Mol. Hum. Reprod. 1996 Bamberger 457 61

8/10/2019 Mol. Hum. Reprod. 1996 Bamberger 457 61

1/5

Molecular Human Reproduction vol.2 no.6 pp.

4 5 7 -4 61 ,

1996

Expression of steroidogenic factor-1 (SF-1) mRNA and protein in

the human placenta

Ana-Maria Bamberger

1

-

5

, Shereen Ezzat

2

, Bruce Cao

2

, Margaret W ong

3

, Keith L.Parker

3

,

Heinrich M.Schuhte and Sylvia L.Asa

4

institute for Hormone and Fertility Research, University of Hamburg, Grandweg 64, 22529 Hamburg, Germany,

de pa rtm en t of Medicine Endoc rinology), Wellesley Hospital, University of Toronto, Toronto, Onta rio, Canada,

3

Department of Medicine and Biochemistry, Howard Hughes Medical Institute, Duke University Medical Center, Durham,

NC,

USA and

4

Department of Pathology, Mount Sinai Hospital, Samuel Lunenfeld Research Institute, University of

Toronto, Toronto, Ontario, Canada

^ o whom correspondence should be addressed

Steroidogenic factor-1 (SF-1), also known as adrenal-4-binding protein (Ad4BP), is a recently-described

transcription factor, which has been shown to be important for the differentiation of steroidogenic tissues.

In addition, SF-1 has been implicated in regulating the glycoprotein hormone oc-subuntt gene in a pituitary

gonadotroph cell line. Considering that the human placenta produces both steroids and human chorionic

gonadotrophin (HCG), we studied the expression of SF-1 in this tissue. Human first trimester and term

placentas were collected at the time of therapeutic abortion and birth respectively. Messenger RNA was

extracted, reverse transcribed, and used for polymerase chain reaction (PCR) amplification with primers

specific for the human SF-1 cDNA sequence. A band of the expected size was obtained from both first and

third trimester samples, indicating that SF-1 expression in the human placenta starts early in pregnancy and

is maintained until birth. In addition to normal placental samples, JEG3 and JAR choriocarcinoma cells were

also analysed and found to express SF-1 mRNA. The identity of the amplified products was confirmed by

diagnostic restriction digest and Southern hybridization. SF-1 protein was localized mainly to the nuclei of

the cyto- and syncytiotrophoblast and to some mesenchymal villous nuclei by immunocytochemistry using

a specific antibody. We conclude that SF-1 is expressed in human first trimester and term placenta, where it

could be implicated in the regulation of HCG production, in steroidogenesis, or both.

Keywords

mRNA/placenta/protein/steroidogenic factor-1 (SF-1)

Introduction

Steroidogenic factor-1 (SF-1), also known as adrenal-4-binding

protein (Ad4BP) is a recently-described transcription factor

encoded by the mammalian homologue of the

Drosophila

FTZ-F1 gene (Ikeda

et al.

1993). SF-1 was first identified

through its ability to bind to and coordinately regulate the

expression of several genes encoding enzymes of the steroid

hormone biosynthesis pathway (Rice

et al.

1991; Lala

et al.

1992;

Morohashi

et al

1992; Lynch

et al.

1993; Morohashi

et al.

1993). Subsequently, SF-1 was shown to belong to the

nuclear steroid receptor family of transcription factors (Honda

et al.

1993) and to regulate several other genes, such as the

Mullerian inhibiting substance (MIS) gene (Shen

et al.

1994),

the oxytocin gene in the bovine ovary (Wehrenberg

et al.

1994), and the glycoprotein a-subunit gene in the aT3-l

pituitary gonadotroph cell line (Bamhart and Mellon, 1994).

Targeted disruption of the

Ftzfl

gene in mice demonstrated

that SF-1 is essential for adrenal and gonadal development

(Luo

et al.

1994; Sadovsky

et al.

1995), as well as for the

differentiation of pituitary gonadotrophs (Ingraham

et al.

1994), and the formation of the ventromedial nucleus of the

hypothalamus (Ikeda

et al.

1995). Recent data from our

laboratory (Asa et al. 1996) indicate that SF-1 may also be

implicated in regulating cytodifferentiation of gonadotrop hs in

the human pituitary, since SF-1 was found to be expressed

exclusively in this cell type, both in normal pituitaries and in

pituitary adenomas.

Considering that the human placenta is an important source

of both steroids and human chorionic gonadotrophin (HCG),

we studied the expression of SF-1 in this tissue.

Materials and methods

Human

placentaland adrenal tissues

Human first trimester and term placentas were obtained at the time

of therapeutic abortion and birth respectively. Fresh tissue was divided

for histological and immunocytochemical studies and for molecular

analysis. Normal human adrenal tissue (used as a positive control)

was obtained at autopsy from patients with no evidence of endocrine

abnormality and examined histologically to exclude the possibility of

incidental pathology.

ll

culture

JEG3 and JAR human choriocarcinoma cells were purchased from

ATCC (Rockville, MD, USA) and maintained in Dulbecco's minimal

essential medium (DMEM) with 4.5 g glucose/1 and glutamine, with

10% fetal bovine serum (FBS) added (JEG3), and Roswell Park

European Society for Human Reproduction and Embryology

45 7


2/5

A.M.Bamberger et al.

2 3 0

SF-1

OCATCTTaOOCTOCCTOCAOGAGCCCACCAAAAGCCGCCCCGACCAGCCGGCGGCCT

TCGGCCTCCTGTGCAGAATGGCCGACCAGACCTTCATCTCCATCGTGGACTGGGCACGCA

GGTGCATGGTCTTCAAGGAGCTGGAGGTGGCCGACCAGATGACGCTGCTGCAGAACTGCT

GGAGCGAGCTGCTGGTGTTCGACCACATCTACCGCCAQOTCCAOCACGGCAAOG

Figure 1. Sequence of human SF-I cDNA in the amplified region (bp 885-1115 in the coding region). The sequences used for primer

design are in bold letters; the BsrI recognition sequence is underlined.

Memorial Institute (RPMI) 1640 medium with 10% FBS (JAR). Both

cell lines were grown in 5% CO

2

and used for RNA extraction when

the cells were 60-80% confluent.

RNA extraction

Fresh frozen human first trimester and term placental tissue was

homo genized with RN Azol (Tel-Test, Friends wood, TX, USA ;

2 ml/100 mg tissue) in a glass-Teflon homogenizer. Total RNA was

extracted with chloroform (0.2 ml/2 ml homogenate), precipitated

with isopropanol, washed with 75% ethanol, and dissolved in

diethylpyrocarbonate (DEPC)-treated, RNase-free water. RNA con-

centration and purity were determined by spectrophotom etry. The same

extraction method was used for JEG3 and JAR choriocarcinoma cells.

Reverse transcription polym erase chain reaction

RT-PCR)

Complementary DNA was synthesized in each case from 5 |ig total

RNA with Superscript RNase H" Reverse Transcriptase (Gibco

BRL, Gaithersburg, MD, USA) using oligo(dT) primers (Pharmacia,

Piscataway, NJ, USA). Of the resulting cDNA 5% was used as a

template for polymerase chain reaction (PCR).

A recombinant bacteriophage clone containing the genomic

sequences of the human SF-1 gene has been isolated (Taketo et al.

1995). Partial sequence of this clone and a second bacteriophage

clone yielded the coding sequences to the gene. For PCR, the

following oligonucleotide primers were used to identify SF-1:

upstream 5' GCA TCT TGG GCT GCC TGC AG 3' and downstream

5 '

CCT TGC CGT GCT GGA CCT GG 3'. These primers span one

intron between exons 4 and 5 of the human SF-1 genomic DNA,

generating a 230 bp product from cDNA (Figure 1). PCR was carried

out in a volume of 25 |il; following an initial denaturing step (95C

for 120 s), amplification was carried out through 30 cycles at 95C

for 30 s, 60C annealing for 30 s and 72C for 45 s in a thermal

cycler using GeneAmp PCR reagents (Am plitaq; Perkin Elmer Cetus,

Norwalk, CT, USA).

PCR products were visualized through electrophoresis in a 1%

agarose gel and ethidium bromide staining. The 230 bp fragment

generated by PCR was also extracted in chloroform and precipitated

in ethanol before digestion with the restriction endonuclease Bsr-I

(Boehringer Mannheim, Indianapolis, IN, US A). Following digestion,

the expected 120 bp and 110 bp fragments were visualized by

electrophoresis with ethidium bromide staining.

Negative controls included mock reverse transcription without

RNA or without reverse transcriptase (RT). The positive control was

represented by RNA from human adrenal cortex.

Southern hybridization

Amplified DNA was further analysed by Southern hybridization. RT-

PCR product from total RNA of the H295 human adrenal tumour

cell line was subcloned into the pCRII vector using the TA cloning

kit (Invitrogen, San Diego, CA, USA) and sequenced. A 230 bp

fragment of this clone was labelled with [a-

32

P]-ATP using random

primers and used for hybridization.

The cDN A fragments w ere separated by agarose gel electrophoresis,

1 2 3 4 5 6 7 8 9 1 0 1 1

H

2

O 1st 3rd JEG JAR

trimester trimester JAR -RT Adrenal

Figure 2. Reverse transcription-polymerase chain reaction (RT-

PCR) and hybridization for SF-1 in human placenta. Upper panel:

ethidium bromide staining of RT-PCR products shows bands of the

expected size with SF-1-specific primers. Lanes 1: water/SF-1

specific primers. Lanes 2, 3, 4: cDNAs from three different human

first trimester placental samples, showing an amplification product

of the expected size (230 bp) with SF-1 specific primers. Lanes 5,

6, 7: cDNAs from three different human term placentas, showing

the amplification product of the expected size with SF-1 specific

primers (the RNA of origin for the cDNA in lane 5 was slightly

degraded before extraction on account of the placental tissue

collection conditions). Lanes 8 and 9: cDNAs from JEG3 (lane 8)

and JAR (lane 9) choriocarcinoma cells, showing the amplification

product of the expected size with SF-1 specific primers. Lane 10:

JAR (-RT) negative con trol. Lane 11: positive control consisting of

cDNA from human adrenal cortex amplified with SF-1 specific

primers. Lower panel: Southern hybridization of the gel shown in

the upper panel with a radiolabelled human SF-1 probe confirms

the specificity of the RT-PCR products. The probe consisted of a

RT-PCR product from total RNA of the H295 human adrenal

tumour cell line; the lanes are the same as in the upper panel.

transferred to a nylon membrane (Gene Screen Plus, Du Pont,

Wilmington, DE, USA), and baked for 2 h at 80C. The blots were

prehybridized for 2 h, then hybridized for 18 h at 42C, washed at

high stringency, and autoradiographed for 2 h at room temperature.

Immunohistochemical localization of

SF-1

protein

Formalin-fixed paraffin embedded tissues were sectioned at 5 urn

and rehydrated. For staining of nuclear antigens, sections were

pretreated for antigen retrieval by microwaving in citrate buffer (Shi

el al. 1991). Endogenous peroxidase activity was blocked with

aqueous hydrogen peroxide, and non-specific binding was prevented

by preincubation in normal goat serum. The avidin-biotin technique

was performed with a primary polyclonal SF-1 antiserum raised in

458


3/5

SF-1 in human placenta

."&' >

r

1

B

.

i

Figure 3. Immunohistochemical localization of SF-1 protein in human placenta. (A) Strong nuclear immunoreactivity for SF-1 in a

first trimester placenta sample: positive nuclei in the cyto- and syncytiotrophoblast and some mesenchymal villous cells; (B) cytoplasmic a-

human chorionic gonadotrophin (HCG) immunoreactivity in the trophoblast of a first trimester placenta sample; (C) replacement of the SF-1

specific antiserum with non-immune serum results in negative staining in first trimester placenta; (D) positive control for SF-1 staining

represented by a human adrenal cortex sample.

rabbits against the DNA-binding domain of mouse SF-1, produced

in

Escherichia coli

as a GST fusion protein and partially purified via

GST-sepharose column chromatography (Product code: 06 431, lot

13702; Upstate Biotechnology Inc., Lake Placid, NY, USA) at a

dilution of

1:1000.

This antibody shows cross-reactivity only with

human and bovine SF-1. For ot-HCG a monoclonal antibody (Zymed

Laboratories In c., South San F rancisco, CA, USA ) at 1:4. The reaction

product was visualized with 3,3'-diamino-benzidine tetrahydro-

chloride. The positive control for SF-1 consisted of adrenal gland

fixed and embedded with identical conditions. The specificity of the

reaction was verified by replacing the primary antibody with non-

immune rabbit serum.

Results

RT PCR analysis

RT-PCR using cDNA derived from multiple different human

first trimester and term placentas demonstrated the presence

of

SF-1

mRNA in this tissue. A band of the predicted size

(230 bp) was visualized after amplification with the human

SF-1 specific primers (Figure 2). A band of the expected

size was also identified using cDNA from JEG3 and JAR

choriocarcinoma cells (Figure

2).

Human adrenal cortex (Figure

2) was used as a positive control, showing an amplification

product which was of the same size as the placental product.

RT-PCR with omission of reverse transcriptase and with water

replacing template were both negative (Figure 2). Further

negative controls represented by thyroid tissue also yielded no

band with the SF-1 primers (not shown). Diagnostic digestion

of the placental RT-PCR products with Bsr-I resulted in

fragments of 120 and 110 bp which were of the expected size

and identical to those obtained with the adrenal product

(positive control).

Southern hybridization

To further characterize the 230 bp placental amplification

product, Southern hybrization was performed as described.

Both the positive control and the placental products hybridized

with the human SF-1 probe (Figure 2, lower panel).

Immunohistochemistry

To assess whether

SF-1

mRNA was translated in human

placenta, immunohistochemical analysis was performed. SF-1

protein immunoreactivity was detected mainly in the nuclei of

placental cyto- and syncytiotrophoblast, as well as in some

mesenchymal villous cell nuclei (Figure 3A). The immuno-

reactive expression pattern was compared to the ot-HCG

459


4/5

A.M.Bamberger et al.

expression pattern (Figure 3B). The positive control is repre-

sented by human adrenal cortex showing SF-1 immuno-

reactivity (Figure 3D). The negative control (Figure 3C) was

produced by replacing the SF-1 specific primary antiserum

with non-immune rabbit antiserum.

Discussion

The results of our study clearly demonstrate that SF-1 mRNA

is expressed in human first trimester and term placenta as

well as in JEG3 and JAR human choriocarcinoma cells.

Immunohistochemistry indicates that the mRNA is translated

into the SF-1 protein, which is localized mainly to the nuclei

of the placental trophoblast, as well as some mesenchymal

villous cells.

The human placenta is, besides the pituitary, the other

important source of gonadotrophin, producing HCG at high

concentrations soon after fertilization and implantation. HCG

is also produced in trophoblastic malignancy and is a useful

marker of these conditions (Kurman et al. 1984). The regula-

tion of the HCG a- and (i-subunit genes has been the focus

of recent investigation (for review, see Jameson and Hollenberg,

1993), but SF-1 has not so far been implicated as a possible

regulator of these genes in the placenta. Our data indicate that

SF-1 is expressed in both normal human placenta and in

choriocarcinoma cells. It will be interesting to determine

whether SF-1 plays a role in regulating one or both these

genes in the normal human placenta and in trophoblastic

tumours producing HCG.

It has been suggested that SF-1 probably does not play a

role in rodent placental function, since no placenta abnormali-

ties have been reported for the SF-1 knock-out mice (Luo

et al. 1994; Sadovsky et al. 1995). SF-1 mRNA has been

found in mouse placenta (Sadovsky et al. 1995) but not in

rat placenta or Rcho-1 trophoblast cells (Yamamoto et al.

1995). These data do not contradict the possibility of a role

for SF-1 in the regulation of HCG in the human placenta.

On the contrary, it is a known fact that rodent placentas

do not produce chorionic gonadotrophin, which has so far

been unequivocally demonstrated only in primate and equine

placentas (Roberts

et al.

1994). Thus, expression of SF-1 in

the human, but not the rodent placenta, might be essential

to understand the species-specific expression of chorionic

gonadotrophin.

In addition to producing gonadotrophin, the placenta is

also one of the most important sources of steroid hormones,

producing large amounts of progesterone and oestrogen

(Simpson and MacDonald, 1981). As mentioned previously,

the first observation of SF-1 was based on its capacity to

regulate the expression of steroidogen ic enzyme s (for a review,

see Parker and Schimmer, 1993). A recent report based on

careful analysis of SF-1-/- mice indicated that, although SF-1

is expressed in the normal mouse placenta from oestrus day

14 on, placentas of mice lacking SF-1 express both P450scc

and P450cl7. This suggests that SF-1 might not be essential

for expression of these genes in mouse placenta (Sadovsky

et al.

1995). SF-1 was also found to regulate the expression

of the aromatase gene in rat ovaries and R2C rat Leydig

tumour cells (Lynch

et al.

1993). Aromatase is not exp ressed

in the rat placenta (Means

et al.

1991). Aromatase activity

has been shown to be present in the syncytiotrophoblast of

human placenta, hydatidiform moles, and in choriocarcinoma

cells (Ryan, 1959; MacDonald and Siiteri, 1964; Bahn et al.

1981; Means et al. 1991; Zhou et al. 1992). Further investi-

gation is necessary to determine whether SF-1 plays a role in

regulating the human aromatase gene, similar to its role in the

rat (Lynch et al. 1993). The human placenta and chorio-

carcinoma cells are a source of aromatase and as we have

now dem onstrated that they also express S F-1 , we therefore

predict a possible role for SF-1 in regulating this gene in

placenta. This does not exclude the possiblity that SF-1 might

also regulate other placental steroidogenic enzymes or other

placental genes, including the HCG genes, thus acting at

multiple levels in controlling hormonal mechanisms involved

in the establishment and maintenance of human pregnancy.

Acknowledgements

This work was supported in part by grant MA 12196 of the

Medical Research Council of Canada and the Saul A.Silverman

Family Foundation. The technical assistance of Kelvin So and Cathy

Grabowski is gratefully acknowledged.

References

Asa, S.L., Bamberger, A.M.. Cao, B. et al. (1996) The transcription factor

steroidogenic factor-1 is preferentially expressed in the human pituitary

gonadotroph. J. Clin. Endocrinol. Metab.. in press

Bahn, R.S., Worsham, A.. Speeg, K.V.etal. (1981) Characterization of steroid

production in cultured human choriocarcinoma cells J. Clin. Endocrinol

Metab..52 , 447^*50.

Barnhart, K.M. and Mellon. P.L. (1994) The orphan nuclear receptor,

steroidogenic

factor-1.

regulates the glycoprotein hormone alpha-subunit

gene in pituitary gonadotropes.

Mol. Endocrinol.

8, 878-885.

Honda. S., Morohashi, K., Nomura, M. et al. (1993) Ad4BP regulating

steroidogenic P450 gene is a member of steroid receptor superfamily.

J. Biol. Chem. 268, 7494-7502.

Ikeda. Y., Lala, D.S.. Luo. X. et al. (1993) Characterization of the mouse

FTZ-FI gene, which encodes a key regulator of steroid hydroxylase gene

expression. Mol. Endocrinol. 7, 852-860.

Ikeda. Y, Luo. X., Abbud. R. et al.(1995) The nuclear receptor steroidogenic

factor I is essential for the formation of the ventromed ial hypo thalam ic

nucleus. Mol. Endocrinol. 9, 478-486.

Ingraham. H.A.. Lala. D.S.. Ikeda. Y. et al. (1994) The nuclear receptor

steroidogenic factor acts at multiple levels of the reproductive axis.Genes

Dev..8, 2303-2312.

Jameson, J.L. and Hollenberg. A.N. (1993) Regulation of chononic

gonadolropin gene expression. Endocr. Rev. 14,

203-221.

Kurman, RJ., Young, R.H.. Norris. HJ. et al. (1984) tmmunocytochemical

localization of placental lactogen and chorionic gonadotropin in normal

placenta and trophoblastic tumors, with emphasis on intermediate

trophoblast and the placental site trophoblastic tumor. Int. J. Gynecol.

Pathol.. 3,

101-121.

LaJa. D.S .. Rice. D.A. and Parker. K.L. (1992) Stero idogen ic factor I. a key

regulator of steroidogenic enzyme expression, is the mouse homolog of

fushi tarazu-factor I. Mol. Endocrinol. 6, 1249-1258.

Luo,

X., Ikeda, Y. and Parker. K.L. (1994) A cell-specific nuclear receptor is

essential for adrenal and gonadal development and sexual differentiation.

Cell 7 7, 4 8 1 ^ 9 0 .

Lynch. J.P.. Lala. D.S., Peluso. JJ. et al. (1993) Steroidogenic factor I, an

orphan nuclear receptor, regulates the expression of the rat aromatase gene

in gonadaJ tissues. Mol. Endocrinol.. 7, 776-786.

MacDonald. P.C. and Siiteri. P.K. (1964) Study of estrogen production in

uomen with hydatidiform mole. J. Clin. Endocrinol. Melab..24, 685-690.

46 0


5/5

SF-1 in human placenta

Means, CD .. Kilgore. M.W.. Mahendroo. M.S.

et al.

(I99I) Tissue-specific

promoters regulate aromatase cytochrome P450 gene expression in human

ovary and fetal tissues. Mol. Endocrinol..5 , 20052013.

Morohashi. K.. Honda. S.. Inomata. Y. et al. (I992) A common transacting

factor. Ad4-binding protein, to the promoters of steroidogenic P-450s.

J. Biol. Chem..

267 1791317919.

Morohashi. K.. Zanger. U.M.. Honda. S.et al. (1993) Activation of CYPI IA

and CYPI IB gene promoters by the steroidogenic cell-specific transcription

factor, Ad4BP. Mol. Endocrinol.. 7, 1196-11204.

Parker. .K.L. and Schimmer. B.P. (1993) Transcriptional regulation of the

adrenal steroidogenic enzymes.

Trends Endocrinol. Metab..

4 , 46-50.

Rice. D.A.. Mouw. A.R.. Bogerd. A.M. and Parker. K.L. (1991) A shared

promoter element regulates the expression of three steroidogenic enzymes.

Mol. Endocrinol.. 5, 1552-1561.

Roberts. R.M. and Anthony. R.V. (1994) Molecular biology of trophectoderm

and placental hormones. In Findlay. J.K. (ed.). Molecular Biology of the

Female Reproductive System.Academic Press Inc.. San Diego, pp. 395440.

Ryan. KJ (1959) Biological aromatization of steroids. J. Biol. Chem.. 234

268-272.

Sadovsky. Y. Crawford. P.A.. Woodson, K.G. et al. (1995) Mice deficient in

the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads

but express P450 side-chain-cleavage enzyme in the placenta and have

normal embryonic serum levels of corticosteroids. Proc. Natl.

Acad

Sci.

USA.

92, 10939-10943

Shen, W.-H., Moore. C.C.D. Ikeda. Y. et al. (1994) Nuclear receptor

steroidogenic factor

regulates the Miillerian inhibiting substance gene: a

link to the sex determination cascade Cell. 77, 651-661

Shi,

S. R..

Key. M.E. and Kalra, K.L. (1991) Antigen retrieval in formalin-

fixed, paraffin em bedded tiss ues: an enhancem ent method for

immunohistochemical staining based on microwave oven heating of tissue

sections. J Histochem. Cytochem. 39, 741-748.

Simpson. E.R. and MacDonald, P.C. (1981) Endocrine physiology of the

placenta. Ann. Rev. Physiol. 43 163-179.

Taketo. M.. Parker. K.L., Howard, T.A.et al.(1995) Homologs ofDrosophila

Fushi-Tarazu factor I map to mouse chromosome 2 and human chromosome

9q33. Genomics 25, 565-567.

Wehrenberg, U., Ivell. R.. Jansen, M.

et al.

(1994) Two orphan receptors

binding to a common site are involved in the regulation of the oxylocin

gene in the bovine ovary. Proc. Nail.

Acad

Sci. USA 91, 1440-1444.

Yamamoto. T., Chapman, B.M.. Clemens. J.W. et al. (1995) Analysis of

cytochrome P-450 side-chain cleavage gene promoter activation during

trophoblast cell differentiation. Mol. Cell. EndocnnoL 113 183-194.

Zhou, D., Korzekwa. K.R.. Poulos. T. and Chen. S. (1992) A site-directed

mutagenesis study of human placental aromatase. J. Biol. Chem. 267

762-768.

Received on December 13. 1995; accepted on March 18. 1996

461

Documents

Mol. Hum. Reprod. 1996 Bamberger 457 61