8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 112

Nematology 2010 Vol 12(5) 661-672 Forum article

Marine nematode taxonomy in the age of DNA the present and

future of molecular tools to assess their biodiversity

Neyvan Renato RODRIGUES DA S ILVA 1234lowast Maria CRISTINA DA S ILVA 1

Verocircnica FONSECA GENEVOIS 1 Andreacute Morgado ESTEVES 1 Paul DE LEY 5Wilfrida DECRAEMER 67 Tania Tassinari RIEGER 2

and Maria Tereza DOS SANTOS CORREIA 4

1 Departamento de Zoologia Universidade Federal de Pernambuco Av Prof Professor Moraes Recircgo sn

Cidade Universitaacuteria Recife Brazil2 Departamento de GeneacuteticaUniversidade Federal de Pernambuco Av Prof Professor Moraes Recircgo sn

Cidade Universitaacuteria Recife Brazil3 Instituto Federal do Rio Grande do Norte Campus Zona Norte Rua Brusque 2926 Potengi Natal

Rio Grande do Norte Brazil4 Departamento de Bioquiacutemica Universidade Federal de Pernambuco Av Prof Professor Moraes Recircgo sn

Cidade Universitaacuteria Recife Brazil5 Department of Nematology University of California Riverside CA 92521 USA

6 Department of Biology Ghent University Ledeganckstraat 35 B 9000 Ghent Belgium7 Royal Belgian Institute of Natural Sciences Vautierstraat 29 B 1000 Brussels Belgium

Received 12 November 2009 revised 18 March 2010Accepted for publication 18 March 2010

Summary ndash Molecular taxonomy is one of the most promising yet challenging fields of biology Molecular markers such as nuclear andmitochondrial genes are being used in a variety of studies surveying marine nematode taxa Sequences from more than 600 species havebeen deposited to date in online databases These barcode sequences are assigned to 150 nominal species from 104 genera There are41 species assigned to Enoplea and 109 species to Chromadorea Morphology-based surveys are greatly limited by processing speedwhile barcoding approaches for nematodes are hampered by difficulties in matching sequence data with morphology-based taxonomyDNA barcoding is a promising approach because some genes contain variable regions that are useful to discriminate species boundariesdiscover cryptic species quantify biodiversity and analyse phylogeny We advocate a combination of several approaches in studies ofmolecular taxonomy DNA barcoding and conventional taxonomy as a necessary step to enhance the knowledge of biodiversity ofmarine nematodes

Keywords ndash barcoding marine nematodes molecular markers molecular taxonomy

The phylum Nematoda exhibits high species diversityas well as high abundances in aquatic (marine or freshwa-

ter) and terrestrial environments (Floyd et al 2002) Ne-matoda in general are one of the most diverse taxa in theanimal kingdom with estimates ranging from 01 to 100million species (Lambshead 1993 Coomans 2002) Onlya few thousand of these species have been described al-though they represent the most abundant component of themeiofauna in several kinds of ecosystems (Lambshead2004 Bhadury et al 2006a)

lowast Corresponding author e-mail neyvanrodriguesifrnedubr

Species-level identification of most marine nematodesstill relies largely on detailed morphological analysithat requires considerable taxonomic expertise placing ioutside the scope of most routine ecological surveys (DeLey et al 2005 Bhadury et al 2006a b) Nematodeidentification using morphological characters is not onlytime-consuming but also problematic mainly because othe high phenotypic plasticity among populations and theabsence of clear diagnostic characters for cryptic species(Avise amp Walker 1999 Derycke et al 2008 Fonseca e

al 2008)

copy Koninklijke Brill NV Leiden 2010 DOI101163138855410X500073Also available online - wwwbrillnlnemy 661

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 212

NR Rodrigues da Silva et al

The advent of molecular techniques has opened up newpossibilities for taxonomic research and has provided animportant tool given that the vast majority of species arenot well differentiated morphologically (Godfray 2002Seberg et al 2003 Vogler amp Monaghan 2007) Thesenew techniques improve taxonomic precision and assist in

critical examinations of the accuracy afforded by morpho-logical traits that are commonly used in traditional taxon-omy (Will amp Rubinoff 2004) Indeed several studies havealready illustrated the advances afforded by the interactiveprocess between morphology and DNA lsquobarcodingrsquo forsystematics (α-taxonomy and phylogeny) (Blaxter 2004Hebert et al 2004 Lee 2004 Hebert amp Gregory 2005)

DNA barcoding appears to be a promising tool toinventory the biodiversity of free-living marine nematodes(Blaxter et al 2005 Bhadury et al 2006a Meldal et

al 2007 Derycke et al 2008) DNA barcode sequences

have proved useful in identifying clades and evolutionaryrelationships (De Ley amp Blaxter 2002 2004 Savolainenet al 2005)

Large-scale application of molecular data is revolution-ising taxonomy but the validity and relevance of mole-cular approaches and the concepts on which these tech-niques are based have been subject to a variety of criti-cisms (Lipscomb et al 2003 Wheeler 2004 Rubinoff et

al 2006 Kohler 2007 Valdecasas et al 2008)This survey presents an overview of molecular ap-

proaches for marine nematode taxa dealing with DNA

taxonomy barcoding and molecular taxonomy We alsodiscuss the application of molecular markers that arepresently used in studies in molecular taxonomy and thepresent number of barcoded sequences available in publicdatabases for marine nematodes We discuss the prospectsfor future studies with barcoding of marine nematodesusing multiple approaches such as microarrays new se-quencing technology and metagenomics to elucidate rela-tionships among new taxa

DNA taxonomy and barcoding for marinenematodes

The history of nematode systematics has been markedby controversy not only as a result of the developmentof diverse classification systems but also because rela-tively few nematologists produce detailed classifications(De Ley amp Blaxter 2002) Nematode identification usingmorphological characters is often difficult and laboriousTo make matters worse there is no generally acceptedspecies concept by which we can define the unit used and

furthermore nematode species can be variable in mor-phology and differences between valid species can be ob-scured by the absence of clear diagnostic differences (DeLey et al 1999 Derycke et al 2006 2007) Althoughnematodes have been studied for over 100 years objec-tive criteria for assessing the homology of morphologica

characters used in phylogenetic reconstructions within thephylum are still lacking (Chilton et al 2003)

By contrast the concept of DNA-based taxonomy asproposed by Tautz et al (2003) is essentially based onthe barcoding approach as its practical component Thebasic procedure of this approach consists of a tissuesample taken from an individual from which DNAis extracted This DNA serves as the reference samplefrom which one or several gene regions are amplified byPCR and sequenced The resulting sequence will be an

identification tag for the species from which the respectiveindividual was derived (Lipscomb et al 2003 Malleamp Willmott 2003 Marshall 2005) The advocates otaxonomy based mainly on DNA sequences claim thathe current practice in morphological taxonomy is noadequate to achieve the aim of a reasonably completeinventory of animal life in a reasonable period of time(Stoeckle 2003)

Proponents of DNA barcoding have argued that wecould use DNA sequences of one or more particular genesto identify nematode species based on the idea that every

species has its own lsquodiagnosticrsquo sequences ie uniquesets of base-pair mutations (Hollingsworth 1998 Kohler2007) The three main aims of DNA barcoding are to i

assign unknown specimens to species ii) enhance the discovery of new species and facilitate identification partic-ularly in cryptic microscopic and other organisms withcomplex or inaccessible morphology and iii) increasemassively the speed of processing larger data sets (Heberamp Gregory 2005 Freacutezal amp Leblois 2008)

DNA barcoding promises rapid accurate identification

of species or molecular operational units by focusing on ashort standardised segment of the genome (Hajibabaei e

al 2007) At the gene level it provides in many animagroups strong species-level resolution for example forbirds (Hebert et al 2004) spiders (Barret amp Hebert2005) fishes (Ward et al 2005) and lepidopteran(Janzen et al 2005) Building upon the idea of theUniversal Product Code found in commercial productsas lsquobarcodesrsquo (Brown 1997) a few nucleotides may welprovide an immediate diagnosis for species (Hebert et al

2003a DeSalle et al 2005 Savolainen et al 2005)

662 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 312

Marine nematode taxonomy in the age of DNA

One of the main disadvantages occurs in samplingshortfalls across taxa that lead to lsquobarcoding gapsrsquo (Moritzamp Cicero 2004) Many taxa are under-represented andconclusions based on a restricted data set may be biased(Rubinoff 2006 Rach et al 2008)

Recently several authors have discussed the nature

of the taxonomic problems and potential strategies thatcould be used to accelerate the pace of the discovery andclassification of biodiversity with a balanced responsethat would maintain the role of morphology in taxonomy(Mallet amp Willmott 2003 Sites amp Marshall 2003) Infact barcoding seems prone to failure except in caseswith extremely well developed background knowledgeof the taxa sampled and barcoded with an a priori

understanding of sequence variation among populationsand individuals (Wilson 2004)

Molecular markers for taxonomy of marinenematodes

In an effort to standardise the approach to speciesidentification using molecular techniques it has beenproposed that as many species as possible should becharacterised for some genetic markers (Sunnucks 2000Blaxter 2004) However the main difficulty in moleculartaxonomy is to find the ideal gene that discriminates agiven species in the animal kingdom

Several molecular markers have been proposed Thenuclear subunit ribosomal RNA gene is a promisingcandidate because of its great abundance in the genomeand its relatively conserved flanking regions that canprovide classifications into molecular taxonomic units(MOTU) as has been shown in meiofauna specimensincluding nematodes (Floyd et al 2002 Blaxter et al2005)

There is intense selection in the ribosomal DNA genesbecause of their vital role in the assembly of proteinsin the ribosome As a consequence these genes ndash or at

least parts of them ndash are strongly conserved Among theribosomal RNA encoding genes the small subunit (SSU)rDNA is the most conserved (Holterman et al 2006)

NUCLEAR GENES

The SSU rDNA gene has proved to be very useful forexploring the phylogenetic relationships within as well asbetween many (though not all) groups of nematodes Thesemi-conserved areas in the gene allow the unravellingof the deep phylogenetic relationships within the phylum

yet at the same time the more variable regions in the genehave enabled investigators to distinguish between familieor genera and in quite a few cases even between species(Aleshin et al 1998 Holterman et al 2008)

Especially among invertebrates the SSU rDNA iusually present in several copies that code for SSU rRNA

SSU rDNA sequences are known for a broad range oterrestrial nematode fauna and are sufficiently variableto permit the differentiation of closely related nematodespecies (Gasser amp Newton 2000 Fontanilla amp Wade2008) Consequently SSU rDNA has received the mosattention as a barcoding locus in recent literature (Cook e

al 2005 Bhadury et al 2006a) The locus has higherphylogenetic information content with small amountsof polymorphism and often works well for resolvingrelationships at different levels of classification (eg Feacutelixet al 2000 Rusin et al 2003 Foucher et al 2004)

The LSU rDNA gene has been used for almost 10 yearsas a source of diagnostic sequences in nematodes particularly the region that spans the D2 and D3 expansion seg-ments (Thomas et al 1997 Zheng et al 2003 Tenente e

al 2004 Subbotin et al 2007 Fonseca et al 2008 Kumari et al 2009) In nematodes this region covers abou600-1000 bp fairly close to the 5 end of the gene In contrast the conserved regions alternating with D2 and D3are highly constant even across phyla and provide veryrobust primer sites According to De Ley et al (2005)

the D2D3 primer pair has the highest success rate whenapplying PCR amplification to a phylum-wide selection onematodes and based on our limited testing it also workwell in other phyla of microscopic metazoans The locusis not known to be subject to significant levels of intraspecific polymorphism and provides very good separation ocryptic species in some groups (De Ley et al 1999) Previous studies have included phylogenetic applications ofD2 or D3 alone (Litvaitis et al 2000)

The Internal Transcribed Spacer (ITS) region is anotheversatile genetic marker located in the repeating array

of nuclear 18S and 28S ribosomal DNA genes The ITShas been used in constructing phylogenetic trees estimating genetic population structures evaluating populationlevel evolutionary processes and determining taxonomicidentity (Powers et al 1997) In marine nematodes ITSshowed highly divergent phylogenetic lineages caused bya common evolutionary process in the Pellioditis marina

species-complex and the genetic structure of Halomon

hystera disjuncta This marker has not been considereda good universal identification tool in marine nematodes for two reasons i) intra-individual variation is fre-

Vol 12(5) 2010 663

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 412

NR Rodrigues da Silva et al

quently observed which reduces the sequencing signaland ii) a large number of indel events are present withinclosely related cryptic taxa rendering alignment betweendivergent taxa problematic (Derycke et al 2007 2008)(Table A1 Fig 1)

MITOCHONDRIAL GENES

The mitochondrial gene cytochrome c oxidase subunit1 (COI) has been proposed as a candidate locus for alsquouniversalrsquo diagnostic barcode (Lorenz et al 2005) COIis widely used for barcoding animals Current barcod-ing studies have primarily focused on a single mitochon-drial marker as a source of identifying diagnostic bar-

codes (Rach et al 2008) Mitochondrial genes such asCOI could also provide further information on gene-flowpatterns and cryptic-level diversity within marine nematodes However amplification of this gene in marine ne-matodes is extremely difficult and unreliable (Bhadury e

al 2006b)To date there are no phylum-wide universal primers fo

the mitochondrial cytochrome oxidase I gene that workacross the Nematoda and PCR success rates are well be-low 50 for various taxa within the phylum (De Leyet al 2005) The reasons for these problems may relateto the emerging evidence that nematode mitochondriagenomes are highly diverse displaying unusual proper

Fig 1 Combinations of nuclear primers used in studies of rDNA genes for molecular taxonomy of nematodes

Fig 2 Combinations of mitochondrial primers used in studies of molecular taxonomy of nematodes

664 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 512

Marine nematode taxonomy in the age of DNA

ties such as recombination (Lunt amp Hyman 1997) inser-tion editing (Vanfleteren amp Vierstraete 1999) and mul-tipartitioning (Armstrong et al 2000) In addition mi-tochondrial genes have higher mutation rates and a four-fold smaller effective size and consequently evolve morerapidly than the nuclear genes (Avise 2000)

Mitochondrial primers are generally used for barcod-ing studies (Hebert et al 2003a b) Derycke et al (20052006 2007 2008) using a combination of primers suc-ceeded in amplifying the COI gene from two nematodespecies P marina and Geomonhystera disjuncta andshowed cryptic diversity within both taxa (Fig 2 Ta-ble A1) Fonseca et al (2008) also used COI in a survey of integrative taxonomy in two free-living-nematode speciescomplexes However it is clear that current primers arenot adequate if COI-based DNA barcoding is to workThere is another combination of COI called a mini-barcode (short primer for COI segment with 150 bp) thatwas used to identify the minimum amount of sequenceinformation required for accurate species identification

(Meusnier et al 2008) This primer set was tested in ma-rine nematodes and showed high PCR success rates buthe sequences produced showed a lack of phylogeneticsignal for discriminating relationships among nematodespecies (Silva et al unpubl data) (Fig 2 Table A1)Thereafter with the sequencing of new mitochondria

genes new insights on how to apply other mtDNA canbecome helpful in studies of molecular taxonomy of marine nematodes

AVAILABLE SEQUENCED DATA OF MARINE

NEMATODES

A total of 600 barcode sequences of marine nematodeshave been deposited in the NCBI to date These barcodesequences were assigned to 150 nominal species from104 genera In total barcoded sequences of 41 specieswere assigned to Enoplea (Fig 3) and 109 species toChromadorea (Fig 4) Within the latter class the mossequenced family is Chromadoridae (with 18 species)

Fig 3 Estimated number of nematode species barcoded for SSULSUCOI markers in class Enoplea compared to the number of

described nematode species Source httpwwwnemyscom

Vol 12(5) 2010 665

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 312

Marine nematode taxonomy in the age of DNA

One of the main disadvantages occurs in samplingshortfalls across taxa that lead to lsquobarcoding gapsrsquo (Moritzamp Cicero 2004) Many taxa are under-represented andconclusions based on a restricted data set may be biased(Rubinoff 2006 Rach et al 2008)

Recently several authors have discussed the nature

of the taxonomic problems and potential strategies thatcould be used to accelerate the pace of the discovery andclassification of biodiversity with a balanced responsethat would maintain the role of morphology in taxonomy(Mallet amp Willmott 2003 Sites amp Marshall 2003) Infact barcoding seems prone to failure except in caseswith extremely well developed background knowledgeof the taxa sampled and barcoded with an a priori

understanding of sequence variation among populationsand individuals (Wilson 2004)

Molecular markers for taxonomy of marinenematodes

In an effort to standardise the approach to speciesidentification using molecular techniques it has beenproposed that as many species as possible should becharacterised for some genetic markers (Sunnucks 2000Blaxter 2004) However the main difficulty in moleculartaxonomy is to find the ideal gene that discriminates agiven species in the animal kingdom

Several molecular markers have been proposed Thenuclear subunit ribosomal RNA gene is a promisingcandidate because of its great abundance in the genomeand its relatively conserved flanking regions that canprovide classifications into molecular taxonomic units(MOTU) as has been shown in meiofauna specimensincluding nematodes (Floyd et al 2002 Blaxter et al2005)

There is intense selection in the ribosomal DNA genesbecause of their vital role in the assembly of proteinsin the ribosome As a consequence these genes ndash or at

least parts of them ndash are strongly conserved Among theribosomal RNA encoding genes the small subunit (SSU)rDNA is the most conserved (Holterman et al 2006)

NUCLEAR GENES

The SSU rDNA gene has proved to be very useful forexploring the phylogenetic relationships within as well asbetween many (though not all) groups of nematodes Thesemi-conserved areas in the gene allow the unravellingof the deep phylogenetic relationships within the phylum

yet at the same time the more variable regions in the genehave enabled investigators to distinguish between familieor genera and in quite a few cases even between species(Aleshin et al 1998 Holterman et al 2008)

Especially among invertebrates the SSU rDNA iusually present in several copies that code for SSU rRNA

SSU rDNA sequences are known for a broad range oterrestrial nematode fauna and are sufficiently variableto permit the differentiation of closely related nematodespecies (Gasser amp Newton 2000 Fontanilla amp Wade2008) Consequently SSU rDNA has received the mosattention as a barcoding locus in recent literature (Cook e

al 2005 Bhadury et al 2006a) The locus has higherphylogenetic information content with small amountsof polymorphism and often works well for resolvingrelationships at different levels of classification (eg Feacutelixet al 2000 Rusin et al 2003 Foucher et al 2004)

The LSU rDNA gene has been used for almost 10 yearsas a source of diagnostic sequences in nematodes particularly the region that spans the D2 and D3 expansion seg-ments (Thomas et al 1997 Zheng et al 2003 Tenente e

al 2004 Subbotin et al 2007 Fonseca et al 2008 Kumari et al 2009) In nematodes this region covers abou600-1000 bp fairly close to the 5 end of the gene In contrast the conserved regions alternating with D2 and D3are highly constant even across phyla and provide veryrobust primer sites According to De Ley et al (2005)

the D2D3 primer pair has the highest success rate whenapplying PCR amplification to a phylum-wide selection onematodes and based on our limited testing it also workwell in other phyla of microscopic metazoans The locusis not known to be subject to significant levels of intraspecific polymorphism and provides very good separation ocryptic species in some groups (De Ley et al 1999) Previous studies have included phylogenetic applications ofD2 or D3 alone (Litvaitis et al 2000)

The Internal Transcribed Spacer (ITS) region is anotheversatile genetic marker located in the repeating array

of nuclear 18S and 28S ribosomal DNA genes The ITShas been used in constructing phylogenetic trees estimating genetic population structures evaluating populationlevel evolutionary processes and determining taxonomicidentity (Powers et al 1997) In marine nematodes ITSshowed highly divergent phylogenetic lineages caused bya common evolutionary process in the Pellioditis marina

species-complex and the genetic structure of Halomon

hystera disjuncta This marker has not been considereda good universal identification tool in marine nematodes for two reasons i) intra-individual variation is fre-

Vol 12(5) 2010 663

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 412

NR Rodrigues da Silva et al

quently observed which reduces the sequencing signaland ii) a large number of indel events are present withinclosely related cryptic taxa rendering alignment betweendivergent taxa problematic (Derycke et al 2007 2008)(Table A1 Fig 1)

MITOCHONDRIAL GENES

The mitochondrial gene cytochrome c oxidase subunit1 (COI) has been proposed as a candidate locus for alsquouniversalrsquo diagnostic barcode (Lorenz et al 2005) COIis widely used for barcoding animals Current barcod-ing studies have primarily focused on a single mitochon-drial marker as a source of identifying diagnostic bar-

codes (Rach et al 2008) Mitochondrial genes such asCOI could also provide further information on gene-flowpatterns and cryptic-level diversity within marine nematodes However amplification of this gene in marine ne-matodes is extremely difficult and unreliable (Bhadury e

al 2006b)To date there are no phylum-wide universal primers fo

the mitochondrial cytochrome oxidase I gene that workacross the Nematoda and PCR success rates are well be-low 50 for various taxa within the phylum (De Leyet al 2005) The reasons for these problems may relateto the emerging evidence that nematode mitochondriagenomes are highly diverse displaying unusual proper

Fig 1 Combinations of nuclear primers used in studies of rDNA genes for molecular taxonomy of nematodes

Fig 2 Combinations of mitochondrial primers used in studies of molecular taxonomy of nematodes

664 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 512

Marine nematode taxonomy in the age of DNA

ties such as recombination (Lunt amp Hyman 1997) inser-tion editing (Vanfleteren amp Vierstraete 1999) and mul-tipartitioning (Armstrong et al 2000) In addition mi-tochondrial genes have higher mutation rates and a four-fold smaller effective size and consequently evolve morerapidly than the nuclear genes (Avise 2000)

Mitochondrial primers are generally used for barcod-ing studies (Hebert et al 2003a b) Derycke et al (20052006 2007 2008) using a combination of primers suc-ceeded in amplifying the COI gene from two nematodespecies P marina and Geomonhystera disjuncta andshowed cryptic diversity within both taxa (Fig 2 Ta-ble A1) Fonseca et al (2008) also used COI in a survey of integrative taxonomy in two free-living-nematode speciescomplexes However it is clear that current primers arenot adequate if COI-based DNA barcoding is to workThere is another combination of COI called a mini-barcode (short primer for COI segment with 150 bp) thatwas used to identify the minimum amount of sequenceinformation required for accurate species identification

(Meusnier et al 2008) This primer set was tested in ma-rine nematodes and showed high PCR success rates buthe sequences produced showed a lack of phylogeneticsignal for discriminating relationships among nematodespecies (Silva et al unpubl data) (Fig 2 Table A1)Thereafter with the sequencing of new mitochondria

genes new insights on how to apply other mtDNA canbecome helpful in studies of molecular taxonomy of marine nematodes

AVAILABLE SEQUENCED DATA OF MARINE

NEMATODES

A total of 600 barcode sequences of marine nematodeshave been deposited in the NCBI to date These barcodesequences were assigned to 150 nominal species from104 genera In total barcoded sequences of 41 specieswere assigned to Enoplea (Fig 3) and 109 species toChromadorea (Fig 4) Within the latter class the mossequenced family is Chromadoridae (with 18 species)

Fig 3 Estimated number of nematode species barcoded for SSULSUCOI markers in class Enoplea compared to the number of

described nematode species Source httpwwwnemyscom

Vol 12(5) 2010 665

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 412

NR Rodrigues da Silva et al

quently observed which reduces the sequencing signaland ii) a large number of indel events are present withinclosely related cryptic taxa rendering alignment betweendivergent taxa problematic (Derycke et al 2007 2008)(Table A1 Fig 1)

MITOCHONDRIAL GENES

The mitochondrial gene cytochrome c oxidase subunit1 (COI) has been proposed as a candidate locus for alsquouniversalrsquo diagnostic barcode (Lorenz et al 2005) COIis widely used for barcoding animals Current barcod-ing studies have primarily focused on a single mitochon-drial marker as a source of identifying diagnostic bar-

codes (Rach et al 2008) Mitochondrial genes such asCOI could also provide further information on gene-flowpatterns and cryptic-level diversity within marine nematodes However amplification of this gene in marine ne-matodes is extremely difficult and unreliable (Bhadury e

al 2006b)To date there are no phylum-wide universal primers fo

the mitochondrial cytochrome oxidase I gene that workacross the Nematoda and PCR success rates are well be-low 50 for various taxa within the phylum (De Leyet al 2005) The reasons for these problems may relateto the emerging evidence that nematode mitochondriagenomes are highly diverse displaying unusual proper

Fig 1 Combinations of nuclear primers used in studies of rDNA genes for molecular taxonomy of nematodes

Fig 2 Combinations of mitochondrial primers used in studies of molecular taxonomy of nematodes

664 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 512

Marine nematode taxonomy in the age of DNA

ties such as recombination (Lunt amp Hyman 1997) inser-tion editing (Vanfleteren amp Vierstraete 1999) and mul-tipartitioning (Armstrong et al 2000) In addition mi-tochondrial genes have higher mutation rates and a four-fold smaller effective size and consequently evolve morerapidly than the nuclear genes (Avise 2000)

Mitochondrial primers are generally used for barcod-ing studies (Hebert et al 2003a b) Derycke et al (20052006 2007 2008) using a combination of primers suc-ceeded in amplifying the COI gene from two nematodespecies P marina and Geomonhystera disjuncta andshowed cryptic diversity within both taxa (Fig 2 Ta-ble A1) Fonseca et al (2008) also used COI in a survey of integrative taxonomy in two free-living-nematode speciescomplexes However it is clear that current primers arenot adequate if COI-based DNA barcoding is to workThere is another combination of COI called a mini-barcode (short primer for COI segment with 150 bp) thatwas used to identify the minimum amount of sequenceinformation required for accurate species identification

(Meusnier et al 2008) This primer set was tested in ma-rine nematodes and showed high PCR success rates buthe sequences produced showed a lack of phylogeneticsignal for discriminating relationships among nematodespecies (Silva et al unpubl data) (Fig 2 Table A1)Thereafter with the sequencing of new mitochondria

genes new insights on how to apply other mtDNA canbecome helpful in studies of molecular taxonomy of marine nematodes

AVAILABLE SEQUENCED DATA OF MARINE

NEMATODES

A total of 600 barcode sequences of marine nematodeshave been deposited in the NCBI to date These barcodesequences were assigned to 150 nominal species from104 genera In total barcoded sequences of 41 specieswere assigned to Enoplea (Fig 3) and 109 species toChromadorea (Fig 4) Within the latter class the mossequenced family is Chromadoridae (with 18 species)

Fig 3 Estimated number of nematode species barcoded for SSULSUCOI markers in class Enoplea compared to the number of

described nematode species Source httpwwwnemyscom

Vol 12(5) 2010 665

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 512

Marine nematode taxonomy in the age of DNA

ties such as recombination (Lunt amp Hyman 1997) inser-tion editing (Vanfleteren amp Vierstraete 1999) and mul-tipartitioning (Armstrong et al 2000) In addition mi-tochondrial genes have higher mutation rates and a four-fold smaller effective size and consequently evolve morerapidly than the nuclear genes (Avise 2000)

Mitochondrial primers are generally used for barcod-ing studies (Hebert et al 2003a b) Derycke et al (20052006 2007 2008) using a combination of primers suc-ceeded in amplifying the COI gene from two nematodespecies P marina and Geomonhystera disjuncta andshowed cryptic diversity within both taxa (Fig 2 Ta-ble A1) Fonseca et al (2008) also used COI in a survey of integrative taxonomy in two free-living-nematode speciescomplexes However it is clear that current primers arenot adequate if COI-based DNA barcoding is to workThere is another combination of COI called a mini-barcode (short primer for COI segment with 150 bp) thatwas used to identify the minimum amount of sequenceinformation required for accurate species identification

(Meusnier et al 2008) This primer set was tested in ma-rine nematodes and showed high PCR success rates buthe sequences produced showed a lack of phylogeneticsignal for discriminating relationships among nematodespecies (Silva et al unpubl data) (Fig 2 Table A1)Thereafter with the sequencing of new mitochondria

genes new insights on how to apply other mtDNA canbecome helpful in studies of molecular taxonomy of marine nematodes

AVAILABLE SEQUENCED DATA OF MARINE

NEMATODES

A total of 600 barcode sequences of marine nematodeshave been deposited in the NCBI to date These barcodesequences were assigned to 150 nominal species from104 genera In total barcoded sequences of 41 specieswere assigned to Enoplea (Fig 3) and 109 species toChromadorea (Fig 4) Within the latter class the mossequenced family is Chromadoridae (with 18 species)

Fig 3 Estimated number of nematode species barcoded for SSULSUCOI markers in class Enoplea compared to the number of

described nematode species Source httpwwwnemyscom

Vol 12(5) 2010 665

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 612

NR Rodrigues da Silva et al

Fig 4 Estimated number of nematode species barcoded for SSULSUCOI markers in class Chromadorea compared to the number of

described nematode species Source httpwwwnemyscom

followed by Desmodoridae Ethmolaimidae and Xyalidaewith nine species each

According to our analysis genera of the families Chro-

madoridae and Oncholaimidae have the largest number of species sequences deposited in GenBank However fewerthan 20 species are represented whereas the genus On-

cholaimus alone has more than 30 valid species describedThe number of marine nematode species with barcode se-quences in databases is very low compared with the diver-sity of the phylum Other nematode groups such as plantparasites are better represented in genetic databases Moresequences are needed in order to increase the number of molecular tags in nematodes This reinforces the neces-sity to produce more sequences in studies dealing with

free-living taxa in order to increase the number of mole-cular tags in nematodes Additional 18S rRNA COI and28S sequences from different marine nematode taxa arerequired in order for the barcoding approach to be moreaccurate and useful

FUTURE STUDIES WITH DNA BARCODING IN MARINE

NEMATODES

Two principal elements are proposed in DNA barcod-ing i) the ability to assign an unknown sample to a known

species and ii) the ability to detect previously collectedspecies as distinct The prospect of assigning an unknownsample to a known one is promising especially for wel

known comprehensively sampled groups that have beenextensively studied by genetic and morphological taxon-omy (Meyer amp Paulay 2005)

Nevertheless it is clear that a comprehensive compara-tive molecular database is needed against which unknownsamples can be compared (Ekrem et al 2007) The studyof marine nematodes has recently focused on moleculartools to describe diversity in ecosystems and methods ofintegration of morphological approaches with molecularanalyses must be developed in order to cover the diversityof the group

Several steps must be followed in order to create aDNA-based species identification system First we musdefine a comprehensive barcode sequence library of marine nematodes Second we must develop an effective approach for comparing and matching sequences from newspecimens to the barcode library (Freacutezal amp Leblois 2008)Finally barcoding must be combined with traditional tax-onomy in an attempt to integrate several aspects of thebiological species concept

Molecular analysis is making an obvious contributionto taxonomy in helping to discover cryptic species (Lee

666 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 712

Marine nematode taxonomy in the age of DNA

2004) However it is necessary to know the completerange of diversity of Nematoda in nature in order to under-stand the possible biological differences between crypticnematode species before applying molecular techniquesto attempt to solve ecological questions

Other technologies are available including metage-

nomics a method of sequencing DNA from natural sam-ples which thus provides access to a much wider rangeof genomes to capture the genomic diversity within a nat-ural population (Tringe amp Rubin 2005) The microarraymethod has been applied in some parasitic nematodes andis a promising alternative for high-throughput genotype-based diagnostics combining powerful DNA amplifica-tion strategies with subsequent hybridisation to developoligonucleotide probes specific for multiple target se-quences allowing parallel study of the expression of thousands of genes (Schulze amp Downward 2001 Butte

2002) This technology has been used to generate whole-genome characterisations of aging wild-type and long-lived individuals of the model organism Caenorhabditis

elegans (Golden amp Melov 2004)

Conclusions

Marine environments present challenges in assessingthe biodiversity of nematodes challenges that imposelimitations using morphology-based species identification

and which result in a gross underestimate of the numberof species in these habitats moreover free-living marinespecies are poorly represented in public sequence data-bases Molecular analyses of a much greater diversity of nematode species are urgently needed to improve the rep-resentation of molecular and phylogenetic diversity withinthis wide-ranging group of organisms

Further evaluation is needed to select different mark-ers for molecular studies since a highly conserved genesuch as the 18S rRNA may also vary somewhat withinsome marine nematode populations (Floyd et al 2005

Bhadury et al 2008) Hyperdiverse samples of marinenematodes are especially difficult because they may con-tain very few individuals of each of the many speciesin the samples leaving little or no room for assessingwhether slightly divergent sequences from similar indi-viduals might represent cryptic species vs being attribut-able to intraspecific sequence variation Nowadays theanalysis of specimens using the combination of molec-ular techniques and morphological approach is helpingto solve some of these problems or to support existingspecies complex already described (Fonseca et al 2008)

Methods for rapid sequence acquisition are already inuse at genome sequencing centres and are easily adaptedfor taxonomic sampling (Blaxter 2004 Bhadury et al

2006a b 2008) At the same time morphology-basedtaxonomic methods should continue to be used in orderto develop identification keys for new species of marine

nematodes De Ley and Bert (2002) developed a techniquebased on video capture editing (VCE) which producesa number of multifocal vouchers of barcoded nematodespecies Voucher specimens can be deposited in an openaccess website database supporting the nematode branchof the tree of life (see httpnematolunhedu) Henceit is important that studies with model organisms onintegrative taxonomy carefully examine the limitations oeach strategy in order to choose the best one for futureidentifications

Traditional marine nematode taxonomy based on the

analysis of observable morphological characters may beinsufficient if we are to understand fully the species-levebiodiversity of this meiobenthic group (Bhadury et al

2008) An expanding nuclear and mitochondrial sequencedatabase for nematode species will need to be developedto facilitate routine identification of nematodes Thedevelopment of high-throughput systems may prove to bemore time efficient than traditional microscopy for faunasamples However considering a combination of thoseprocedures it seems that molecular data ndash based on two ormore markers ndash as used to code the morphological datase

for multivariate analysis and ultimately for pinpointingmorphological diagnostic characters may prove to bevery effective (Fonseca et al 2008) although success insome specific cases is very different from applicability onthe scale of ecological surveys Various novel sequencingtechnologies are being developed each aspiring to reducecosts with the aim of producing more sequences onematode species to be deposited in public databases

Although integrative taxonomy requires substantial expertise and time the method is at present one of the besways accurately to delimit species in taxa with unknownbiodiversity (Will et al 2005) Hence taxonomic revisions are urgently required in the phylum Nematoda in order to understand the grouprsquos diversity and to make a compilation of taxonomic descriptions of nematode species

Acknowledgements

The authors are indebted to Luciana Tosta for composing the diagrams that illustrate this paper We acknowl-edge anonymous reviewers for their constructive criti

Vol 12(5) 2010 667

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 812

NR Rodrigues da Silva et al

cism and valuable comments which improved the qualityof this manuscript NR was sponsored by a PhD fel-lowship from Petrobras and supported by the Institute of Technology of Rio Grande do Norte ndash North Zone

References

ALESHIN VV KEDROVA OS MILYUTINA IA VLADY-CHENSKAYA NS amp PETROV NB (1998) Relationshipsamong nematodes based on the analysis of 18S rRNA genesequences molecular evidence for monophyly of chromado-rian and secernentian nematodes Russian Journal of Nema-

tology 6 175-184ARMSTRONG MR BLOK VC amp PHILLIPS MS (2000)

A multipartite mitochondrial genome in the potato cystnematode Globodera pallida Genetics 154 181-192

AVISE JC (2000) Phylogeography the history and formation

of species Cambridge MA USA Harvard University Press447 pp

AVISE J C amp WALKER D (1999) Species realities andnumber in sexual vertebrates perspectives from an asexuallytransmitted genome Proceedings of the National Academy of

Sciences of the United States of America 96 992-995BARRETT R DH amp HEBERT PDN (2005) Identifying

spiders through DNA barcodes Canadian Journal of Zoology

83 481-491BERT W LELIAERT F VIERSTRAETE AR VAN-

FLETEREN JR amp BORGONIE G (2008) Molecular phy-logeny of the Tylenchina and evolution of the female gon-oduct (Nematoda Rhabditida) Molecular Phylogenetics and

Evolution 48 728-744BHADURY P AUSTEN MC BILTON DT LAMBSHEAD

PJD ROGERS AD amp SMERDON GR (2006a) Molec-ular detection of marine nematodes from environmental sam-ples overcoming eukaryotic interference Aquatic Microbial

Ecology 44 97-103BHADURY P AUSTEN MC BILTON DT LAMBSHEAD

PJD ROGERS AD amp SMERDON GR (2006b) Devel-opment and evaluation of a DNA-barcoding approach for the

rapid identification of nematodes Marine Ecology ProgressSeries 320 1-9

BHADURY P AUSTEN MC BILTON DT LAMBSHEAD PJD ROGERS A D amp SMERDON GR (2007) Ex-ploitation of archived marine nematodes ndash a hot lysis DNAextraction protocol for molecular studies Zoologica Scripta

36 93-98BHADURY P AUSTEN MC BILTON DT LAMBSHEAD

PJD ROGERS AD amp SMERDON GR (2008) Evalua-tion of combined morphological and molecular techniques formarine nematode (Terschellingia spp) identification Marine

Biology 154 509-518

BLAXTER ML (2004) The promise of DNA taxonomyPhilosophical Transactions of the Royal Society London B

359 669-679BLAXTER ML DE LEY P GAREY J R LIU LX

SCHELDEMANN P VIERSTRAETE A VANFLETEREN

JR MACKEY LY DORRIS M FRISSE LM ET AL

(1998) A molecular evolutionary framework for the phylumNematoda Nature 392 71-75BLAXTER ML MANN J CHAPMAN T THOMAS F

WHITTON C FLOYD R amp ABEBE E (2005) Definingoperational taxonomic units using DNA barcode data Philo

sophical Transactions of the Royal Society London B 3601935-1943

BROWN SA (1997) Revolution at the checkout counter

Cambridge MA USA Harvard University Press 38 ppBUTTE A (2002) The use and analysis of microarray data

Nature Reviews 1 951-959CHILTON NB HUB Y-CHILTON F amp GASSER RB (2003)

First complete large subunit ribosomal RNA sequence andsecondary structure for a parasitic nematode phylogeneticand diagnostic implications Molecular and Cellular Probes

17 33-39COO K AA BHADURY P DEBENHAM NJ MELDAL

BHM BLAXTER ML SMERDON GR AUSTEN

MC LAMBSHEAD P J D amp ROGERS AD (2005)Denaturing gradient gel electrophoresis (DGGE) as a tool foridentification of marine nematodes Marine Ecology Progress

Series 291 103-113COOMANS A (2002) Present status and future of nematode

systematics Nematology 4 573-582DE LEY P amp BERT W (2002) Video capture and editing as

a tool for the storage distribution and illustration of morpho-logical characters of nematodes Journal of Nematology 34296-302

DE LEY P amp BLAXTER M (2002) Systematic position andphylogeny In Lee D (Ed) The biology of nematodes

London UK Taylor amp Francis pp 1-30DE LEY P amp BLAXTER M (2004) A new system for Ne

matoda combining morphological characters with moleculatrees and translating clades into ranks and taxa In Cook Ramp Hunt DJ (Eds) Nematology Monographs and Perspec

tives volume 2 Leiden The Netherlands EJ Brill pp 633653DE LEY P FEacuteLIX MA FRISSE LM NADLER SA

STERNBER PW amp THOMAS WK (1999) Molecular andmorphological characterization of two reproductively isolatedspecies with mirror-image anatomy (Nematoda Cephalobidae) Nematology 1 591-612

DE LEY P DE LEY IM MORRIS K ABEBE E MUNDO

OCAMPO M YODER M HERAS J WAUMANN DROCHA-OLIVARES A BURR AHJ ET AL (2005) Anintegrated approach to fast and informative morphologicavouchering of nematodes for applications in molecular bar-

668 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 912

Marine nematode taxonomy in the age of DNA

coding Philosophical Transactions of the Royal Society Lon-

don B 360 1945-1958DERYCKE S REMERIE T VIERSTRAETE A BACKELJAU

T VANFLETEREN J VINCX M amp MOENS T (2005)Mitochondrial DNA variation and cryptic speciation withinthe free-living marine nematode Pellioditis marina Marine

Ecology Progress Series 300 91-103DERYCKE S BACKELJAU T VLAEMINCK C VIE R-STRAETE A VANFLETEREN J VINCX M amp MOENST (2006) Seasonal dynamics of population genetic structurein cryptic taxa of the Pellioditis marina complex (NematodaRhabditida) Genetica 128 307-321

DERYCKE S BACKELJAU T VLAEMINCK C VIE R-STRAETE A VANFLETEREN J VINCX M amp MOENS T(2007) Spatiotemporal analysis of population genetic struc-ture in Geomonhystera disjuncta (Nematoda Monhysteridae)reveals high levels of molecular diversity Marine Biology

151 1799-1812

DERYCKE S FONSECA G VIERSTRAETE A VAN-FLETEREN J VINCX M amp MOENS T (2008) Disentan-gling taxonomy within the Rhabditis (Pellioditis) marina (Ne-matoda Rhabditidae) species complex using molecular andmorphological tools Zoological Journal of the Linnean Soci-

ety 152 1-15DESALLE R E GA N MG amp SIDDALL M (2005) The

unholy trinity taxonomy species delimitation and DNAbarcoding Philosophical Transactions of the Royal Society

London B 360 1905-1916DORRIS M VINEY ME amp BLAXTER ML (2002) Mole-

cular phylogenetics analysis of the genus Strongyloides and

related nematodes International Journal of Parasitology 321507-1517

EKREM T WILLASSEN E amp STU R E (2007) A compre-hensive DNA sequences library is essential for identificationwith DNA barcodes Molecular Phylogenetics and Evolution

43 530-542FEacuteLIX MA DE LEY P SOMMER RJ FRISSE LM

NADLER SA THOMAS WK VANFLETEREN JR ampSTERNBERG PW (2000) Evolution of vulva developmentin the Cephalobina (Nematoda) Developmental Biology 22168-86

FLOYD RM ABEBE E PAPERT A amp BLAXTER ML

(2002) Molecular barcodes for soil nematode identification Molecular Ecology 11 839-850

FLOYD RM ROGERS AD LAMBSHEAD PJ amp SMITHCR (2005) Nematode-specific PCR primers for the 18Ssmall subunit rRNA Molecular Ecology Notes 5 611-612

FONSECA G DERYCKE S amp MOENS T (2008) Integrativetaxonomy in two free-living nematode species complexes

Biological Journal of the Linnean Society 94 737-753FONTANILLA I K C amp WAD E CM (2008) The small

subunit (SSU) ribosomal (r) RNA gene as a genetic markerfor identifying infective 3rd juvenile stage Angiostrongylus

cantonensis Acta Tropica 105 181-186

FOUCHER ALJL BONGERS T NOBLE LR amp WIL

SON MJ (2004) Assessment of nematode biodiversity using DGGE of 18S rDNA following extraction of nematodefrom soil Soil and Biochemistry 36 2027-2032

FREacuteZAL L amp LEBLOIS R (2008) Four years of DNA barcoding current advances and prospects Infection Genetics and

Evolution 8 727-736GASSER RB amp NEWTON SE (2000) Genomic and geneticresearch on bursate nematodes significance implications andprospects International Journal for Parasitology 30 509534

GODFRAY HCJ (2002) Challenges for taxonomy ndash thediscipline will have to reinvent itself if it is to survive andflourish Nature 417 17-19

GOLDEN TR amp MELOV S (2004) Microarray analysis ogene expression with age in individual nematodes Aging Cel

3 111-124HAJIBABAEI M SINGER GAC HEBERT PDN amp

HICKEY DA (2007) DNA barcoding how it complementtaxonomy molecular phylogenetics and population geneticsTrends in Genetics 23 167-172

HEBERT PDN amp GREGORY TR (2005) The promise oDNA barcoding for taxonomy Systematic Biology 54 852859

HEBERT PDN CYWINSKA A BALL SL amp DEWAARD

JR (2003a) Biological identifications through DNA barcodes Proceedings of the Royal Society London B 270 313321

HEBERT PDN RATNASINGHAM S amp DEWAARD JR(2003b) Barcoding animal life cytochrome c oxidase subuni1 divergences among closely related species Proceedings of

the Royal Society London B 270 96-99HEBERT PDN PENTON EH BURNS J M JANZEN

DH amp HALLWACHS W (2004) Ten species in one DNAbarcoding reveals cryptic species in the neotropical skippebutterfly Astraptes fulgerator Proceedings of the Nationa

Academy of Sciences of the United States of America 10114812-14817

HOLLINGSWORTH BD (1998) The systematics of chuckwallas (Sauromalus) with a phylogenetic analysis of otheriguanid lizards Herpetology Monographs 12 38-191

HOLTERMAN M VAN DER WURV A VAN DEN ELSENS VAN MEGEN H BONGERS T HOLOVACHOV OBAKKER J amp HELDER J (2006) Phylum-wide analysisof SSU rDNA reveals deep phylogenetic relationships amongnematodes and accelerated evolution towards crown clades

Molecular Biology and Evolution 23 1792-1800HOLTERMAN M RYBARCZYK K VAN DEN ELSEN S

VAN MEGEN H MOOYMAN P PENtildeA SANTIAGO RBONGERS T BAKKER J amp HELDER J (2008) A ribosomal DNA-based framework for the detection and quantification of stress-sensitive nematode families in terrestrial habitats Molecular Ecology Resources 8 23-34

Vol 12(5) 2010 669

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 1012

NR Rodrigues da Silva et al

JANZEN DH HAJIBABAEI M BURNS JMHALLWACHS W REMIGIO E amp HEBERT P (2005) Wed-ding biodiversity inventory of a large complex Lepidopterafauna with DNA barcoding Philosophical Transactions of

the Royal Society London B 360 1835-1845KOHLER F (2007) From DNA taxonomy to barcoding ndash how a

vague idea evolved into a biosystematic tool Zoosystematicsand Evolution 83 44-51KUMARI S DECRAEMER W TRAVERSA D amp LIŠKOVAacute

M (2009) Molecular and morphological delineation of Longidorus poessneckensis Altherr 1974 (Nematoda Dory-laimida) European Journal of Plant Pathology 123 125-137

LAMBSHEAD PJD (1993) Recent developments in marinebenthic biodiversity research Oceanis 19 5-24

LAMBSHEAD PJD (2004) Marine nematode biodiversity InChen ZX Chen SY amp Dickson DW (Eds) Nematology

advances and perspectives volume 1 Nematode morphology

physiology and ecology Wallingford UK CABI Publishing

pp 436-467LEE MSY (2004) The molecularisation of taxonomy Inver-

tebrate Systematics 18 1-6LIPSCOMB D PLATNICK N amp WHEELER Q (2003)

The intellectual content of taxonomy a comment on DNAtaxonomy Trends in Ecology and Evolution 18 65-68

LITVAITIS MK BATES JW HOP E WD amp MOENS T(2000) Inferring a classification of the Adenophorea (Nema-toda) from nucleotide sequences of the D3 expansion segment(2628S rDNA) Canadian Journal of Zoology 78 911-922

LORENZ JG JACKSON WE BECK JC amp HANNER R(2005) The problems and promise of DNA barcodes for

species diagnosis of primate biomaterials PhilosophicalTransactions of the Royal Society London B 360 1869-1877

LUNT DH amp HYMAN BC (1997) Animal mitochondrialDNA recombination Nature 387 247

MALLET J amp WILLMOTT K (2003) Taxonomy renaissanceor Tower of Babel Trends in Ecology and Evolution 18 57-59

MARSHALL E (2005) Taxonomy Will DNA barcodes breathelife into classification Science 307 1037

MELDAL BHM DEBENHAM NJ DE LEY P DE LEYIT VANFLETEREN JR VIERSTRAETE AR BERT WBORGONIE G MOENS T TYLER PA ET AL (2007)

An improved molecular phylogeny of the Nematoda withspecial emphasis on marine taxa Molecular Phylogenetics

and Evolution 42 622-636MEUSNIER I SINGER GAC LANDRY J F HICKEY

DA HEBERT PDN amp HAJIBABAEI M (2008) A uni-versal DNA mini-barcode for biodiversity analysis BMC Ge-

nomics 9 214MEYER CP amp PAULAY G (2005) DNA barcoding Error

rates based on comprehensive sampling Public Library of

Science Biology 3 2229-2238MORITZ C amp CICERO C (2004) DNA barcoding promise

and pitfalls Public Library of Science Biology 2 1529-1531

POWERS TO TOD D TC BURNELL AM MURRAY

PCB FLEMING CC SZALANSKI AL ADAMS BAamp HARRIS TS (1997) The rDNA internal transcribedspacer region as a taxonomic marker for nematodes Journa

of Nematology 29 441-450RACH J DESALLE R SARKAR IN SCHIERWATER B amp

HADRYS H (2008) Character-based DNA barcoding allowdiscrimination of genera species and populations in OdonataProceedings of the Royal Society London B 275 237-247

RUBINOFF D (2006) DNA barcoding evolves into the familiarConservation Biology 20 1548-1549

RUBINOFF D CAMERON S amp WIL L K (2006) A genomicperspective on the shortcomings of mitochondrial DNA forldquobarcodingrdquo identification Journal of Heredity 29 1-14

RUSIN LY ALESHIN V V TCHESUNOV AV ampATRASHKEVICH GI (2003) The 18S ribosomal RNA geneof Soboliphyme baturini Petrow 1930 (Nematoda Dioctophymida) and its implications for phylogenetic relationships

within Dorylaimia Nematology 5 615-628SAVOLAINEN V COWAN RS VOGLER AP RODERICK

GK amp LAN E R (2005) Towards writing the encyclopediaof life an introduction to DNA barcoding Philosophica

Transactions of the Royal Society London B 360 1805-1811SCHULZE A amp DOWNWARD J (2001) Navigating gene

expression using microarrays ndash a technology review Nature

Cell Biology 3 190-195SEBERG O HUMPHRIES CJ KNAPP S STEVENSON

DW PETERSEN G SCHARFF N amp ANDERSEN NM(2003) Shortcuts in systematics A commentary on DNAbased taxonomy Trends in Ecology and Evolution 18 63-65

SITES JW amp MARSHALL JC (2003) Delimiting speciesa renaissance issue in systematic biology Trends in Ecology

and Evolution 18 462-470STOECKLE M (2003) Taxonomy DNA and the barcode of

life Bioscience 53 796-797SUBBOTIN SA STURHAN D VOVLAS N CASTILLO

P TAMBE JT MOENS M amp BALDWIN JG (2007)Application of the secondary structure model of rRNA forphylogeny D2-D3 expansion segments of the LSU geneof plant-parasitic nematodes from the family HoplolaimidaeFilipjev 1934 Molecular Phylogenetics and Evolution 43881-890

SUNNUCKS P (2000) Efficient genetic markers for populationbiology Trends in Ecology and Evolution 5 199-203

TAUTZ D ARCTANDER P MINELLI A THOMAS RH ampVOGLER AP (2003) A plea for DNA taxonomy Trends in

Ecology and Evolution 18 71-74TENENTE G DE LEY P DE LEY I T amp KARSSEN G

(2004) Sequence analysis of the D2D3 region of the largesubunit rDNA from different Meloidogyne isolates Nematro

pica 34 1-12THOMAS W K VIDA JT FRISSE LM MUNDO

OCAMPO M amp BALDWIN JG (1997) DNA sequencefrom formalin-fixed nematodes integrating molecular and

670 Nematology

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 1112

Marine nematode taxonomy in the age of DNA

morphological approaches to taxonomy Journal of Nemato-

logy 29 250-254TRINGE SG amp RUBIN EM (2005) Metagenomics DNA

sequencing of environmental samples Nature Reviews Gene-

tics 6 805-814VALDECASAS AG WILLIAMS D amp WHEELER QD

(2008) lsquoIntegrative taxonomyrsquo then and now a response toDayrat (2005) Biological Journal of the Linnean Society 93211-216

VANFLETEREN J R amp VIERSTRAETE AR (1999) In-sertional RNA editing in metazoan mitochondria the cy-tochrome b gene in the nematode Teratocephalus lirellus

RNA 5 622-624VOGLER AP amp MONAGHAN MT (2007) Recent advances

in DNA taxonomy Journal of Zoological Systematics and

Evolutionary Research 45 1-10WARD RD ZEMLAK TS INNES BH LAS T PR amp

HEBERT PDN (2005) DNA barcoding Australiarsquos fish

species Philosophical Transactions of the Royal Society

London B 360 1847-1857WHEELER QD (2004) Taxonomic triage and the poverty o

phylogeny Philosophical Transactions of the Royal Society

London B 359 571-583WIL L KW amp RUBINOFF D (2004) Myth of the molecule

DNA barcodes for species cannot replace morphology foridentification and classification Cladistics 20 47-55WIL L KW MISHLER B D amp WHEELER QD (2005)

The perils of DNA barcoding and the need for integrativetaxonomy Systematic Biology 54 844-851

WILSON EO (2004) Taxonomy as a fundamental disciplinePhilosophical Transactions of the Royal Society London B

359 739ZHENG J SUBBOTIN SA HE S GU J amp MOENS M

(2003) Molecular characterisation of some Asian isolates of Bursaphelenchus xylophilus and B mucronatus using PCRRFLPs and sequences of ribosomal DNA Russian Journal of

Nematology 11 17-22

Appendix A

Table A1 Molecular markers used in studies with marine nematodes

Primer Position of Sequence (5 rarr 3) Sourceampliconslowast

Nuclear genes18S ndash SSU

SSUG18S 30-49 GCT TGT CTC AAA GAT TAA GCC Blaxter et al (1998)Meldal et al (2007)Bhadury et al (2005Bert et al (2008)

SSUA 39-57 AAAGATTAAGCCATGCATG Dorris et al (2002)SSU22R 429-411 GCC TGC TGC CTT CCT TGG A Blaxter et al (1998)

Meldal et al (2007)Bhadury et al (2007Bert et al (2008)

SSU22F 411-428 TCC AAG GAA GGC AGC AGG C Blaxter et al (1998)

SSU9FX 530-550 AAG TCT GGT GCC AGC AGC CGC Meldal et al (2007)Bert el al (2008)

SSU9F 573-591 CGCGGTAATTCCAGCTCCA Blaxter et al (1998)SSU9R 584-565 AGC TGG AAT TAC CGC GGC TG Blaxter et al (1998)

Bert et al (2008)SSU24F 868-887 AGR GGT GAA ATY CGT GGA CC Blaxter et al (1998)

Meldal et al (2007)SSU 24R 885-868 CCCCRRTCCAAGAATTTCACCTC Meldal et al (2007)SSU26R 927-907 CATTCTTGGCAAATGCTTTGC Blaxter et al (1998)SSU23F 1280-1298 ATT CCG ATA ACG AGC GAG A Blaxter et al (1998)

Bert el al (2008)

Vol 12(5) 2010 671

8112019 Da_Silva_Marinepdf

httpslidepdfcomreaderfulldasilvamarinepdf 1212

NR Rodrigues da Silva et al

Table A1 (Continued)

Primer Position of Sequence (5 rarr 3) Sourceampliconslowast

SSU23R 1298-1280 TCT CGC TCG TTA TCG GAA T Blaxter et al (1998)Bert et al (2008)

SSU13R 1438-1419 GGG CAT CAC AGA CCT GTT A Blaxter et al (1998)SSU18P 3 end TGA TCC WMC RGC AGG TTC AC Blaxter et al (1998)Bert et al (2008)

SSU2FX 1108-1129 GGA AGG GCA CCA CCA GGA GTG G Meldal et al (2007)SSUDR 1213-1194 CATAAAAGTCTCGCTCGTTA Dorris et al (2002)NM18F 345-925 CGCGAATRGCTCATTACAACAGC Bhadury et al (2008)

Bhadury et al (2006)Bhadury et al (2007)

Nem 18SF CGCGAATRGCTCATTACAACAGC Floyd et al (2005)Nem 18SR 998-1015 GGGCGGTATCTGATCGCC Bhadury et al (2008)

Bhadury et al (2006a bFloyd et al (2005)

ITSRDNA2 2523-2503 TTG ATT ACG TCC CTG CCC TTT Powers et al (1997)rDNA158S ndash ACG AGC CGA GTG ATC CAC CG Powers et al (1997)rDNA 2144 ndash GTA GGT GAA CCT GCA GAT GGA T Powers et al (1997)VRAIN 2F 900 CTTTGTACACACCGCCCGTCGCT Derycke et al (2005)

Derycke et al (2008)VRAIN 2R 900 TTTCACTCGCCGTTACTAAGGGAATC Derycke et al (2005)

Derycke et al (2008)

28S ndash LSULSU rDNA-D2A 397 TTCGACCCGTCTTGAAACACG Fonseca et al (2008)

De Ley et al (2005)Derycke et al (2008)

LSU rDNA-D3B 397 TCGGAAGGAACCAGCTACTA Fonseca et al 2008De Ley et al (2005)Derycke et al (2008)

Mitochondrial DNACOI (cytochrome oxidase 1)

JB2 ndash ATGTTTTGATTTTACCWGCWTTYGGTGT Derycke et al (2005)Derycke et al (2006)Derycke et al (2007)

JB3 426 TTTTTTGGGCATCCTGAGGTTTAT Derycke et al (2005)Derycke et al (2006)Derycke et al (2007)

JB5 426 TAAAGAAGAACATAATGAAAATG Derycke et al (2007)JB5GED 422 AGCACCTAAACTTAAAACATARTGRAARTG Derycke et al (2007)JB8 363 CCCCTCTAGTCTWCTATTTCTTAATAC Derycke et al (2007)

Uncoming genesMinibarcode-COI

Minibar-R1 ndash GAAAATCATAATGAAGGCATGAGC Meusnier et al (2008)Minibar-F1 ndash TCCACTAATCACAARGATATTGGTAC Meusnier et al (2008)

Position of amplicon in relation to Caenorhabditis elegans

672 Nematology