Molecular mechanisms of disease-related human b-actinmutations p.R183W and p.E364KNikolas Hundt1, Matthias Preller1,2, Olga Swolski1, Angella M. Ang1, Hans G. Mannherz3,Dietmar J. Manstein1 and Mirco M€uller1,*
1 Institute for Biophysical Chemistry, Hannover Medical School, Hannover, Germany
2 Centre for Structural Systems Biology (CSSB), German Electron Synchrotron (DESY), Hamburg, Germany
3 Institute for Anatomy and Molecular Embryology, Ruhr-University Bochum, Bochum, Germany
Keywords
actin mutations; cytoplasmic b-actin;
molecular dynamics simulations; p.E364K;
p.R183W
Correspondence
M. M€uller, Department of Cardiology and
Angiology, OE 6887, Hannover Medical
School, Carl-Neuberg-Str. 1, D-30625
Hannover, Germany
Fax: +49 511 532 3357
Tel: +49 511 532 3270
E-mail: [email protected]
D. J. Manstein, Institute for Biophysical
Chemistry, OE4350, Hannover Medical
School, Carl-Neuberg-Str. 1, D-30625
Hannover, Germany
Fax: +49 511 532 5966
Tel: +49 511 532 3700
E-mail: [email protected]
*Present address:
Department of Cardiology and Angiology,
Hannover Medical School, Hannover,
Germany
(Received 13 May 2014, revised 6
September 2014, accepted 22 September
2014)
doi:10.1111/febs.13068
Cytoplasmic b-actin supports fundamental cellular processes in healthy and
diseased cells including cell adhesion, migration, cytokinesis and mainte-
nance of cell polarity. Mutations in ACTB, the gene encoding cytoplasmic
b-actin, lead to severe disorders with a broad range of symptoms. The two
dominant heterozygous gain-of-function b-actin mutations p.R183W and
p.E364K were identified in patients with developmental malformations,
deafness and juvenile-onset dystonia (p.R183W) and neutrophil dysfunc-
tion (p.E364K). Here, we report the recombinant production and func-
tional characterization of the two mutant proteins. Arg183 is located near
the nucleotide-binding pocket of actin. Our results from biochemical stud-
ies and molecular dynamics simulations show that replacement by a trypto-
phan residue at position 183 establishes an unusual stacking interaction
with Tyr69 that perturbs nucleotide release from actin monomers and poly-
merization behavior by inducing a closed state conformation. The replace-
ment of Glu364 by a lysine residue appears to act as an allosteric trigger
event leading to the preferred formation of the closed state. Thus, our
approach indicates that both mutations affect interdomain mobility and
nucleotide interactions as a basis for the formation of disease phenotypes
in patients.
Introduction
Actin is a highly conserved and ubiquitous protein
found in nearly all eukaryotic cells. Six actin isoforms
can be distinguished in vertebrates: three a-actin
isoforms (a-skeletal muscle, a-cardiac muscle and
a-aortic smooth muscle, also known as a-vascular),one b-isoform (b-cytoplasmic) and two c-isoforms
Abbreviations
e-ATP, 1,N6-ethenoadenosine-50-triphosphate; IC50, inhibitory concentration; MD, molecular dynamics; Ni-NTA, Ni2+-nitrilotriacetic acid; NM-
2A, nonmuscle myosin-2A isoform.
1FEBS Journal (2014) ª 2014 FEBS
(c-cytoplasmic and c-smooth muscle also known as c-enteric). Cytoplasmic b- and c-actin are essential for
cell migration, cell shape maintenance, mitosis and
intracellular transport processes and are expressed at
moderate to high levels in nearly all adult tissues [1,2].
The most abundant isoactin in many nonmuscle cells
including myeloid and neuronal cells is b-actin [2]. Cel-
lular studies show that the b-isoform is preferentially
recruited into cellular protrusions, stress fibers, circular
bundles and at cell–cell contacts [3,4]. The rapid cyto-
skeletal rearrangements observed for these structures
appear to be linked to the highly dynamic turnover of
actin filaments made from b-actin [5].
All actin isoforms share the same architecture with
four different subdomains and a common nucleotide-
binding site. In vivo, b-actin is post-translationally
modified by cleavage of the first methionine followed
by N-terminal acetylation. Actin is an ATPase and the
hydrophobic nucleotide-binding site is located in the
cleft between subdomains SD1–2 and SD3–4(Fig. 1A). In the presence of divalent cations, mono-
mers with bound ATP assemble into filaments. The
growth of actin filaments depends on the addition of
actin–ATP monomers predominantly at the fast-grow-
ing barbed ends. After monomer addition, the bound
ATP is hydrolyzed to ADP and inorganic phosphate
(Pi) followed by Pi-release. Because dissociation of
actin–ADP occurs preferentially from pointed ends,
the association and dissociation reactions result in
‘treadmilling’, a process whereby subunits migrate
through filaments [6,7]. Filament polarity is main-
tained by ATP hydrolysis and F-actin treadmilling is
accompanied by an increased rate of ATP hydrolysis
[8,9].
Mutations in actin-coding genes lead to severe disor-
ders. Compared with myopathy- and angiopathy-asso-
ciated defects of muscle isoactins, mutations of b- andc-actin isoforms lead to a wider spectrum of diseases
that include deafness, cancer and developmental disor-
ders [10,11]. Most biochemical studies in the past,
dealing with human actin mutations, have focused on
skeletal and cardiac isoactins or have aimed to charac-
terize disease-related mutations by introducing them
into the endogenous actin from yeast or other simple
eukaryotic model systems [12–14]. We describe the
recombinant production and functional characteriza-
tion of two dominant heterozygous gain-of-function
mutations in ACTB, the gene encoding human b-actin.Mutation p.E364K has been linked to neutrophil dys-
function [15] and p.R183W to a complex disease phe-
notype that includes developmental malformations,
deafness and delayed-onset dystonia [10]. The bio-
chemical properties of the mutant proteins are
described in detail. Functional differences from the
wild-type protein are explained by structural changes
observed in molecular dynamics simulations.
wt p.R183W
p.E364K
kDa2001501201008570605040
30
2520
SD4SD2
SD1
SD3
CBA R183
E364
15
10
kDa
70100130170
40
55
25
35
10
15
wt p.R183W
p.E364K
Fig. 1. Location of mutated residues and purification of human b-actin variants p.R183W and p.E364K. (A) Atomic structure of cytoplasmic
b-actin as determined in complex with profilin (PDB code: 2BTF). Actin subdomains SD1–4 are numbered. The PDB file was modified and
rendered using PYMOL 1.4 highlighting the residues R183 (close to the nucleotide ATP depicted in blue) and E364 (at the bottom of SD1).
(B) SDS/PAGE of purified, untagged b-actin wild-type (wt), p.R183W and p.E364K. (C) Immunoblot analysis of cytoplasmic b-actin
preparations.
2 FEBS Journal (2014) ª 2014 FEBS
Molecular mechanisms of human b-actin mutations N. Hundt et al.
Results
Recombinant production of human cytoplasmic
b-actin mutants
We used a baculovirus-driven expression of tag-free
b-actin variants in Sf9 cells, because tag-mediated
sequence changes compromise functional competence
in polymerization assays and interfere with N-terminal
processing in acetylation-competent host cells. Proper
post-translational modification of the actin N-terminus
is crucial for the native functional behavior of the pro-
tein. We previously demonstrated by MS analysis that
our recombinantly produced actin variants are N-ter-
minally acetylated [16]. A disadvantage of tag-free
actin expression in insect cells is the presence of con-
taminating endogenous actin. Our actin preparations
contain 5–15% endogenous actin, as previously shown
by 2D gel electrophoresis and MS analyses [16]. As
shown in Fig. 1B, untagged wild-type (wt) and the
mutant b-actin were purified to homogeneity. Prepara-
tions of cytoplasmic b-actin were confirmed by immu-
noblot analysis (Fig. 1C). Immunoblotting was
performed using an antibody that recognizes the N-ter-
minal acetylated epitope of human b-actin and does
not bind to insect actin. Similar yields (~ 5 mg per
3 9 109 cells) were obtained for wt-, p.R183W- and
p.E364K-b-actin from different preparations (n = 3–5).
Actin folding, stability and nucleotide release
Cytoplasmic actin filaments are highly dynamic struc-
tures undergoing constant assembly and disassembly
cycles to drive motile processes and to serve as tracks
for motor proteins. Correct folding and nucleotide
turnover of actin monomers are crucial for their ability
to assemble into filaments.
Improper folding of actin variants has been proposed
to be associated with human diseases by a number of
studies [12–14]. We tested the ability of the b-actinmutations p.R183W and p.E364K to affect protein con-
formation and stability. The DNase I inhibition assay
represents a classical approach to assess actin folding.
Only properly folded G-actin is able to inhibit DNase I
activity [17,18]. Compared with monomeric wt-b-actin(inhibitory concentration [IC50]: 63 � 4 nm) (Fig. 2A),
mutant p.R183W displayed approximately threefold
greater inhibition of DNase I-mediated nucleic acid
cleavage (IC50: 24 � 1 nm; P < 0.0001). This result
suggests an effect of the p.R183W mutation on the con-
formation of SD2, which contains the DNase I binding
loop (D-loop). Likewise, we observed an increase in
DNase I affinity for mutant p.E364K (IC50: 49 � 2 nm;
P = 0.0028) indicating a link to structural alterations
within SD2. In addition, a higher affinity to DNase I
may be linked to a more closed conformation between
SD2 and SD4 in the mutants, as outlined below.
To further assess the thermal stability of the b-G-
actin variants, we equilibrated the actin used for
DNase I inhibition assays over a range of increasing
temperatures until full denaturation was reached. The
deduced Tm values were in the range of 55.3–55.9 � 0.8 °C (Fig. 2B). Accordingly, thermal stability
and unfolding behavior of the mutant b-actins appearsto be unchanged compared with the wild-type.
Actin monomers with bound ATP preferentially
bind to the plus or barbed ends of F-actin. In fact,
actin with bound ATP has a 10-fold higher association
rate than ADP–actin [19]. The hydrolysis of ATP
A
B
Fig. 2. Folding and stability of b-actin mutants. (A) Folding of
monomeric b-actin variants was assessed by their ability to inhibit
DNase I activity. The mutant actins bind more strongly to DNase I.
(B) Thermal unfolding was monitored using the same DNase I
inhibition assay after incubating actin at the indicated temperatures.
The thermal stability of the mutant actins is unchanged.
3FEBS Journal (2014) ª 2014 FEBS
N. Hundt et al. Molecular mechanisms of human b-actin mutations
followed by the release of inorganic phosphate occurs
after binding to barbed ends. During dynamic actin
cycling ADP–actin monomers dissociate from the
minus or pointed ends of F-actin. Exchange of ADP
for ATP is crucial for the reassembly of actin mono-
mers to the barbed ends. During nucleotide exchange
actin has to undergo transitions between open and
closed states that involve twisting of its two major
domains [20]. Any impairment of the conformational
flexibility associated with these transitions is predicted
to affect nucleotide exchange and polymerization
behavior. We measured the rate of nucleotide release
under monomeric conditions using the fluorescent
ATP analog 1,N6-ethenoadenosine-50-triphosphatee-ATP). The release kinetics of e-ATP are best
described by a double-exponential model including a
fast and a slow process. The fast process corresponds
to nucleotide exchange from free actin monomers. The
slow process most likely corresponds to the formation
of polymerization-competent actin nuclei or oligomers.
Its contribution to the signal amplitude is small (15–20%) [21]. Monomeric wt-b-actin displayed a fast pro-
cess rate of 0.062 � 0.015 s�1. The fast process was
2.4-fold slower for p.R183W (0.0254 � 0.0005 s�1;
P = 0.0113) and 2.1-fold slower for p.E364K-b-actin(0.030 � 0.003 s�1; P = 0.0177) (Fig. 3). The slow
process remained unchanged with values in the range
of 0.0016–0.0020 � 0.0004 s�1 for the actin variants.
A reduced exchange rate of ADP for ATP in actin
monomers is likely to affect the rate of polymerization.
Indeed, this behavior is reflected by our polymeriza-
tion assays, as outlined below.
Actin assembly and disassembly
The ability of actin monomers to assemble into polar
filaments is crucial for their physiological function.
G-Actin undergoes multiple conformational changes
upon polymerization. The incorporated monomer
subunits are flattened by subdomains SD1–2 undergoinga 12–13° propeller twist with respect to subdomains
SD3–4. Secondary elements such as the DNase I-bind-
ing loop are structurally reorganized. We assessed the
actin assembly behavior of both mutant b-actins by
monitoring the increase in the fluorescence of pyrene-
labeled actin that coincides with filament formation
[22]. The p.R183W mutant as well as the p.E364K var-
iant exhibited significantly slower polymerization rates
compared with wild-type actin (Fig. 4A). The apparent
half-time t1/2, pol of polymerization was increased 1.9-
fold for the p.R183W-b-actin (39.9 � 4.4 min;
P = 0.0006) and 2.6-fold in the case of p.E364K-b-actin (52.2 � 5.2 min; P < 0.0001) compared with
wild-type actin (20.6 � 2.4 min) (Fig. 4A, inset). In
addition, we monitored the ATPase activity of the fila-
mentous b-actin variants. In comparison with wt-b-actin, which showed a hydrolysis rate of
2.1 � 0.3 h�1, the p.R183W mutant exhibited a 1.7-
fold (P = 0.0141) increase in ATP turnover
(3.6 � 0.4 h�1) (Fig. 4B). Filaments made from
p.E364K-b-actin did not differ significantly from the
wild-type with an ATPase activity of 2.8 � 0.4 h�1
(P > 0.05). Depolymerization assays were performed
to analyze whether the increased ATP turnover in
p.R183W filaments and, thus, faster accumulation of
ADP–actin, affects the disassembly step. Indeed, the
depolymerization half-time of the p.R183W mutant
was significantly reduced (t1/2, depol, p.R183W =9.1 � 0.8 min; P = 0.0204), whereas wt- and p.E364K-
b-actin had similar depolymerization kinetics (t1/2, de-
pol, wt = 12.2 � 1.0 min; t1/2, depol, p.E364K = 13.0 �1.6 min; P = 0.67) (Fig. 4C). In summary, slower fila-
ment growth, higher ATP-hydrolysis and faster depo-
lymerization indicate that p.R183W actin is impaired
in forming long, stable filaments.
Interactions with profilin and myosin
Profilin is an important actin-binding protein that
regulates the dynamic reorganization of the actin
Fig. 3. Nucleotide exchange in the mutant actin monomers is
impaired. Time courses of e-ATP release from monomeric b-actin
variants in the presence of excess ATP are measured by the
decrease in e-ATP fluorescence (n = 2–5). In order to visualize the
rate differences for the fast phase, which corresponds to
nucleotide exchange in monomeric actin, the data were
normalized to the fast phase amplitudes. Only the fast phase is
shown (100 s), however, the datasets extend over a period of
25 min and were fitted using double exponential functions.
4 FEBS Journal (2014) ª 2014 FEBS
Molecular mechanisms of human b-actin mutations N. Hundt et al.
cytoskeleton and drastically increases the exchange
rate of actin-bound ADP to ATP [23]. Nunoi and
coworkers reported that the interaction of profilin with
the p.E364K variant purified from patients’ cells is
impaired [15]. By contrast, this result was not verified
by another study in which an in vitro translation
approach was applied for protein production and
interactions with different actin-binding proteins were
screened using band shift assays [13]. In order to test
the ability of our recombinant actin constructs to
interact with profilin II, we performed microscale ther-
mophoresis experiments to determine affinities [24]. As
shown in Fig. 5A, the equilibrium dissociation con-
stant Kd for wt-b-actin was 5.9 � 1.2 lM. Our experi-
ment did not show a significant change in profilin
binding for the p.E364K mutant (Kd = 8.9 � 0.8 lM;P = 0.095) in comparison with the wt-b-actin.Moreover, binding of p.R183W-b-actin to profilin II
was similar to wild-type actin with an equilibrium
dissociation constant of 6.8 � 0.5 lM.
CBA
Fig. 4. Properties of filamentous b-actin wild-type and mutants p.R183W and p.E364K. (A) Polymerization of the mutant actins is slowed.
Polymerization of 10 lM b-actin variants was initiated by a salt shift as described in the Materials and methods. Shown are the averaged
traces from ~ 10 independent measurements using two different batches of wt-, p.R183W- and p.E364K-b-actin. The t1/2 values from the
kinetic traces are depicted in the inset. (B) Intrinsic ATP hydrolysis rates of b–F-actin variants. Actin (10 lM) was freshly polymerized and
the ATP turnover was measured in a NADH-coupled assay (n = 2–3). ATP hydrolysis in p.R183W actin filaments is increased. (C) The
depolymerization rate of p.R183W actin filaments is increased. Depolymerization was induced by diluting pyrene-labeled actin filaments
below the critical concentration. The half-times of the fluorescence decrease were determined from fitting single exponential functions to
the traces. Statistically significant differences (P < 0.05) are marked with asterisks.
A CSD4 SD2
SD1SD3
SD4 SD2
SD1SD3
D-loopD-loop
E364 E364
371H371H
961Y961Y573F573F M355 M355
B
Fig. 5. Interaction with profilin II. Residue E364 does not appear to be essential for profilin binding. (A) Dissociation constants of profilin II
and monomeric b-actin variants were quantified by microscale thermophoresis (n = 2). The mutant actins bind profilin normally. The lack of
a larger effect can be explained by the peripheral location of E364 in relation to the profilin-binding site in both structures showing a closed
(B, PDB: 2BTF) and open nucleotide-binding site (C, PDB: 1HLU) for the actin–profilin complex. Actin is shown in orange and profilin in
grey. Primary actin contacts include H173, F375, (light orange spheres), Y169 and M355 (yellow orange spheres).
5FEBS Journal (2014) ª 2014 FEBS
N. Hundt et al. Molecular mechanisms of human b-actin mutations
A major role of cytoplasmic b-actin is the formation
of polar tracks on which myosin motor proteins can
move in a directional fashion. The nonmuscle myosin-
2A isoform (NM-2A) colocalizes with b-actin in cells
and its ATPase activity is preferentially activated by
b-actin [16]. We tested whether the mutations p.R183W
and p.E364K in b-actin have an effect on the
activation of NM-2A ATPase activity (Fig. 6). We
found that 30 lM of filamentous wt-b-actin stimulated
the ATP turnover of NM-2A ~ 15-fold (0.189 �0.015 s�1, basal ATPase activity was 0.013 �0.0006 s�1). Activation of NM-2A ATPase activity by
p.R183W actin was reduced fourfold under the same
conditions (0.045 � 0.013 s�1), whereas activation by
mutant p.E364K resembled that observed with wt-b-actin (0.176 � 0.029 s�1).
Molecular dynamics simulations
To analyze the impact of the mutations on the struc-
ture and dynamics of b-actin monomers at the atomic
level, we carried out all-atom molecular dynamics
(MD) simulations in explicit water using NAMD 2.9
[25]. Starting with the high-resolution X-ray crystal
structure of b-actin in the ATP-bound state (PDB:
2BTF) [26], we introduced single-point mutations
using the SCHR€ODINGER SUITE [27] and replaced the
bound Sr2+∙ATP by Ca2+∙ATP, because calcium ions
were present in all our experimental setups. The analy-
sis was based on 50 ns trajectories of the energy mini-
mized and equilibrated simulation systems for each
actin monomer. Simulation of the wt-b-actin under
the same conditions as the mutants served as the con-
trol of unaffected actin. In accordance with previous
studies [28,29], the presence of Ca2+∙ATP led to an
opening of the nucleotide cleft between the SD1–SD2
and SD3–SD4 domains of wt-b-actin during our simu-
lations, which was mainly achieved by rearrangements
in SD1–SD2 and a domain rotation of the entire SD2
by ~ 37° (Fig. 7A). The final structure of the wt-b-actin monomer after 50 ns simulation time closely
resembled the crystal structure of b-actin∙Ca2+∙ATP,
solved in the open state (PDB: 1HLU; [29]), when
superimposed based on the protein Ca atoms
(Fig. 7B).
During our simulations of the p.R183W mutant, this
opening of the nucleotide cleft was significantly
impaired (Figs 7C and 8B, Movies S1 and S2). Com-
pared with the simulations with wt-b-actin, the maxi-
mal cleft opening reached only 30%. The mutated
tryptophan is located in SD4 at one side of the nucleo-
tide cleft and its bulky side chain moved into that cleft
along the trajectory, thereby blocking in part the
potential exit route for Pi. In addition, Trp183 formed
a stacking interaction with Tyr69 of SD2, which seems
to contribute to the restricted opening of the cleft in
our simulations (Fig. 7C and Movie S2). As a conse-
quence, the interaction of the critical Ser14 in the
active site with the c-phosphate of ATP remained sta-
ble throughout the simulations (Fig. 8A). This interac-
tion broke in all wild-type simulations after around
25 ns simulation time, concurrent with the progress of
the cleft opening. Furthermore, the impaired ability of
SD2 to rotate away from SD4 in order to open the
nucleotide cleft during our simulations appeared to
translate into a shift of SD3, in particular of loop
300–309 which is involved in binding the adenine base
of the nucleotide in a hydrophobic pocket. Hence,
along the trajectory, the nucleotide base lost its inter-
actions to SD1 and SD3, and slipped out of the bind-
ing pocket, whereas the triphosphate moiety remained
unaffected (Fig. 7C, transparent silhouette of ATP).
By comparison, mutation p.E364K is located in
SD1 ~ 38 �A from the nucleotide-binding pocket or the
nucleotide cleft. The p.E364K mutant also showed an
impact on cleft opening during the MD simulations,
although apparently via a different mechanism than
for p.R183W (Figs 7D and 8B,D, Movies S1 and S3).
Indeed, the SD2 tilted notably and drew even closer
towards SD4 and the nucleotide. As a consequence,
the nucleotide cleft closed to a greater extent than in
p.R183W or wt-b-actin in the closed state, narrowing
to a width of ~ 4 �A at the tightest spot (Fig. 7D). The
interaction between Ser14 and the c-phosphate of ATP
remained intact, as seen for mutant p.R183W
(Fig. 8A). In addition to the perturbed nucleotide cleft
Fig. 6. Interaction with nonmuscle myosin. The interaction of
p.R183W actin and nonmuscle myosin-2A is impaired. The
steady-state ATPase rate of the myosin was measured in the
absence (basal) and presence of 30 lM of the actin variants in a
NADH-coupled assay. *Statistical significance at P < 0.05.
6 FEBS Journal (2014) ª 2014 FEBS
Molecular mechanisms of human b-actin mutations N. Hundt et al.
opening and the stable interaction of SD1 to the nucle-
otide via Ser14 and the c-phosphate, the p.E364K
mutation led to further complex conformational
changes throughout the entire protein, which was not
observed for p.R183W (Fig. 7D and Movie S3). Fig-
ure 8D depicts the difference of the root mean square
fluctuations of wt-p.E364K, clearly showing drastic
changes in the conformational dynamics and structure
of all four subdomains. As a further control and to
exclude potential misinterpretation and bias introduced
into the trajectories by the choice of the starting rot-
amer for the mutated amino acid residues, we repeated
simulations of both mutants starting each with two
additional, distinct rotamers. Analyses of these control
simulations confirm the considerable impact of the two
mutations on cleft opening (Fig. 8C). Accordingly, the
interaction of Ser14 with the c-phosphate of ATP
remains intact in all mutant simulations.
Discussion
To study the consequences of the disease-related
human b-actin mutations p.R183W and p.E364K, we
examined the properties of the mutant proteins at the
level of the monomers, in the filamentous state, and in
the context of interactions with selected binding part-
ners. The mutant actins display normal thermal stabil-
ity indicating that the mutations do not interfere with
folding. Although the two mutations are located in dif-
ferent parts of the molecule, p.R183W and p.E364K
actin display similar changes in their biochemical
behavior compared with the wild-type protein. In the
monomeric state, both mutants show increased affinity
for DNase I and reduced exchange of nucleotides.
The results of our MD simulations suggest that the
mutated actins favor a conformation similar to the
closed state of wild-type actin (Fig. 7C,D). The con-
comitant establishment of a binding surface for
A B
C D
Fig. 7. Conformational changes of wild-type and mutant b-actins during molecular dynamics simulations. (A) Conformational changes of
wt-b-actin along the MD trajectories. Comparison of the starting structure (gray) and the conformation after 50 ns MD simulations
(colored). Structural changes are indicated by blue vectors and Mg2+∙ATP is shown as a stick representation. Note the rearrangements in
SD1 and SD2. SD2 rotates by ~ 37°. The rotation axis was determined using the program DYNDOM [50]. (B) Comparison of the wt-b-actin
conformation after 50 ns MD simulation (colored) and the high-resolution X-ray structure of wt-b-actin in the open state (PBD: 1HLU; light
gray). The final actin structure resembles closely the open state crystal structure. (C, D) Single-point mutations p.R183W and p.E364K both
interfere with the opening of the nucleotide cleft, mainly by affecting the rotation of SD2, however, through distinct mechanisms. The
p.E364K mutation appears to affect all subdomains, whereas the p.R183W mutation directly interferes with cleft opening. Color code: teal,
subdomain 1 (SD1); pink, subdomain 2 (SD2); orange, subdomain 3 (SD3); green, subdomain 4 (SD4).
7FEBS Journal (2014) ª 2014 FEBS
N. Hundt et al. Molecular mechanisms of human b-actin mutations
DNase I and the trapping of nucleotide at the active
site correlate well with our experimental results. Our
computational analysis predicts that the tryptophan
residue in p.R183W actin forms a stacking interaction
with Tyr69 in SD2. As a result, the gap between SD2
and SD4 is closed and the hydrogen bond between
Ser14 and the c-phosphate of ATP is stabilized. The
latter interaction has been suggested to play a key role
in sensing bound ATP and to stabilize the closed con-
formation of the nucleotide-binding pocket. It is
thought to break upon ATP-hydrolysis, which facili-
tates opening of the nucleotide-binding site and prod-
uct release [30–32]. A p.S14A mutant shows an
increased nucleotide exchange rate, higher susceptibil-
ity to proteolysis, and decreased DNase I affinity
[33,34]. The mutant displays the opposite biochemical
behavior to the p.R183W mutant, most likely because
it adopts an open nucleotide-binding pocket even in
the presence of ATP.
Our MD simulations show that mutation p.E364K
induces conformational changes in SD1 that propagate
through the entire monomer. As a result, p.E364K
actin forms a closed conformation in the presence of
ATP under formation of a stable hydrogen bond
between Ser14 and the c-phosphate of ATP. However,
the mechanism is clearly different from the effect of
p.R183W. Given the distance of the mutated amino
acid residue to the nucleotide-binding cleft, the
p.E364K mutation appears to act via an allosteric
mechanism.
With regard to predicting the behavior of actin
monomers following their incorporation into the fila-
ment, the information provided by our MD simula-
tions is limited. However, our in vitro experiments still
provide insight into the mutation-derived defects in fil-
amentous actin. Reduced nucleotide exchange in
monomers of both mutant actins slows regeneration of
the ATP–actin pool from ADP–actin, which leads to
an accumulation of ADP–actin and reduces the avail-
able amount of polymerization competent actin mono-
mers. In addition, in the presence of ATP–actin, as in
our polymerization assay, both mutants display a
decreased polymerization rate. We hypothesize that
the impaired interdomain mobility affects the incorpo-
ration process of monomers into the filament, because
this process involves conformational rearrangements of
A B
C D
Fig. 8. Consequences of the b-actin mutations on the conformational dynamics. (A) Stability of the interaction between serine 14 and the
c-phosphate of ATP during the simulations of wt- (black), p.R183W- (red) and p.E364K-b-actin (blue) as indicated by the distance between
the hydroxyl group of serine 14 and the phosphorous atom of the c-phosphate. Both point mutations prevent breaking of this crucial
interaction. (B) Opening of the nucleotide cleft in the actin monomers, measured by monitoring the distance between Gly55 and Arg183
along the trajectories. Note that the shift in the cleft distance for p.E364K around 3 ns is caused by a tilting of the a helix in SD2, which
decreases the cleft width even further rather than increasing it. (C) Control simulations with two additional starting rotamers per p.R183W
and p.E364K mutant confirm the impaired opening of the cleft by the mutations. (D) Difference in the root mean square fluctuations
(RMSF) of wt- and p.E364K-b-actin averaged over the amino acid residues. The single-point mutation p.E364K leads to complex allosteric
conformational changes in all four subdomains of the protein.
8 FEBS Journal (2014) ª 2014 FEBS
Molecular mechanisms of human b-actin mutations N. Hundt et al.
the subdomains such as twisting of SD1–2 against
SD3–4 and reorganization of SD2 and its D-loop [20].
These conformational changes have been linked to the
enhanced ATPase activity of actin monomers follow-
ing their incorporation into filaments [9]. ATP-hydro-
lysis in p.R183W mutant F-actin is increased 1.7-fold
and the filament disassembly is 34% faster than in
wt-b-actin. Hence, we assume that the p.R183W
mutant forms shorter and less stable filaments. Fila-
ment instability of p.R183W actin can be linked to the
lack of lamellipodial protrusions in lymphoblastoid cell
lines derived from patients carrying this mutation [10].
Because the proper formation of lamellipodia is impor-
tant for coordinated cell migration, the observed devel-
opmental malformations in the patients with p.R183W
actin can be partially explained by our findings. Fur-
thermore, b-actin is crucial for the maintenance of ste-
reocilia in cochlear hair cells [35]. Therefore, unstable
actin filaments made from p.R183W actin are likely to
contribute to the patients’ hearing loss.
Actin dynamics are important for many intracellular
signaling pathways, particularly the chemotactic fMLP
receptor pathway in neutrophil granulocytes [36,37].
Its activation induces rapid actin polymerization and
depolymerization events. Nunoi et al. have reported
that neutrophils from patients with p.E364K actin
show a reduced fMLP receptor-mediated chemotactic
response [15]. With regard to our results, the p.E364K
mutation is likely to hinder rapid polymerization of
b-actin during fMLP receptor signaling and thereby
contributes to neutrophil dysfunction.
We examined the interactions of the mutant actins
with profilin and myosin in detail. Profilin triggers
nucleotide exchange. The complex of profilin with
ATP–actin is recruited to the barbed end of growing
filaments in the cell [38,39]. Contradictory results
regarding the interaction of p.E364K actin with profi-
lin have been published [13,15]. We tested the interac-
tion of the proteins using microscale thermophoresis.
Our results show only minor differences in the profilin
affinity of p.E364K-b-actin compared with the wild-
type. Profilin binds in a groove between SD1 and SD3
with actin residues Tyr169, His173, Met355 and
Phe375 forming the central interaction interface (see
also Refs [26,29] and Fig. 5B,C). They are less
involved in structural alterations predicted by our MD
simulations (Fig. 7C,D). As the thermophoresis experi-
ment suggests, Glu364 is not essential for profilin
binding. The structures in Fig. 5B,C show that this
residue is situated at the periphery of the actin–profilinbinding interface.
The interaction with myosin is severely impaired in
the case of p.R183W actin. Filaments formed by this
mutant show a fourfold reduced ability to activate the
ATPase of NM-2A. We assume that allosteric pertur-
bation by the p.R183W mutation affects actin’s capac-
ity to interact with the myosin.
Both nonsarcomeric myosin and cytoplasmic actin
have complementary roles in cell migration and over-
lapping functions in the maintenance of stereocilia
[35,40,41]. Therefore, a defective actomyosin interac-
tion is likely to contribute to the phenotype of the
patients carrying the p.R183W mutation [10].
Our study of disease-related b-actin variants provides
insight into the mechanisms that drive the conforma-
tional changes actin undergoes during its polymeriza-
tion and depolymerization cycle. Actin has evolved a
dense allosteric network that regulates the transition
between the monomeric and the filamentous form as
well as the interaction with many cellular components.
Our work highlights how changes in this network by sin-
gle point mutations affect the functional competence of
the molecule and thereby lead to severe disorders.
Materials and methods
Reagents
The Phusion Site-Directed-Mutagenesis Kit, goat anti-
(mouse) IgG conjugated with horseradish-peroxidase,
SuperSignal West Femto Maximum Sensitivity Substrates
and desalting columns were purchased from Thermo Fisher
Scientific (Schwerte, Germany). Ni2+-nitrilotriacetic acid
(Ni-NTA) superflow resin was purchased from Qiagen
(Hilden, Germany). e-ATP was from Life Technologies
(Carlsbad, CA, USA). Monoclonal anti-(b-actin) IgG
(mouse, clone AC-74) and standard reagents were
purchased from Sigma-Aldrich (St. Louis, MO, USA). N-
(1-pyrene)iodoacetamide and Cellfectin II were from Invi-
trogen (Carlsbad, CA, USA), recombinant bovine pancreas
DNase I and complete protease inhibitor cocktail tablets
were from Roche (Basel, Switzerland).
Plasmid construction and baculovirus generation
The pFastBac plasmid encoding tag-free human cytoplas-
mic b-actin and the human gelsolin C-terminal segments
G4–6 were generated as previously described [16]. Site-
directed mutagenesis of b-actin was performed using the
following 50-phosphorylated oligonucleotides (sequences
from 50 to 30): TACCTCATGAAGATCCTCACCGAGCG
(p.R183W sense primer), GTCAGTCAGGTCCCAGC
CAGCCAGGTC (p.R183W mutagenic antisense primer),
CAGGAGTATGACAAGTCCGGCCCCTCC (p.E364K
mutagenic sense primer), CTTGCTGATCCACATCTGCT
GGAAGGT (p.E364K antisense primer). The mutation
nomenclature follows the guidelines of the HGVS (Human
9FEBS Journal (2014) ª 2014 FEBS
N. Hundt et al. Molecular mechanisms of human b-actin mutations
Genome Variation Society). The resulting plasmids were
double-strand sequenced to verify mutagenesis and to
exclude the possibility of amplification-associated errors.
The baculovirus transfer vectors for wild-type b-actin and
both mutants were transformed in DH10Bac
Escherichia coli cells and the recombinant bacmids were
transfected into Sf9 (Spodoptera frugiperda) insect cells. Ba-
culovirus was amplified according to the manufacturer’s
protocol and Sf9-cells were infected at MOI 25. Cells were
harvested 3 days post infection and stored at �80 °C.
Protein production
Tag-free human b-actin wild-type (wt), p.R183W and
p.E364K were purified from Sf9-cells as G-actin (globular
or monomeric actin) by affinity chromatography using the
C-terminal gelsolin half G4–6 [16,42]. Briefly, Sf9 cells were
lyzed by sonication in lysis buffer (10 mM Tris/HCl pH 8.0,
5 mM CaCl2, 4% Triton X-100, 1 mg�mL�1 Tween-20,
1 mM dithiothreitol, 1 mM ATP and protease inhibitor mix-
ture). Afterwards, 50 mM KCl, 20 mM imidazole, pH 8.0,
and a threefold excess of gelsolin G4–6 were added and
incubated at 4 °C overnight. The lysate was cleared by
centrifugation. The actin–gelsolin complex was bound to a
Ni-NTA column and washed with wash buffer (10 mM
Tris/HCl pH 8.0, 5 mM CaCl2, 50 mM KCl, 20 mM imidaz-
ole). Actin was eluted with elution buffer (10 mM Tris/HCl
pH 8.0, 50 mM KCl, 1.5 mM EGTA). The actin was dia-
lyzed against actin storage buffer (10 mM Tris/HCl pH 8.0,
0.2 mM MgCl2, 1 mM dithiothreitol), concentrated, frozen
in liquid nitrogen and stored at –80 °C. The G4–6 gelsolin
deletion mutant was expressed and purified from E. coli
according to Ohki et al. [42]. Human NM-2A and human
profilin II were prepared as described elsewhere [43,44].
The homogeneity of the protein preparations was con-
firmed by 10% SDS/PAGE and western blot analysis using
an anti-(b-actin) IgG (Fig. 1B,C).
Pyrene-actin-based assays
Actin polymerization rates were measured by the change in
fluorescence upon incorporation of pyrene-labeled actin
[22]. Using 10 lM of G-actin supplemented with 5% of
pyrene-labeled actin, polymerization was induced by the
addition of 2 mM MgCl2 and 0.1 M KCl in G-actin buffer
(10 mM Tris/HCl pH 8.0, 0.2 mM CaCl2, 7 mM b-mercapto-
ethanol, 1 mM ATP). The increase of pyrenyl-fluorescence
was monitored in a total volume of 50 lL on a microplate
at 407 nm and 21 °C using a Varian Cary Eclipse spectro-
fluorometer (Agilent Technologies, Santa Clara, CA, USA)
with an excitation wavelength of 365 nm. Actin depolymer-
ization assays were performed with filamentous actin that
was polymerized in the presence of 5% pyrene-labeled
actin. A 10 lM stock solution was diluted to 0.2 lM in
depolymerization buffer (10 mM Tris/HCl pH 8.0, 50 mM
KCl, 1 mM MgCl2, 1 mM EGTA, 2 mM dithiothreitol). The
decrease in pyrenyl-fluorescence was observed in a total
volume of 200 lL on a microplate as described above.
Apparent half-times of polymerization and depolymeriza-
tion time courses were calculated from the rate constants
obtained by approximation of a single exponential function
to the kinetic traces.
ATPase measurements
Intrinsic steady-state ATP turnover of 10 lM F-actin was
measured using an NADH-coupled assay, as described pre-
viously [45]. b-Actin variants were polymerized for at least
4 h at 21 °C and used directly in the assay. ATPase activa-
tion of NM-2A was measured in the absence and presence
of 30 lM F-actin as detailed elsewhere [16].
DNase I inhibition and thermal stability
Binding of actin to DNase I was determined with the
DNase I inhibition assay according to Morrison et al. [46].
Briefly, 0.05–0.75 lM G-actin and 150 nm recombinant
DNase I were preincubated in G-actin buffer for 30 min at
room temperature. The reactions were started in a UV-
transparent 96-well microplate by adding 80 lL of
200 lg�mL�1 salmon sperm DNA in DNA buffer (10 mM
Tris/HCl pH 8.0, 4 mM MgCl2, 1.8 mM CaCl2) into 20 lLof the actin–DNase I preincubation mix. Absorption at
260 nm was recorded for 3 min at 25 °C using a SPEC-
TROstar Omega absorbance microplate reader (BMG Lab-
tech, Ortenberg, Germany). Initial rates were compared
with a reference sample containing no actin. The actin con-
centration that causes 50% of DNase I inhibition (IC50)
was determined by fitting a Hill function to the data set.
For testing thermal stability of the actin variants the
DNase I inhibition assay was modified according to
Sch€uler et al. [18]. Briefly, G-actin was incubated for 5 min
at temperatures between 40 and 70 °C using a temperature
gradient in a PCR thermocycler (SensoQuest, G€ottingen,
Germany). Afterwards, the DNase I inhibition assay was
applied as described above using saturating actin concen-
trations. The temperatures at which inhibition of DNase I
was half-maximal were determined by nonlinear curve fit-
ting using a Boltzmann function and are regarded as mid-
points of the thermal transition into the unfolded state
(Tm).
Nucleotide exchange
Nucleotide exchange rates were determined from the
change in fluorescence after exchange of actin-bound
e-ATP by ATP [21]. First, residual nucleotides in the actin
stocks were removed by buffer exchange with 10 mM Tris/
10 FEBS Journal (2014) ª 2014 FEBS
Molecular mechanisms of human b-actin mutations N. Hundt et al.
HCl (pH 8.0) using desalting spin columns. Actin was
then incubated with 100 lM e-ATP for 2 h on ice and the
main excess of e-ATP was subsequently removed by a sec-
ond buffer exchange with 10 mM Tris/HCl (pH 8.0)
including 10 lM e-ATP. The protein concentration was
determined using a Bradford assay (Bio-Rad Protein
Assay; Bio-Rad, Munich, Germany) with BSA as stan-
dard. The e-ATP-bound actin was diluted to 2 lM and
mixed with an equal volume of G-actin buffer including
0.2 mM ATP in a High-Tech Scientific stopped-flow fluo-
rometer. The change in fluorescence at 21 °C was detected
over 25 min with an excitation wavelength of 335 nm and
a 389 nm emission cut-off filter. The signal was averaged
from at least three replicates and fitted to a double expo-
nential decay function to determine the fast and slow
phase of nucleotide exchange.
Microscale thermophoresis
Profilin II in 25 mM Hepes (pH 8.0) was labeled using the
Monolith NT Protein Labeling Kit RED NHS (NanoTem-
per Technologies, Munich, Germany). Labeling efficiency
was tested by comparing absorption at 280 and 650 nm.
The buffer of the b-actin variants was replaced by 25 mM
Hepes (pH 8.0), 20 mM KCl using desalting spin columns.
Actin was prepared as a twofold serial dilution and added
to an equal volume of 0.2 lM labeled profilin (final buffer
conditions: 25 mM Hepes pH 8.0, 10 mM KCl). After
10 min incubation time, the complex was filled into Mono-
lith NT.115 Standard Treated Capillaries (NanoTemper
Technologies) and thermophoresis was measured in a
Monolith NT.015T Microscale Thermophoresis device
(NanoTemper Technologies) at 20 °C, 75% red LED
power and 20% IR-laser power. The actin dependent
change in thermophoresis was described with a Hill func-
tion to determine the apparent dissociation constant Kd of
the actin–profilin complex.
MD simulations
MD simulations were carried out with NAMD 2.9 [25] and
the CHARMM27 force field [47]. The X-ray coordinates of G-
actin in the closed state (2BTF) were used as a starting
structure. Single-point mutations (p.R183W and p.E364K)
were inserted using the SCHR€ODINGER SUITE (2012) and the
proteins were prepared using PROTEIN PREPARATION WIZARD
[27]. N-Terminal acetylation of the protein was removed
and Sr2+∙ATP was replaced by Ca2+∙ATP. The proteins
were fully solvated with the TIP3P explicit water model
[48] and charges were neutralized by adding counter ions to
the system. Simulations were performed in a NpT ensemble
at constant temperature (310 K) and constant pressure
(1 atm) using Langevin dynamics and the Langevin piston
method. Long-range electrostatics were treated with the
particle-mesh Ewald method [49] and a 12 �A cut-off was
used for nonbonded short-range interactions. Prior to pro-
duction runs, the system was energy minimized, the solvent
was equilibrated for 200 ps with positional restraints on the
protein atoms, and subsequently the entire system was
equilibrated for 5 ns. Production runs were conducted for
50 ns per simulation system.
Computational and statistical analysis
Data analysis and graph plotting were performed using
Microsoft EXCEL 2010 (Microsoft, Redmond, WA, USA)
and ORIGIN 8.5 (OriginLab, Northampton, MA, USA).
Errors are given as standard deviations and are based on
three independent determinations (n), if not otherwise spec-
ified. Unpaired two-tailed t-tests were employed for statisti-
cal analysis of kinetic rates and affinity constants using
GraphPad Prism version 5.02 for Windows (GraphPad
Software, San Diego, CA, USA) or Microsoft EXCEL 2010
and the means were regarded as statistically significant if
P < 0.05.
Acknowledgements
This work was supported by the ‘Deutsche Fors-
chungsgemeinschaft’ Grant MA 1081/19-1 (to Dietmar
J. Manstein). The authors thank Hella Scharnhorst for
technical assistance.
Author contributions
Planned experiments: NH, MP, MM; Performed
experiments: NH, MP, OS, MM; Analyzed data: NH,
MP, OS, MM; Contributed reagents or other essential
material: NH, OS, AMA, HGM, DJM, MM; Wrote
the paper: NH, MP, DJM, MM.
References
1 Sheterline P, Clayton J & Sparrow J (1995) Actin.
Protein Profile 2, 1–103.
2 Tondeleir D, Vandamme D, Vandekerckhove J, Ampe
C & Lambrechts A (2009) Actin isoform expression
patterns during mammalian development and in
pathology: insights from mouse models. Cell Motil
Cytoskeleton 66, 798–815.
3 Hoock TC, Newcomb PM & Herman IM (1991) Beta
actin and its mRNA are localized at the plasma
membrane and the regions of moving cytoplasm
during the cellular response to injury. J Cell Biol 112,
653–664.
4 Dugina V, Zwaenepoel I, Gabbiani G, Clement S &
Chaponnier C (2009) Beta and gamma-cytoplasmic
actins display distinct distribution and functional
diversity. J Cell Sci 122, 2980–2988.
11FEBS Journal (2014) ª 2014 FEBS
N. Hundt et al. Molecular mechanisms of human b-actin mutations
5 Khaitlina SY (2001) Functional specificity of actin
isoforms. Int Rev Cytol 202, 35–98.
6 Wegner A (1976) Head to tail polymerization of actin.
J Mol Biol 108, 139–150.
7 Pollard TD & Cooper JA (1986) Actin and actin-
binding proteins. A critical evaluation of mechanisms
and functions. Annu Rev Biochem 55, 987–1035.
8 Carlier MF (1990) Actin polymerization and ATP
hydrolysis. Adv Biophys 26, 51–73.
9 Sch€uler H, Karlsson R, Schutt CE & Lindberg U (2006)
The connection between actin ATPase and
polymerization. Adv Mol Cell Biol 37, 49–66.
10 Procaccio V, Salazar G, Ono S, Styers ML, Gearing M,
Davila A, Jimenez R, Juncos J, Gutekunst CA, Meroni
G, et al. (2006) A mutation of beta-actin that alters
depolymerization dynamics is associated with
autosomal dominant developmental malformations,
deafness, and dystonia. Am J Hum Genet 78, 947–960.
11 Lohr JG, Stojanov P, Lawrence MS, Auclair D,
Chapuy B, Sougnez C, Cruz-Gordillo P, Knoechel B,
Asmann YW, Slager SL, et al. (2012) Discovery and
prioritization of somatic mutations in diffuse large
B-cell lymphoma (DLBCL) by whole-exome
sequencing. Proc Natl Acad Sci USA 109, 3879–3884.
12 Bryan KE, Wen KK, Zhu M, Rendtorff ND,
Feldkamp M, Tranebjaerg L, Friderici KH &
Rubenstein PA (2006) Effects of human deafness
gamma-actin mutations (DFNA20/26) on actin
function. J Biol Chem 281, 20129–20139.
13 Rommelaere H, Waterschoot D, Neirynck K,
Vandekerckhove J & Ampe C (2004) A method for
rapidly screening functionality of actin mutants and
tagged actins. Biol Proced Online 6, 235–249.
14 Vang S, Corydon TJ, Borglum AD, Scott MD,
Frydman J, Mogensen J, Gregersen N & Bross P
(2005) Actin mutations in hypertrophic and dilated
cardiomyopathy cause inefficient protein folding and
perturbed filament formation. FEBS J 272,
2037–2049.
15 Nunoi H, Yamazaki T, Tsuchiya H, Kato S, Malech
HL, Matsuda I & Kanegasaki S (1999) A heterozygous
mutation of beta-actin associated with neutrophil
dysfunction and recurrent infection. Proc Natl Acad Sci
USA 96, 8693–8698.
16 M€uller M, Diensthuber RP, Chizhov I, Claus P,
Heissler SM, Preller M, Taft MH & Manstein DJ
(2013) Distinct functional interactions between actin
isoforms and nonsarcomeric myosins. PLoS ONE 8,
e70636.
17 Mannherz HG, Goody RS, Konrad M & Nowak E
(1980) The interaction of bovine pancreatic
deoxyribonuclease I and skeletal muscle actin. Eur J
Biochem 104, 367–379.
18 Sch€uler H, Lindberg U, Schutt CE & Karlsson R
(2000) Thermal unfolding of G-actin monitored with
the DNase I-inhibition assay stabilities of actin
isoforms. Eur J Biochem 267, 476–486.
19 Pollard TD (1984) Polymerization of ADP-actin. J Cell
Biol 99, 769–777.
20 Fujii T, Iwane AH, Yanagida T & Namba K (2010)
Direct visualization of secondary structures of F-actin
by electron cryomicroscopy. Nature 467, 724–728.
21 Wang YL & Taylor DL (1981) Exchange of 1, N6-
etheno-ATP with actin-bound nucleotides as a tool for
studying the steady-state exchange of subunits in F-
actin solutions. Proc Natl Acad Sci USA 78, 5503–5507.
22 Kouyama T & Mihashi K (1981) Fluorimetry study of
N-(1-pyrenyl)iodoacetamide-labelled F-actin. Local
structural change of actin protomer both on
polymerization and on binding of heavy meromyosin.
Eur J Biochem 114, 33–38.
23 Selden LA, Kinosian HJ, Estes JE & Gershman LC
(1999) Impact of profilin on actin-bound nucleotide
exchange and actin polymerization dynamics.
Biochemistry 38, 2769–2778.
24 Wienken CJ, Baaske P, Rothbauer U, Braun D &
Duhr S (2010) Protein-binding assays in biological
liquids using microscale thermophoresis. Nat Commun
1, 100.
25 Phillips JC, Braun R, Wang W, Gumbart J,
Tajkhorshid E, Villa E, Chipot C, Skeel RD, Kale L &
Schulten K (2005) Scalable molecular dynamics with
NAMD. J Comput Chem 26, 1781–1802.
26 Schutt CE, Myslik JC, Rozycki MD, Goonesekere NC
& Lindberg U (1993) The structure of crystalline
profilin-beta-actin. Nature 365, 810–816.
27 Schr€odinger Suite (2012) Protein Preparation Wizard;
Epik version 2.3; Impact version 5.8; Prime version 3.1;
Maestro Version 9.3. Schr€odinger L, New York, NY.
28 Minehardt TJ, Kollman PA, Cooke R & Pate E (2006)
The open nucleotide pocket of the profilin/actin x-ray
structure is unstable and closes in the absence of
profilin. Biophys J 90, 2445–2449.
29 Chik JK, Lindberg U & Schutt CE (1996) The structure
of an open state of beta-actin at 2.65 A resolution.
J Mol Biol 263, 607–623.
30 Orlova A, Chen X, Rubenstein PA & Egelman EH
(1997) Modulation of yeast F-actin structure by a
mutation in the nucleotide-binding cleft. J Mol Biol
271, 235–243.
31 Sch€uler H, Schutt CE, Lindberg U & Karlsson R (2000)
Covalent binding of ATPgammaS to the nucleotide-
binding site in S14C-actin. FEBS Lett 476, 155–159.
32 Sch€uler H (2001) ATPase activity and conformational
changes in the regulation of actin. Biochim Biophys
Acta 1549, 137–147.
33 Chen X & Rubenstein PA (1995) A mutation in an
ATP-binding loop of Saccharomyces cerevisiae actin
(S14A) causes a temperature-sensitive phenotype in vivo
and in vitro. J Biol Chem 270, 11406–11414.
12 FEBS Journal (2014) ª 2014 FEBS
Molecular mechanisms of human b-actin mutations N. Hundt et al.
34 Sch€uler H, Korenbaum E, Schutt CE, Lindberg U &
Karlsson R (1999) Mutational analysis of Ser14 and
Asp157 in the nucleotide-binding site of beta-actin. Eur
J Biochem 265, 210–220.
35 Perrin BJ, Sonnemann KJ & Ervasti JM (2010) beta-
actin and gamma-actin are each dispensable for
auditory hair cell development but required for
Stereocilia maintenance. PLoS Genet 6, e1001158.
36 Kutsuna H, Suzuki K, Kamata N, Kato T, Hato F,
Mizuno K, Kobayashi H, Ishii M & Kitagawa S (2004)
Actin reorganization and morphological changes in
human neutrophils stimulated by TNF, GM-CSF, and
G-CSF: the role of MAP kinases. Am J Physiol Cell
Physiol 286, C55–C64.
37 Cicchetti G, Allen PG & Glogauer M (2002)
Chemotactic signaling pathways in neutrophils: from
receptor to actin assembly. Crit Rev Oral Biol Med 13,
220–228.
38 Mockrin SC & Korn ED (1980) Acanthamoeba profilin
interacts with G-actin to increase the rate of exchange
of actin-bound adenosine 50-triphosphate. Biochemistry
19, 5359–5362.
39 Romero S, Le Clainche C, Didry D, Egile C, Pantaloni
D & Carlier MF (2004) Formin is a processive motor
that requires profilin to accelerate actin assembly and
associated ATP hydrolysis. Cell 119, 419–429.
40 Heissler SM & Manstein DJ (2012) Nonmuscle myosin-
2: mix and match. Cell Mol Life Sci. 70, 1–21.
41 Yamamoto N, Okano T, Ma X, Adelstein RS & Kelley
MW (2009) Myosin II regulates extension, growth and
patterning in the mammalian cochlear duct.
Development 136, 1977–1986.
42 Ohki T, Ohno C, Oyama K, Mikhailenko SV &
Ishiwata S (2009) Purification of cytoplasmic actin by
affinity chromatography using the C-terminal half of
gelsolin. Biochem Biophys Res Commun 383, 146–150.
43 Diensthuber RP, Muller M, Heissler SM, Taft MH,
Chizhov I & Manstein DJ (2011) Phalloidin perturbs
the interaction of human non-muscle myosin isoforms
2A and 2C1 with F-actin. FEBS Lett 585, 767–771.
44 Ballweber E, Giehl K, Hannappel E, Huff T, Jockusch
BM & Mannherz HG (1998) Plant profilin induces
actin polymerization from actin : beta-thymosin
complexes and competes directly with beta-thymosins
and with negative co-operativity with DNase I for
binding to actin. FEBS Lett 425, 251–255.
45 M€uller M, Mazur AJ, Behrmann E, Diensthuber RP,
Radke MB, Qu Z, Littwitz C, Raunser S,
Schoenenberger CA, Manstein DJ, et al. (2012)
Functional characterization of the human alpha-cardiac
actin mutations Y166C and M305L involved in
hypertrophic cardiomyopathy. Cell Mol Life Sci 69,
3457–3479.
46 Morrison SS & Dawson JF (2007) A high-throughput
assay shows that DNase I binds actin monomers and
polymers with similar affinity. Anal Biochem 364,
159–164.
47 Brooks BR, Brooks CL III, Mackerell AD Jr, Nilsson
L, Petrella RJ, Roux B, Won Y, Archontis G, Bartels
C, Boresch S, et al. (2009) CHARMM: the
biomolecular simulation program. J Comput Chem 30,
1545–1614.
48 Jorgensen WL, Chandrasekhar J, Madura JD, Impey
RW & Klein ML (1983) Comparison of simple
potential functions for simulating liquid water. J Chem
Phys 79, 926–935.
49 Darden T, York D & Pedersen L (1993) Particle
mesh Ewald: an N [center-dot] log(N) method for
Ewald sums in large systems. J Chem Phys 98,
10089–10092.
50 Hayward S & Berendsen HJ (1998) Systematic analysis
of domain motions in proteins from conformational
change: new results on citrate synthase and T4
lysozyme. Proteins 30, 144–154.
Supporting information
Additional supporting information may be found in
the online version of this article at the publisher’s web
site:Movies S1–S3. Molecular dynamics simulation of wt-
b-actin (S1), p.R183W-b-actin (S2) and p.E364K-b-actin (S3).
13FEBS Journal (2014) ª 2014 FEBS
N. Hundt et al. Molecular mechanisms of human b-actin mutations