Laporan Tugas Proyek Taksonomi Tumbuhan Tinggi

  • View
    159

  • Download
    5

Embed Size (px)

DESCRIPTION

semogaa bermanfaat

Text of Laporan Tugas Proyek Taksonomi Tumbuhan Tinggi

LAPORAN TUGAS PROYEK TAKSONOMI TUMBUHAN TINGGITANAMAN BINTARO (Cerbera manghas)Cerbera manghas (Apocynaceae )Morfologi. Perawakan pohon dengan tinggi 20 m. Daun daun tunggal, berwarna hijau, bentuk daun jorong (ovalis atau elipticus) dengan panjang 7,5-17cm dan lebar 2,5-5 cm, ujung daun meruncing (acuminatus), pangkal daun runcing (acutus), tepi daun rata (integer), tulang daun menyirip (penninervis), permukaan daun licin (laevis),tangkai daun bulat, tulang cabang satu dengan yang lain bersatu, filotaksis daun spiral, pangkal daun melanjut, daun agak berdaging, dan rumus duduk daun 2/5. Batang arah tumbuh batang tegak (erectus), berkayu, bentuk batang bulat (teres) dan berbintik-bintik hitam, tinggi sekitar 9 m, keliling batang 50 cm, percabangan simpodial. Perbungaan. Bunga berwarna putih dengan bercak kuning, yang terletak pada ujung pedikel simosa dengan lima petal yang sama ( pentamery), majemuk, Korola berbentuk tabung dan ada warna kuning pada bagian tengahnya, tangkai silindris, panjang tangkai putik 2-2,5 cm, mahkota berbentuk terompet. Buah. Buah berbentuk bulat dan buah muda berwarna hijau pucat dan berwarna merah saat tua, berdaging tipis, buah terdiri dari tiga lapisan yaitu epikarp atau eksokarp (kulit bagian terluar buah), mesokarp (lapisan tengah berupa serat seperti sabut kelapa yang kasar), dan endocarp ( biji yang dilapisi kulit biji atau testa), diameter buah 4 cm. biji berwarna putih, pipih dan panjang dan jumlahnya satu setiap buah, terletak dilapisan kulit buah yang berkayu.Rumus bunga:Diagram bunga :Habitat dan agihan. Gedung FMIPA di green house dan FIS di sebelah lapangan voli, Universitas Negeri Surabaya, Ketintang-Surabaya. Manfaat. Pohon bintaro biasanya dimanfaatkan sebagai tanaman penaung/pelindung yang biasa ditanam dipekarangan rumah atau di taman-taman. Kayunya digunakan sebagai ornament, hiasan dalam ruangan dan arang (PROSEA, 2002). Leeuwenberg (1999) melaporkan bahwa di Hawai bintaro digunakan sebagai tanaman hias. Selain itu tanaman ini dimanfaatkan sebagai obat. Di Thailand, biji bintaro dimanfaatkan sebagai antipiretik dan obat dysuria. Minyak dari bijinya digunakan sebagai pembunuh kutu rambut. Daunnya digunakan sebagai obat haemorrhoids (PROSEA, 2002). Di Irlandia dan Papua New Guinea, kulit kayunya dicampur dengan daun jahe liar kemudian direbus ke dalam air sebagai obat malaria dan hepatitis. Heyne (1987) melaporkan bahwa daun muda, akar dan kulit batangnya berkhasiat untuk pencahar. Kayunya yang putih dan rapuh, menghasilkan arang yang ringan, sangat halus dan berguna untuk pembentukan mesiu. Sedangkan getahnya digunakan untuk mengobati sengatan ikan swanggi (Heyne, 1987).PROSEA (2002) melaporkan bahwa ekstrak daun C. oddolam mempunyai efek toksisitas pada tikus. Ekstrak daun tersebut dapat mengurangi aktivitas saraf motorik secara spontan dan menyebabkan kematian. Selain itu Tarmadi et al.(2007) melaporkan bahwa ekstrak daun dan kulit bintaro mempunyai efek mortalitas terhadap rayap Coptotermes sp. Mortilitas rayap tertinggi terjadi pada ekstrak daun bintaro dengan menggunakan pelarut methanol konsentrasi 10% kulit bintaro dengan pelarut n-heksan dan aseton masing-masing dengan konsentrasi 10%.Biji bintaro digunakan dalam mengabsorpsi polusi udara serta merubahnya menjadi oksigen, mengandung minyak hingga 54,33% dan berpotensi digunakan sebagai bahan baku biodesel dengan melalui proses hidrolisis ekstrasi dan destilasi, Kulit buah bintaro yang berserat bisa dijadikan bahan baku papan partikel atau bahan bakar dan juga bisa diubah menjadi briket untuk bahan bakar tungku, dapat digunakan sebagai pengusir tikus.Kerugian. Biji binatro mengandung cerbirin yaitu racun yang terdapat pada seluruh bagian pohonnya dimana dapat menghambat saluran ion kalsium did lam otot jantung manusia, sehingga mengganggu detak jantung dan dapat menyebabkan kematian, getahnya digunakan sebagai racun panah atau tulup untuk berburu.Pollen. Berdasarkan tipe aperturanya bentuk pollen Cerbera manghas adalah Pericolporate (Kapp, 1969)

Gambar pollen (Kapp,1969Bentuk pollen Cerbera manghas. Bentuk pollen Cerbera manghas diperbesarBiomolekuler.LOCUS EF456094 850 bp DNA linear PLN 17-DEC-2008DEFINITION Cerbera manghas isolate R32 tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplast.ACCESSION EF456094VERSION EF456094.1 GI:129562027KEYWORDS .SOURCE chloroplast Cerbera manghas ORGANISM Cerbera manghas Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; asterids; lamiids; Gentianales; Apocynaceae; Rauvolfioideae; Plumerieae; Cerbera.REFERENCE 1 (bases 1 to 850) AUTHORS Livshultz,T., Middleton,D.J., Endress,M.E. and Williams,J.K. TITLE Phylogeny of Apocynaoideae and the APSA clade (Apocynaceae S.L.) JOURNAL Ann. Mo. Bot. Gard. 94 (2), 324-359 (2007)REFERENCE 2 (bases 1 to 850) AUTHORS Livshultz,T., Middleton,D.J., Endress,M.E. and Williams,J.K. TITLE Direct Submission JOURNAL Submitted (26-FEB-2007) Biology, University of Nebraska Omaha, 6001 Dodge St., Omaha, NE 68182, USAFEATURES Location/Qualifiers source 1..850 /organism="Cerbera manghas" /organelle="plastid:chloroplast" /mol_type="genomic DNA" /specimen_voucher="D. J. Middleton et al. 2047 (A)" /db_xref="taxon:141545" /note="authority: Cerbera manghas L." misc_feature 850 /note="contains tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer"ORIGIN 1 taagtgataa ctttcaaact cagagaaacc ccggaattaa taaaaagggc aatcctgagc 61 caaatcctgt tttccacaaa caaaggttca gaaaacgaaa acaaggatag gtgcagagac 121 tcaacggaag ctgttctaac aaatggagtt ggccgcgttg gtagagaaat ctttccatcg 181 aaaattcaga agggatgaag gataaacgta tatacatatt gaatactata tcaaatgatt 241 aatgccgacc cgaatgaatc tgtatttttt ctataaaaat cgaagaattg gtgtaattcg 301 attctttctt caatgtggaa tcgaatattc attgatcaaa tgatttactc cagagtctgt 361 agatcttttc aagaactgat taatcggacg agaataaaga tagagtcccg ttctacatgt 421 caatgctggc aacaatgaaa tttatagtaa gaggaaaatc cgtcgactta aaaaatcgtg 481 agggttcaag tccctctatc cccaaaaagc ctatttgcct ccccaactat atccattcta 541 ttcccccttt tctttcgtta gtgtccttat acatccgccc aattctattc ttttagaaat 601 agatctgggc ggaaatgtct tattacatct tataattaca tcttatatat aagatataca 661 tctttgagca agaaatcccc atttgaatga tttacaatcg atatcattac tcatactgaa 721 acttacaaag tcgtcttttt taagatccaa gaaattccag tacctagcta aaactttata 781 atcttctttc gcccttttaa ttgacataga cccccgtcct ctaataaaat gaggatgcta 841 cattgggact/

Cerbera manghas isolate R150 tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplastScoreExpectIdentitiesGapsStrand

1570 bits(850)0.0850/850(100%)0/850(0%)Plus/Plus

Query 1 TAAGTGATAACTTTCAAACTCAGAGAAACCCCGGAATTAATAAAAAGGGCAATCCTGAGC 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 1 TAAGTGATAACTTTCAAACTCAGAGAAACCCCGGAATTAATAAAAAGGGCAATCCTGAGC 60

Query 61 CAAATCCTGTTTTCCACAAACAAAGGTTCAGAAAACGAAAACAAGGATAGGTGCAGAGAC 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 61 CAAATCCTGTTTTCCACAAACAAAGGTTCAGAAAACGAAAACAAGGATAGGTGCAGAGAC 120

Query 121 TCAACGGAAGCTGTTCTAACAAATGGAGTTGGCCGCGTTGGTAGAGAAATCTTTCCATCG 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 121 TCAACGGAAGCTGTTCTAACAAATGGAGTTGGCCGCGTTGGTAGAGAAATCTTTCCATCG 180

Query 181 AAAATTCAGAAGGGATGAAGGATAAACGTATATACATATTGAATACTATATCAAATGATT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 181 AAAATTCAGAAGGGATGAAGGATAAACGTATATACATATTGAATACTATATCAAATGATT 240

Query 241 AATGCCGACCCGAATGAATCTGTATTTTTTCTATAAAAATCGAAGAATTGGTGTAATTCG 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 241 AATGCCGACCCGAATGAATCTGTATTTTTTCTATAAAAATCGAAGAATTGGTGTAATTCG 300

Query 301 ATTCTTTCTTCAATGTGGAATCGAATATTCATTGATCAAATGATTTACTCCAGAGTCTGT 360 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 301 ATTCTTTCTTCAATGTGGAATCGAATATTCATTGATCAAATGATTTACTCCAGAGTCTGT 360

Query 361 AGATCTTTTCAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGT 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 361 AGATCTTTTCAAGAACTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGT 420

Query 421 CAATGCTGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAAAAATCGTG 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 421 CAATGCTGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAAAAATCGTG 480

Query 481 AGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTATTTGCCTCCCCAACTATATCCATTCTA 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 481 AGGGTTCAAGTCCCTCTATCCCCAAAAAGCCTATTTGCCTCCCCAACTATATCCATTCTA 540

Query 541 TTCCCCCTTTTCTTTCGTTAGTGTCCTTATACATCCGCCCAATTCTATTCTTTTAGAAAT 600 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 541 TTCCCCCTTTTCTTTCGTTAGTGTCCTTATACATCCGCCCAATTCTATTCTTTTAGAAAT 600

Query 601 AGATCTGGGCGGAAATGTCTTATTACATCTTATAATTACATCTTATATATAAGATATACA 660 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 601 AGATCTGGGCGGAAATGTCTTATTACATCTTATAATTACATCTTATATATAAGATATACA 660

Query 661 TCTTTGAGCAAGAAATCCCCATTTGAATGATTTACAATCGATATCATTACTCATACTGAA 720 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 661 TCTTTGAGCAAGAAATCCCCATTTGAATGATTTACAATCGATATCATTACTCATACTGAA 720

Query 721 ACTTACAAAGTCGTCTTTTTTAAGATCCAAGAAATTCCAGTACCTAGCTAAAACTTTATA 780 ||||||||||