Silmarina 2

8/8/2019 Silmarina 2

http://slidepdf.com/reader/full/silmarina-2 1/5

Introduction

Silymarin is a complex mixture of flavonoids routinely isolated

from the seeds and fruits of the common milk thistle [ Silybum

marinum (L.) Gaertner]. Crude extracts from this plant have

been used for centuries as a natural remedy and silymarin is

now effectively used in the treatment of inflammatory liver toxi-

city and disease in humans. Silymarin is a powerful antioxidant

and displays hepatoprotective, chemopreventive and immuno-

modulatory properties [1]. The immunomodulatory properties

of silymarin may play a role in protecting against liver damage

and fibrosis induced by toxic agents including carbon tetrachlor-

ide and phalloidin [2].

It has been demonstrated that T-lymphocytes are important in

the initiation and repair stages of liver injury induced by carbon

tetrachloride [3]. This population of cells is sensitive to silymarinboth in vivo and in vitro. Lang et al. [4] demonstrated increased

mitogen-induced proliferation of peripheral blood T-lympho-

cytes from patients with alcoholic cirrhosis who were treated

with silymarin. Administration of silymarin to rats was also

shown to increase lymphocyte proliferation [5]. In contrast,

treatment of T-lymphocytes with silybin, an active component

of silymarin in vitro resulted in suppression of mitogen-induced

proliferation [6]. Further investigations are needed to determine

the mechanisms responsible for these disparate effects of sily-

marin on T-lymphocyte function.

Other isoflavonoids can also modulate T-lymphocyte activity.

Genistein is an immunosuppressive flavonoid that inhibits T-

lymphocyte proliferation, interleukin (IL)-2 production and IL-2

receptor expression [7]. Genistein functions through inhibition

Physiological Responses to a Natural Antioxidant

Flavonoid Mixture, Silymarin, in BALB/c Mice:

II. Alterations in Thymic Differentiation Correlate with

Changes in c-myc Gene Expression

Victor J. Johnson1

Marcin F. Osuchowski1, 2

Quanren He1

Raghubir P. Sharma1

Affiliation1 Department of Physiology and Pharmacology, College of Veterinary Medicine, The University of Georgia,

Athens, GA, USA2 Department of Animal Anatomy, University Warmia and Mazury, Olsztyn, Poland

CorrespondenceDr. Raghubir P. Sharma ´ Department of Physiology and Pharmacology ´ College of Veterinary Medicine ´

The University of Georgia ´ Athens, GA 30602±7389, USA ´ Phone: +1-706-542-2788 ´ Fax: +1-706-542-3015 ´E-mail: [email protected]

Received February 15, 2002 ´ Accepted June 15, 2002

Bibliography Planta Med 2002; 68: 961±965 ´ Georg Thieme Verlag Stuttgart ´ New York ´ ISSN 0032-0943

Abstract

Silymarin is a mixture of bioactive flavonoids isolated from theseeds and fruits of Milk Thistle [ Silybum marianum (L.) Gaertner].

We tested the hypothesis that exposure to silymarin will modu-

late differentiation and cell selection in the thymus via altera-

tions in gene expression. Male BALB/c mice were treated intra-

peritoneally once daily for five days with 0, 10, 50 or 250 mg/kg

of silymarin. Flow cytometric examination of thymic lymphocyte

populations showed that the absolute numbers of CD4+ and CD8+

positive T-lymphocytes were increased by silymarin. The c-myc

proto-oncogene is important in controlling differentiation and

functions of thymocytes. Treatment with silymarin resulted in

increased c-myc expression in the thymus. In contrast, the ex-

pressions of IL-2 and IL-4 were decreased by silymarin, whileMHC II expression did not change. These results indicate that in

vivo exposure to silymarin influences phenotypic selection pro-

cesses in the thymus at doses that may be encountered in natural

medicinal use. Further studies investigating the effects of sily-

marin on the immune system are warranted.

Key words

Silymarin ´ thymus ´ T-lymphocytes ´ CD4 ´ CD8 ´ c-myc ´ cyto-

kines ´ Silybum marianum ´ Asteraceae

Or i gi n al P a p er

961



of cellular kinases thereby deregulating T-lymphocyte signaling

events. The effects of silymarin on T-lymphocyte function may

also be through modification of signalingenzymes. Zi and Agarwal

[8] showed that silymarin inhibited activation of extracellular sig-

nal-regulate protein kinase (ERK). ERK and p38 mitogen-activated

protein kinase (MAPK) were shown to oppositely regulate the ca-pacity of silymarin to induce differentiation of HL-60 cells [9]. In-

hibition of ERK prevented differentiation whereas inhibition of

p38 potentiated silymarin-induced differentiation. MAPKs are im-

portant in regulating genes responsible for thymic differentiation

including c-myc [10]. Therefore, silymarin may affect T-lympho-

cyte function through alterations in thymic differentiation.

The resurgence of silymarin as a widely used therapeutic agent for

liver and biliary pathologies necessitates a better understanding of

the effects of this mixture on healthy organ systems, specifically

the immune system. The purpose of the present study was to de-

termine the impact of short-term exposure to silymarin on thymic

differentiation and gene expression in healthy BALB/c mice.

Materials and Methods

Animal care and handling

Male BALB/c mice (Harlan, Indianapolis, IN), 7±8 weeks of age

and an average body weight of 20 g were used. Mice (6/cage)

were allowed to acclimate forone week in the University of Geor-

gia Animal Resources facility maintained at 21 8C with a 12-hour

light/dark cycle. Rodent chow (Harlan Teklad, Madison, WI) and

distilled water were supplied ad libitum. Body weight gain and

food and water consumption were monitored daily for the dura-tion of treatment. Care and treatment of the mice were in accord-

ance with the guidelines established by the Public Health Service

Policy on Humane Care and Use of Laboratory Animals and were

approved by the Institutional Animal Care and Use Committee.

Treatment of assay groups

Silymarin was purchased from Sigma-Aldrich Chemical Compa-

ny (St. Louis, MO). This silymarin consists of a mixture of seven

isomers including taxifolin (4%), silichristin (27.9%), silidianin

(2.9%), silybin A (19.3%), silybin B (31.3%), isosilybin A (8.2%)

and isosilybin B (2.3%) as determined by high performance li-

quid chromatography as described previously [11]. Modifica-

tions included a methanol : water:acetic acid (35: 60: 5) mobile

phase and UV detection at 277 nm. This preparation of silymar-

in was comparable to several commercial formulations charac-

terized by Campodónico et al [11]. Mice were given five daily

intraperitoneal (i.p.) injections of phosphate buffered saline

(PBS, vehicle control) or 10, 50, 250 mg/kg of silymarin as a sus-

pension in PBS. This route of exposure has been used previously

for the investigation of the hepatoprotective effects of silymar-

in [12] and we recently employed the same protocol to examine

the effects of silymarin on normal liver [13]. One day following

the final injection, mice were euthanized by decapitation and

the thymus was aseptically excised and weighed. This study

duration is longer than the majority of studies using silymarinto prevent hepatotoxicity in rodent models. Single cell suspen-

sions were prepared from the thymus as reported previously

[14] and used for phenotypic and functional analysis of thymo-

cyte populations.

Flow cytometric phenotyping of thymic lymphocyte

populations

Three-color flow cytometry was used to determine the preval-

ence of specific lymphocyte populations in the thymus as de-

scribed earlier [14]. Following antibody labeling, cells were fixed

in 0.5 % formalin in PBS and acquired (20 000 events) using anEPICS XL-MCL flow cytometer (Coulter Cytometry, Hialeah, FL)

equipped with a 488 nm argon ion laser and Lysis II acquisition

software. Analysis was performed using the WinMidi flow

analysis package.

Analysis of mRNA expression

Thymocytes (2.5 106/ml) were stimulated with phorbol 12-

myristate 13-acetate (PMA, 80 nM) plus A23187 calcium iono-

phore (1 m M) or left untreated for six hours following which total

RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA) ac-

cording to the manufacturer's protocol. Expressions of IL-2, IL-4,

c-myc , major histocompatibility class II (MHC II) and b -actin (in-

ternal control) were assayed using reverse-transcriptase poly-merase chain reaction (RT-PCR). Conditions for reverse transcrip-

tion and PCR steps were performed as previously reported [14]

with the exception of primer sets (see Table 1). Cycle number

was optimized to achieve amplification within the linear range.

Amplification products were electrophoretically separated and

documented using a Kodak DC290 digital camera. The resulting

images were digitized and quantified using UN-SCAN-IT soft-

ware (Silk Scientific, Inc., Orem, UT) and the pixel values for

each cytokine were normalized to that of b -actin.

Statistical analysis

All statistical analyses were performed using the SAS statisticalsoftware (SAS Institute, Cary, NC). Treatment effects were ana-

lyzed using one way analysis of variance (ANOVA) followed by

Fisher's PLSD. A value of P < 0.05 was considered significant un-

less indicated otherwise.

Results

Treatment of mice with silymarin for 5 consecutive days did not

cause any signs of overt toxicity or behavioral changes. Silymarin

Table 1 Primer sets and amplifications conditions*

Cytokine Primer Sequence AnnealingTempera-ture ( 8C)

CycleNumber

IL-2 senseantisense

5¢ CTCGCATCCTGTGTCACATT 3¢ 5¢ ATCCTGGGGAGTTTCAGGTT 3¢

54 31

IL-4 senseantisense

5¢ TCAACCCCCAGCTAGTTGTC 3¢ 5¢ GGAGCTCACTCTCTGTGGTG 3¢

54 36

c-myc senseantisense

5¢ ATCTGCGACGAGGAAGAGAA 3¢ 5¢ ATCGCAGATGAAGCTCTGGT 3¢

54 37

MHC II senseantisense

5¢ GTCCTGGTCATGCTGGAGAT 3¢ 5¢ CTGACTCCTGTGACGGATGA 3¢

54 33

b -actin senseantisense

5¢ ATGGATGACGATATCGCT 3¢ 5¢ ATGAGGTAGTCTGTCAGGT 3¢

56 31

* Thermal cycles consisted of denaturation at 94 8C for 15 seconds, annealing (see above) for

15 seconds and extension at 72 8C for 30 seconds followed by a final extension at 72 8C for 2

minutes.

Johnson VJ et al. Physiological Responses to¼ Planta Med 2002; 68: 961 ± 965

Or i gi nal P a

per

62





shown that flavonoids have potential to influence thymocyte dif-

ferentiation possibly via effects on intracellular signaling includ-

ing protein kinase and phosphatase pathways [1]. In the present

study, silymarin increased the CD4+ and CD8+ thymocyte popula-

tions. This effect occurred in the absence of changes in other thy-

mocyte populations including double positive and double nega-tive cells. Evidence suggests that silymarin can alter genes criti-

cal for thymocyte selection including MHC genes [15].

Treatment with silymarin did not alter the expression of MHC II

gene in thymocytes but did increase the expression of c- myc , an-

other gene that is important in thymic differentiation [16]. Inter-

estingly, increased expression of c-myc was seen in mice treated

with 10 and 250mg/kg of silymarin, which also displayed chang-

es in thymocyte development. This correlation indicates that c-

myc may be an important gene controlling the effects of silymar-

in on thymus development. The c-myc gene is up regulated fol-

lowing the acquisition of the double positive CD4+/CD8+ pheno-

type. It has been suggested that this up-regulation plays an im-portant role in the transition from double positive to single posi-

tive thymocytes [10]. Recently, it was shown that activation of c-

Myc enhances the efficiency of positive selection and prolifera-

tion of thymocytes [17]. Therefore, by activating the expression

of c-myc , silymarin may promote positive selection of single po-

sitive cells thus increasing these populations.

There is no direct evidence in the literature showing that sily-

marin can alter c-myc gene expression but there is evidence

that silymarin can influence the signaling pathway controlling

the expression of this gene. Zi and Agarwal [8] demonstrated

that silymarin influenced the phosphorylation and activation of MAPKs in A431 cells. MAPK signaling is known to influence

both positive and negative selection in the thymus [18] and it

may be through phosphorylation of c-Myc [19]. Strong activation

of ERK is associated with negative selection and clonal deletion

of self-reactive thymocytes [18]. In contrast, lower levels of ERK

activation support positive selection [18] and may lead to an in-

crease in single positive cells. Silymarin treatment inhibited the

phosphorylation of ERK in A431 cells [8]. Therefore it is possible

that in vivo treatment with silymarin may favor positive selec-

tion in the thymus through reduced ERK signaling. Activation of

p38 MAPK was shown to be important for the transition of thy-

mocytes from the double negative to the double positive stage

[20]. The use of a p38 inhibitor indicated that this MAPK is in-

volved in silymarin-induced differentiation of HL-60 cells [9].

Further studies are required to determine the role of MAPKs in

the effects of silymarin on thymocyte differentiation.

Short-term treatment with silymarin resulted in a down regula-

tion of cytokine gene expression in thymocytes from the 250 mg/

kg group. The expression of IL-2 and IL-4 were decreased in the

highest dose group compared to control mice. These data indi-

cate that silymarin interferes with signal transduction control-

ling gene expression. IL-2 and IL-2 receptor expression are also

important regulators of thymocyte differentiation. Bassiri and

Carding [21] showed that IL-2 plays a role in negative selection.Double positive thymocytes undergoing activation-induced cell

death were shown to bind and internalize IL-2. Thymocytes

from transgenic IL-2 knockout mice were resistant to apoptosis,

which could be restored upon exogenous addition of IL-2. It is

possible that decreased IL-2 expression may impair negative se-

lection in the thymus of silymarin-treated mice leading to an in-

crease in the single positive populations. Further experimenta-

tion is needed to define the role of cytokines in silymarin-in-

duced alterations in thymus development.

The purpose of the present study was to determine the effect of

sub-acute treatment with silymarin on thymocyte differentia-

tion. The results indicate that silymarin treatment disrupts selec-

tion processes in the thymus leading to an increase in single po-

sitive thymocytes. It is not known at this time if the alterations

in thymus development observed in this study are detrimental

to health. Subtle increases in mature single positive T-lympho-

cytes may be beneficial by increasing the peripheral population

of T-lymphocytes. This would be important in diseases or toxin

exposures in which peripheral T-cells are impaired. Investiga-

tion of the effects of long-term exposure to silymarin on the

thymus are needed to determine if the changes observed in

this study are persistent and thus will impact immune func-tion.

Acknowledgements

This study was supported in part by a grant from the National In-

stitutes of Health TW01009.

References

1 Middleton E, Kandaswami C, Theoharides TC. The effects of plant fla-vonoids on mammalian cells: implications for inflammation, heartdisease, and cancer. Pharmacol Rev 2000; 52: 673±751

2 HahnG, Lehmann HD, Kurten M, Uebel H, Vogel G. On the pharmacol-ogy and toxicology of silymarin, and antihepatotoxic active principlefrom Silybum marianum. Arzneim-Forsch/Drug Res 1968; 18: 698±704

3 Shi Z, Wakil AE, Rockey DC. Strain-specific differences in mouse hepa-tic wound healing are mediated by divergent T helper cytokine re-sponses. Proc Natl Acad Sci USA 1997; 94: 10663 ± 8

4 Lang I, Deak GY, Nekam K, Muzes GY, Gonzalez-Cabello R, Gergely P,Feher J. Hepatoprotective and immunomodulatory effects of antioxi-dant therapy. Acta Med Hung 1988; 45: 287± 95

5 Agoston M, Cabello RG, Blazovics A, Feher J, Vereckei A. The effect of amiodarone and/or antioxidant treatment on splenocyte blast trans-formation. Clin Chim Acta 2001; 303: 87± 94

6 Meroni PL, Barcellini W, Borghi MO, Vismara A, Ferraro G, Ciani D, Za-nussi C. Silybin inhibition of human T-lymphocyte activation. Int J Tis-sue React 1988; 10: 177±81

7 Atluru S, Atluru D. Evidence that genistein, a protein-tyrosine kinaseinhibitor, inhibits CD 28 monoclonal-antibody-stimulated human Tcell proliferation. Transplantation 1991; 51: 448±50

8 Zi X, Agarwal R. Modulation of mitogen-activated protein kinase acti-vation and cell cycle regulators by the potent skin cancer preventiveagent silymarin. Biochem Biophys Res Commun 1999; 263: 528±36

9 Kang SN, Lee MH, Kim KM, Cho D, Kim TS. Induction of human pro-myelocyticleukemia HL-60 cell differentiation into monocytes by sili-binin: involvement of protein kinase C. Biochem Pharmacol 2001; 61:1487±95

10 Broussad-Diehl C, Bauer SR, Scheuermann RH. A role for c-myc in theregulation of thymocyte differentiation and possible positive selec-tion. J Immunol 1996; 156: 3141±50

11 Campodónico A, Collado E, Ricci R, Pappa H, Segall A, Pizzorno MT.Dissolution test for silymarin tablets and capsules. Drug Dev IndPharm 2001; 27: 261± 5

Johnson VJ et al. Physiological Responses to¼ Planta Med 2002; 68: 961 ± 965

Or i gi nal P a

per

64



12 Letteron P, Labbe G, Degott C, Berson A, Fromenty B, Delaforge M, Lar-rey D, Pessayre D. Mechanism for the protective effects of silymarinagainst carbon tetrachloride-induced lipid peroxidation and hepato-toxicity in mice. Evidence that silymarin acts both as an inhibitor of metabolic activation and as a chain-breaking antioxidant. Biochem-ical Pharmacology 1990; 39: 2027± 34

13 He Q, Osuchowski MF, Johnson VJ, Sharma RP. Physiological responses

to a natural antioxidant flavonoid mixture, silymarin, in BALB/c mice:I. Induction of transforming growth factor b 1 and c-myc in liver withmarginal effects on other genes. Planta Medica 2002; 68: 676± 9

14 Johnson VJ, Sharma RP. Gender-dependent immunosuppression fol-lowing subacute exposure to fumonisin B1. International Immuno-pharmacology 2001; 1: 2023 ± 34

15 Sakai K, Li Y, Shirakawa T, Kitagawa Y, Hirose G. Induction of majorhistocompatibility complex class I molecules on human neuroblasto-ma line cells by a flavonoid antioxidant. Neurosci Lett 2001; 298:127±30

16 Douglas NC, Jacobs H, Bothwell AL, Hayday AC. Defining the specificphysiological requirements for c-Myc in T cell development. Nat Im-munol 2001; 2: 307±15

17 Rudolph B, Hueber AO, Evan GI. Reversible activation of c-Myc in thy-mocytes enhances positive selection and induces proliferation andapoptosis in vitro. Oncogene 2000; 19: 1891± 900

18 Mariathasan S, Ho SS, Zakarian A, Ohashi PS. Degree of ERK activation

influences both positive and negative thymocyte selection. Eur J Im-munol 2000; 30: 1060±8

19 Ferrer I, Blanco R, Carmona M, Puig B. Phosphorylated c-MYC expres-sion in Alzheimer's disease, Pick's disease, progressive supranuclearpalsy and corticobasal degeneration. Neuropathol Appl Neurobiol2001; 27: 343±51

20 Mulroy T, Sen J. p38 MAP kinase activity modulates ab T cell develop-ment. Eur J Immunol 2001; 31: 3056 ± 63

21 Bassiri H, Carding SR. A requirement for IL-2/IL-2 receptor signaling inintrathymic negative selection. J Immunol 2001; 166: 5945±54

Johnson VJ et al. Physiological Responses to¼ Planta Med 2002; 68: 961 ±965

Or i gi n al P a

p er

965

Documents

Silmarina 2