martin, J.F., Amendt, B.A., Liu, M., 2008.Deletion of G protein-coupled receptor 48 leads to ocularanterior segment dysgenesis (ASD) through down-regulation ofPitx2. Proc. Natl. Acad. Sci. U. S. A. 105, 6081–6086.

Xin, L., Lukacs, R.U., Lawson, D.A., Cheng, D., Witte, O.N., 2007.Self-renewal and multilineage differentiation in vitro frommurine prostate stem cells. Stem Cells 25, 2760–2769.

Yokohama-Tamaki, T., Ohshima, H., Fujiwara, N., Takada, Y.,Ichimori, Y., Wakisaka, S., Ohuchi, H., Harada, H., 2006.Cessation of Fgf10 signaling, resulting in a defectivedental epithelial stem cell compartment, leads to thetransition from crown to root formation. Development 133,1359–1366.

Zhang, Y., Zhang, J., Lin, Y., Lan, Y., Lin, C., Xuan, J.W., Shen,M.M., McKeehan, W.L., Greenberg, N.M., Wang, F., 2008. Roleof epithelial cell fibroblast growth factor receptor substrate2alpha in prostate development, regeneration and tumorigene-sis. Development 135, 775–784.