From the

Institute of Parasitology

Faculty of Veterinary Medicine

University of Leipzig

Evaluation of inhibition of Eimeria tenella sporozoites

by antibody fragments expressed in pea

Inaugural dissertation

for the attainment of the degree of a

Doctor medicinae veterinariae (Dr. med. vet.)

from the Faculty of Veterinary Medicine

University of Leipzig

Submitted by

Reda El-Bastaweisy Ibrahim Khalafalla, M.V.Sc.

from Biyala-Kafrelsheikh, Egypt

Leipzig, 2009

Mit Genehmigung der Veterinärmedizinischen Fakultät der Universität Leipzig

Dekan: Prof. Dr. Arwid Dawgschies

Betreuer: Prof. Dr. Arwid Dawgschies

Gutachter: Prof. Dr. Arwid Daugschies

Institut für Parasitologie, Veterinärmedizinische Fakultät, Universität

Leipzig, Leipzig

PD Dr. Gerhard Glünder

Klinik für Geflügel, Tierärztliche Hochschule Hannover, Hannover

Tag der Verteidigung: 08.12.2009

To the memory of my father and to my family

(Abeir, Mohamed, Mariam and Sara)

With all my love and gratitude

Table of contents

1 INTRODUCTION........................................................................................................................ 1

2 LITERATURE REVIEW ............................................................................................................ 2

2.1 TAXONOMY .................................................................................................................................. 2

2.2 LIFE CYCLE................................................................................................................................... 3

2.3 HOST-PARASITE RELATIONSHIP.................................................................................................... 5

2.4 INVASION OF HOST CELLS............................................................................................................. 6

2.5 EFFECTS OF DISEASE.................................................................................................................... 7

2.6 SEVERITY OF DISEASE.................................................................................................................. 7

2.6 IMMUNE RESPONSE TO EIMERIA SPP. INFECTING CHICKENS......................................................... 8

2.7 ROLE OF GUT-ASSOCIATED LYMPHOID TISSUES (GALT) AND MUCOSAL-ASSOCIATED LYMPHOID

TISSUE (MALT)................................................................................................................................... 9

2.8 ANTIBODY RESPONSES TO EIMERIA SPP. .................................................................................... 10

2.9 CELL-MEDIATED IMMUNE (CMI) RESPONSES TO EIMERIA......................................................... 12

2.9.1 T-lymphocytes..................................................................................................................... 12

2.9.2 Macrophages ...................................................................................................................... 12

2.9.3 Natural killer (NK) cells ..................................................................................................... 13

2.9.4 Blood leukocytes ................................................................................................................. 13

2.9.5 Cytokines ............................................................................................................................ 13

2.10 SPECIES DETERMINATION AND DIAGNOSIS............................................................................... 14

2.11 CONTROL OF COCCIDIOSIS IN CHICKENS.................................................................................. 16

2.11.1 Management ..................................................................................................................... 16

2.11.2 Immunobiology ................................................................................................................. 16

2.11.3 Immunization .................................................................................................................... 17

2.11.4 Chemotherapeutic agents ................................................................................................. 18

2.11.5 Drug resistance................................................................................................................. 19

2.11.6 Feed additives and plant natural products ....................................................................... 19

2.12 TRANSGENIC PLANTS................................................................................................................ 20

Developing a plant-based vaccine................................................................................................ 21

Application of plant-based vaccines for animal diseases............................................................. 22

2.13 PRODUCTION OF RECOMBINANT ANTIBODIES AGAINST EIMERIA SPP. USING DIFFERENT

EXPRESSION SYSTEMS, INCLUDING TRANSGENIC PLANTS................................................................. 23

3 ANIMALS, MATERIAL AND METHODS .............. .............................................................. 25

3.1 ANIMALS .................................................................................................................................... 25

3.2 PARASITE.................................................................................................................................... 25

3.2.1 Single oocyst infection ........................................................................................................ 25

Table of contents

3.2.2 Recovery of oocysts............................................................................................................. 26

3.2.3 Preparation and purification of sporozoites and merozoites ............................................. 27

3.3 DNA PREPARATION.................................................................................................................... 31

3.4 PCR ............................................................................................................................................ 32

3.4.1 Visualization of PCR products............................................................................................ 33

3.5 INDIRECT IMMUNOFLUORESCENCE TEST (IFAT) ....................................................................... 36

3.5.1 ACQUIRING AND PROCESSING OF IMAGES............................................................................... 38

3.6 FLOW CYTOMETRY (FC)............................................................................................................. 39

3.6.1 CELL CULTURE AND GROWTH CONDITIONS............................................................................. 41

3.6.2 INHIBITION ASSAY ................................................................................................................... 42

3.6.3 SERUM SAMPLES...................................................................................................................... 43

3.6.4 MTT ASSAY (MOSMANN 1983)............................................................................................ 43

3.7 ANTIBODY NEUTRALIZATION TEST ............................................................................................ 44

3.8 STATISTICAL ANALYSIS .............................................................................................................. 45

4 RESULTS.................................................................................................................................... 47

4.1 SINGLE OOCYST INFECTION (SOI) .............................................................................................. 47

4.2 PURIFICATION OF SPOROZOITES AND MEROZOITES OF EIMERIA SPP........................................... 48

4.3 INDIRECT FLUORESCENT ANTIBODY TEST (IFAT)...................................................................... 49

4.4 INVASION INHIBITION ASSAY......................................................................................................56

4.4.1 Invasion inhibition after treatment with antibody fragments ............................................. 58

4.4.2 Invasion inhibition rates after incubation with mixed antibody fragments ........................ 59

4.4.3 Invasion inhibition after treatment of sporozoites with chicken immune sera ................... 61

4.5 PROLIFERATION RATES OF THE HOST CELLS UNDER DIFFERENT TREATMENTS.......................... 63

4.5.1 PR after treatment with single antibody fragments ............................................................ 63

4.5.2 PR after treatment with different dilutions of mixed antibody fragments........................... 65

4.5.3 PR after incubation of MDBK with sporozoites treated with serum .................................. 67

4.6 IN VIVO ANTIBODY NEUTRALIZATION TEST ................................................................................ 69

5 DISCUSSION ............................................................................................................................. 73

CONCLUSION..................................................................................................................................... 80

6 ZUSAMMENFASSUNG............................................................................................................ 81

7 SUMMARY................................................................................................................................. 83

8 REFERENCES........................................................................................................................... 85

ACKNOWLEDGEMENTS................................................................................................................ 99

Abbreviations

Abbreviations list

µm Micrometer

Ab Antibody

AG Antigen

bp base pairs

BSA bovine serum albumin

CDPK Protein Kinase with Calmodulin-like Domain

CFSE Carboxy Fluorescein Succinimidyl Ester

CMI Cell mediated immunity

DAPI 4',6-diamidino-2-phenylindole

DEPC Diethylpyrocarbonate

DMEM Dulbecco’s modified Eagle medium

DMSO Dimethylsulfoxide

DNA deoxyribonucleic acid

dNTP deoxyribo nucleotide

DSMZ Deutsche Sammlung von Microorganismen und Zellkulturen (German

Collection of Microorganisms and Cell Cultures)

EDTA ethylenediaminetetraacetic acid

EtBr ethidium bromide

EtOH Ethanol

FACS fluorescence activated cell sorting

FC Flow cytometry

FCS fetal calf serum

FITC fluorescein isothiocyanate

Abbreviations

fw Forward (primer)

GALT Gut associated lymphoid tissues

GaM-FITC fluorescein isothiocyanate labelled goat anti-mouse antibody

HBSS Hank’s balanced salt solution

HEPES N-(2-hydroxyethyl) piperazine-N′-(2-ethane sulfonic acid)

IEL Intestinal intraepithelial lymphocyte aggregates

Ig immunoglobulin

mAB monoclonal antibody

MALT Mucosa associated lymphoid tissue

MHC The major histocompatibility complex

MDBK Madin Darby Bovine Kidney cells

MeOH Methanol

mM Milimolar

mOsmol/kg H2O Osmolality unit

MW Molecular weight

NCS newborn calf serum

NK Natural killer

nM nanomolar

o/n over night

OPG Oocyst per gram faeces

p.i. post-infection

PBS phosphate buffered saline

PCR polymerase chain reaction

pM Picomolar

PMSF Phenylmethylsulfonylfluoride

Abbreviations

PR Proliferation rate

RCF (or x g) Relative centrifugal force expressed in units of gravity (times gravity or × g)

rev Reverse (primer)

RNA ribonucleic acid

R-PE R-phycoerythrin

rpm round per minute

RPMI Roswell Park Memorial Institute

RT Room temprature

scAB single-chain antibody

scFv single chain variable antibody domain

SOI Single oocyst infection

Ta (°C) annealing temperature

TCR T-cell receptor

µ Micro

µM Micromolar

TM Trade Mark

DIC Differential interference contrast microscopy (DIC)

Introduction

1

1 Introduction

Coccidiosis in poultry is caused by infection with Eimeria spp. This disease has great economic

impact on poultry production particularly in intensively reared herds (WALLACH et al. 1995;

WILLIAMS 1998; 1999; LILLEHOJ and LILLEHOJ 2000).

Different attempts have been made to immunize chicken against coccidiosis throughout the

world by using low doses of sporulated oocysts (EDGAR 1958), irradiated sporulated oocysts

(REHMAN 1971), sporozoites (GARG et al. 1999), merozoites, recombinant merozoite antigen

(JENKINS 1998) recombinant refractile body antigen (KOPKO et al. 2000) and inactivated

sporulated oocysts (AKHTAR et al. 2001). None of these experimental vaccines reached to

commercial scale. In the late 80’s and early 90’s, vaccines based on virulent or attenuated status

(LEE 1987; SHIRLEY 1989; BEDRNIK 1996) were developed and are being marketed now in

different countries.

Some antibodies with inhibitory effect on various Eimeria - stages have been identified

(DANFORTH et al. 1985; LILLEHOJ and CHOI 1998; LABBE et al. 2005). Antibodies

produced in plants used for animal feeding could offer a simple and cheap biopharmaceutical

application to protect exposed herds.

The present study was conducted to investigate the effect of some antibody fragments against

Eimeria tenella which have been molecularly expressed in a transgenic pea plant. Both in vitro

and in vivo infection experiments were used to evaluate the inhibitory effect of these antibodies

on E. tenella by indirect immunofluorescence, antibody neutralization test and flow cytometry.

Literature review

2

2 Literature review

2.1 Taxonomy

Coccidiosis, is an intestinal disease of intensively reared livestock and is caused by protozoa

belonging to the taxonomic family Eimeridae and the phylum Alveolata (SCHNIEDER and

TENTER 2006). Most commonly recognized coccidia infecting chickens and other poultry are of

the genus Eimeria (MCDOUGALD 2008). The genus Eimeria is classified according to

SCHNIEDER and TENTER (2006) as follows:

Kingdom Protozoa,

Phylum Alveolata,

Subphylum Apicomplexa,

Class Coccidia,

Subclass Coccidiasina,

Order Eimeriida,

Family Eimeriidae,

Genus Eimeria

Coccidiosis has an economical significant incidence and even subclinical coccidiosis causes

impaired feed conversion. Eimeria spp. are obligate intracellular parasites of the intestinal tract,

but some species have been found in other organs such as the kidney and liver.

Most Eimeria spp. are highly host specific with a direct life cycle and infect only one host

species or a range of closely related host species. Multiple distinct Eimeria spp. infecting the

same host develop in species specific sites (Table 1). There are currently seven recognized

species of Eimeria infecting chickens, including E. acervulina, E. brunetti, E. maxima, E. mitis,

E. necatrix, E. praecox and E. tenella. Mixed infections with two or more of these species are

more common than monospecific infections (REID and LONG 1979).

Literature review

3

Table 1: Eimeria species of the domestic fowl, Gallus gallus (REID and LONG 1979)

Species Region infected Location in tissue Prepatent period

Average oocyst size (L x W, µm)

E. acervulina Duodenum Epithelial 97 18.3 x 14.6

E. brunetti Lower intestine, rectum

Subepithelial (second generation meronts)

120 24.6 x 18.8

E. maxima Upper intestine, ileum

Subepithelial gametocytes

121 30.5 x 20.7

E. mitis Upper intestine Epithelial 99 16.2 x 16.0

E. praecox duodenum, upper jejunum and mid-intestine

Epithelial 83 21.3 x 17.1

E. necatrix Cecae Subepithelial (second generation meronts)

138 20.4 x 17.2

E. tenella Cecae Subepithelial (second generation meronts)

115 22.0 x 19.0

2.2 Life cycle

The infection with Eimeria species is initiated when the sporulated oocyst is ingested by a

suitable host; sporocysts are released into the intestinal lumen (Figure 1). They excyst with the

aid of a variety of factors including mechanical disruption of the oocyst wall, enzymatic

digestion with trypsin, and the presence of bile salts and carbon dioxide.

The released sporozoites then penetrate epithelial cells of the intestinal villi where they either

develop directly within enterocytes or are transported, by host cells, to a specific location where

they develop into trophozoites and then meronts to initiate merogony (LILLEHOJ and TROUT

1996). Following invasion of villar epithelial cells, sporozoites of E. maxima and E. tenella are

transported from the epithelium to the lamina propria and finally to the crypt epithelium where

development continues.

Merozoite formation occurs through asexual schizogony (multiple simultaneous cellular fission)

with subsequent release of merozoites that invade other cells, and initiate another merogonic

cycle. The number of merogonic cycles is genetically determined and different for each species

or strain (precocious parasites often lack one or more merogonic replicative cycles).

Merozoites from the final generation invade intestinal cells to develop into macro- and

microgamonts through gametogony. Each macrogamont matures into one large macrogamete;

Literature review

4

the microgamonts divide to form many flagellated microgametes. The microgametes penetrate

and fertilize a macrogamete to form the zygote, an unsporulated oocyst. The unsporulated oocyst

breaks out of the host cell or is sloughed with its host cell and passed in the faeces (ROSE 1987).

In the absence of reinfection the parasites are cleared from the host in 7 to 14 days depending on

the species, irrespective of the host response to the parasites. Thus, the life cycle of the parasite

in an infected host is self-limiting.

Sporulation occurs outside of the host in the presence of oxygen. The unsporulated oocyst

develops to form four sporocysts, each of which differentiates to contain two mature sporozoites.

The environmentally resistant sporulated oocyst is the infective stage of the parasite.

Literature review

5

Figure 1: Life cycle of Eimeria. Following the ingestion of a sporulated oocyst (a) sporozoites

are released from sporocysts (b) and sporozoites invade villar epithelial cells (c). Merozoites are

formed through merogony (d) and are released to invade new cells and initiate subsequent

rounds of merogony (e). Final generation merozoites invade new cells to initial sexual

development, or gamogony (f) whereby microgamonts (g) and macrogamonts (h) are formed.

Microgamonts develop into microgametes that are released to fertilize the single macrogamete

that has developed from the macrogamont (i) to form the zygote, which moves out of the host

with the feces as (j) unsporulated oocyst. The unsporulated oocyst develops into the infective,

sporulated oocyst following exogenous sporulation (j-l). copyright for (MCDOUGALD 2008)

2.3 Host-parasite relationship

Recently particular attention has been paid in diverse Eimeria species to organelles involved in

the invasion of the host cells by extracellular motile stages of Eimeria located within the apical

complex (DANFORTH et al. 1989). Increasing resistance of avian coccidiosis against selective

Literature review

6

drugs has stimulated the search for novel and alternative methods of control such as vaccines

(MCDOUGALD 2008). This requires specific coccidial antigens to be recognized and

characterized. Certain regions on the cell surface of the coccidial parasite have been shown to

possess discrete immunogenic properties (DANFORTH and AUGUSTINE 1989).

2.4 Invasion of host cells

Invasive stages (zoites) of all Apicomplexa, including Eimeria spp., possess an apical complex.

This apical complex, consisting of the polar ring, conoid, rhoptries, micronemes and dense

granules, is used to penetrate host cells (CARRUTHERS and SIBLEY 1997). Apicomplexan

parasites actively invade specific host cells in a process in which the host cell plays no active

role (SIBLEY et al. 1998). Following the initial recognition between a zoite and host cell,

penetration into the host cell is initiated by contact between the zoite apical region and the

surface of the host cell. The zoite moves progressively into the developing parasitophorous

vacuole (PV), which forms as the parasite enters the cell and is contiguous with the host cell

plasmalemma. Several organelles of the apical complex, the micronemes, rhoptries and dense

granules, are important to host cell invasion, during which the contents of these organelles are

sequentially released. The invasive process, driven by the parasite, depends on the gliding

motility of the zoite, which is dependent on actin and myosin (RUSSELL 1983; AUGUSTINE

2001).

The invasion of specific cells by Eimeria spp. zoites suggests the presence of specific surface

membrane sites mediating contact and cell entry (LILLEHOJ and TROUT 1996). Host-cell

selection by parasites must allow for optimal survival and development of the parasites.

Protozoan sporozoites have D-galactose residues on their surfaces; host cells have receptors that

recognize these carbohydrates. Interaction between these moieties may occur prior to cell

penetration (BABA et al. 1996). Merozoites and microgametes of E. tenella express a

fibronectin-like molecule that may mediate host cell recognition and penetration. An integrin

receptor, demonstrated on merozoites, may also be involved in the parasite-host cell interaction

(LOPEZBERNAD et al. 1996).

Following invasion, several changes occur in the host cell. For example, after invasion of host

cells by merozoites of E. necatrix there was an increase in cell volume leading to increased

surface area due to the formation of a new membrane. The infected cells became invasive,

leaving the crypt and entering the lamina propria and muscle tissue. This process was assisted by

tissue breakdown by secreted collagenase. Accumulation of mitochondria around the PV was

Literature review

7

noted as well as formation of intravacuolar tubules and hypertrophy of the nucleus. The infection

led to alterations in the host cell membrane that led to increased susceptibility to trypsin and,

ultimately, cell lysis. Lysis of the host cell allows for merozoite release without a unique

mechanism suggesting that the morphological changes of the host cell may be tied to the

parasite's life cycle (PASTERNAK and FERNANDO 1984; AUGUSTINE 2001;

CARRUTHERS and TOMLEY 2008).

2.5 Effects of Disease

Infection of the gastrointestinal tract by Eimeria spp. results in an alteration of the mucosa that

may give rise to enteric disease. Signs of disease include anorexia, weight loss, huddling,

ruffling of feathers, soft stools and death. At necropsy, intestinal lesions are visible that, along

with history and scrapings of intestinal mucosa, can be used to diagnose the disease

(MCDOUGALD 2008). The intestinal mucosa is damaged directly by the parasites and

indirectly through the host's inflammatory responses to the parasites. The damage is manifested

both structurally and physiologically as mucosal hypertrophy, villous atrophy, increased vascular

permeability, and epithelial and vascular damage. Villous atrophy is related to several

mechanisms. Exfoliation of villar cells into the lumen and exposure of lamina propria stromal

cells at the villar tip occur following infection of surface enterocytes, leading to atrophy and

damage to the proliferative cells in the crypt decreasing the ability for epithelial renewal. Cell

mediated immune responses (CMI) by the host also affect mucosal integrity. Inflammation,

haemorrhage and necrosis can be induced by lymphoid effector cells in the mucosa and

submucosa, with changes in vascular permeability leading to oedema and haemorrhage

(BARKER 1993).

2.6 Severity of Disease

The severity of avian coccidiosis is affected by external and internal factors. Environmental

factors, as well as diet, management and stress all affect the severity of disease. The amount and

types of nutrients in the diet are important, as for example, birds fed on low protein diets develop

less severe disease. Commercial poultry houses that are maintained with high temperatures and

humidity generally have flocks with less severe disease (RUFF 1993).

Genetics, age, disease interactions, nutritional state and immunity are internal factors which may

affect the severity of disease (RUFF 1993). Susceptibility to disease is affected by the host

Literature review

8

genome. Breeds and individuals within breeds differ in susceptibly to coccidiosis (JEFFERS

1978). These differences in susceptibility may arise due to random genetic differences between

strains. For instance, FP strain chickens are more susceptible than are SC strain chickens to

disease due to infections with E. maxima, E. acervulina and E. tenella (LILLEHOJ and RUFF

1987) Concurrent diseases and infections, such as Marek's disease and infectious bursal disease,

may increase the severity of coccidiosis. Development of specific immunity following primary

infection may greatly reduce the severity of disease after subsequent infections.

2.6 Immune response to Eimeria spp. infecting chickens

The complex life cycle of Eimeria species consists of intracellular, extracellular, asexual and

sexual developmental stages resulting in a complex host immune response. This necessitates a

better understanding of host-parasite interactions and of protective immune mechanisms for

successful prevention and control practices (DALLOUL and LILLEHOJ 2005). The

development of immunity is strongly influenced by many factors including the species of

Eimeria infecting the chicken, the stage responsible for intestinal damage, the number of oocysts

ingested, host age, genotype, general health, and on whether a primary or secondary response is

occurring (LILLEHOJ and TROUT 1996; SWINKELS et al. 2006).

The immune responses elicited to Eimeria spp. can be categorized into non-specific and specific

immunity as reviewed by (DALLOUL and LILLEHOJ 2005); where the specific immunity is

composed of cellular and humoral immune response mechanisms. The non-specific immune

responses include physical barriers, phagocytes and leukocytes, and complement whereas the

specific one is mediated by antibodies, lymphocytes and cytokines.

Host defence mechanisms are activated following sporozoites invasion of host cells inducing

local inflammatory reaction. Increased intestinal permeability results in plasma leakage from the

vasculature and is coincident with cell invasion (CASTRO 1989). Following sporozoite invasion,

leukocytes and other components of the gut-associated lymphoid tissue (GALT) are found at the

site of infection, including macrophages, B-lymphocytes, T-lymphocytes and soluble factors

(mucin, enzymes, antimicrobial peptides, immunoglobulins and cytokines) (LILLEHOJ 1998)

Activated macrophages modulate the severity of infection and reduce numbers of sporozoites

and merozoites through phagocytosis (LEE and AL-IZZI 1981). CD4+ T-cells help to induce

antibody and cell mediated immunity after the primary infection. The marked increase of CD4+

cells suggests that these cells are involved in the induction of the immune response and of

Literature review

9

antibody production, whereas the increase of CD8+ cells after challenge infection suggests that

these cells act as effector cells and are involved in cell mediated immunity (VERVELDE et al.

1996).

Immunity affects early stages of the parasite likely through limiting invasion, inhibition of

sporozoite and merozoite development and induces parasite death followed by removal with host

cells, resulting in parasite elimination (JEURISSEN et al. 1996)

2.7 Role of Gut-associated lymphoid tissues (GALT) and mucosal-associated

lymphoid tissue (MALT)

In general the GALT serve three functions in host defence against Eimeria spp. infections:

processing and presentation of antigens, production of intestinal antibodies (primarily secretory

IgA), and activation of cell mediated immunity (CMI) (YUN et al. 2000b; DALLOUL and

LILLEHOJ 2005). In chickens the GALT include the bursa of Fabricius, cecal tonsils, Payer’s

patches, and lymphocyte aggregates in the intraepithelium and in the lamina propria of the

intestinal wall of the gastrointestinal tract (LILLEHOJ and TROUT 1996). In the immune hosts,

parasites enter the gut early after infection but are prevented from further development,

indicating that acquired immunity to coccidiosis may involve mechanisms that inhibit the natural

progression of parasite development (LILLEHOJ and TROUT 1996).

Intestinal lymphocyte populations following infection with Eimeria spp. have been extensively

investigated by several research groups (LILLEHOJ and BACON 1991; OVINGTON et al.

1995; BESSAY et al. 1996). Increased numbers of duodenal CD4+ lELs from 4 days through 14

days post-infection result from E. acervulina (BESSAY et al. 1996). Also there were fewer

increases in CD8+ and γδ-TCR+ cells at 12th days post-infection and numbers decreased by the

p.i. day 14. Following secondary infection with E. acervulina, CD8+ T-cells increased

(LILLEHOJ and BACON 1991). The authors speculated that CD8+ T-cells and natural killer

(NK) cells were involved in protective immunity due to significant increases in these cells at the

site of infection in naive and immunized breeds of chickens.

The most important role of mucosal-associated lymphoid tissue (MALT) is to destroy invading

pathogens at their port of entry to prevent dissemination and systemic infection throughout the

host. This function is accomplished in a number of different ways including non-specific barriers

such as gastric secretions, lysozymes and bile salts, peristalsis, and competition by native

Literature review

10

microbial flora that provide an important component of the first line of defence in the MALT

(SANDERSON and HE 1994).

Following the primary infection with E. tenella, an infiltration of the mucosa by T-cells,

predominantly CD4+ and also CD8+ cells, and macrophages was observed in chickens 24 to 96

hours post-infection. The CD4+ cells were thought to be involved in the induction of a cytotoxic

response, MHC Class II recognition and the production of cytokines. In immune challenged

chickens, lymphocyte migration to the intestine was more rapid and involved mostly CD8+ cells

surrounding sporozoites in the lamina propria. More cells were observed in the lamina propria of

these birds than in naive birds, mostly representing CD4+ and less frequently CD8+

(VERVELDE et al. 1996).

Increases in CD8+ cells but not γδ-TCR+ cells were observed following primary infection with

E. tenella. CD4+ cells increased 8 days post-infection and decreased by 14 days (BESSAY et al.

1996). The authors, in comparing the response to E. tenella with that to E. acervulina, concluded

that there might be differences in the early immune infection response of chicken to eimerian

parasites based on the sites of development (cecum vs. duodenum). It appeared that the number

of CD8+ lymphocytes was relatively more elevated in distal regions of the intestinal tract. One

hour following primary infection with E. maxima, local lymphocytes initially decreased and then

increased 3 to 7 hours later. Most of the responding lymphocytes were T-cells rather than B-

cells. Subsequent T-cell responses were biphasic, with increases in the number of CD4+ cells in

the lamina propria observed on day 3 and day 11 following primary infection. Little response

was observed in epithelial CD4+ cells. Following challenge infection, increases were observed in

lamina propria CD4+ cells at 0.5 and 3 hours. The CD8+ populations infiltrated the lamina

propria and intraepithelial regions, similar to CD4+ cells. The numbers also increased following

challenge, most notably in the epithelium. Greater numbers of γδ-TCR+ cells were observed in

the epithelium than in the lamina propria. This population peaked on day 11 post-infection. αβ-

TCR+ cells were observed in both regions but in greater numbers in the lamina propria

(ROTHWELL et al. 1995).

2.8 Antibody Responses to Eimeria spp.

The definitive role of humoral immunity against poultry coccidiosis is still unclear. Similar to

mammals, three classes of antibodies are recognized in birds, viz immunoglobin IgM, IgA, and

IgY. Each antibody class has at least one monomer of heavy chains and of light chains. Both

heavy and light chains have a variable domain at the N-terminal position and 3 or 4 constant

Literature review

11

domains at the C-terminal region. Depending on the types of constant regions of the heavy (H)

chains, the antibodies are classified into IgM (µH chain), IgA (αH chain), and IgY (γH chain)

(LILLEHOJ et al. 2004). IgY is considered orthologue to the mammalian IgG (LESLIE and

CLEM 1969).

Maternal IgY is concentrated in the yolk sac of the egg (ROSE et al. 1974) and its transportation

to the chicken embryo during late development was found to be similar to that found in

mammals (WEST et al. 2004). Thus it is regarded as a carrier for the maternal passive immunity

(LILLEHOJ et al. 2004). Passive antibodies, transferred to chicks by hens immunized by

gametocyte surface antigens of E. maxima, reduced oocyst output in those birds after challenge

with sporulated E. maxima oocysts. Maternal antibodies induced by infection with E. maxima are

able to partially protect hatchlings against infection with E. tenella (WALLACH et al. 1992) and

the E. tenella egg-propagated gametocyte vaccine induced protective immunity against E. tenella

infections in offspring chicken (ALLEN et al. 1997; ANWAR et al. 2008).

Increased production of IgA, IgM and IgY following infection with an upper intestinal species

(E. acervulina) and with a cecal species (E. tenella) was observed in the serum and locally at the

site of infection in the intestinal secretions. Following infection with E. acervulina significant

increases in secretory IgA (sIgA) were observed in mucosal tissue from the duodenum and

cecum 14 days post-infection (GIRARD et al. 1997). However, antibody responses have a minor

role in protective immunity to Eimeria spp. because agammaglobulinemic chickens produced by

hormonal and chemical bursectomy are though resistant to reinfection with Eimeria spp. (ROSE

and LONG 1970; YUN et al. 2000a).

The role of sIgA during infections is not clearly understood but is believed to be minor. Chickens

lacking the isotype are still resistant to infection (LILLEHOJ 1993). Its main role may be in the

prevention or reduction of invasion of some (but not all) species of Eimeria or it may enhance

the intraluminal destruction of sporozoites if parasites come into close contact with local

antibodies before the parasites enter host cells (LILLEHOJ 1993). Moreover, it possibly inhibits

sporozoite and merozoite development (LONG et al. 1982). IgA may attach to the coccidial

surface and prevent binding to the epithelium by direct blocking, steric hindrance, and induction

of conformational changes and/or reduction of motility (XUAMANO et al. 1992).

Literature review

12

2.9 Cell-Mediated immune (CMI) responses to Eimeria

It has been reported that cell mediated immunity plays a major role in resistance to coccidiosis

by developing a protective immune response involving T-lymphocytes, macrophages and natural

killer (NK) cells (LILLEHOJ et al. 2004). Antigen-specific T cell responses against Eimeria spp.

have been demonstrated in chickens using in vitro lymphocyte proliferation assays. T-

lymphocytes isolated from chickens infected with E. tenella proliferated when stimulated with

soluble antigen from developmental stages of E. tenella (ROSE and HESKETH 1984). This

proliferative response did not occur when the Eimeria spp. from which the soluble antigen was

obtained differed from that used to infect the chicken whose lymphocytes were under evaluation

(LILLEHOJ 1986).

2.9.1 T-lymphocytes

The importance of T-lymphocytes in mediating resistance has been shown partly through

transfer and depletion experiments. It is possible to adoptively transfer immunity to Eimeria spp.

with T-cells from immune birds (OVINGTON et al. 1995). Induction of immunosuppression by

administration of cyclosporin before the primary inoculation of Eimeria species increased

susceptibility and administration of cyclosporin prior to secondary inoculation eliminated

protective immunity (TROUT and LILLEHOJ 1996). Depletion of CD4+ cells had no effect on

the development of immunity. However, following depletion of CD8+ cells, resistance to

secondary infection was cancelled. The authors concluded that the role of CD4+ cells was during

primary immune responses possibly in the production of interferon (IFN) and the role of CD8+

cells was that of effectors against infected epithelial cells.

2.9.2 Macrophages

Macrophages reduced infection with E. tenella and disease severity (QURESHI et al. 2000).

Macrophages are antigen presenting cells and mediate immune responses to the parasites.

Through the secretion of cytokines, macrophages modulate responses by other cells of the

immune system and by epithelial cells. They also function as effector cells through the

production of tumour necrosis factor (TNF), reactive oxygen intermediates (ROI) and reactive

nitrogen intermediates (RNI), all of which have anti-parasitic effects (VERVELDE et al. 1996)

and are increased during infections with Eimeria spp. (QURESHI et al. 2000). This is

Literature review

13

accompanied by changes in CD4+ and CD8+ T-cell subpopulations (CORNELISSEN et al.

2009).

2.9.3 Natural killer (NK) cells

NK cells are non-T, non-B, and non-macrophage mononuclear cells with characteristic

morphology that are capable of spontaneous cytotoxicity against a wide variety of target cells.

Because NK cells lack immunological memory and MHC restriction, their cellular lineage is

debatable (LILLEHOJ 1993).

NK cell activity has been demonstrated in the spleen (ROSE et al. 1979; LILLEHOJ 1989),

peripheral blood (LEIBOLD et al. 1980), thymus, bursa, and intestine (CHAI and LILLEHOJ

1988; LILLEHOJ and CHAI 1988). These cells are found in greatest quantity in the

intraepithelial compartments in the early stages of coccidial infection (ROSE et al. 1979;

LILLEHOJ 1989) suggesting that their role may be to control parasite proliferation.

2.9.4 Blood leukocytes

Blood leukocytes, including polymorphonuclear (PMN) cells, large mononuclear (LMN) cells

and lymphocytes, were found to be increased following primary infection with E. maxima. The

greatest increase in LMN was observed at the end of the life cycle of the parasites and was

possibly associated with lesion resolution. Increases in PMNs were observed before and after

peak oocyst production. Decreased numbers of leukocytes were concurrent with the appearance

of sexual stages in the life cycle of the parasite. The leukocyte response in chickens reinfected

with the parasite was rapid and involved increases in PMN and lymphocyte numbers. Infiltration

of PMN and lymphocytes into the intestinal mucosa was observed concurrently (ROSE et al.

1979; LILLEHOJ 1993). Following challenge of immune birds, circulating blood lymphocytes

(primarily T-cells) initially decreased and then increased. The predominant involvement of T-

cells was thought to indicate a protective role for that population (ROSE et al. 1984).

2.9.5 Cytokines

The lymphocytes, macrophages, and other effector cells act in harmony to secrete cytokines and

proinflammatory molecules, mediating the appropriate immune responses to the invading

parasite. In contrast to the mammalian cytokines, only a few chicken homologues have been

described, the main ones being interferon (IFN)-γ, transforming growth factor (TGF), tumor

necrosis factor, interleukin (IL)-1, IL-2, IL-6, IL-8, and IL-15 (LILLEHOJ et al. 2004).

Literature review

14

Recently, a number of cytokines including IL-17, IL-18, IL-16, IL-12, IL-10, and the Th2 type

IL-3, IL-4, IL-13, granulocyte macrophage colony stimulating factor, and IL-5 have been

described in chicken (DALLOUL and LILLEHOJ 2005). These cytokines could be participants

in the immune responses to coccidiosis. Although not fully characterized, IL-1 association with

E. tenella and E. maxima infections has been described (LAURENT et al. 2001).

As it stands, Th1 responses seem to be dominant during coccidiosis, as best manifested by

proven involvement of IFN-γ (DALLOUL and LILLEHOJ 2005). IL-10 was reported to induce

inhibition of IFN-γ during E. maxima infection, suggesting that IL-10 may favour a shift to Th2-

type immunity in response to coccidiosis (ROTHWELL et al. 2004). This furthers our

understanding that strong Th1-type, IFN-γ–driven immune responses are the dominant players

during Eimeria spp. infections.

2.10 Species determination and diagnosis

Generally, the five most pathogenic species E. acervulina, E. brunetti, E. maxima, E. necatrix,

and E. tenella can be differentiated in the host on the basis of clinical signs, characteristic lesions

at particular sites of infection in the chicken intestine, and consideration of the prepatent period,

size of oocysts, and morphology of intracellular stages. However, the less pathogenic species

such as E. mitis and E. praecox might be overlooked.

SHIRLEY (1975) was the first to use a molecular biological approach to differentiate species on

the basis of isoenzyme patterns of oocysts by starch block electrophoresis. ELLIS and

BUMSTEAD (1990) were among the first to demonstrate that ribosomal RNA (rRNA) genes

could be used to identify individual species through characteristic restriction fragment patterns.

PROCUNIER et al. (1993) used a randomly amplified polymorphic DNA assay to differentiate

E. acervulina and E. tenella and to detect within-strain differences. Recombinant DNA

techniques have been used to discriminate different strains of E. tenella (SHIRLEY 1994) and to

develop markers for precocious and drug-resistant strains. PCR amplification of internal

transcribed spacer region 1 (ITS-1) from genomic DNA, which are located in-between 18s and

5.8s ribosomal RNA fragments, has been used to detect and differentiate six Eimeria species

(SCHNITZLER et al. 1998). Eight species (including E. hagani) are claimed to be differentiated

using a two-step PCR procedure (TSUJI et al. 1997), and six Australian species have been

characterized using a PCR-linked restriction fragment length polymorphism approach (WOODS

et al. 2000b). These PCR methods should prove very useful for epidemiological surveys of avian

coccidiosis.

Literature review

15

SCHNITZLER et al. (1998, 1999) chose the ITS-1 as a target for PCR. Initially, genus-specific

primers to conserved regions flanking the ITS-1 were used to amplify a product from each of the

seven species of Eimeria. Seven different primer pairs were designed to unique sections of the

ITS-1 sequence, one for each species. Other workers (LEW et al. 2003; SU et al. 2003) used a

similar approach, employing genus-specific primers as a starting point, cloning and sequencing

the ITS-1 region, and then designing species-specific primers. The above studies employed one

of two methods for the detection of the amplicons produced. Typically, PCR products underwent

electrophoresis on ethidium bromide stained agarose gels, their sizes being displayed

(SCHNITZLER et al. 1998; LEW et al. 2003; SU et al. 2003). While agarose gels allow the

resolution of a PCR product based on size, they are limited in their ability to display sequence

variation among amplicons, unless it relates to a considerable length difference. SCHNITZLER

et al. (1999) also used a paper chromatography hybridization assay (PCHA) for the detection of

amplicons.

Using the first and second internal transcribed spacers of ribosomal DNA (ITS-1 and ITS-2),

PCR-based electrophoretic methods for diagnosis and analysis of genetic variation were

established. In Australia, Eimeria spp. from chickens were characterised using a polymerase

chain reaction-linked restriction fragment length polymorphism (PCR-RFLP) approach;

electrophoretic analysis of restriction endonuclease-digested radio-labelled ITS-2 amplicons was

done in a denaturing polyacrylamide gel matrix (for six species of Eimeria) (WOODS et al.

2000b).

Denaturing polyacrylamide gel electrophoresis (D-PGE) and single-strand conformation

polymorphism (SSCP) analyses were established for the display of sequence variation both

within and among amplicons, produced from the ITS-1 and ITS-2 ribosomal DNA regions using

a single set of genus/family-specific, radio-labelled oligonucleotide primers (for five species of

Eimeria) (WOODS et al. 2000a).

Electrophoresis of amplicons produced from the ITS-2 using a single primer set (one of which is

fluorescence-labelled) can be used for the specific identification of and differentiation among all

seven currently recognized species of Eimeria, and for the detection of variation within species

(GASSER et al. 2001; GASSER et al. 2005).

Recently, BLAKE et al. (2008) described the development of three other diagnostic real-time

PCR assays, also based on sequence-characterized amplified regions (SCARs), for the specific

detection of E. tenella, E. acervulina and E. necatrix. Recently another Real-time PCR assay has

been established for the detection and quantification of seven species of Eimeria that infect

Literature review

16

chickens in Australia. The assay targets one genetic marker, the second internal transcribed

spacer of nuclear ribosomal DNA (ITS-2), makes use of TaqMan® MGB technology with

species-specific probes, and can be multiplexed in pairs such that the seven species of Eimeria

can be screened in four reaction tubes (MORGAN et al. 2009).

2.11 Control of coccidiosis in chickens

2.11.1 Management

It is very difficult to keep chickens coccidia free, especially under current intensive rearing

conditions, because Eimeria oocysts are ubiquitous and easily disseminated in the poultry house

environment and have a large reproduction potential. Oocysts sporulate readily in poultry house

litter, however, bacteria, other organisms, and ammonia that are also present can damage them,

and their viability can begin to diminish after 3 weeks (WILLIAMS 1998). Disinfection alone is

not an effective control measure but good sanitation practices allow for the mechanical removal

of oocysts from the environment, thus decreasing exposure. However, reliance on this as a sole

control method is not recommended as it is not effective in reducing disease (LONG et al. 1982).

Many producers in the United States basically remove caked litter, let the houses air out for 2 to

3 weeks, and top dress with fresh litter before placing a new flock (H. D. Danforth, private

communication). On the other hand, it is common practice in most European countries to do a

thorough cleanout between flocks. This practice may become more widespread as the

effectiveness of anticoccidials continues to decrease and the use of live vaccines increases.

Hygienic measures such as requiring caretakers to change clothes between houses can reduce the

spread of infective oocysts. The practice of strict biosecurity is essential in the care of broiler

breeders (ALLEN and FETTERER 2002).

2.11.2 Immunobiology

Day-old chicken can derive passively transferred protective immunity from the immunized hen

by gametocyte surface antigens of E. maxima (WALLACH et al. 1992), however, birds of any

age are principally susceptible to coccidiosis. In practise, most acquire infection in the first

weeks of life and this infection induces a good immunity, which persists for life in most cases

(DANFORTH 1998). A cardinal feature is that immunity is species specific. Thus, in chickens

for example, immunity to E. tenella does not confer resistance to E. maxima or other species

(MCDOUGALD 2008). Within species there appears to be remarkably little strain variation and

Literature review

17

strains of the same species isolated from widely separated locations will provide substantial

protection against other isolates of the same species with exception of E. maxima and E.

acervulina (MCDOUGALD et al. 1997). Immunity is best maintained by repeated exposure to

low number of oocysts, so-called trickle infection (NAKAI et al. 1992). Immunity is manifest as

a reduction in lesions and a marked reduction in oocyst output due to both a reduction in the

number of sporozoites that successfully invade host cells and inhibition of intracellular

development of those that do (MCDOUGALD et al. 1997). The effectors of immune response to

primary and challenge coccidial infections are primary T cells residing in the gut associated

lymphoid tissues (GALT). Humoral immune (IgA) responses also occur, but antibodies play a

minor role in resistance and immunity to coccidia (CHAPMAN 1999).

2.11.3 Immunization

The development of drug resistance in Eimeria has necessitated the development of other means

of control. Immunological control through vaccination is the main current alternative. Species-

specific immunity is induced by controlled inoculation with oocysts of that species (LONG et al.

1982).

According to MCDOUGALD et al. (1997) vaccines must contain all the important species

because of the species specificity of immunity. Following vaccination strategies are currently

practised;

• Natural infection from litter is relied on to induce immunity and serious disease is prevented by

the use of drugs of modest efficacy or by using “step-down” doses programs in the first weeks of

life (WILLIAMS 1998).

•Live unattenuated vaccines are available in North America comprising mixtures of unattenuated

lines of oocysts of all important species delivered in drinking water. This vaccine approach has

had only limited popularity and it has not been used in Europe (SHIRLEY et al. 2005).

•Live, attenuated vaccines: All seven pathogenic Eimeria species of chickens have been

attenuated by rapid passage in vivo, selecting so-called “precocious” strain. Although these

strains have lost virulence, they remain immunogenic. ParacoxTM (Schering-Plough Animal

Health) contains 8 precocious lines (shortened life cycles) of the parasites, including seven

species with two strains of E. maxima. Also LivacoxTM (Biopharm) contains attenuated lines of

E. acervulina, E. maxima and E. tenella. Attenuated lines of the parasites are developed through

Literature review

18

selection for precociousness. This trait is stable and heritable and results in reduced

pathogenicity and increased sensitivity to anticoccidials (SHIRLEY et al. 2005).

•Non-living vaccines. This vaccine is not yet available but it remains a subject of considerable

research (SHIRLEY et al. 2005).

Protection, as measured by increased weight gain, reduced lesion scores and reduced oocyst

output, was found to be optimal following oral administration of the vaccine by gel delivery

(DANFORTH 1998).

Vaccines are now being used commonly in the breeder replacement layer industries, but not

widely in the broiler-heavy roaster industry (DANFORTH 1998; ALLEN and FETTERER 2002;

DALLOUL and LILLEHOJ 2005). Vaccines are not preferable for broilers due to an inability of

the birds to compensate for the period of reduced weight gain that occurs following vaccine

administration. For effective development of protection in broilers, exposure to the parasites

must occur by 1day of age. However, Paracox® vaccine (Schering–Plough Animal Health) has

already been used in over 240 million broiler breeders, layer replacements and heavy meat birds

(WILLIAMS 1998).

2.11.4 Chemotherapeutic agents

Chemotherapeutics in use today are broadly classified as synthetics (chemically synthesized

compounds) and ionophorous antibiotics (compounds produced through microbial fermentation)

(CHAPMAN 1999). Chemotherapeutic strategies include the complete suppression of disease

(broiler flocks), treatment of outbreaks and partial suppression of disease to allow for

development of immunity (layer flocks). At present no single drug is effective in all three roles

(RIDDELL 1984).

The sulfonamides and related drugs compete for the incorporation of folic acid. Amprolium

competes for absorption of thiamine by the parasite. The quinoline coccidiostats and clopidol

inhibit energy metabolism in the cytochrome system of the coccidia. The polyether ionophorous

upset the osmotic balance of the protozoan cell by altering the permeability of cell membranes

for alkaline metal cations (JEFFERS and BENTLEY 1980).

The coccidia are labile to be attacked by drugs at various stages in the development in the host.

Totally unrelated drugs may attack the same stage of parasite. The quinolones and ionophorous

drugs arrest or kill the sporozoite or early trophozoite. Nicarbazin, robenidine and zoalene

destroy the first- or second-generation schizont, and the sulfonamides act on the developing

Literature review

19

schizont and probably against sexual stages. Diclazuril acts in early schizogony with E. tenella

but is delayed to later schizogony with E. acervulina and to the maturing macrogamet with E.

maxima (CHAPMAN 1999).

2.11.5 Drug resistance

Anticoccidial resistance arises due to continued reliance on medication, use of suboptimal levels

of drug, as well as the short life cycle of the parasites (RIDDEL 1984). The rapid asexual

multiplicative cycles are characteristic of the coccidia and the inclusion of sexual recombination

in the life cycle contributes to the relatively rapid development of drug resistance (LONG 1982).

It has been fully studied (CHAPMAN 1994 and 1998; RUFF et al. 1976, BAFUNDO et al.

2008), that some degree of resistance to all anticoccidial drugs, including ionophores, has been

developed. To minimize the effects of resistance, poultry producers rotate the use of various

anticoccidials with successive flocks, combine chemical and ionophore treatments, or employ

shuttle programs during a flock grow out. Two new potential drug targets, enzymes of the

sporozoite mannitol cycle (ALLOCCO et al. 1999; SCHMATZ 1997) and trophozoite histone

deacetylase, have been identified (SCHMATZ 1997). Drug residues in the poultry products are

potentially annoyed by consumers (YOUN and NOH 2001). Therefore other alternative

treatments such as medicinal plant use in coccidiosis control must be envisaged, since

coccidiosis was reported to be the most important parasitic disease chicken (KUSINA and

KUSINA 1999).

2.11.6 Feed additives and plant natural products

Many different types of substances have been investigated in the search for alternative control of

coccidiosis. Fish oil and flaxseed oil diets significantly reduced the degree of parasitism and

development of E. tenella (ALLEN et al. 1996) and caused ultrastructural degradation of both

asexual and sexual stages, characterized by cytoplasmic vacuolization, chromatin condensation

within the nucleus, and lack of parasitophorous vacuole delineation (DANFORTH et al. 1997).

Feed supplementation with antioxidants such as alpha-tocopherol (8 ppm), found plentifully in

seed oils such as wheat, corn, and soybean, and the spice turmeric (1%), as well as its main

medicinal component, curcumin (0.05%), appear effective in reducing upper- and mid-small

intestinal infections caused by E. acervulina and E. maxima (ALLEN et al. 1998). They are not

beneficial for E. tenella infections, however. Artemisinin is a chinese herb isolated from

Artemisia annua; it is a naturally occurring endoperoxide with antimalarial properties. It has

Literature review

20

been found effective in reducing oocyst output from both E. acervulina and E. tenella infections

when fed at levels of 8.5 and 17 ppm in starter diets (ALLEN et al. 1997). The mode of action is

also thought to involve oxidative stress.

In Thailand, NAIYANA (2002) used Andrographis paniculata leaf powder in the feed and found

a significant reduction of mortality rate as well as of the lesion scores in comparison to control

groups.

Recently, extracts from 15 asian herbs were tested for anticoccidial activity against E. tenella. Of

the species tested, extracts from Sophora flavescens Aiton was the most effective in reducing

lesion scores, maintaining body weight gain, and reducing oocyst production (YOUN and NOH

2001).

2.12 Transgenic plants

Mass vaccination programmes led to significantly lower consumption of veterinary drugs,

including antibiotics and reduced negative environmental impacts by eliminating chemical

residues in products such as milk, eggs and meat. Production losses caused by illnesses can be

avoided (FLOSS et al. 2007). The modern biotechnology has provided the opportunity to

develop and produce protein pharmaceuticals in plants which offer inexpensive

biopharmaceutical production with maintaining product quality and safety and the material can

be delivered without extensive purification. However, the development of plant-based vaccines

for animal health is more progressive than that for human health due to the stringent regulation

to be followed for human medical products (METT et al. 2008)

Medically relevant proteins expressed in plants can roughly be divided into three functional

categories: (i) vaccines, (ii) recombinant antibodies, and (iii) other medical proteins, including

blood products, growth factors, cytokines, enzymes, and structural proteins.

The first recombinant plant derived pharmaceutical protein, human serum albumin, was

produced in transgenic tobacco in 1990 (METT et al. 2008). There is some public concern

regarding glycoproteins made in plants but there was no observation for undesirable symptoms

after evaluating several plant-made glycoproteins, including monoclonal antibodies, in different

animal models (METT et al. 2008).

Literature review

21

Developing a plant-based vaccine

In the absence of a currently used antigen, a suitable protein target, such as toxin subunits or

surface antigens related to the pathogen of interest, must be selected. Known protective subunit

vaccine and established vaccine antigen can be expressed in transgenic plants, an alternative oral

option will be considered for reasons of cost (STREATFIELD 2007). When dealing with a

poorly characterised pathogen, a genomics or proteomics approach might first be used to identify

antigen candidates that possess promising characteristics (e.g. cell surface virulence factors).

Several different plant species have been experimented for the purpose of expressing antigens at

high levels. The most common plant chosen as an expression host is tobacco because it is

relatively easy to transform and successful expression can be assessed quickly. However, in

industry more focus has been placed on plant species, such as cereals, that offer long-term

stability of the expressed protein, are cost effective, rapidly produce large volumes of the desired

product, and can be easily processed into a deliverable form for oral vaccination (especially

against diseases that are not lethal but diminish animal welfare and growth rate)

(STREATFIELD and HOWARD 2003; STREATFIELD 2007; RYBICKI 2009)

Vaccine antigens have been expressed in fresh tissues such as mature leaves (MASON et al.

1992), fruits (MCGARVEY et al. 1995), tubers (HAQ et al. 1995), and taproots (BOUCHE et al.

2003), and in dry tissues, including mature seeds (STREATFIELD et al. 2001). Harvested fresh

plant tissues usually need processing to preserve the antigen in a stable form, while mature seeds

are desiccated and allow long-term storage at ambient temperatures. However, fruits, tubers, and

taproots can be stored for a limited time, especially in a chilled environment. Vaccine antigens

have also been expressed in undifferentiated plant cell cultures such as cell suspensions (SMITH

et al. 2002) and callus cultures (KAPUSTA et al. 1999), although these systems are not

competitive in the bulk scale production needed for oral vaccine applications.

Four different methods are now generally used for the production of recombinant proteins

(HORN et al. 2004): Generation of stable nuclear transgenic plants, transplastomic plants,

transient expression using a plant virus and transient expression via Agrobacterium infiltration.

Animal enteric diseases are a particularly attractive target for edible plant-produced vaccines.

Optimal protective mucosal immune response will be achieved when the vaccine is administered

by the same route as the infection enters the body (DOUGAN 1994). Oral delivery offers ease of

application and, by the induction of mucosal immunity, protection against pathogens interacting

Literature review

22

with host mucosal surfaces (STREATFIELD 2005). In contrast, the immunisation of animals via

injection lead to a systemic immune response.

Sufficient expression levels are essential for economic viability of recombinant protein

production to allow for oral delivery of the required antigen dose. Currently, the expression

levels for most pharamaceutical proteins in the transgenic plants are less than that needed for

commercial demands. Growing sufficient quantities of transgenic plants to meet large-scale

production needs often requires outdoor field growth, raising regulatory concerns over

containment (GOLDSTEIN and THOMAS 2004).

Purification is the most obvious next step for proteins expressed in a plant tissue culture

fermentation system or in plants grown under hydroponics, where the protein is secreted from

the roots. Proteins have been purified from plants and are already being produced on a large-

scale for sale in fine chemical markets, most notably with the first large-scale commercial

product, trypsin produced in corn (WOODARD et al. 2003). The protein purification approach is

possible for candidate vaccine antigens expressed in recombinant plants, in which case a purified

antigen could be delivered by any chosen means, including injection. However, this approach is

likely to be prohibitively expensive for animal vaccines, and to properly realise the economic

potential of plant-based vaccines it is necessary to pursue an oral delivery option based on a

native or processed form of the plant material.

Application of plant-based vaccines for animal diseases

Viral diseases: ZHOU et al. (2003) successfully developed an edible potato-based vaccine

against Infectious bronchitis virus (IBV) and the orally immunized chickens developed a virus-

specific antibody response and were protected against IBV. (WU et al. 2004) succeeded in

vaccinating chickens orally with arabidobsis crude extracts against Infectious bursal disease

virus (IBDV) and the chickens were protected in a manner similar to their counterparts, who had

received a commercial injectable vaccine. Immune responses were elicited in laboratory animals

after oral vaccination by transgenic plants (lettuce and alfalfa) expressing the E2 glycoprotein of

Classical Swine Fever Virus (CSFV) or cysteine protease from Fasciola hepatica (LEGOCKI et

al. 2005).

Complete antigenic proteins, as well as peptides representing major antigenic determinants, have

been produced in plant systems. In the case of vaccination against viruses, proteins located at the

virion surface are generally the most suitable targets for an efficient immune response.

Numerous veterinary vaccines, mainly against virus infections, have been expressed in plants.

Literature review

23

Examples are Foot-and-Mouth-Disease (SANTOS et al. 2005), Rinderpest Virus

(KHANDELWAL et al. 2003a; KHANDELWAL et al. 2003b), and Rotavirus (SALDANA et al.

2006).

Recently, achievements in the development of a plant-produced vaccine against avian Newcastle

disease virus have been reported. Cucumber mosaic virus was utilized as a platform to display

epitopes from virus surface glycoproteins. Chimeric virus particles were assembled in tobacco

leaves, but their immunogenicity was not determined (ZHAO and HAMMOND 2005).

(BERINSTEIN et al. 2005) chose another approach, using transgenic potato plants to express the

same surface antigens in full length. Mice fed with the potato leaves or injected with leaf extracts

showed virus-specific antibody responses.

Parasitic diseases: A recombinant tobacco mosaic virus (TMV) with its capsid protein fused to

a malarial peptide. Tobacco plants systemically infected contained high titers of genetically

stable recombinant virus, enabling purification of the chimeric particles in high yield enough for

production of subunit vaccines (TURPEN et al. 1995). Plant-based recombinant chicken sIgA

was expressed in Tobacco (N. benthamiana) leaves and induced immune protection against

coccidiosis (WIELAND et al. 2006).

(CLEMENTE et al. 2005) used two constructs of Toxoplasma gondii Surface antigen 1 based in

a potato virus X (PVX) amplicon were expressed in Agrobacterium-mediated transient

Nicotiniana tabacum and found to be protective and immunogenic by subcutaneous delivery to

mice. T. gondii multiple antigenic gene (Tg-MAG) recombinant protein with good immune

activity was expressed successfully in transgenic tomato fruits (ZHOU et al. 2008).

Bacterial diseases: bacterial infectors have also been chosen as targets for recombinant

vaccines, e.g. B. anthracis (AZIZ et al. 2002; WATSON et al. 2004; AZIZ et al. 2005), E. coli

(KANG et al. 2003; LEE et al. 2004), or M. tuberculosis (JOENSUU et al. 2004; ZELADA et al.

2006).

(For more examples see (STREATFIELD and HOWARD 2003; STREATFIELD 2005;

STREATFIELD 2007; FLOSS et al. 2007; METT et al. 2008; RYBICKI 2009).

2.13 Production of recombinant antibodies against Eimeria spp. using different

expression systems, including transgenic plants

Many researcher over the last years have attempted to develop a subunit coccidiosis vaccine

using recombinant antigens expressed from DNA of various developmental stages (sporozoites,

Literature review

24

merozoites, gametes) of Eimeria spp. (JENKINS 1998; VERMEULEN 1998). These DNA

sequences have been expressed in a variety of prokaryotic and eukaryotic vectors, but

immunization has only elicited partial protection against oocyst challenge (JENKINS 1998;

VERMEULEN 1998). The reason for failure to stimulate protective immunity is unknown, but is

probably related to either the use of a “non-protective” antigen or to inappropriate delivery of the

vaccine to the mucosal immune system. Studies of resistance elicited by infection with virulent,

irradiated, or drug-arrested Eimeria spp. suggests that sporozoite-infected cells are necessary for

the development of protective immunity (JENKINS et al. 1991a; JENKINS et al. 1991b;

JENKINS et al. 1993a; JENKINS et al. 1993b). There is also evidence for merogonic stages

inducing and being targeted by protective immunity (ROSE and HESKETH 1979; MCDONALD

et al. 1988).

Recombinant antigens of avian coccidia have been derived generally from cDNA arising from

mRNA of extracellular stages of the parasite (sporozoites, merozoites). It is likely that CD4+ and

CD8+T cell responses during primary and secondary infections are directed against antigens

expressed by parasite-infected cells. Thus, intracellular processing would be required for the

presentation of recombinant antigen to the avian immune system. Supporting this idea is a recent

finding that recombinant E. tenella sporozoite antigen was protective only if administered to

chickens by direct DNA vaccination (KOPKO et al. 2000). Delivery of recombinant Eimeria

antigens using Salmonella, fowl pox virus (FPV), or herpes virus of turkeys (HVT) expressing

Eimeria DNA sequences may be a viable approach to protect chickens against coccidiosis

(VERMEULEN 1998). These vectors have been shown to elicit CD4+ and CD8+ T cell

responses in infected cells (RAMSAY et al. 1999). Recombinant chicken secretory IgA has been

proposed as a potential means for passive immunisation against coccidiosis. IgA, assumed to

have a role in the protection of mucosal surfaces (see above; Antibody responses to Eimeria

spp.), was expressed in Tobacco (N. benthamiana) leaves and induced immune protection

against coccidiosis (WIELAND et al. 2006).

Animals, materials and methods

25

3 Animals, material and methods

3.1 Animals

One day old unsexed CobbTM chicken (CobbTM, Germany) were kept under pathogen free

conditions. The poultry house was disinfected with 4% Neopredisan® 135-1 (25% chlorocresole,

Menno Chemie, Norderstedt, Germany) for 2 h (as listed in guidelines of DVG, the German

Veterinary Society).

The chicken were bred in groups (each group representing 10 chicken) in batteries with free

access to food and water under coccidia free conditions. The faeces of the chicken were

examined on the day of infection to exclude accidental coccidia infection. During the single

oocyst infection trials the individual chicken were completely separated from each other. Over

the whole study period, faecal samples were collected in separated plastic bags to be tested

individually.

3.2 Parasite

For the infection trials Eimeria tenella (isolate LE-01 Eten-05/1), Eimeria brunetti (isolate LE-

04 Ebru-06/1), Eimeria acervulina (isolate LE-02 Eacer-05/1) and Eimeria maxima (isolate LE-

03 Emax-05/1) were used. The chicken were infected orally at an age of 2-3 weeks with a dose

of 1,500 – 2,000 oocysts / chicken.

3.2.1 Single oocyst infection

Instruments

Glass slides (Heiland, Hamburg, Germany)

Microscope (CX31, Olympus Optical, Hamburg, Germany)

Glass diamond pen

Autoclave (Varioklav 25 T, H+P Labortechnik, Oberschleißheim, Germany)

Single use wood spatula, plastic pails and plastic sieves

Material

Gelatin capsules (size 2, G29202, Plano GmbH, Wetzlar, Germany)

Cooking gelatin

Animals, materials and methods

26

Two methods were used for single oocyst infection:

Method 1: The glass slides were divided into very small cubics (circa 1 x 1 mm2) by using a

glass diamond pen. The cubics were marked with different letters and numbers. A first layer of

prewarmed liquid 5% gelatin was spread over the divided slide and kept 10 min at 4°C to

solidify. A mixture of 0.5 ml prewarmed liquid 5% gelatin and 0.5 ml oocyst suspension (100

oocyst / ml) was spread over the first layer and kept at 4°C for 10 min. The slide was examined

microscopically and separated single sporulated oocysts were cut from the slide. Single oocysts

were placed into a gel capsule and introduced into the esophagus followed by some drops of

water.

Method 2: one ml of oocyst suspension containing 100 oocysts was diluted into 10 ml water.

Every chicken was inoculated orally with a volume of 100 µl which assumingly contained one

oocyst. The chicken were bred individually to avoid cross contamination between the different

isolates.

The fecal samples were collected separately and examined individually using single use

equipments or cleaned, disinfected and autoclaved materials. The oocysts were recovered from

the fecal samples by precipitation and floatation (see 3.2.2.).

3.2.2 Recovery of oocysts

Instruments

Cascade sieves with different pore size from the top to downward (300 µm, 200

µm, 100 µm, 65 µm and 36 µm; Analysette 3, Fritsch, Idar-Oberstein, Germany)

Electric pipetting aid ( Pipetus-akku, Hirschman Laboratory equipments,

Eberstadt, Germany)

Centrifuge (Rotina 46, Hettich GmbH, Tuttlingen, Germany)

Microscope (CX31, Olympus Optical, Hamburg, Germany)

Shaking plate (Rocky RT-N/G/2, LFT-Labortechnik, Wasserburg, Germany)

Hand-hold blender (MR 305, Braun, Kornberg, Germany)

Materials

Sodium chloride, saturated solution with a specific gravity of 1.200

Potassium dichromate 4%

Animals, materials and methods

27

The fecal samples were collected after the prepatency for each Eimeria species. The samples

were daily collected in one 5-liter pail and homogenized thoroughly with a hand-hold blender,

then filtered using a system of cascade sieves. The usage of cascade sieves helped to concentrate

and partially purify the oocyst suspension. The suspension was centrifuged at 700x g for 10 min.

The sediment was resuspended with saturated salt solution and centrifuged at 700 x g for 10 min.

The resulting supernatant was examined microscopically. The oocysts were sucked off with an

electric pipette, washed into water and centrifuged at 700 x g for 10 min. The collected oocysts

were kept in potassium dichromate 4% on a shaking plate (27 – 30 rpm) to sporulate within

about 3 days.

3.2.3 Preparation and purification of sporozoites and merozoites

3.2.3.1 Excystation of sporozoites

Instruments

Neubauer counting chamber (Roth, Karlsruhe, Germany)

Phase contrast microscope (DM IRB, Leica, Bensheim, Germany)

Vortex (Vortex-Genie 2, Scientific industries, USA)

Water bath (W270, Memmert, Schwabach, Germany)

Centrifuge (Megafuge 2.0 R, Haereus, Hanau, Germany)

Materials

Glass beads 0.5 mm (catalog # 11079105, Biospec Products, Bartlesville, OK,

USA)

Excystation medium: 1x Hanks Balanced Salt Solution (HBSS) (Biochrom),

0.25% Trypsin (Roth, Karlsruhe, Germany), 2% sodium taurocholate (T-4009,

Sigma, Taufkirchen, Germany). pH adjusted to 7.4 by using 7.5% sodium

carbonate (NaHCO3-AppliChem)

Sodium hypochlorite 12% free chlorine (Roth, Germany)

Distilled water

Plastic test tubes (12 ml, 50 ml; Techno plastic products (TPP), Trasadingen,

Switzerland)

Animals, materials and methods

28

Diagnostic slides (epoxy-coated divided into 12 wells, 5 mm diameter,

X1XER302W#MNZ, Diagnostika, MANZEL GLAESER, Braunschweig,

Germany)

1x phosphate buffered solution (PBS, pH 7.6): Na2HPO4 13.48 g/l, NaH2PO4 0.78

g/l, NaCl 4.25 g/l

The sporulated Eimeria spp. oocysts were washed three times with distilled water to remove

potassium dichromate and centrifuged at 700 x g for 10 min. The oocyst pellet was incubated

with sodium hypochlorite solution (4% active chlorine) on ice for 15 min. The oocyst suspension

was centrifuged at 300 x g for 3 min. The supernatant was taken and the sediment which mainly

consists of faecal debris was discarded. The oocyst suspension was washed with 50 ml PBS 3-5

times to remove the chlorine by centrifugation at 1500 x g for 5 min.

The oocysts were cracked with glass beads upon the vortex for 30-120 seconds according to the

species. Cracking of oocysts was noticed microscopically every 10 seconds until all oocysts were

destroyed and the sporocysts were free. If the sporozoites were seen, the cracking was stopped.

The mixture of oocysts, sporocysts and sporozoites was transferred into another tube and

centrifuged at 1500 x g for 5 min.

The pellet was washed twice with PBS, then added to the excystation medium and incubated in a

water bath at 41°C for 90-120 min. Excystation was controlled microscopically every 15 min.

The excysted sporozoites were counted under the phase contrast microscope using Neubauer

chambers. The sporozoites were either frozen at -196°C until use or transferred onto 12 well

diagnostic slides with approximately 104 sporozoites per well. The slides were left to dry at room

temperature, then kept at -80°C until used for indirect immunofluorescence.

3.2.3.2 Recovery of merozoites

Materials

Incubation medium: 1x HBSS with 10 mM MgCl2 (Roth, Karlsruhe, Germany),

0.25% Trypsin (Roth, Karlsruhe, Germany) and 1% Na taurocholate (T-4009,

Sigma, Taufkirchen, Germany). This solution was sterilized by filtration

1x phosphate buffered saline (PBS, ph 7.6): Na2HPO4 13.48 g/l, NaH2PO4 0.78

g/l, NaCl 4.25 g/l

Instruments

Animals, materials and methods

29

Heatable magnetic stirrer (MR3001 K, Heidolph instruments, Schabach,

Germany)

Ten chicken at age of 2 weeks were infected per os with 2 x 105 sporulated oocysts from each

species as shown in table 1.2.

Table1.2: Infection conditions to produce merozoites

Eimeria spp. hours post infection dose of infection

E. acervulina 80 h 200 x 10 3

E. tenella 112 h 200 x 10 3

E. maxima 110-120 h 50 x 10 3

E. brunetti 110-120 h 200 x 10 3

After the prepatent period, the infected birds were humanely killed by exposure to chloroform

inhalation in a closed box for 5-10 min. The upper part of the small intestine from the gizzard to

the yolk sac diverticulum (E. acervulina), caeca (E. tenella), the middle part of the small

intestine (E. maxima) or the lower part of the small intestine, rectum and caeca (E. brunetti) was

removed separately.

The samples were cut into small pieces and stirred separatly in the incubation medium for 30

min at 41°C at 250 rpm. The mixture was filtered through gauze to remove large particles. The

filtrate was centrifuged at 700 x g for 5 min and then resuspended in PBS.

The merozoites pellet was passed through an equal volume of DE-52 and purified (see 3.2.3.3).

3.2.3.3 Purification of sporozoites and merozoites by DE-52 anion exchange

chromatography

Instruments

pH meter

Microfuge (Micro 20, Hettich GmbH, Tuttlingen, Germany)

Refrigerator with freezer (+4/-20, Liebherr, Germany)

Animals, materials and methods

30

Materials

Glass wool superfine (No. 1408/2, Assistant, Germany)

Nylon wool fiber (Polysciences, Inc., Warrington, England)

10 ml medical syringe

DE-52 (Diethylaminoethyl Cellulose, Pre-Swollen Microgranular Anion

Exchanger, Whatman International Ltd, Maidstone, England)

1x PBS (pH 7.6) Na2HPO4 13.48 g/l, NaH2PO4 0.78 g/l, NaCl 4.25 g/l

Elution buffer (pH 7.6): 1x PBS supplemented with 1% glucose

Glas beaker (50 ml and 100 ml)

DE-52 Equilibrium buffer: (1x PBS - 1% Glucose)

Single use syringe (10 ml, B. Braun, Melsungen, Germany)

1.5 ml microfuge tube (Roth, Karlsruhe, Germany)

In a 100 ml beaker, 5g of DE-52 were mixed well with 50 ml of 1x PBS (pH 7.6) and allowed to

settle for 1 h. The supernatant was poured off and more 1x PBS (pH 7.6) was added. This

washing step was repeated 2-3 times.

The DE-52 was resuspended in 1x PBS (pH 8) and kept overnight at 4°C. At the next day the

supernatant was discarded leaving some fluid to avoid dryness of the DE-52.

The DE-52-column was prepared by putting a small amount of glass wool into the nozzle of a 10

ml syringe barrel. Nylon wool was added to a height of 3 cm. Few drops of buffer were used to

wet the glass and nylon wool, then DE-52 was added to a height of 3 cm above the nylon wool.

The DE-52 column was washed once with the elution buffer before use (dryness of the DE-52

must be avoided). The suspension of zoites (sporozoites or merozoites) was added directly on the

column and purified by elution buffer.

The zoites were collected in 1.5 microfuge tubes and washed twice with 1x PBS (pH 7.6). The

zoites were centrifuged at 7,000 x g for 5 min and the pellet was resuspended in 1 ml PBS before

counting in a Neubauer slide. They were used directly or kept at -196°C until use.

3.2.3.4 Purification of sporozoites by PercollTM gradient

Instruments

Animals, materials and methods

31

Microfuge (Micro 20, Hettich GmbH, Tuttlingen, Germany)

Materials

1x PBS (pH 7.6): Na2HPO4 13.48 g/l, NaH2PO4 0.78 g/l, NaCl 4.25 g/l

10x Hanks balanced salt solution (HBSS) (Biochrom)

PercollTM (sterile) at a density of 1.13 g/ml (Pharmacia Fine-Chemicals, Uppsala,

Sweden)

PercollTM (density, 1.13 g/ml) was diluted to an osmolality of 340 mOsmol/kg H2O by adding 9

parts (vol/vol) of 10x HBSS or 10x PBS. Further dilutions of the PercollTM solution were made

with 1x HBSS or 1x PBS.

The excysted sporozoites (in a suspension of oocysts, sporocysts and other debris; see 3.2.3.1.)

were washed twice in 1x PBS and pelleted at 7,000 x g for 5 min. The pellet was resuspended in

60% PercollTM and centrifuged for 1 min at 10,000 x g. The sporozoites were pelleted in the

bottom while the sporocysts and other debris were mainly located in the most upper layer. The

sporozoites were collected carefully from the bottom and washed 2-3 times with PBS. The

collected sporozoites were counted and used directly or kept at -196°C until use.

3.3 DNA preparation

Instruments

Ultrasound sonicator (Bandelin Sonopuls GM 70, Bandelin electronics, 12207

Berlin)

Stop watch (Roth, Karlsruhe, Germany)

Vortex (Vortex-Genie 2, Scientific industries, USA)

Microfuge (Micro 20, Hettich GmbH, Tuttlingen, Germany)

Refrigerator -20°C (Liebherr, Germany)

Thermomixer (Modell 5436, Eppendorf, Hamburg, Germany)

Spectrophotometer (Eppendorf BioPhotometer, Eppendorf AG, Hamburg,

Germany)

Materials

Sodium hypochlorite 12% free chlorine (Roth, Karlsruhe, Germany)

Animals, materials and methods

32

Absolute ethanol (Roth, Karlsruhe, Germany)

Proteinase K 20 mg/ml (Roth, Karlsruhe, Germany)

QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany)

The sporulated Eimeria spp. oocysts were washed three times with distilled water to remove

potassium dichromate by centrifugation at 700 x g for 10 min. The oocyst pellet underwent

surface sterilization (see 3.2.3.1).

The oocyst pellet was mixed with 200 ATL buffer (QIAamp® DNA mini Kit) into a 1.5 ml

microfuge tube and cracked with ultrasound sonicator at 50% power for 9 min. The DNA was

extracted with QIAmp® DNA mini Kit as described in the manufacturer’s instructions. The

concentration of the extracted DNA was measured at 260 nm using a spectrophotometer. The

extracted DNA was used directly or kept at -20°C until use.

3.4 PCR

Instruments

Thermocycler (iCycler®, Bio-Rad, München, Germany)

Microcentrifuge (SD 220 VAC, Roth, Karlsruhe, Germany)

Pipettes (10 µl, 100 µl, 1000 µl, PreCision® , Biozym Diagnostics, Hess. Olden-

dorf, Germany)

Materials

Magnesium chloride (MgCl2) solution (25 mM, Promega, USA)

Deoxyribonucleotide (100 mM dATP, 100 mM dTTP, 100 mM dCTP and 100

mM, Peqlab, Erlangen, Germany)

PCR buffer (10x Promega, USA)

Taq polymerase (5 U/µl, Promega, USA)

Oligonucleotide primers (MWG-Biotech, Ebersberg, Germany)

DEPC water for molecular biology (Roth, Karlsruhe, Germany)

PCR tubes (100 µl, 200 µl, Roth, Karlsruhe, Germany)

Pipette tips (10 µl, 100 µl, 1000 µl, Roth, Karlsruhe, Germany)

Animals, materials and methods

33

The PCR protocol to detect different chicken Eimeria spp. has been published by SCHNITZLER

et al. (1998 and 1999) and SU et al. (2003) previously. The PCR reactions were prepared in a

final volume of 25 µl consisting of 1x PCR buffer, 2 mM MgCl2, 200 µM of each

deoxyribonucleotide, 300 nM of each oligonucleotide primers (see table 3.4.), one unit of Taq

polymerase and 30-50 ng DNA template.

The reaction cycles consisted of an initial denaturation step at 95°C for 3 min followed by 35

cycles at 94°C for 45 seconds, annealing at a temperature of 61°C for 40 seconds (this

temperature was used for all primers listed in table 3.4) and 72°C for 60 seconds, and a final

extension cycle at 72°C for 10 min.

3.4.1 Visualization of PCR products

Instruments

Electrophoresis chamber, gel form and comb (Biometra, Göttingen, Germany)

Electrophoresis power supply (Powerpack P25, Biometra, Göttingen, Germany)

Transilluminator with UV light of wavelength 254 nm (TFX-20M, Vilber

Lourmat, France) connected to a PC-digital camera (CSE-0028, Cybertech,

Berlin, Germany) and computer

Rock plate (Rocky RT-N/G/2, LFT-Labortechnik, Wasserburg, Germany)

Balance (BP310 P, Sartorius AG, Göttingen, Germany)

Microwave ofen (MW712, CTC Clatronic, Kempen, Germany)

Materials

10x TBE buffer (1 liter: 108 g Tris base, 55 g Boric acid and 40 ml 0.5M EDTA),

pH 8.0, autoclaved for 20 min

Destilled water

Deionized water

Ethidium bromide stock solution 10 mg/ml (Sigma, Taufkirchen, Germany) 2 µl

dissolved into 100 ml distilled water in a plastic container (0.2 µg/ml)

Gel loading buffer: 2 ml glycerol, 4.4 ml TE buffer and 0.6 ml 1% (w/v)

Bromophenol blue

Animals, materials and methods

34

(1x TE buffer: 10mM Tris-HCl pH 7.4 and 1mM EDTA pH 8.0)

Agarose (preqGold Universal Agarose, Peqlab, Erlangen, Germany)

Parafilm (American National Can, Menashs, Wisconsin, USA)

Erlenmeyer bottles (100 ml, 500 ml)

Graduated glass cylinders (50 ml, 100 ml, 500 ml)

Method

10 µl of PCR product were loaded onto 1.5 % agarose gel in 1x TBE buffer and separated by

electrophoresis at 110-130 volts for 60-80 min. The gel was transferred to be stained in an

aqueous ethidium bromide solution (0.5 µg/ml) for 15 min. The gel was shortly rinsed in

deionized water to remove ethidium bromide.

The gel was placed on the transilluminator (UV wavelength 254 nm) and DNA bands were

visualized under UV light and photographed by digital camera. The pictures were captured and

saved to the connected computer.

Animals, materials and methods

35

Table 3.4: List of PCR primers used in the current study

Sequence (5’-3’)

leng

th (b

ases)

Ta* (°C

)

Location in genome P

rod

uct len

gth

(bp)

Reference

BSEF CTGTGAATTCATCGGA 16

BSER ATCGCATTTCGCTGCGTCCT 20 61

ITS-1/ssrRNA-Gene of chicken-Eimeria

(SU et al. 2003)

TEN1 CGCTGCTGGTTTTACAGGTT 20

TEN2 GCTGAAGCAAAGTTCCAAGC 20 61

ITS-1/ssrRNA-Gene E.tenella

463 (SU et al. 2003)

ACER1 CTGCGAGGGAACGCTTAAT 19

ACER2 AACGAACGCAATAACACACG 20 61

ITS-1/ssrRNA-Gene of E.acervulina

303 (SU et al. 2003)

BRUN1 AGCTTGGATTTTCGCTCAGA 20

BRUN2 CTTCCGTACGTCGGATTTGT 20 61

ITS-1/ssrRNA-Gene of E. brunetti

395 (SU et al. 2003)

MAX1 TTGTGGGGCATATTGTTGTG 20

MAX2 CAATGAGGCACCACATGTCT 20 61

ITS-1/ssrRNA-Gene of E.maxima

151 (SU et al. 2003)

NEC1 GTCACGTTTTTGCCTGGGTG 20

NEC2 ACAGACCGCTACACAACACG 20 61

ITS-1/ssrRNA-Gene of E.necatrix

385 (SU et al. 2003)

EAceF GGCTTGGATGATGTTTGCTG 20

EAceR CGAACGCAATAACACACGCT 20 61 ITS-1 of E. acervulina 321 (SCHNITZLER

et al. 1998; 1999)

EBruF GATCAGTTTGAGCAAACCTTCG 22

EBruR TGGTCTTCCGTACGTCGGAT 20 61 ITS-1 of E. brunetti 311 (SCHNITZLER

et al. 1998; 1999)

ENecF TACATCCCAATCTTTGAATCG 21

ENecR GGCATACTAGCTTCGAGCAAC 21 61 ITS-1 of E. necatrix 384 (SCHNITZLER

et al. 1998; 1999)

ETenF AATTTAGTCCATCGCAACCCT 21

ETenR CGAGCGCTCTGCATACGACA 20 61 ITS-1 of E. tenella 278 (SCHNITZLER

et al. 1998; 1999)

EMaxF GTGGGACTGTGGTGATGGGG 20

EMaxR ACCAGCATGCGCTCACAACCC 21 61 ITS-1 of E. maxima 205 (SCHNITZLER

et al. 1998; 1999)

EMitF TATTTCCTGTCGTCGTCTCGC 21

EMitR GTATGCAAGAGAGAATCGGGA 21 61 ITS-1 of E. mitis 327 (SCHNITZLER

et al. 1998; 1999)

EPreF CATCATCGGAATGGCTTTTTGA 22

EPreR AATAAATAGCGCAAAATTAAGCA 23 61 ITS-1 of E. praecox 391 (SCHNITZLER

et al. 1998; 1999)

Eb_18s_S1 CCCATGCATGTCTAAGTATAAGC 23

AP1_SSU

_rDNA_A CACTGCCACGGTAGTCCAATAC 22

56 RNA 18s of Coccidia specieses

300 (DYACHENKO 2006)

*Ta is the annealing temperature.

Animals, materials and methods

36

3.5 Indirect Immunofluorescence test (IFAT )

Sporozoites and merozoites were used as antigen and were prepared as explained before (3.2.3)

Instruments

Phase contrast microscope (DM IRB, Leica, Bensheim, Germany)

Air dryer (Memmert, Schwabach, Germany)

-20°C refrigerator (Liebherr, Germany)

Materials

Diagnostic slides (epoxy-coated divided into 12 wells, 5 mm diameter,

X1XER302W#MNZ, Diagnostika, MANZEL GLAESER, Braunschweig,

Germany)

Thick cover glass 24 x 60 mm (Roth, Karlsruhe, Germany)

Absolute methanol (Roth, Karlsruhe, Germany)

1x PBS (pH 7.6) Na2HPO4 13.48 g/l, NaH2PO4 0.78 g/l, NaCl 4.25 g/l

DAPI 300nM; the stock solution is dissolved in absolute methanol at a

concentration of 2 mg/ml (2 µg/µl)

Blocking buffer I: used for blocking of free-aldehyde groups consisting of 100

mM glycin dissolved in 1x PBS (i.e., 0.7507 g in 100 ml PBS)

Blocking buffer II: to block the non specific binding sites on the antigen

consisting of 2% (w/v) bovine serum albumin (BSA, Roth, Karlsruhe, Germany)

in PBS

Antibody-incubation buffer: 1% BSA (w/v) in 1x PBS; antibody is added

according to the desired concentration (1:10 or 1:100). 0.2% Evans Blue is added

with the secondary antibodies

4% buffered formaldehyde solution (w/v) as fixative (must be prewarmed to 50-

60°C before use; fixation at room temperature)

Methanol 100% as fixative, kept at -20°C before and during fixation

Mounting medium: 100 mg p-Phenylendiamin, 10 ml 1x PBS and 90 ml glycerol,

pH 8.0; this medium is kept in the dark at -20°C

Animals, materials and methods

37

Primary antibodies

Antibody fragments purified from transgenic pea plant and antibodies containing

periplasmatic extracts of E. coli were kindly supplied by Novoplant (Novoplant

GmbH, Am Schwabeplan 1b, 06466 Gatersleben, Germany), which are Ab1, Ab2,

Ab3, Ab4, Ab5, Ab6, Ab7, Ab8 and Ab9.

Rabbit anti-Eimeria bovis-calmodulin domain protein kinase-antiserum was used

as positive control which was kindly provided by Dr. V. Dyachenko (Institute of

Parasitology, University of Leipzig, Germany)

Secondary antibodies

Fluorescein (FITC)-conjugated goat anti-rabbit immunoglobulin, IgG (H+L)

(code 111-0950003, Dianova, Jakson Immunoresearch laboratories)

Un-conjugated monoclonal mouse anti-poly-histidin IgG clone His-1 (Sigma

Aldrich, St. Louis, Mo, USA)

Fluorescein (FITC) -conjugated goat-anti-mouse IgG, (Fcg-fragment specific,

115-095-008, Dianova, Jakson Immunoresearch Laboratories)

Method

The slides with dried antigen were separated into two groups. The slides of the first group were

fixed in 4 % buffered formaldehyde for 15 min at room temprature (RT). The second group of

slides were fixed with pre-cold methanol at -20°C for 10-15 min, then were left 10 min to dry

under air flow.

Waxy or greasy pen was used to separate the antigenic spots or wells to avoid cross

contamination.

20 µl of blocking buffer I were added onto each antigen spot of formaldehyde-fixed slides. The

slides were incubated in moistened Petri dishes at RT for 10 min. Then the slides were rinsed 3

times in PBS and once in destilled water to remove the excess of PBS. The slides were left to dry

for 10 min.

Formaldehyde- and methanol-fixed slides were incubated in blocking buffer II (in a Petri dish

with moistened tissue to avoid dryness) for 30 min at RT. Then the slides were rinsed 3 times in

PBS and once in destilled water to remove the excess of PBS and left to dry for 10 min.

Animals, materials and methods

38

The primary antibodies were dropped (diluted 1:10, 1:50, 1:100 1:500 in incubation buffer) onto

each antigen spot of the slide and incubated 60 min at RT. Then the slides were rinsed in 1x PBS

for 10 min three times and once in destilled water and left to dry.

Anti-poly-histidin IgG (diluted 1:100 in incubation buffer) was added followed by incubation for

60 min at RT. Then the slides were rinsed in 1x PBS for 10 min three times and once in destilled

water and left to dry.

Conjugated antibody (FITC-conjugated goat-anti-mouse IgG) was dropped at a dilution of 1:100

in incubation buffer containing 0.02% Evan’s blue as a counter stain. The slides were incubated

with the conjugated antibodies for 60 min at RT.

Then the slides were rinsed in 1x PBS for 10 min three times and once in destilled water and left

to dry, but not completely.

All spots were covered with 20 µl of DAPI solution (300 nM) for 3 min in a dark place at RT.

The slides were washed twice 5 min with PBS and finally were washed with destilled water.

Mounting medium (about 5 µl) was added to each spot. The slides were covered by a large thick

cover glass avoiding entrance of air bubbles and sealed with nail paint. The slides were

examined immediately or kept in a refrigerator at 4°C until examination.

The control reactions were made as described above using following antibodies:-

1st negative control: monoclonal antibody anti-poly-histidin and FITC-conjugated goat-anti-

mouse IgG.

2nd negative control: only FITC-conjugated goat-anti-mouse IgG (without antibody fragments

or anti-poly-histidin IgG).

Positive control: rabbit anti-CDPK IgG and FITC-conjugated goat anti-rabbit IgG.

3.5.1 Acquiring and processing of images

Instruments

inverted microscope (Leica DM IRB, Wetzlar GmbH, Bensheim, Germany). This

microscope is equipped with a cooled camera head (DS-5Mc, Nikon, Japan) and

liquid crystal display (Nikon DS-L1, Nikon, Japan) and is controlled by software

that displays current settings and view. Also this microscope has a phase contrast

facility and three different fluorescence filters (green, blue and red)

Animals, materials and methods

39

Software

software package CorelDRAW® Graphics Suite 12

Images were captured using the inverted microscope and digital camera. Pictures of each view

were acquired using following filters: the red filter to visualize refractile bodies of sporozoites

stained with Evan´s blue, the green filter to visualize antibody binding reaction and the blue filter

to visualize DNA containing nuclei. The phase contrast view was used to visualize the whole

parasitic cell. Pictures aquired with different modes were compared and taken under identical

adjustments in respect of exposure time and magnification. The pictures were further processed

using the computer software package CorelDRAW® Graphics Suite 12. In brief, overlays were

created by addition of fluorescence pictures obtained with different filters. The blue fluorescence

picture was considered as the background with applying a merge mode of ‘’Normal’’ while the

pictures of green and red fluorescence were added on the background with a merge mode of

‘’Logical Or’’ to keep them transparent. Then all pictures were combined to get finally one

photo showing green, red and blue fluorescence and this was compared with the phase contrast

view later to localize the regions of interest.

3.6 Flow cytometry (FC)

To estimate cells infected with fluorescent labeled sporozoites, flow cytometry was performed.

Fluorescence activated cell sorting (FACS) is the most widely used method for selectively

isolating cells based on their fluorescent markers. This method has already been successfully

applied in a number of studies on invasion inhibition assay for Eimeria species (SCHUBERT et

al. 2005; LABBE et al. 2005; HERMOSILLA et al. 2008)

Flow cytometry is defined as the measurement of the cellular and fluorescent properties of cells

in suspension as they pass by a laser or other light source (SHARROW 1991; HAWLEY and

HAWLEY 2004). The measurements are represented by changes in light scattered, light

absorbed, and light emitted by a cell as it passes by fixed detectors directed off the light source.

From these measurements, specific populations and subsets within them are defined.

Prior to this procedure, the cell cultures were grown (see 3.6.1), infected with CFSE-labelled

sporozoites, incubated for 24 h at 37°C and 5% CO2, trypsinised and washed in PBS. Thereafter

the infected cells were fixed with 2% buffered formaldehyde for 10 min.

As the cells pass through the cytometer, all light signals, whether from fluorescently labelled

cells or from the beam scattered by unlabeled cells, are transferred to a computer and

Animals, materials and methods

40

transformed into digital signals. These signals can then be displayed as histogram graphs or, as

two-dimensional graphs called dot-plots. In these diagrams, one parameter is plotted against

another in an X versus Y axis display (see Results, figure 4.4).

Parasite

purified sporozoites of Eimeria tenella (see 3.2.3).

Instruments

FACScalibur cytometer (Becton-Dickinson Biosciences, Heidelberg, Germany)

equipped with an argon laser. A standard filter setting was used. Laser excitation

wave lengths were 488 nm for the green fluorescence (CFSE). In each sample,

20,000 events were analysed for fluorescent signals using the associated software

Cell Quest ProTM (BD Biosciences, Heidelberg, Germany)

Materials

CFSE; carboxy fluorescein succinimidyl ester (Cell TraceTM CFSE cell

proliferation kit for flow cytometry, Cat# C34554, Invitrogen, Technologiepark

Karlsruhe, Germany)

Accutase™ (CatNo. L11-007, PAA Laboratories, Cölbe, Germany) alternative to

Trypsin/EDTA for the detachment of monolayer cells from surfaces suitable to

reduce clumping in cell suspension used for counting

1x PBS with calcium and magnesium (washing buffer): 100 ml of PBS Ca2+ and

Mg2+ containing 1mM CaCl2 (0.015g) and 0.5 mM MgCl2 (0.010g)

Dulbecco’s modified Eagle’s medium (DMEM), high glucose (4.5 g/l), with 1%

sodium pyruvate and L-glutamine (CatNo. E15-843, PAA Laboratories, Cölbe,

Germany)

Newborn calf serum (NCS, CatNo. B11-001, PAA Laboratories, Cölbe, Germany)

HEPES buffer (CatNo. S11-001, PAA Laboratories, Cölbe, Germany)

Fixation buffer; 10% formaldehyde buffered solution: paraformaldehyde

dissolved in 10x PBS by at 60-70°C during stirring , pH 7.4. The buffer was

stored in a refrigerator as stock solution. It was warmed before use and diluted in

distilled water 1:10 before used for fixation of cells. The fixed cells were stored at

4°C in a refrigerator in the dark until use.

Animals, materials and methods

41

96-well plates with V-bottom (Cat# 9292.1, Carl Roth, Karlsruhe, Germany)

3.6.1 Cell culture and growth conditions

Instruments

Autoclave (Varioklav 25 T, H+P Labortechnik, Oberschleißheim, Germany)

Laminar flow (HERAsafe K 12, Kendro, Hanau, Germany)

CO2 incubator (CB 150, Binder, Tutlingen, Germany)

Inverted phase contrast microscope with fluorescence equipment (DM IRB, Leica,

Bensheim, Germany)

Vortex (Vortex-Genie 2, Scientific Industries, USA)

Water bath (W270, Memmert, Schwabach, Germany)

Centrifuge (Megafuge 2.0 R, Haereus, Hanau, Germany)

Electric pipetting aid (Pipettus-akku, Hirschaman Laborgeraete, Eberstadt,

Germany)

Liquid ring vacuum pump (VacuSafe®, Integra Biosciences, Fernwald, Germany)

Materials

Glass pasteur pipettes (150 mm, unplugged, Roth, Karlsruhe, Germany)

Cell culture bottles 75 cm2 (TPP, Trasadingen, Switzerland)

Cell culture 24-well plates (TPP, Trasadingen, Switzerland)

Graduated glass pipettes (5 ml, 10 ml, 25 ml; Roth, Karlsruhe, Germany)

Centrifuge tubes with clockwise stopper (12 ml, TPP, Trasadingen, Switzerland)

Syring attachable filter (0.2 µm, 0.8 µm; Renner, Darmstadt, Germany)

Cryogenic tubes (Roth, Karlsruhe, Germany)

Wiping tissues (Roth, Karlsruhe, Germany)

Latex gluves (Roth, Karlsruhe, Germany)

Ethanol 70%

Neubauer counting slide (Roth, Karlsruhe, Germany)

Animals, materials and methods

42

Accutase™ (CatNo. L11-007, PAA Laboratories, Cölbe, Germany)

1x PBS (pH 7.6): Na2HPO4 13.48 g/l, NaH2PO4 0.78 g/l, NaCl 4.25 g/l

1x PBS with calcium and magnesium (washing buffer): 100 ml of PBS Ca2+ and

Mg2+ contains 1mM CaCl2 (0.015g) and 0.5 mM MgCl2 (0.010g)

Dulbecco’s modified Eagle’s medium (DMEM), high glucose (4.5 g/l), with 1%

sodium pyruvate and L-glutamine (CatNo. E15-843, PAA Laboratories, Cölbe,

Germany)

Newborn calf serum (NCS, CatNo. B11-001, PAA Laboratories, Cölbe, Germany)

HEPES buffer (N’-2-Hydroxyethylpiperazine-N’-2 ethane sulphonic acid, CatNo.

S11-001, PAA Laboratories, Cölbe, Germany)

Dimethylsulfoxid (DMSO, Roth, Karlsruhe, Germany)

Madin Darby Bovine Kidney cells (MDBK; DSMZ (German Collection of Microorganisms and

Cell Cultures), Braunschweig, Germany) were used for infection assay and infection inhibition

assay.

All used solutions were bought sterile or sterilized by autoclaving or filtration through a cone-

point attachable filter.

The cells were cultured in 24-well cell culture plate at a density of 1.5-2.0 x105 cells/well to

obtain a semi-confluent monolayer within 24 h. They were supplied with DMEM high glucose

medium which was supplemented with 5% NCS, 1% sodium pyruvate and 1% HEPES buffer.

CFSE-labelled sporozoites of E. tenella were added to semi-confluent monolayers of MDBK

cells at a ratio of three sporozoites per cell.

Infected monolayers were incubated at 37°C and 5% CO2. After the infection the cells were

supplied with growth medium containing a reduced concentration of 2% (v/v) NCS to optimize

the cell growth and to enhance the infection. The cells were washed twice 24 h post-infection

(p.i.) using 1x PBS with Ca2+ and Mg2+ followed by supplementation of fresh medium.

3.6.2 Inhibition assay

For invasion - inhibition assay, sporozoites were first irreversibly labelled with CFSE. For this

purpose 1×107 sporozoites were suspended in 2 ml of sterile PBS and 4 µl of a 5 mM solution of

CFSE was added, resulting in a final concentration of 10 µM.

Animals, materials and methods

43

After 10 min of incubation at 37°C, sporozoites were washed twice in DMEM medium or PBS

supplemented with 5% NCS (to stop reaction).

Sporozoites were incubated at 37°C with the different purified antibody fragments (10-20 µg/ml)

for 60 min in 1 ml of growth medium or PBS containing 5% NCS. The sporozoites were rinsed

twice in PBS by centrifugation at 2,000× g for 5 min. Batches of 105 fluorescent sporozoites

were used to infect each 105 MDBK cells in a 24-well plate, infected cultures were susequently

kept at 37°C and 5% CO2.

After 24 h p.i. the infected cells were washed twice with PBS containing Ca2+ and Mg2+.

Monolayers were incubated with 100 µl/well AccutaseTM at 37°C for 10-20 min. The detached

cells of each well were washed twice with 400 µl of culture medium by centrifugation at 7,000 x

g for 5 min in microfuge tubes.

The cells were fixed in 1% buffered formaldehyde and were subsequently washed with 1x PBS.

The fixed cells were kept at 4°C for short time (not exceeding 48 h to avoid changes in size of

the fixed cells) before analysis in the FACScalibur cytometer at 488 nm for CFSE fluorescence.

Usually CFSE labelled samples were measured in channel FL1. For each sample, 20,000 events

were analysed for fluorescent signals using the associated software, Cell Quest ProTM (BD

Biosciences, Heidelberg, Germany) and visualized in a histogram plot (counts over fluorescence)

or a density plot.

All assays were performed in eight replicates and the same conditions were followed.

3.6.3 Serum samples

Infected chicken were bled 8-9 days after infection and the blood was allowed to clot at room

temperature for 2 h. The resulting serum was collected by centrifugation at 3,000 x g for 10 min

and stored at -20°C until required. Sera of non-infected control chicken were used for

comparison with those of infected chicken.

3.6.4 MTT assay (MOSMANN 1983)

Instrument

Microplate reader (Anthos Reader 2001, Anthos microsystems GmbH, Krefeld,

Germany)

Materials

Animals, materials and methods

44

MTT reagent (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide;

Sigma, catalog no. M2128)

acid-isopropanol (0.04 N HCL in isopropanol)

Overnight grown MDBK cells (105 cells/well) were exposed to various antibody fragments and

incubated for 2 h at 37°C and 5% CO2. MTT reagent was added (50 µl/well) and the plates were

further incubated for 1 h. Precipitated formazan crystals were dissolved by adding acid-

isopropanol. The level of absorption was measured using a microplate reader at 600 nm.

Experiments were performed in quadruplicate.

3.7 Antibody neutralization test

Parasite

purified sporozoites of Eimeria tenella (see 3.2.3).

Instruments

Microscope (CX31, Olympus Optical, Hamburg, Germany)

Heatable magnetic stirrer (MR3001 K, Heidolph instruments, Schabach,

Germany)

Hand-hold blender (MR 305, Braun, Kornberg, Germany)

Balance (BP310 P, Sartorius AG, Göttingen, Germany)

Animals and materials

Anti-Eimeria tenella antibody fragments Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7,

Ab8 and Ab9

Syringe fitted with a rinsing cannula (1.5 x 40 mm) curved with a spherical ball

tip (Art.Nr. 07505, Wirtschaftsgenossenschaft deutscher Tieraerzte eG, Garbsen ,

Germany)

Two weeks-old chicken were kept under coccidia free conditions in disinfected

cages

McMaster counting chambers (Omnilab-Laborzentrum, Gehrden, Germany)

Sodium chloride, saturated solution with a specific gravity 1.2

Graduated plastic cylinder (100 ml, Roth, Karlsruhe, Germany)

Animals, materials and methods

45

Small plastic bowl

Wooden spatula

Funnel

Tea strainer

Glass pasteur pipettes (150 mm, unplugged, Roth, Karlsruhe, Germany)

Method

Chicken were divided into 11 groups, 9 in each group, and starved one day before the infection

to avoid repealing movement of the intestine. Nine groups were infected with treated sporozoites

(with 9 different antibody fragments). One group was infected with untreated sporozoites as

positive infected control while one group served as non-infected control.

Sporozoites of Eimeria tenella were purified by PercollTM gradient (see 3.2.3.4). The sporozoites

were incubated 1 h at 41°C with the different antibody fragments, then inoculated intracloacally.

Each chicken was inoculated by a curved canula with 0.25 ml of sporozoites suspension (2 x 104

sporozoites) into the right or left cecum.

After the infection the chicken were given feed and water ad libitum. The oocyst count (oocysts

per gram, OPG) was performed over a period of 5 days starting on the 7th day post-infection.

4 g of faeces were suspended in about 15 ml saturated salt solution. The suspension was passed

through a funnel and tea strainer into a 100 ml plastic graduated cylinder. The volume of the

suspension was increased with saturated salt solution to 60 ml. A magnetic rod was added and

the suspension was mixed with a magnetic stirrer for 2 min at the highest setting.

From the central vortex 1 ml was removed with a pipette and transferred into two chambers of a

McMaster slide, ensuring that no air bubbles form. The slides were left on the side-bench for 2

min to allow floatation of the oocysts. The slides were examined microscopically at a

magnification of x100. The mean number of oocysts counted in the scaled areas of both

champers multiplied by 100 is the oocyst count per gram of faeces.

The results were recorded and interpreted in comparison with a positive control group.

3.8 Statistical analysis

Data analysis was performed using GraphPad prism Software Inc. (GraphPad , 2236 Avenida de

la Playa La Jolla, CA 92037 USA). The ANOVA one-way test was used to test for differences

Animals, materials and methods

46

between the treatments. The data were expressed as mean +/- SEM (Standard error of the mean).

The Bonferroni’s Multiple Comparison Test was used to determine the significance of

differences between the mean values of the treatments. The results were considered significant

when the probability (P) value was less than 0.05 (P < 0.05).

Results

47

4 Results

4.1 Single oocyst infection (SOI)

Regarding Eimeria maxima oocyst shedding was evident only in 4 of 15 chicken infected with a

single oocyst and an average of 9,450 oocysts was excreted per positive chicken. These oocysts

were used to infect 10 chicken with an infection dose of 2,000 oocysts per chicken and finally 5

x106 oocysts / chicken were collected and purified in a period of 5 days.

In case of E. tenella SOI 32,000 oocysts were obtained from one chicken out of 10 chicken at the

7th day post infection. Altogether 106 oocysts / chicken were collected during the next passage.

Following E. acervulina SOI 25,000 oocysts were collected from one out of 10 chicken. Oocyst

excretion was recorded at the 5th day post infection. During the succeeding passage, an average

of 3 x 106 oocysts / chicken was collected.

In case of E. brunetti after SOI the oocyst excretion was recorded only in one out of 15 chicken

and the oocyst output was 8,500 oocysts. During the succeeding passage, shedding was recorded

at the 7th day post infection with an average of 5 x 106 oocysts / chicken (Table 4.1).

Table 4.1: Oocyst shedding after single-oocyst-infection (SOI) and subsequent passage.

Oocyst output/chicken

(in a period of 5 days)

Species

Prepatency (in days)

SOI Passage

E. tenella 6-7 32 x 103 106

E. maxima 6-8 9.5 x 103 5 x 106

E. acervulina 4-6 2.5 x 103 3 x 106

E. brunetti 6-8 8.5 x 103 5 x 106

The obtained oocysts were checked by PCR for homogenicity of the respective Eimeria spp. The

PCR performed on DNA samples from the single oocyst infection suggested the presence of only

one Eimeria spp. in the infected animals, as no amplification of DNA of other Eimeria spp. was

Results

48

observed. The corresponding bands of 303, 395, 151, and 463 bp in case of E. acervulina, E.

brunetti, E. maxima, and E. tenella, respectively, were clearly visible (Figure 4.1).

Figure 4.1: PCR products obtained after amplification of DNA from Eimeria oocysts after SOI.

M: marker with bands from 100 to 3000 base pairs; 1: amplification of DNA from oocysts after

SOI corresponding to E. acervulina (303 bp), E. brunetti (395 bp), E. maxima (151 bp) and E.

tenella (463 bp); 2: positive control; and 3: negative control (amplification from H2O).

However, these pure species became contaminated with other Eimeria spp. during the

subsequent passage. The PCR led to slight amplification of E. acervulina DNA (303 bp),

suggesting the presence of at least few oocysts of E. acervulina after passage of SOI generated

E. tenella, E. brunetti and E. maxima.

4.2 Purification of sporozoites and merozoites of Eimeria spp.

Sporozoites of E. tenella were purified by two PercollTM density gradients. Firstly the sporocysts

were purified after glass-bead grinding and 80% of undamaged sporocysts were recovered. The

second PercollTM gradient purification was used after the excystation of the sporozoites and

resulted in 90% recovery of the sporozoites loaded onto the gradient while only 70% of the

sporozoites loaded onto DE-52 column chromatography were recovered. The sporozoites

Results

49

recovered from PercollTM density gradients and DE-52 column chromatography were 95% pure

with final recovery of about 2-3 sporozoites per oocyst.

The sporozoites of E. acervulina, E. maxima, and E. brunetti were purified by DE-52 column

chromatography and only 70% were recovered from those loaded onto the gradient with a purity

degree of 90%.

The merozoites of Eimeria spp. were purified only by DE-52 column chromatography with a

high degree of purity of 90%. Merozoites were directly fixed on slides for indirect

immunofluorescence or were frozen in liquid nitrogen for later use.

4.3 Indirect fluorescent antibody test (IFAT)

Due to the high degree of conservation of calmodulin-domain protein kinases (CDPK) in

Eimeria spp. the rabbit anti-Eimeria bovis-calmodulin domain protein kinase-antiserum (Anti-

EbCDPK) was used undiluted as positive control. The control antiserum showed strong

fluorescence reaction with methanol fixed and buffered formaldehyde fixed sporozoites and

merozoites of E. tenella, E. maxima, E. acervulina, and E. brunetti. The fluorescence was

observed on the surface of all sporozoites and merozoites (Figure 4.3.1).

Figure 4.3.1: Reaction of Anti-EbCDPK with Eimeria spp. sporozoites (A) and merozoites (B),

the reaction is located on surface of both merozoites and sporozoites. The zoites were fixed with

methanol and buffered formaldehyde (x100 magnification)

Results

50

Antibody binding to parasitic stages was detected using undiluted and 1:10 diluted antibody

fragments but no reaction was observed using 1:100 and 1:1000 diluted antibodies. The

concentration of antibodies was measured by Bradford assay and ranged from 0.3 µg/µl to 5.5

µg/µl (Table 4.3.1).

Results

51

Table 4.3.1: Concentrations of different antibody fragments measured by Bradford technique

Antibody fragments Concentration in ng/µl (µg/ml)

Ab1 4.0

Ab2 5.4

Ab3 5.4

Ab4 0.3

Ab5 5.4

Ab6 5.7

Ab7 1.6

Ab8 5.5

Ab9 4.7

Seven of nine antibody fragments (Ab1, Ab4, Ab5, Ab6, Ab7, Ab8 and Ab9) showed positive

reaction with E. tenella sporozoites (Table 4.3.2 and Figure 4.3.2). Two Ab fragments (Ab4 and

Ab5) showed cross reactivity with sporozoites of E. brunetti, E. acervulina and E. maxima

(Table 4.3.2 and Figure 4.3.3). In contrast, Ab2 and Ab3 showed no binding to any zoites

(sporozoites and merozoites) of Eimeria species.

Table 4.3.2: Cross reactivity of anti-Eimeria tenella-antibody fragments with

sporozoites and merozoites of chicken Eimeria species.

Antibody fragments

Ab1 Ab2 Ab3 Ab4 Ab5 Ab6 Ab7 Ab8 Ab9

sporozoites + - - + + + + + + E. tenella

merozoites - - - - - - - - -

sporozoites - - - + + - - - - E. brunetti

merozoites - - - - - - - - -

sporozoites - - - + + - - - - E. acervulina

merozoites - - - - - - - - -

sporozoites - - - + + - - - - E. maxima

merozoites - - - - - - - - -

Results

52

The localization of specific fluorescence on sporozoites varied between species. No specific

antibody binding could be observed on merozoites of all examined Eimeria species.

In case of Ab4 and Ab5 some differences in localization of binding could be distinguished

among sporozoites of different Eimeria species. Ab4 and Ab5 binding with sporozoites was seen

in both anterior and posterior refractile bodies in case of E. tenella, E. brunetti and E. maxima

but was only observed in the posterior refractile body in case of E. acervulina (Figure 4.3.4).

Results

53

Figure 4.3.2: Reaction of sporozoites of E. tenella with Ab1 (A), Ab4 (B), Ab5 (C), Ab6 (D),

Ab7 (E), Ab8 (F) and Ab5 (G). Ab binding was visualized by green fluorescence (FITC), blue

fluroscence (DAPI) and red fluroscence (Evans Blue). The latter is the counterstain for

visualising the position of refractile bodies (x100 magnification)

Results

54

Figure 4.3.3: Reaction of sporozoites of Eimeria spp. with Ab4 and Ab5. A and B represent Ab

reaction with sporozoites of E. brunetti, C and D with sporozoites of E. acervulina and E and F

with sporozoites of E. maxima. Ab binding was visualized by green fluorescence (FITC), blue

fluroscence (DAPI) and red fluroscence (Evans Blue) as counterstain to visualise the position of

refractile bodies (x100 magnification)

Results

55

Figure 4.3.4: Ab4 and Ab5 binding reaction with sporozoites of Eimeria spp. was localized in

the cytoplasm in the area of both anterior and posterior refractile bodies in case of E. tenella (A,

B, respectively), E. brunetti (C, D, respectively) and E. maxima (G, H, respectively) but was

only observed in the cytoplasm of the posterior refractile body in case of E. acervulina (E, F,

respectively). (x100 magnification)

Results

56

4.4 Invasion inhibition assay

According to the results of indirect immunofluorescence analysis most (seven of nine) of tested

antibody fragments showed binding ability to E. tenella sporozoites more than to other species.

Thus only E. tenella sporozoites were used in both in vivo and in vitro assays.

The infected MDBK cells were treated with trypan blue (0.2% solution) to quench the

fluorescence of the extracellular and attached parasites and to distinguish them from the invading

intracellular sporozoites. However, there were no remarkable differences observed between the

trypan blue treated and non-treated cells. The CFSE labelled sporozoites were exposed to trypan

blue (0.2% solution) and observed microscopically for 3-5 min and the fluorescence emission

was properly quenched. Washing of infected cells twice with PBS containing Ca+2 and Mg+2 24

h after the infection with labelled sporozoites was sufficient to remove attached and dead

sporozoites away from the host cell monolayers.

The main population of non-infected host cells were detected by FC analysis in the upper R2

region while infected cells (fluorophore containing labeled sporozoites) were placed in the upper

R3 region. The non-labeled sporozoites were located in the lower R2 region and the labeled ones

were in the lower R3 region. Such differences in size and fluorescence content between the

different cell types could be easily determined by FC analysis. Therefore the infected cells could

be reliably distinguished from the non-infected cells and from the extracellular sporozoites

(Figure 4.4).

The invasion rates of E. tenella sporozoites were determined by FC analysis following 24 h of

incubation of the MDBK cells with the treated sporozoites at 37°C and 5% CO2.

Results

57

Figure 4.4: Analysis of different cell types by FC analysis; upper R2 represents the main

population of non-infected host cells, upper R3 represents the infected host cells (containing

labeled sporozoites), lower R2 represents the non-labeled sporozoites and lower R3 represents

the labeled sporozoites.

Results

58

4.4.1 Invasion inhibition after treatment with antibody fragments

Treatment of sporozoites with Ab3, Ab6 and Ab7 led to reduction of invasion rates by 35%,

44.8% and 39.8%, respectively, compared to invasion rates of untreated sporozoites. Ab1, Ab2,

Ab4, Ab5, Ab8 and Ab9 reduced the invasion rates less by 29.6%, 30.3%, 23.8%, 31.7%, 30.2%,

and 32.4%, respectively (Table 4.4.1 and Figure 4.4.1).

untr. c

ontrol

Ab. 1Ab. 2

Ab. 3Ab. 4

Ab. 5Ab. 6

Ab. 7Ab. 8

Ab. 90

10

20

30

40

50

* **

*

** **

*

inva

sion

rat

e of

MD

BK

cel

ls

Figure 4.4.1: Comparison between invasion rates of control group of MDBK cells infected with

untreated E. tenella sporozoites or sporozoites treated with antibody fragments (Ab1, Ab2, Ab3,

Ab4, Ab5, Ab6, Ab7, Ab8 and Ab9). The numbers of infected MDBK cells are the mean +/-

SEM values of two experiments done in 8 replicates and determined by FC analysis. All cells

were incubated for 24 h after the infection at 37°C and 5% CO2.

* The mean difference is statistically significant at the P value of < 0.05 level compared to

untreated control.

Results

59

Table 4.4.1: Invasion rates and invasion inhibition rates of E. tenella sporozoites1, as determined

by FC analysis after 24 h incubation of MDBK cells with sporozoites incubated with different

antibody fragments.

Treatment Mean of invasion %1 Invasion rate %2 Invasion inhibition %3

Untreated control 37.3 100 0.0

Ab 1 26.2* 70.4 29.6*

Ab 2 26.0* 69.7 30.3*

Ab 3 24.2* 64.8 35.2*

Ab 4 28.4* 76.2 23.8*

Ab 5 25.5* 69.3 31.7*

Ab 6 20.6* 55.2 44.8*

Ab 7 22.4* 60.2 39.8*

Ab 8 26.0* 69.8 30.2*

Ab 9 25.2* 67.6 32.4*

* The mean differs statistically significant at the P = 0.05 level compared to untreated control

1All results are the mean of two experiments with 8 replicates for each treatment.

2Invasion rate%= invasion % of Ab treated / invasion % of untreated control

3Invasion inhibition rate = invasion rate % of untreated control - invasion rate % of sporozoites incubated with

antibody fragment.

4.4.2 Invasion inhibition rates after incubation with mixed antibody fragments

Simultaneous incubation of sporozoites of E. tenella with all antibody fragments in dilutions of

1:1000 resulted in no reduction of invasion rate. In contrast, invasion was inhibited by 9% and

10.9% after incubation with dilutions of 1:100 and 1:10, respectively. Application of undiluted

antibody fragments had the most pronounced effect with 21.8% reduction of invasion.

Statistically significant results were observed between treated and non treated groups at the level

of P value < 0.05 (Table 4.4.2 and Figure 4.4.2).

Results

60

Table 4.4.2: Invasion rates and invasion inhibition rates of E. tenella sporozoites1, determined

by FC after 24 h incubation of MDBK cells with sporozoites treated with different dilutions of

mixed antibody fragments

Untreated control

Undiluted Ab mixture

1:10 diluted Ab mixture

1:100 diluted Ab mixture

1:1000 diluted Ab mixture

Invasion %1 37.7 29.5* 33.6* 34.3* 37.7

Invasion rate%2 100 78.2 89.1 91 100

Invasion inhibition rate 3 0.0 21.8* 10.9* 9.0* 0.0

* The mean difference is statistically significant at the P = 0.05 level compared with untreated control.

1All results are the mean of two experiments with 8 replicates for each treatment.

2Invasion rate%= invasion % of Ab treated / invasion % of untreated control

3Invasion inhibition rate = invasion rate % of untreated control - invasion rate % of Ab treated.

Results

61

untreat

ed c

ontrol

undilute

d Abs

1-10

Abs

1-10

0 Abs

1-10

00 A

bs0

10

20

30

40

50

** *

inva

sion

rat

e of

MD

BK

cel

ls

Figure 4.4.2: Comparison of infection rates of MDBK cells after incubation with untreated E.

tenella sporozoites or of sporozoites treated with undiluted or diluted (1:10, 1:100 and 1:1000)

mixture of all antibody fragments (Abs). The numbers of infected MDBK cells are the mean +/-

SEM values of two experiments and 8 replicates as determined by FC analysis. All cells were

incubated for 24 h after the infection at 37°C and 5% CO2.

* The mean difference is statistically significant at the P value of < 0.05 level compared to

untreated control.

4.4.3 Invasion inhibition after treatment of sporozoites with chicken immune sera

Sera of non-infected chicken and of E. tenella infected chicken were collected 7 days post

infection and used to compare their inhibitory effect to the effect of antibody fragments on

invasion of E. tenella sporozoites.

The invasion rates were reduced to 39.7%, 20.4%, and 68.6% in case of host cells infected with

E. tenella sporozoites treated with 1:100, 1:10, or undiluted serum of E. tenella infected chicken,

respectively. Treatment of sporozoites with 1:100, 1:10, or undiluted serum of non-infected

chicken resulted in reduction of invasion rates to 32.2%, 33.9%, and 69.9%, respectively. In case

Results

62

of host cells infected with sporozoites treated with 1:100, 1:10, and undiluted Anti-EbCDPK, the

invasion inhibition rates were 15.8%, 42.7%, and 63.7%, respectively (Table 4.4.3 and Figure

4.4.3).

contro

l

Et-S un

dil

Et-S 1

:10 dil

Et-S 1:

100 d

il

S-non

inf. u

ndil

S-nonin

f. 1:

10 dil

S-nonin

f. 1:10

0 dil

Anti-E

bCDPK und

il

Anti-E

bCDPK 1:10

dil

Anti-E bC

DPK 1:10

0 dil

0

5

10

15

*

**

*

*

* *

*

*

*

infe

ctio

n ra

te o

f M

DB

K c

ells

Figure 4.4.3: Comparison between infection rates of MDBK cells. Cells were infected with

sporozoites treated with undiluted, 1:10, and 1:100 diluted sera or with polyclonal anti-EbCDPK

antibody. Sera originated from non-infected chicken (S-non inf.) and from E. tenella infected

chicken (Et-S). Positive controls were infected with untreated E. tenella sporozoites. The values

represent the mean values of 8 replicates as determined by FC analysis. All cells were incubated

for 24 h after the infection at 37°C and 5% CO2.

*The mean difference is statistically significant at the P value of < 0.05 level compared to

untreated control.

Results

63

Table 4.4.3: Invasion rates of E. tenella sporozoites1, as determined by FC after 24 h incubation

of MDBK cells with sporozoites treated with different dilutions of sera originating from non

infected or infected chicken with E. tenella.

Untreated control

serum

(E.ten_infected

undil.)

serum

(E.ten_infected

1:10)

serum

(E.ten_infected

1:100)

serum

(non infected_undil.)

serum

(non infected 1:10)

serum

(non infected 1:100)

serum

(Anti

-E

bCD

PK

undil.)

serum

(Anti

-E

bCD

PK

1:10)

serum

(Anti-

EbC

DP

K 1:100)

Invasion %1 12.4 3.9* 9.9* 7.5* 3.7* 8.2* 8.4* 4.5* 7.1* 10.4*

Invasion rate %2 100 31.4 79.6 60.3 30.1 66.1 67.8 36.3 57.3 84.2

Invasion inhibition %3 0 68.6* 20.4* 39.7* 69.9* 33.9* 32.2* 63.7* 42.7* 15.8*

* The mean difference is statistically significant at the P value of < 0.05 level compared with untreated control

1All results are the mean of two experiments with 8 replicates for each treatment.

2Invasion rate%= invasion % of Ab treated / invasion % of untreated control

3Invasion inhibition rate = invasion rate % of untreated control - invasion rate % of sporozoites incubated with

antibody fragments.

4.5 Proliferation rates of the host cells under different treatments

The detrimental effects of antibody fragments on the proliferation rates (PR) and the viability of

MDBK cells were studied by FC analysis and MTT. All results are the mean of two experiments

with 8 replicates for each treatment.

4.5.1 PR after treatment with single antibody fragments

As determined by FC assays and MTT assay, PR of host cells were reduced after application of

Ab preparations. This reduction paralleled the reduction in the invasion rates of host cells. PR of

MDBK cells incubated with Ab2 and Ab4 were highly reduced by 23.0% and 26.0%,

respectively, with reduction in invasion rates by 30.3% and 23.8%, respectively. In contrast, PR

of MDBK cells incubated with Ab1, Ab3, Ab5, Ab6, Ab7, Ab8 and Ab9 were moderately

Results

64

reduced by 19.5%, 18.0%, 17.0%; 17.5%, 19.5%, 17.5% and 15.0%, respectively, with invasion

rates reduced by 29.6%, 35.2%, 31.7%, 44.8%, 39.8%, 30.2% and 32.4%, respectively (Table

4.5.1 and Figure 4.5.1).

0%

20%

40%

60%

80%

100%

120%

untreat

ed co

ntrol

Ab1Ab2

Ab3Ab4

Ab5Ab6

Ab7Ab8

Ab9

invasion rate proliferation rate

Figure 4.5.1: Comparison between proliferation rate (PR) and invasion rates of MDBK cells.

MDBK cells were infected with E. tenella sporozoites treated with undiluted antibody fragments

(Ab1, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, and Ab9). Controls were infected with untreated E.

tenella sporozoites PR values are the mean of two measurements; FC and MTT, with 8 replicates

for each treatment.

Results

65

Table 4.5.1: Proliferation rates (PR) 1 of host cells incubated with different antibody fragments

as measured by FC2 and MTT3

PR %

FC2 % MTT3% Mean

Reduction in PR %

Invasion inhibition%4

Untreated control 100.0 100.0 100.0 0.0 0.0

Ab 1 81.0 80.0 80.5 19.5 29.6*

Ab 2 73.0 81.0 77.0 23.0 30.3*

Ab 3 81.0 83.0 82.0 18.0 35.2*

Ab 4 62.0 86.0 74.0 26.0 23.8*

Ab 5 76.0 90.0 83.0 17.0 31.7*

Ab 6 80.0 85.0 82.5 17.5 44.8*

Ab 7 75.0 86.0 80.5 19.5 39.8*

Ab 8 80.0 85.0 82.5 17.5 30.2*

Ab 9 82.0 88.0 85.0 15.0 32.4*

* The mean differs statistically significant at the P < 0.05 level compared to untreated control.

1All results are the mean of two experiments with 8 replicates for each treatment.

2 Cells were incubated 24 h, at 37°C, 5% CO2.

3Cells were incubated at 37°C, 5% CO2 for 4 h during treatment, 3h with MTT-reagent and PR of the cells were

measured by microplate ELISA reader.

4Invasion inhibition rate = invasion rate % of untreated control - invasion rate % of sporozoites incubated with

antibody fragment.

4.5.2 PR after treatment with different dilutions of mixed antibody fragments

PR of host cells treated with 1:1000, 1:100, 1:10 and undiluted mixed antibody fragments were

reduced by 1%, 10%, 16%, and 26%, respectively, with a reduction in invasion rates by 0%, 9%,

15% and 18%, respectively. This reduction in PR is proportionally correlated to the

concentration of the mixed antibodies and to the invasion inhibition rates of host cells treated

with the same dilutions. Such results suggest the presence of toxic components in the

Results

66

preparations of these antibody fragments which may affect the viability and proliferation of

MDBK cells (Table 4.5.2 and Figure 4.5.2).

0%

20%

40%

60%

80%

100%

120%

untraeted control undiluted Abs 1-10 Abs 1-100 Abs 1-1000 Abs

invasion rate proliferation rate

Figure 4.5.2: Comparison between proliferation rate (PR) and invasion rates of MDBK cells.

MDBK cells were infected with E. tenella sporozoites treated with undiluted, 1:10, 1:100, and

1:1000 diluted mixtures of all antibody fragments (Abs). Controls were infected with untreated

E. tenella sporozoites. PR values and invasion rates are the mean of two measurements with 8

replicates for each treatment.

Results

67

Table 4.5.2: Reduction in invasion rates1 and proliferation rates (PR) 2 of MDBK treated with

different dilutions of mixed antibody fragments

Infection rate

Invasion inhibition % PR

Reduction in PR

untreated control 100% 0% 100% 0%

undiluted Abs 82% 18% 74% 26%

1-10 Abs 85% 15% 84% 16%

1-100 Abs 91% 9% 90% 10%

1-1000 Abs 100% 0% 99% 1% 1Invasion inhibition rate = invasion rate % of untreated control - invasion rate % of sporozoites incubated with

antibody fragments.

2 PR are the mean of two experiments, FC and MTT assay, with 8 replicates for each treatment.

4.5.3 PR after incubation of MDBK with sporozoites treated with serum

Reduction in the PR of host cells ranged from 2% to 11% when sporozoites were treated with

sera in different dilutions (see Table 4.5.3). However, the sera favoured the proliferation of the

host cells as demonstrated by application of heat inactivated serum (data not shown). Invasion

rates of host cells ranged from 69.9% to 15.8% (see Table 4.5.3 and Figure 4.5.3) in comparison

to the untreated host cells.

Results

68

Table 4.5.3: Proliferation rates (PR) 1 of host cells incubated with sporozoites pre-incubated with

different dilutions of serum or with Anti-EbCDPK

Invasion inhibition %2

PR

%

Reduction

in PR %

untreated control 0.0 100 0

Serum of E. tenella infected chicken (undiluted) 68.6 108 0

Serum of E. tenella infected chicken (1:10 diluted) 20.4 104 0

Serum of E. tenella infected chicken (1:100 diluted) 39.7 91 9

Serum of non-infected chicken. (undiluted) 69.9 98 2

Serum of non-infected chicken (1:10 diluted) 33.9 90 10

Serum of non-infected chicken (1:100 diluted) 32.2 97 3

Anti-EbCDPK (undiluted) 63.7 114 0

Anti-EbCDPK (1:10 diluted) 42.7 110 0

Anti-EbCDPK (1:100 diluted) 15.8 89 11 1All results are the mean of two measurements; FC and MTT assay, with 8 replicates for each treatment.

2Invasion inhibition rate = invasion rate % of untreated control - invasion rate % of sporozoites incubated with

antibody fragment.

Invasion rates were moderately reduced in host cells incubated with sporozoites treated with

antibody fragments, however, the proliferation rates of the host cells were greatly affected under

these treatments. While the PR values of MDBK cells infected with sporozoites treated with sera

were not affected, sera reduced the invasion rates more than the tested antibody fragments and

favoured the proliferation rates of the host cells.

Results

69

0%

20%

40%

60%

80%

100%

120%

untreatedcontrol

S-noninf.undiluted

S-noninf.1:10

diluted

S-noninf.1:100

diluted

Et-Sundiluted

Et-S 1:10diluted

Et-S1:100

diluted

Anti-EbCDPKundiluted

Anti-EbCDPK

1:10diluted

Anti-EbCDPK

1:100diluted

invasion rate proliferation rate

Figure 4.5.3: Comparison between proliferation rate (PR) and invasion rates of MDBK cells.

MDBK cells were infected with E. tenella sporozoites treated with different dilutions (undiluted,

1:10, and 1:100) of sera of non-infected (S.non-inf) or infected chicken (Et-S) or with Anti-

EbCDPK. Controls were infected with untreated E. tenella sporozoites. PR values are the mean

of two measurements; FC and MTT assay were performed with 8 replicates for each treatment.

4.6 In vivo antibody neutralization test

The purified sporozoites of E. tenella were pre-incubated for one hour at 37°C with the different

antibody fragments in a concentration of 1:10. The sporozoite suspension was inoculated

intracloacally to avoid effects of digestive enzymes on the antibodies.

During the preliminary trials it was noticed that the sporozoite inoculum was sometimes repealed

out with the faeces directly after inoculation. Withholding of feed and water for several hours

Results

70

before the inoculation appeared suitable to enhance evacuation of the rectum. There was no

record of any mortality within the infected chicken during this experiment.

The control group was infected intracloacally with untreated E. tenella sporozoites. The oocyst

output (OPG) was markedly reduced in case of chicken infected with sporozoites treated with

antibody fragments Ab1, Ab3, Ab5, and Ab9 (Table 4.6 and Figure 4.6.1).

OPG was moderately to slightly reduced in case of chicken infected with sporozoites pre-treated

with Ab6 and Ab8 in comparison to the control group Statistically, the mean differences were

found significant at the P value < 0.05 level in case of Ab1, Ab3, Ab5 and Ab8 (Table 4.6 and

Figure 4.6.2).

Table 4.6: Reduction in oocyst excretion one week after intracloacal inoculation of sporozoites

treated with antibody fragments

% of OPG reduction2

dpi1 Untreated control OPG Ab1* Ab2 Ab3* Ab4 Ab5* Ab6 Ab7 Ab8* Ab9

7 139325 93 0 76 51 98 84 63 15 80

8 63025 64 16 74 0 99 38 0 64 89

9 79500 52 59 90 55 89 54 52 70 85

10 74250 83 73 58 66 87 74 54 58 89

11 26500 70 43 0 21 96 0 8 0 68

12 17550 67 30 29 7 96 57 11 23 66

OP

G

13 18550 78 62 73 19 100 68 78 27 68

1dpi is days post-infection.

2 % of OPG reduction = % of OPG of untreated control - % of OPG of Ab treated group.

* The mean of total OPG over observation period differs statistically significant at the P < 0.05 level

compared to untreated control

Results

71

0

20000

40000

60000

80000

100000

120000

140000

160000

7 8 9 10 11 12 13

dpi

OP

G

untreated control Ab1 Ab3 Ab5 Ab9

Figure 4.6.1: OPG of chicken infected intracloacally with E. tenella sporozoites. E. tenella

sporozoites were treated with Ab1, Ab3, Ab5, Ab7, or Ab9, respectively. The mean differences

of total oocyst output over observation period were found statistically significant as compared to

the untreated control at the P value < 0.05 level in case of Ab1, Ab3, Ab5 and Ab8.

Results

72

0

20000

40000

60000

80000

100000

120000

140000

160000

7 8 9 10 11 12 13

dpi

OP

G

untreated control Ab2 Ab4 Ab6 Ab7 Ab8

Figure 4.6.2: OPG of chicken infected intracloacally with E. tenella sporozoites. E. tenella

sporozoites were treated with Ab2, Ab4, Ab6, Ab7, or Ab8, respectively. The mean differences

of total oocyst output over observation period were found statistically significant as compared to

the untreated control at the P value < 0.05 level in case of Ab1, Ab3, Ab5 and Ab8.

Discussion

73

5 Discussion

Poultry coccidiosis is caused by infection with Eimeria spp. This disease has great economic

impact on poultry production particularly in intensively reared commercial flocks (WALLACH

et al. 1995; LILLEHOJ and LILLEHOJ 2000). The disease is associated with the enteric

predilection site of the parasites. Clinical signs include decreased feed conversion efficiency,

decreased growth rate, diarrhoea, dehydration and possibly mortality (BARKER 1993). The cost

of coccidiosis to the poultry industry is high due to decreased food utilization and weight gain

and to costs of prophylactic and therapeutic drug use to control infection with estimated annual

costs of $800 million (DANFORTH 1986; WILLIAMS 1998).

In intensive poultry farms, the incidence of clinical disease is generally low despite the crowding

of the animals. This is due mainly to the proper application of prophylactic anticoccidial drugs

(SHIRLEY and BEDRNIK 1997). However, with the increased prevalence of drug resistant

parasites, there is increasing interest in vaccines and recombinant antibodies (SHIRLEY et al.

2005). Success of vaccination is based on the fact that once a bird has been infected it develops

protective immunity against the respective Eimeria species (LILLEHOJ and LILLEHOJ 2000).

Some antibodies with inhibitory effect on various Eimeria-stages have already been identified

(DANFORTH et al. 1985; LILLEHOJ and CHOI 1998; LABBE et al. 2005). Such antibodies

produced in plants used for animal feeding could offer a simple and inexpensive

biopharmaceutical means for coccidiosis control. Plant based antibodies (plantibodies) are

supposed as alternative options to control several animal diseases, for example: Foot-and-Mouth-

Disease (SANTOS et al. 2005), Rinderpest (KHANDELWAL et al. 2003a; KHANDELWAL et

al. 2003b), rotavirus infection (SALDANA et al. 2006) and infectious bronchitis virus (IBV)

(ZHOU et al. 2003). Plant-based recombinant chicken sIgA was expressed in tobacco leaves and

induced immune protection against coccidiosis (WIELAND et al. 2006).

There are several potential advantages of using plant technology for the production of vaccines;

most notably, the overall costs can be greatly reduced compared with competing systems. This is

mainly due to the relatively low cost afforded by oral delivery of antigen in large amounts.

Despite the obvious advantages of plant-based vaccines there are still severe biosafety

Discussion

74

limitations as well as concerns in the public to genetically modified plants. With increased public

awareness of biotechnology, especially plant genetics, companies working in this field will have

to supply sufficient appropriate information to the public and other interested stakeholders.

Currently, transgenic crops are planted on very small acreages with the intent of developing high

expressing plant lines and generating material for experimental trials. Thus, much of the material

generated for this purpose is grown in contained greenhouses. Application intended to open-field

cultivation might evoke potential risks that must be assessed case-by-case. Potential biosafety

risks are transgene spread in the environment, recombinant protein accumulation in the

ecosystem, contamination of food and feed chains with transgenes and their products. Also

product quality and safety are discussed (COMMANDEUR et al. 2003). However, these

potential risks can be controlled by various physical and biological means (COMMANDEUR et

al. 2003).

Different attempts have been made to immunize chicken against coccidiosis throughout the

world by using different antigenic materials including low doses of sporulated oocysts (EDGAR

1958), irradiated sporulated oocysts (REHMAN 1971), sporozoites (GARG et al. 1999),

merozoites, recombinant merozoite antigen (JENKINS 1998) recombinant refractile body

antigen (KOPKO et al. 2000) and inactivated sporulated oocysts (AKHTAR et al. 2001). None

of these experimental vaccines reached the commercial scale. Later, vaccines from virulent or

attenuated strains were developed and are being marketed now in different countries (LEE 1987;

SHIRLEY 1989; BEDRNIK 1996). Recently, a subunit vaccine against coccidiosis (CoxAbic®)

which contains recombinant antigens expressed in bacteria has been commercialized (BELLI et

al. 2004).

The aim of the present study is to evaluate the inhibitory effect of some recombinant antibody

fragments against Eimeria tenella which have been expressed in a transgenic pea plant. If

efficacious, these antibody fragments might be implemented later as a food constituent to protect

chicken from infection with coccidia. Both in vitro and in vivo infection experiments were

performed to evaluate the inhibitory effect of these antibody fragments on E. tenella by indirect

immunofluorescence test, flow cytometry and in vivo antibody neutralisation assay.

Discussion

75

The future use of these plantibodies is mainly to stop coccidiosis or minimize its severity, and

thereby to increase food gain conversion rate, to decrease mortality and to save economic losses.

Alternatives to anticoccidials are potentially attractive to owners of poultry farms because of

their low costs and the gradual loss of anticoccidial drug efficacy due to increasing resistance

(ALLEN and FETTERER 2002; KITANDU and JURANOVA 2006). It would be a significant

step forwards to find an alternative, drug free, and economic method to control coccidiosis by

using feeding plants expressing protective antibody fragments such as pea, corn or soya bean.

A simple method of single oocyst infection has been successfully applied to produce

homogenous Eimeria isolates representing a single species from field samples, that contain

mixed Eimeria spp. in most cases (JOYNER and NORTON 1983). The species specific

polymerase chain reaction with different protocols (SCHNITZLER et al. 1998; SCHNITZLER et

al. 1999; SU et al. 2003) was used as a supplementation to the classical parasitological methods,

which are based on parasite morphology, intestinal lesions and prepatent periods, to identify the

respective Eimeria species (CHAPMAN 1982). The species-specific PCR was optimized and

successfully established as a laboratory test to differentiate oocysts and to confirm purity of

laboratory strains.

Unfortunately, after single oocyst infection the number of obtained oocysts was insufficient for

further experimental procedures. The next passages which were done to propagate the few

obtained oocysts of a single species led to contamination by other Eimeria species. Maintaining

the purity of Eimeria species under the given conditions appeared impossible. The chicken

should be reared in positive air pressure isolators supplied with HEPA (high-efficiency

particulate air) filtered air to prevent contamination (SHIRLEY and HARVEY 1996;

JORGENSEN et al. 1997). Such stringent pathogen free conditions were not available. The

production and maintenance of pure strains would enable evaluation of antibodies against

specific Eimeria species and assessment of immunogenicity to each individual species or strain.

The slight DNA amplification bands of other Eimeria species (mostly E. acervulina) suggested

the presence of only few contaminating oocysts, as PCR is very sensitive giving a positive signal

from as little as 10 oocysts (SCHNITZLER et al. 1998; SCHNITZLER et al. 1999; SU et al.

2003). Because microscopical examination indicated morphological homogenicity of oocysts

Discussion

76

and the respective target DNA was strongly amplified (see results, Figure 4.1), contamination

was regarded not significant for the current study.

An advantage of PCR diagnosis is the high sensitivity and specificity which makes it possible to

diagnose different Eimeria species present in the same samples (SCHNITZLER et al. 1998;

SCHNITZLER et al. 1999; ALLEN and FETTERER 2002; SU et al. 2003; MORRIS and

GASSER 2006). However, conventional PCR lacks the option to exactly quantify the number of

Eimeria oocysts.

A sensitive assay capable to identify, differentiate and quantify the Eimeria spp. present in

chicken with mixed infection or to precisely determine the degree of purity or contamination in

single oocyst isolates would be highly desirable. Recently a real-time PCR assay has been

published (MORGAN et al. 2009) which will help to screen the purity of isolates.

Nine antibody fragments were screened in the current study by indirect immunofluorescent

antibody test for the binding reactivity with sporozoites and merozoites of various Eimeria

species. Only 7 of 9 antibody fragments were binding to sporozoites of E. tenella. Of these 7

antibody fragments only two (Ab4 and Ab5) displayed cross reactivity with the sporozoites of E.

brunetti, E. maxima, and E. acervulina. None of these antibodies showed a binding reactivity

with the merozoites of any of the above mentioned Eimeria species. Ab2 and Ab3 showed no

binding to any zoites of Eimeria spp.

Failure of immunofluorescent staining of merozoites of different Eimeria species is suggesting

that the target antigens used for preparation of these antibody fragments are not expressed on

merozoites owing to different antigen patterns of merozoites and sporozoites of Eimeria spp.

These differences were also evident between sporozoites and merozoites of Eimeria spp.

(REDUKER and SPEER 1986) and 29 SAGs (surface antigen genes) of E. tenella were

expressed solely by merozoites but not by sporozoites (TABARES et al. 2004). Sporozoites and

second generation merozoites of E. tenella varied in reaction location with the immune

monoclonal antibody 13.90 (SPEER et al. 1989). Merozoites and sporozoites of Eimeria spp. are

different in their ultrastructures as the refractile bodies are not found in the first generation

merozoites and are replaced by several smaller spherical bodies (HAMMOND et al. 1970;

DANFORTH and AUGUSTINE 1989). Antigens unique to sporozoites or merozoites may

Discussion

77

represent stage-specific differentiation, as has been reported in T. gondii (KASPER et al. 1984;

KASPER and WARE 1985) and Plasmodium spp. (TOURE-BALDE et al. 2009).

Fluorescence was observed on the outer surface of the sporozoites of Eimeria tenella for Ab1,

Ab6, Ab7, Ab8 and Ab9 and thus these antibody fragments are obviously reacting with surface

antigen. In contrast, the binding reaction of Ab4 and Ab5 was located in the posterior and

anterior refractile bodies in case of E. tenella, E. brunetti and E. maxima but was only observed

in association to the posterior refractile body in case of E. acervulina.

Cross-reactivity of Ab4 and Ab5 was observed with sporozoites of E. acervulina, E. brunetti and

E. maxima. This indicates the presence of common antigen. (DANFORTH and AUGUSTINE

1983) also reported cross-reactivity of immune serum from birds infected with different Eimeria

species. The candidate antigen used for production of the antibody fragments in the present study

is presumably conserved in E. acervulina, E. brunetti and E. maxima; however this assumption

deserves further investigations.

The immunofluorescent staining of sporozoites of E. acervulina, E. maxima and E. brunetti with

most of the tested antibody fragments was unsuccessful showing that antigenicity varies between

species. It is well known that immunity to E. tenella does not confer resistance to E. maxima or

other species (MCDOUGALD 2008) and thus it appears improbable that certain antibody

fragments even if they bind across the species barrier, will have general protective effects against

coccidia.

None of the tested antibody fragments showed positive binding reaction with merozoites. This

property will be a disadvantage because sporozoites invading host cells in spite of presence of

antibody fragments will induce rapid multiplication of the parasite and eventually oocyst

excretion. A single oocyst, single sporocyst or single sporozoite is able to give rise to a clonal

population of the respective Eimeria species (SHIRLEY and HARVEY 1996). To produce

effective recombinant antibodies against multi-stage protozoan parasites such as Eimeria spp. it

would be advantageous if they would target antigens of different stages. This would include

sporozoite antigen to protect against the first invasive stages and merozoite antigen to prevent

asexual multiplication which might appear if sporozoites escape the first line of defence.

Discussion

78

To investigate the most suitable cell culture line to be used for the invasion inhibition assay,

some preliminary trials on different cell lines were performed. Madin-Darby Bovine Kidney

cells (MDBK) appeared most suitable and were chosen for the in vitro model to investigate and

evaluate sporozoite invasion in accordance to previous reports (DORAN and VETTERLI 1967;

BUMSTEAD et al. 1998; TIERNEY and MULCAHY 2003; TIERNEY et al. 2004; JOHNSON

et al. 2004; ALLEN 2007).

During the course of this study particular attention was paid to the effect of antibody fragments

on the sporozoite invasion rate. Initially only microscopical examination was available which is

rather qualitative than quantitative in terms of invasion inhibition rates. Labeling with

radioactive isotopes would be a good alternative but was not applicable under the given

conditions. Flow cytometry appeared suitable to assess the invasion inhibition rates precisely

using labeling with vital fluorescence stain (RAETHER et al. 1991; HOFMANN et al. 1993) and

recently CFSE labeling was used (LABBE et al. 2005; HERMOSILLA et al. 2008). In the

present study CFSE-labelling was applied as it is time saving and easy to perform in comparison

to antibody-based immunoassays which require specific antibodies, fixation and other

procedures to support binding of the antibodies to parasitic antigens. CFSE has successfully been

used to investigate drug effects against parasites, e. g. assessment of proliferation of CFSE-

stained Leishmania infantum promastigotes after exposure to allopurinol (KAMAU et al. 2000)

and to dinitroaniline compounds by flow cytometry analysis (KAMAU et al. 2001), indicating

the applicability of CFSE in pharmacological screenings. CFSE also has been used to label E.

bovis sporozoites and meronts to study parasite-host cell interactions in vitro (HERMOSILLA et

al. 2008) and to investigate functions of ETMIC3 (E. tenella microneme protein 3) and its

importance during host cell invasion by E. tenella sporozoites (LABBE et al. 2005).

Invasion rates were clearly reduced in host cells incubated with sporozoites treated with antibody

fragments, however, proliferation rates of the host cells were also affected under these

treatments. This suggested the presence of some toxic compounds in the tested antibody

preparations which may induce detrimental effects on the viability and proliferation of the cell

culture. To assess this assumption sera from non-infected chicken and chicken infected with

Eimeria tenella or polyclonal antibody developed against EbCDPK were applied. It was noticed

that sera, either heat inactivated or non-heated, did not negatively affect the PR of MDBK cells

Discussion

79

but instead increase PR, especially if heat inactivated. The latter may reflect removal of

complement from the serum by heat inactivation whereas general increase of PR is probably due

to other constituents and nutrients in the sera such as essential amino acids.

In the antibody neutralization assay, the sample size was small (9 chicken in each group).

However, for scoring of pathological lesions groups of around 10 are rather common

(HORTON-SMITH and LONG 1963; HORTON-SMITH and LONG 1966; CRANE et al. 1986).

It was not possible to repeat this experiment because of limited availability of antibody

fragments. More in vivo studies on a larger scale are needed to get a data quality sufficient for

statistical analysis. The intracecal inoculation technique used in the in vivo antibody

neutralization assay appeared suitable to estimate sporozoite infectivity and may be applied in

further studies related to detection and quantification of antibody effects on sporozoite activity in

vivo.

The artificial excystation performed for both in vitro and in vivo assays may have led to the loss

of some membrane protein, i.e. antigens (WISHER and ROSE 1987), possibly due to proteolysis

by trypsin present in the excystation medium (TOMLEY 1994). Both assays should be similarly

biased by this, however, oocyst excretion was more reduced after sporozoite incubation with

antibody fragments (especially Ab1, Ab3, Ab5, and Ab9) than expected from the result of the in

vitro inhibition assay. To fully understand the potential of antibody fragment application for the

control of coccidiosis co-factors must be taken in consideration such as the intestinal barrier,

quality and amount of intestinal content, and the immune response including the local

inflammatory reaction. Increased intestinal permeability, resulting in plasma leakage from

vasculature, may coincide with cell invasion (CASTRO 1989). GALT (gut associated lymphoid

tissue) and MALT (mucosal-associated lymphoid tissue) play important roles by processing and

presentation of antigens, production of intestinal antibodies (primarily secretory IgA), and

activation of cell mediated immunity (YUN et al. 2000b; DALLOUL and LILLEHOJ 2005).

These different elements could contribute to the more or less distinct inhibitory effect of the

tested antibody fragments in vivo, however, this remains to be characterized in future studies.

Whatsoever, the sporozoites are obviously facing more hindrance under in vivo conditions to

invade the epithelial cells of the host than assumed from in vitro studies.

Discussion

80

Conclusion

In this study, a simple method was established for single oocyst infection which can be used to

produce pure strains from field samples. However, maintenance of purity was not successful

under the given conditions, although contamination remained on an acceptable level.

All tested antibody fragments showed moderate inhibitory effect on the invasion rates of the

sporozoites in vitro.

Some of the tested antibody fragments (Ab1, Ab3, Ab5 and Ab9) were more capable to

neutralize E. tenella sporozoites infectivity in vivo than others (Ab2, Ab4, Ab6, Ab7 and Ab8).

In vitro invasion inhibition can be combined with assessment of E. tenella sporozoite infectivity

in vivo after intracloacal inoculation to produce quantitative inactivation data.

Flow cytometry is a suitable quantitative assay for assessment of the sporozoite invasion in vitro.

Further studies are necessary to elaborate the potential efficacy of antibody fragment application

to chicken exposed to coccidiosis and if unequivocally demonstrated, to optimise their

application and dosage.

Zusammenfassung

81

6 Zusammenfassung

Reda Khalafalla

Hemmung der Infektiosität von Eimeria tenella Sporozoiten durch in Erbsen exprimierte

Antikörper-Fragmente

Institut für Parasitologie der Veterinärmedizinischen Fakultät der Universität Leipzig

Eingereicht im August 2009

84 Seiten, 15 Abbildungen, 13 Tabellen, 192 Referenzen

Schlüsselwörter: Antikörper-Fragmente, Eimeria tenella, MDBK, in vitro- Invasionshemmung,

MTT assay, In vivo-Antikörper- Neutralisierung, Durchfloßzytometrie.

Die Hühnerkokzidiose verursacht weltweit erhebliche wirtschaftliche Verluste. Aufgrund der

zunehmenden Resistenzen der Eimeria-Arten gegen die häufig eingesetzten Antikokzidia besteht

ein großes Interesse an alternativen Methoden zur Kontrolle der Kokzidiose beim Geflügel. Die

vorliegende Studie untersucht die potentiell inhibitorische Wirkung von Anti-Eimeria-tenella-

Antikörperfragmenten aus Erbsen. Hierzu wurden die indirekte Immunfluoreszenz, ein

Infektionsassay nach In-vivo-Antikörper-Neutralisation und ein Zellkultur-Invasionshemmtest

eingesetzt.

Sieben von neun Antikörperfragmenten (Ab1, Ab4, Ab5, Ab6, Ab7, Ab8 und Ab9) zeigten im

indirekten Immunfluoreszenztest eine Bindung an Sporozoiten von E. tenella. Nur zwei

Antikörper-Fragmente (Ab4 und Ab5) zeigten Kreuzreaktivität mit Sporozoiten von E. maxima,

E. brunetti und E. acervulina, die Lokalisation der spezifischen Fluoreszenz unterschied sich

jedoch zwischen den Arten. Eine Markierung mit Ab4 und Ab5 wurde an den vorderen und

hinteren Refraktilkörperchen im Fall der Sporozoiten von E. tenella, E. brunetti, und E. maxima

aber nur am hinteren Refraktilkörperchen im Falle von E. acervulina gesehen. Eine Bindung an

Merozoiten wurde bei keiner der getesteten Eimeria-Arten beobachtet.

Die Eignung der Antikörper, die Infektiosität von E. tenella für bovine Nierenzellen (MDBK) zu

verändern, wurde in vitro im Invasionshemmtest mittels Durchflusszytometrie quantifiziert. Um

die inhibitorische Wirkung dieser Antikörperfragmente auf die Reproduktion der Parasiten im

Zusammenfassung

82

natürlichen Wirt zu beurteilen, wurde der In vivo-Antikörper-Neutralisationstest durchgeführt.

Dabei infezierte man die Hühnerküken retrograde mit Sporozoiten, die vorher In vitro mit

Antikörperfragmenten inkubiert wurden

In den Zellen, die mit Antigenfragment-behandelten Sporozoiten infiziert wurden, waren die In-

vitro-Invasionsraten um zirka 24 bis 45 % reduziert, wobei Ab6 und Ab7 den deutlichsten

Effekt zeigten. Allerdings wurden auch die Proliferationsraten (PR) der MDBK-Zellen um 15 bis

26 % vermindert. Im Verhältnis 1:1000, 1:100 oder 1:10 verdünnte oder unverdünnte

Antikörperfragment-Präparationen reduzierten die PR um 1 %, 10 %, 16 % oder 26 %, während

die entsprechenden Infektionsraten um 0 %, 9 %, 15 % oder 18 % sanken. Serum infizierter

Tiere reduzierte die Invasion um 16 bis 70 % und förderte zudem die Proliferation der

Wirtzellen.

Es scheint, dass die Antikörperfragment-Zubereitungen Komponenten enthielten, die einen

zytotoxischen Effekt auf die MDBK-Zellen hatten. Aus diesem Grund konnte die

Invasionshemmung in vitro nicht eindeutig beurteilt werden. Eine weitere Analyse dieser

Beobachtung war aufgrund der begrenzten Mengen an Ab-Präparationen nicht möglich.

Nach der Inkubation mit Antikörperfragmenten zeigten Sporozoiten eine reduzierte Fähigkeit

sich nach einer intrakloakalen Infektion in Hühnern zu reproduzieren (insbesondere Fragmente

Ab1, Ab3, Ab5 und Ab9). Andere Antikörperfragmente (Ab2, Ab4, Ab6, Ab7 und Ab8) waren

weniger geeignet, die Infektion durch Sporozoiten und damit die Reproduktion zu verringern.

Weitere Untersuchungen sind erforderlich, um den möglichen Nutzen der Antigenfragmente aus

Erbsen zur Bekämpfung der Hühner-Kokzidiose abzuschätzen und ihre Wirkung auf infizierte

Hühner zu testen.

Summary

83

7 Summary

Reda Khalafalla

Evaluation of inhibition of Eimeria tenella sporozoites by antibody fragments expressed in

pea

Institute of Parasitology, Faculty of Veterinary Medicine, University of Leipzig.

Submitted in August 2009

84 pages, 15 figures, 13 tables, 192 references

Keywords: chicken coccidiosis, plant-based antibodies; Eimeria tenella; MDBK; in vitro

invasion inhibition assay, in vivo antibody neutralisation assay; flow cytometry.

Coccidiosis in chicken causes great economic losses. Increasing resistance of Eimeria species to

anticoccidials has forced the search for alternative methods of control.

The present study evaluates the anticoccidial activity of some anti-Eimeria tenella antibody

fragments expressed in pea plants. Both in vitro and in vivo infection assays including indirect

immunofluorescence, in vivo evaluation of antibody neutralization and cell culture invasion-

inhibition assays were used to study the inhibitory effect of these antibody fragments on E.

tenella sporozoites.

Seven of nine antibody fragments (Ab1, Ab4, Ab5, Ab6, Ab7, Ab8 and Ab9) showed binding to

sporozoites of E. tenella in an indirect immunofluorescence test. Only two antibodies (Ab4 and

Ab5) cross reacted with sporozoites of E. maxima, E. acervulina and E. brunetti. The

localization of specific fluorescence differed between species. Ab binding with sporozoites was

seen in the area of both anterior and posterior refractile bodies in case of E. tenella, E. brunetti,

and E. maxima but was only observed in the posterior refractile body in case of E. acervulina.

No antibody binding was observed on merozoites.

The suitability of antibody fragments to alter the infectivity of E. tenella sporozoites to Madin

Darby Bovine Kidney cells (MDBK) was examined in vitro and the invasion-inhibition rates

Summary

84

were quantified by flow cytometry. To assess the inhibitory effect on parasite reproduction, the

in vivo antibody neutralization assay was done by retrograde infection of chicken with

sporozoites previously incubated with antibody fragments.

In vitro invasion rates were reduced by incubation with antibody fragments by approximately 24

to 45 %, with Ab6 and Ab7 showing the most distinct effect. However, proliferation rates (PR)

of the respective MDBK cultures were also clearly reduced by 15 to 26 %.

PR of MDBK cells treated with 1:1000, 1:100, 1:10 and undiluted mixed antibody fragments

were reduced by 1%, 10%, 16%, and 26% with a reduction of invasion rates by 0%, 9%, 15%

and 18%, respectively. Immune sera reduced the invasion rates by 16% to 70% and increased PR

of the host cells.

It appeared that the preparations of the antibody fragments contained compounds cytotoxic to

MDBK cells and thus invasion inhibition could not be unequivocally evaluated in vitro.

However, after incubation with antibody fragments sporozoites displayed a reduced ability to

reproduce after intracloacal application to chicken (especially Ab1, Ab3, Ab5 and Ab9). Other

antibody fragments (Ab2, Ab4, Ab6, Ab7 and Ab8) were less capable to reduce sporozoite

infectivity and reproduction.

More investigations are still required to study the possible use of antibody fragments and their

application to infected chicken exposed to coccidiosis.

References

85

8 References

1. Akhtar M, Hayat CS, Ayaz S, Ashfaque M, Ayaz MM, Hussain I. Development of immunity to coccidiosis in chicken administrated sonicated coccidial vaccine. Pak Vet J 2001;21:61-64.

2. Allen PC. Anticoccidial effects of xanthohumol. Avian Diseases 2007;51:21-26.

3. Allen PC, Danforth HD, Augustine PC. Dietary modulation of avian coccidiosis. International Journal for Parasitology 1998;28:1131-1140.

4. Allen PC, Danforth HD, Levander OA. Diets high in n-3 fatty acids reduce cecal lesion scores in chickens infected with Eimeria tenella. Poultry Science 1996;75:179-185.

5. Allen PC and Fetterer RH. Recent advances in biology and immunobiology of Eimeria species and in diagnosis and control of infection with these coccidian parasites of poultry. Clinical Microbiology Reviews 2002;15:58-+.

6. Allen PC, Lydon J, Danforth HD. Effects of components of Artemisia annua on coccidia infections in chickens. Poultry Science 1997;76:1156-1163.

7. Allocco JJ, Profous-Juchelka H, Myers RW, Nare B, Schmatz DM. Biosynthesis and catabolism of mannitol is developmentally regulated in the protozoan parasite Eimeria tenella. Journal of Parasitology 1999;85:167-173.

8. Anwar MI, Akhtar M, Hussain I, Haq AU, Muhammad F, Hafeez MA, Mahmood MS, Bashir S. Field evaluation of Eimeria tenella (local isolates) gametocytes vaccine and its comparative efficacy with imported live vaccine, LivaCox (R). Parasitology Research 2008;104:135-143.

9. Augustine PC. Cell: sporozoite interactions and invasion by apicomplexan parasites of the genus Eimeria. International Journal for Parasitology 2001;31:1-8.

10. Aziz MA, Sikriwal D, Singh S, Jarugula S, Kumar PA, Bhatnagar R. Transformation of an edible crop with the pagA gene of Bacillus anthracis. Faseb Journal 2005;19:1501-+.

11. Aziz MA, Singh S, Kumar PA, Bhatnagar R. Expression of protective antigen in transgenic plants: a step towards edible vaccine against anthrax. Biochemical and Biophysical Research Communications 2002;299:345-351.

12. Baba E, Uno H, Sadano N, Fukata T, Sasai K, Arakawa A. Eimeria tenella: Role of carbohydrates on sporozoite at the penetration into cultured cells. Experimental Parasitology 1996;83:67-72.

13. Bafundo KW, Cervantes HM, Mathis GF. Sensitivity of Eimeria field isolates in the United States: Responses of nicarbazin-containing anticoccidials. Poultry Science 2008;87:1760-1767.

14. Barker IK. pathological processes associated with coccidiosis. Proc. VIth International Coccidiosis Conference, ed. University of Guelph, Guelph, Ontario, Canada.; 1993; p. 81-94

References

86

15. Bedrnik P. Livacox, an attenuated vaccine against coccidiosis of chickens. Magyar Allatorvosok Lapja 1996;51:34-36.

16. Belli SI, Mai K, Skene CD, Gleeson MT, Witcombe DM, Katrib M, Finger A, Wallach MG, Smith NC. Characterisation of the antigenic and immunogenic properties of bacterially expressed, sexual stage antigens of the coccidian parasite, Eimeria maxima. Vaccine 2004;22:4316-4325.

17. Berinstein A, Vazquez-Rovere C, Asurmendi S, Gomez E, Zanetti F, Zabal O, Tozzini A, Grand DC, Taboga O, Calamante G, Barrios H, Hopp E, Carrillo E. Mucosal and systemic immunization elicited by Newcastle disease virus (NDV) transgenic plants as antigens. Vaccine 2005;23:5583-5589.

18. Bessay M, LeVern Y, Kerboeuf D, Yvore P, Quere P. Changes in intestinal intra-epithelial and systemic T-cell subpopulations after an Eimeria infection in chickens: Comparative study between E acervulina and E tenella. Veterinary Research 1996;27:503-514.

19. Blake DP, Qin ZH, Cai JP, Smith AL. Development and validation of real-time polymerase chain reaction assays specific to four species of Eimeria. Avian Pathology 2008;37:89-94.

20. Bouche FB, Marquet-Blouin E, Yanagi Y, Steinmetz A, Muller CP. Neutralising immunogenicity of a polyepitope antigen expressed in a transgenic food plant: a novel antigen to protect against measles. Vaccine 2003;21:2065-2072.

21. Bumstead JM, Topham SJ, Tomley FM. Inhibition of the development of Eimeria tenella in cultured bovine kidney cells by a soluble factor produced by peripheral blood lymphocytes from immune chickens. Parasitology 1998;117:39-47.

22. Carruthers VB and Sibley LD. Sequential protein secretion from three distinct organelles of Toxoplasma gondii accompanies invasion of human fibroblasts. European Journal of Cell Biology 1997;73:114-123.

23. Carruthers VB and Tomley F. Microneme Proteins in Apicomplexans. 2008;33-45.

24. Castro GA. Immunophysiology of enteric parasitism. Parasitol Today 1989;5:11-19.

25. Chai JY and Lillehoj HS. Isolation and Functional-Characterization of Chicken Intestinal Intra-Epithelial Lymphocytes Showing Natural-Killer Cell-Activity Against Tumor Target-Cells. Immunology 1988;63:111-117.

26. Chapman HD. The Use of Enzyme Electrophoresis for the Identification of the Species of Eimeria Present in Field Isolates of Coccidia. Parasitology 1982;85:437-&.

27. Chapman HD. Sensitivity of Field Isolates of Eimeria to Monensin Following the Use of A Coccidiosis Vaccine in Broiler-Chickens. Poultry Science 1994;73:476-478.

28. Chapman HD. The development of immunity to Eimeria species in broilers given anticoccidial drugs. Avian Pathology 1999;28:155-162.

References

87

29. Clemente M, Curilovic R, Sassone A, Zelada A, Ange SO, Mentaberry AN. Production of the main surface antigen of Toxoplasma gondii in tobacco leaves and analysis of its antigenicity and immunogenicity. Molecular Biotechnology 2005;30:41-49.

30. Commandeur U, Twyaman R, Fisher R. The biosafety of molecular farming in plants. AgBiotechNet 2003;5:1-9.

31. Cornelissen JBWJ, Swinkels WJC, Boersma WA, Rebel JMJ. Host response to simultaneous infections with Eimeria acervulina, maxima and tenella: A cumulation of single responses. Veterinary Parasitology 2009;In Press:

32. Crane MSJ, Gnozzio MJ, Murray PK. Eimeria-Tenella (Eucoccidiorida) - A Quantitative Assay for Sporozoite Infectivity Invivo. Journal of Protozoology 1986;33:94-98.

33. Dalloul RA and Lillehoj HS. Recent advances in immunomodulation and vaccination strategies against coccidiosis. Avian Dis 2005;49:1-8.

34. Danforth HD. Biotechnology - the Potential in Coccidial Control. Abstracts of Papers of the American Chemical Society 1986;191:28-AGFD.

35. Danforth HD. Use of live oocyst vaccines in the control of avian coccidiosis: experimental studies and field trials. International Journal for Parasitology 1998;28:1099-1109.

36. Danforth HD, Allen PC, Levander OA. The effect of high n-3 fatty acids diets on the ultrastructural development of Eimeria tenella. Parasitology Research 1997;83:440-444.

37. Danforth HD and Augustine PC. Specificity and crossreactivity of immune serum and hybridoma antibodies to various species of avian coccidia. Poult Sci 1983;62:2145-2151.

38. Danforth HD and Augustine PC. Immunoparasitology in Avian Species. American Zoologist 1989;29:419-425.

39. Danforth HD, Augustine PC, Ruff MD, Mccandliss R, Strausberg RL, Likel M. Genetically Engineered Antigen Confers Partial Protection Against Avian Coccidial Parasites. Poultry Science 1989;68:1643-1652.

40. Danforth HD, Macandrew SJ, Augustine PC. Characterization of Avain Coccidial Antigens Recognized by Hybridoma Antibodies. Federation Proceedings 1985;44:1334-1334.

41. Doran DJ and Vetterli JM. Comparative Cultivation of Poultry Coccidia in Mammalian Kidney Cell Cultures. Journal of Protozoology 1967;14:657-&.

42. Dougan G. The Molecular-Basis for the Virulence of Bacterial Pathogens - Implications for Oral Vaccine Development. Microbiology-Uk 1994;140:215-224.

43. Dyachenko V. Identifizierung einer Proteinkinase mit Calmodulin-ähnlicher Domäne bei Eimeria bovis und Studien zu ihrer Lokalisation im Parasiten[Dissertation med. vet]. Giessen: Univ. Justus Liebig; 2006.

References

88

44. Edgar SA. Control of Coccidiosis of Chickens and Turkeys by Immunization. Poultry Science 1958;37:1200-1200.

45. Ellis J and Bumstead J. Eimeria Species - Studies Using Ribosomal-RNA and rDNA Probes. Parasitology 1990;101:1-6.

46. Floss DM, Falkenburg D, Conrad U. Production of vaccines and therapeutic antibodies for veterinary applications in transgenic plants: an overview. Transgenic Research 2007;16:315-332.

47. Garg R, Banerjee DP, Gupta SK. Immune responses in chickens against Eimeria tenella sporozoite antigen. Veterinary Parasitology 1999;81:1-10.

48. Gasser RB, Skinner R, Fadavi R, Richards G, Morris G. High-throughput capillary electrophoresis for the identification and differentiation of seven species of Eimeria from chickens. Electrophoresis 2005;26:3479-3485.

49. Gasser RB, Woods WG, Wood JM, Ashdown L, Richards G, Whithear KG. Automated, fluorescence-based approach for the specific diagnosis of chicken coccidiosis. Electrophoresis 2001;22:3546-3550.

50. Girard F, Fort G, Yvore P, Quere P. Kinetics of specific immunoglobulin A, M and G production in the duodenal and caecal mucosa of chickens infected with Eimeria acervulina or Eimeria tenella. International Journal for Parasitology 1997;27:803-809.

51. Goldstein DA and Thomas JA. Biopharmaceuticals derived from genetically modified plants. Qjm-An International Journal of Medicine 2004;97:705-716.

52. Hammond DM, Speer CA, Roberts W. Occurrence of refractile bodies in merozoites of Eimeria species. J Parasitol 1970;56:189-191.

53. Haq TA, Mason HS, Clements JD, Arntzen CJ. Oral Immunization with A Recombinant Bacterial-Antigen Produced in Transgenic Plants. Science 1995;268:714-716.

54. Hawley TS and Hawley RG. Flow Cytometry Protocols, 2nd edition. Methods in Molecular Biology, Volume 263. 2004;

55. Hermosilla C, Stamm I, Taubert A, Lutz K, Zahner H, Menge C. Fluorescent Eimeria bovis sporozoites and meront stages in vitro: a helpful tool to study parasite-host cell interactions. Parasitology Research 2008;102:777-786.

56. Hofmann J, Raether W, Ehrlich K. Flow Cytometric Analysis of Eimeria tenella Sporozoites Exposed to Nigericin, Monensin and Lasalocid In-Vitro. Journal of Protozoology Research 1993;3:46-51.

57. Horn ME, Woodard SL, Howard JA. Plant molecular farming: systems and products. Plant Cell Reports 2004;22:711-720.

58. Horton-Smith C and Long PL. Coccidia and Coccidiosis in the Domestic Fowl and Turkey. Advances in Parasitology 1963;1:67-107.

References

89

59. Horton-Smith C and Long PL. Fate of Sporozoites of Eimeria acervulina, Eimeria maxima and Eimeria mivati in Caeca of Fowl. Parasitology 1966;56:569-&.

60. Jeffers TK. Genetics of coccidia and the host response. In: Long PL, Editor. Avian coccidiosis. Edinburgh: British Poultry Science Ltd; 1978. p. 51-125.

61. Jeffers TK and Bentley EJ. Experimental Development of Monensin Resistance in Eimeria-Meleagrimitis. Poultry Science 1980;59:1731-1735.

62. Hofmann J, Raether W, Ehrlich K. Flow Cytometric Analysis of Eimeria-tenella Sporozoites Exposed to Nigericin, Monensin and Lasalocid In-Vitro. Journal of Protozoology Research 1993;3:46-51.

63. Jenkins MC. Progress on developing a recombinant coccidiosis vaccine. Int J Parasitol 1998;28:1111-1119.

64. Jenkins MC, Augustine PC, Barta JR, Castle MD, Danforth HD. Development of resistance to coccidiosis in the absence of merogonic development using X-irradiated Eimeria acervulina oocysts. Exp Parasitol 1991a;72:285-293.

65. Jenkins MC, Augustine PC, Danforth HD, Barta JR. X-irradiation of Eimeria tenella oocysts provides direct evidence that sporozoite invasion and early schizont development induce a protective immune response(s). Infect Immun 1991b;59:4042-4048.

66. Jenkins MC, Fayer R, Tilley M, Upton SJ. Cloning and expression of a cDNA encoding epitopes shared by 15- and 60-kilodalton proteins of Cryptosporidium parvum sporozoites. Infect Immun 1993a;61:2377-2382.

67. Jenkins MC, Seferian PG, Augustine PC, Danforth HD. Protective immunity against coccidiosis elicited by radiation-attenuated Eimeria maxima sporozoites that are incapable of asexual development. Avian Dis 1993b;37:74-82.

68. Jeurissen SH, Janse EM, Vermeulen AN, Vervelde L. Eimeria tenella infections in chickens: aspects of host-parasite: interaction. Vet Immunol Immunopathol 1996;54:231-238.

69. Joensuu JJ, Kotiaho M, Riipi T, Snoeck V, Palva ET, Teeri TH, Lang H, Cox E, Goddeeris BM, Niklander-Teeri V. Fimbrial subunit protein FaeG expressed in transgenic tobacco inhibits the binding of F4ac enterotoxigenic Escherichia coli to porcine enterocytes. Transgenic Research 2004;13:295-298.

70. Johnson JK, Schmidt J, Gelberg HB, Kuhlenschmidt MS. Microbial adhesion of Cryptosporidium parvum sporozoites: Purification of an inhibitory lipid from bovine mucosa. Journal of Parasitology 2004;90:980-990.

71. Jorgensen WK, Stewart NP, Jeston PJ, Molloy JB, Blight GW, Dalgliesh RJ. Isolation and pathogenicity of Australian strains of Eimeria praecox and Eimeria mitis. Aust Vet J 1997;75:592-595.

72. Joyner LP and Norton CC. Eimeria mitis in mixed infections with E. acervulina and E. brunetti in the fowl. Parasitology 1983;86 (Pt 3):381-390.

References

90

73. Kamau SW, Grimm F, Hehl AB. Expression of green fluorescent protein as a marker for effects of antileishmanial compounds in vitro. Antimicrobial Agents and Chemotherapy 2001;45:3654-3656.

74. Kamau SW, Hurtado M, Muller-Doblies UU, Grimm F, Nunez R. Flow cytometric assessment of allopurinol susceptibility in Leishmania infantum promastigote. Cytometry 2000;40:353-360.

75. Kang TJ, Loc NH, Jang MO, Jang YS, Kim YS, Seo JE, Yang MS. Expression of the B subunit of E. coli heat-labile enterotoxin in the chloroplasts of plants and its characterization. Transgenic Research 2003;12:683-691.

76. Kapusta J, Modelska A, Figlerowicz M, Pniewski T, Letellier M, Lisowa O, Yusibov V, Koprowski H, Plucienniczak A, Legocki AB. A plant-derived edible vaccine against hepatitis B virus. Faseb Journal 1999;13:1796-1799.

77. Kasper LH, Bradley MS, Pfefferkorn ER. Identification of stage-specific sporozoite antigens of Toxoplasma gondii by monoclonal antibodies. J Immunol 1984;132:443-449.

78. Kasper LH and Ware PL. Recognition and characterization of stage-specific oocyst/sporozoite antigens of Toxoplasma gondii by human antisera. J Clin Invest 1985;75:1570-1577.

79. Khandelwal A, Lakshmi SG, Shaila MS. Expression of hemagglutinin protein of rinderpest virus in transgenic tobacco and immunogenicity of plant-derived protein in a mouse model. Virology 2003a;308:207-215.

80. Khandelwal A, Sita GL, Shaila MS. Oral immunization of cattle with hemagglutinin protein of rinderpest virus expressed in transgenic peanut induces specific immune responses. Vaccine 2003b;21:3282-3289.

81. Kitandu A and Juranova R. Review Article: Progress in Control Measures for Chicken Coccidiosis. Acta Veterinaria Brno 2006;75:265-276.

82. Kopko SH, Martin DS, Barta JR. Responses of chickens to a recombinant refractile body antigen of Eimeria tenella administered using various immunizing strategies. Poultry Science 2000;79:336-342.

83. Kusina JF and Kusina NT. Feasibility study of agricultural and household activities as they relate to livestock production in Guruve District of Mashonaland central Province with emphasis on village chicken production. Household. 1999;

84. Labbe M, de Venevelles P, Girard-Misguich F, Bourdieu C, Guillaume A, Pery P. Eimeria tenella microneme protein EtMIC3: identification, localisation and role in host cell infection. Molecular and Biochemical Parasitology 2005;140:43-53.

85. Laurent F, Mancassola R, Lacroix S, Menezes R, Naciri M. Analysis of chicken mucosal immune response to Eimeria tenella and Eimeria maxima infection by quantitative reverse transcription-PCR. Infection and Immunity 2001;69:2527-2534.

86. Lee EH. Vaccination Against Coccidiosis in Commercial Roaster Chickens. Canadian Veterinary Journal-Revue Veterinaire Canadienne 1987;28:434-436.

References

91

87. Lee EH and Al-Izzi SA. Selective killing of macrophages in the peritoneal cavity by carrageenan and its effect on normal infection of Eimeria tenella in chickens. Avian Dis 1981;25:503-512.

88. Lee JY, Yu J, Henderson D, Langridge WHR. Plant-synthesized E-coli CFA/I fimbrial protein protects Caco-2 cells from bacterial attachment. Vaccine 2004;23:222-231.

89. Legocki AB, Miedzinska K, Czaplinska M, Plucieniczak A, Wedrychowicz H. Immunoprotective properties of transgenic plants expressing E2 glycoprotein from CSFV and cysteine protease from Fasciola hepatica. Vaccine 2005;23:1844-1846.

90. Leibold W, Janotte G, Peter HH. Spontaneous cell-mediated cytotoxicity (SCMC) in various mammalian species and chickens: selective reaction pattern and different mechanisms. Scand J Immunol 1980;11:203-222.

91. Leslie GA and Clem LW. Phylogeny of Immunoglobulin Structure and Function .3. Immunoglobulins of Chicken. Journal of Experimental Medicine 1969;130:1337-&.

92. Lew AE, Anderson GR, Minchin CM, Jeston PJ, Jorgensen WK. Inter- and intra-strain variation and PCR detection of the internal transcribed spacer 1 (ITS-1) sequences of Australian isolates of Eimeria species from chickens. Vet Parasitol 2003;112:33-50.

93. Lillehoj HS. Immune-Response During Coccidiosis in Sc and Fp Chickens .1. Invitro Assessment of T-Cell Proliferation Response to Stage-Specific Parasite Antigens. Veterinary Immunology and Immunopathology 1986;13:321-330.

94. Lillehoj HS. Intestinal Intraepithelial and Splenic Natural-Killer Cell Responses to Eimerian Infections in Inbred Chickens. Infection and Immunity 1989;57:1879-1884.

95. Lillehoj HS. Avian Gut-Associated Immune-System - Implication in Coccidial Vaccine Development. Poultry Science 1993;72:1306-1311.

96. Lillehoj HS. Role of T lymphocytes and cytokines in coccidiosis. International Journal for Parasitology 1998;28:1071-1081.

97. Lillehoj HS and Bacon LD. Increase of Intestinal Intraepithelial Lymphocytes Expressing Cd8 Antigen Following Challenge Infection with Eimeria acervulina. Avian Diseases 1991;35:294-301.

98. Lillehoj HS and Chai JY. Comparative Natural-Killer Cell Activities of Thymic, Bursal, Splenic and Intestinal Intraepithelial Lymphocytes of Chickens. Developmental and Comparative Immunology 1988;12:629-643.

99. Lillehoj HS and Choi KD. Recombinant chicken interferon-gamma-mediated inhibition of Eimeria tenella development in vitro and reduction of oocyst production and body weight loss following Eimeria acervulina challenge infection. Avian Diseases 1998;42:307-314.

100. Lillehoj HS and Lillehoj EP. Avian coccidiosis. A review of acquired intestinal immunity and vaccination strategies. Avian Diseases 2000;44:408-425.

References

92

101. Lillehoj HS, Min W, Dalloul RA. Recent progress on the cytokine regulation of intestinal immune responses to Eimeria. Poultry Science 2004;83:611-623.

102. Lillehoj HS and Ruff MD. Comparison of Disease Susceptibility and Subclass-Specific Antibody-Response in Sc and Fp Chickens Experimentally Inoculated with Eimeria tenella, Eimeria acervulina, or Eimeria maxima. Avian Diseases 1987;31:112-119.

103. Lillehoj HS and Trout JM. Avian gut-associated lymphoid tissues and intestinal immune responses to Eimeria parasites. Clinical Microbiology Reviews 1996;9:349-&.

104. Long PL, Millard BJ, Batty AF, da VC. Immunisation against coccidiosis in chickens: tests under simulated field conditions. Avian Pathol 1982;11:131-144.

105. LopezBernad F, DelCacho E, Gallego M, Quilez J, SanchezAcedo C. Identification of a fibronectin-like molecule on Eimeria tenella. Parasitology 1996;113:505-510.

106. Mason HS, Lam DMK, Arntzen CJ. Expression of Hepatitis-B Surface-Antigen in Transgenic Plants. Proceedings of the National Academy of Sciences of the United States of America 1992;89:11745-11749.

107. Mcdonald V, Wisher MH, Rose ME, Jeffers TK. Eimeria tenella - Immunological Diversity Between Asexual Generations. Parasite Immunology 1988;10:649-660.

108. McDougald LR, Fuller L, Mattiello R. A survey of Coccidia on 43 poultry farms in Argentina. Avian Diseases 1997;41:923-929.

109. McDougald LR. Coccidiosis. In: Saif YM, Fadly AM, Glisson JR (editors). Diseases of Poultry. 12th Ed. Wiley-Blackwell. 2008; p. 974-990.

110. Mcgarvey PB, Hammond J, Dienelt MM, Hooper DC, Fu ZF, Dietzschold B, Koprowski H, Michaels FH. Expression of the Rabies Virus Glycoprotein in Transgenic Tomatoes. Bio-Technology 1995;13:1484-1487.

111. Mett V, Farrance CE, Green BJ, Yusibov V. Plants as biofactories. Biologicals 2008;36:354-358.

112. Morgan JAT, Morris GM, Wlodek BM, Byrnes R, Jenner M, Constantinoiu CC, Anderson GR, Lew-Tabor AE, Molloy JB, Gasser RB, Jorgensen WK. Real-time polymerase chain reaction (PCR) assays for the specific detection and quantification of seven Eimeria species that cause coccidiosis in chickens. Molecular and Cellular Probes 2009;23:83-89.

113. Morris GM and Gasser RB. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnology Advances 2006;24:590-603.

114. Mosmann T. Rapid Colorimetric Assay for Cellular Growth and Survival - Application to Proliferation and Cyto-Toxicity Assays. Journal of Immunological Methods 1983;65:55-63.

References

93

115. Naiyana T. Effects of Andrographis Paniculata (Burm.F.) nees on performance, mortality and coccidiosis in broiler chickens. 2002;

116. Nakai Y, Uchida T, Kanazawa K. Immunization of Young Chickens by Trickle Infection with Eimeria-Tenella. Avian Diseases 1992;36:1034-1036.

117. Ovington KS, Alleva LM, Kerr EA. Cytokines and Immunological Control of Eimeria Spp. International Journal for Parasitology 1995;25:1331-1351.

118. Pasternak J and Fernando MA. Host-Cell Response to Coccidian Infection - An Introspective Survey. Parasitology 1984;88:555-563.

119. Procunier JD, Fernando MA, Barta JR. Species and Strain Differentiation of Eimeria Spp of the Domestic-Fowl Using Dna Polymorphisms Amplified by Arbitrary Primers. Parasitology Research 1993;79:98-102.

120. Qureshi MA, Heggen CL, Hussain I. Avian macrophage: effector functions in health and disease. Developmental and Comparative Immunology 2000;24:103-119.

121. Ramsay AJ, Kent SJ, Strugnell RA, Suhrbier A, Thomson SA, Ramshaw IA. Genetic vaccination strategies for enhanced cellular, humoral and mucosal immunity. Immunological Reviews 1999;171:27-44.

122. Reduker DW and Speer CA. Proteins and antigens of merozoites and sporozoites of Eimeria bovis (Apicomplexa). J Parasitol 1986;72:901-907.

123. Rehman B. Comparative studies on the immune response in Desi and foreign breeds of chickens against Eimeria tenella. Pak J Sci 1971;23:201-204.

124. Reid WM and Long PL. Diagnostic Chart for 9 Species of Fowl Coccidia. Georgia Agricultural Experiment Station Research Report 1979;5-24.

125. Riddell C. Avian Medicine. In: Veterinary Pathology. 1984. p. 1-130.

126. Rose ME. Immunity to Eimeria infections. Vet Immunol Immunopathol 1987;17:333-343.

127. Rose ME and Hesketh P. Immunity to Coccidiosis - Lymphocyte-T-Deficient Or Lymphocyte-B-Deficient Animals. Infection and Immunity 1979;26:630-637.

128. Rose ME and Hesketh P. Infection with Eimeria tenella: modulation of lymphocyte blastogenesis by specific antigen, and evidence for immunodepression. J Protozool 1984;31:549-553.

129. Rose ME, Hesketh P, Ogilvie BM. Peripheral blood leucocyte response to coccidial infection: a comparison of the response in rats and chickens and its correlation with resistance to reinfection. Immunology 1979;36:71-79.

130. Rose ME, Hesketh P, Rennie M. Coccidiosis: rapid depletion of circulating lymphocytes after challenge of immune chickens with parasite antigens. Infect Immun 1984;45:166-171.

References

94

131. Rose ME and Long PL. Resistance to Eimeria Infections in Chicken - Effects of Thymectomy, Bursectomy, Whole Body Irradiation and Cortisone Treatment. Parasitology 1970;60:291-&.

132. Rose ME, Orlans E, Buttress N. Immunoglobulin Classes in Hens Egg - Their Segregation in Yolk and White. European Journal of Immunology 1974;4:521-523.

133. Rothwell L, Gramzinski RA, Rose ME, Kaiser P. Avian Coccidiosis - Changes in Intestinal Lymphocyte Populations Associated with the Development of Immunity to Eimeria maxima. Parasite Immunology 1995;17:525-533.

134. Rothwell L, Young JR, Zoorob R, Whittaker CA, Hesketh P, Archer A, Smith AL, Kaiser P. Cloning and characterization of chicken IL-10 and its role in the immune response to Eimeria maxima. J Immunol 2004;173:2675-2682.

135. Ruff MD. External and internal factors affecting the severity of avian coccidiosis. 1993;73-79.

136. Ruff MD, Danforth HD, Reid WM, Johnson J. Anticoccidial Activity of Salinomycin in Floor-Pen Experiments. Poultry Science 1976;55:2086-2086.

137. Russell DG. Host-Cell Invasion by Apicomplexa - An Expression of the Parasites Contractile System. Parasitology 1983;87:199-&.

138. Rybicki ER. Plant-produced vaccines: promise and reality. Drug Discovery Today 2009;14:16-24.

139. Saldana S, Guadarrama FE, Flores TDO, Arias N, Lopez S, Arias C, Ruiz-Medrano R, Mason H, Mor T, Richter L, Arntzen CJ, Lim MAG. Production of rotavirus-like particles in tomato (Lycopersicon esculentum L.) fruit by expression of capsid proteins VP2 and VP6 and immunological studies. Viral Immunology 2006;19:42-53.

140. Sanderson IR and He YP. Nucleotide Uptake and Metabolism by Intestinal Epithelial-Cells. Journal of Nutrition 1994;124:S131-S137.

141. Santos MJD, Carrillo C, Ardila F, Rios RD, Franzone P, Piccone ME, Wigdorovitz A, Borca MV. Development of transgenic alfalfa plants containing the foot and mouth disease virus structural polyprotein gene P1 and its utilization as an experimental immunogen. Vaccine 2005;23:1838-1843.

142. Schmatz DM. The mannitol cycle in Eimeria. Parasitology 1997;114:S81-S89.

143. Schnieder T and Tenter AM. erreger von Parasiten: Taxonomie, Systematik und allgemeine Merkmale. In: Schnieder T (editor). Veterinärmediziniche Parasitologie. 6. Aufl. Stuttgart: Parey Buchverlag; 2006. p. 26-72.

144. Schnitzler BE, Thebo PL, Mattsson JG, Tomley FM, Shirley MW. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathology 1998;27:490-+.

References

95

145. Schnitzler BE, Thebo PL, Tomley FM, Uggla A, Shirley MW. PCR identification of chicken Eimeria: a simplified read-out. Avian Pathol 1999;28:89-93.

146. Schubert U, Fuchs J, Zimmermann J, Jahn D, Zoufal K. Extracellular calcium deficiency and ryanodine inhibit Eimeria tenella sporozoite invasion in vitro. Parasitology Research 2005;97:59-62.

147. Sharrow SO. Overview of flow cytometry. In: edited by John Wiley & Sons Inc. Current Protocols in Immunology; 1991. p. 5.1.1-5.1.8.

148. Shirley MW. Enzyme Variation in Eimeria Species of Chicken. Parasitology 1975;71:369-&.

149. Shirley MW. Development of A Live Attenuated Vaccine Against Coccidiosis of Poultry. Parasite Immunology 1989;11:117-124.

150. Shirley MW. Coccidial Parasites from the Chicken - Discrimination of Different Populations of Eimeria tenella by DNA Hybridization. Research in Veterinary Science 1994;57:10-14.

151. Shirley MW and Bedrnik P. Live attenuated vaccines against avian coccidiosis: Success with precocious and egg-adapted lines of Eimeria. Parasitol Today 1997;13:481-484.

152. Shirley MW and Harvey DA. Eimeria tenella: Infection with a single sporocyst gives a clonal population. Parasitology 1996;112:523-528.

153. Shirley MW, Smith AL, Tomley FM. The biology of avian Eimeria with an emphasis on their control by vaccination. Advances in Parasitology, Vol 60 2005;60:285-330.

154. Sibley LD, Hakansson S, Carruthers VB. Gliding motility: An efficient mechanism for cell penetration. Current Biology 1998;8:R12-R14.

155. Smith ML, Keegan ME, Mason HS, Shuler ML. Factors important in the extraction, stability and in vitro assembly of the hepatitis B surface antigen derived from recombinant plant systems. Biotechnology Progress 2002;18:538-550.

156. Speer CA, Thammnana P, Schenkel RH. Ultrastructural-Localization of Antigenic Sites on Sporozoites, Sporocysts, and Oocysts of Eimeria acervulina and Eimeria tenella by Monoclonal Igg and Igm Antibodies. Journal of Parasitology 1989;75:92-97.

157. Streatfield SJ. Plant-based vaccines for animal health. Revue Scientifique et Technique-Office International des Epizooties 2005;24:189-199.

158. Streatfield SJ. Plant-based vaccines. In Vitro Cellular & Developmental Biology-Animal 2007;43:S2-S2.

159. Streatfield SJ and Howard JA. Plant-based vaccines. International Journal for Parasitology 2003;33:479-493.

References

96

160. Streatfield SJ, Jilka JM, Hood EE, Turner DD, Bailey MR, Mayor JM, Woodard SL, Beifuss KK, Horn ME, Delaney DE, Tizard IR, Howard JA. Plant-based vaccines: unique advantages. Vaccine 2001;19:2742-2748.

161. Su YC, Fei AC, Tsai FM. Differential diagnosis of five avian Eimeria species by polymerase chain reaction using primers derived from the internal transcribed spacer 1 (ITS-1) sequence. Vet Parasitol 2003;117:221-227.

162. Swinkels WJC, Post J, Cornelissen JB, Engel B, Boersma WJA, Rebel JMJ. Immune responses in Eimeria acervulina infected one-day-old broilers compared to amount of Eimeria in the duodenum, measured by real-time PCR. Veterinary Parasitology 2006;138:223-233.

163. Tabares E, Ferguson D, Clark J, Soon PE, Wan KL, Tomley F. Eimeria tenella sporozoites and merozoites differentially express glycosylphosphatidylinositol-anchored variant surface proteins. Molecular and Biochemical Parasitology 2004;135:123-132.

164. Tierney J, Gowing H, Van Sinderen D, Flynn S, Stanley L, McHardy N, Hallahan S, Mulcahy G. In vitro inhibition of Eimeria tenella invasion by indigenous chicken Lactobacillus species. Veterinary Parasitology 2004;122:171-182.

165. Tierney J and Mulcahy G. Comparative development of Eimeria tenella (Apicomplexa) in host cells in vitro. Parasitology Research 2003;90:301-304.

166. Tomley FM. Characterization of rhoptry proteins of Eimeria tenella sporozoites: antigenic diversity of rhoptry epitopes within species of the genus Eimeria and among three asexual generations of a single species, E. tenella. Infect Immun 1994;62:4656-4658.

167. Toure-Balde A, Perlaza BL, Sauzet JP, Ndiaye M, Aribot G, Tall A, Sokhna C, Rogier C, Corradin G, Roussilhon C, Druilhe P. Evidence for multiple B- and T-cell epitopes in Plasmodium falciparum liver-stage antigen 3. Infect Immun 2009;77:1189-1196.

168. Trout JM and Lillehoj HS. T lymphocyte roles during Eimeria acervulina and Eimeria tenella infections. Veterinary Immunology and Immunopathology 1996;53:163-172.

169. Tsuji N, Kawazu S, Ohta M, Kamio T, Isobe T, Shimura K, Fujisaki K. Discrimination of eight chicken Eimeria species using the two-step polymerase chain reaction. J Parasitol 1997;83:966-970.

170. Turpen TH, Reinl SJ, Charoenvit Y, Hoffman SL, Fallarme V, Grill LK. Malarial Epitopes Expressed on the Surface of Recombinant Tobacco Mosaic-Virus. Bio-Technology 1995;13:53-57.

171. Vermeulen AN. Progress in recombinant vaccine development against coccidiosis. A review and prospects into the next millennium. Int J Parasitol 1998;28:1121-1130.

References

97

172. Vervelde L, Vermeulen AN, Jeurissen SHM. In situ characterization of leucocyte subpopulations after infection with Eimeria tenella in chickens. Parasite Immunology 1996;18:247-256.

173. Wallach M, Halabi A, Pillemer G, Sarshalom O, Mencher D, Gilad M, Bendheim U, Danforth HD, Augustine PC. Maternal Immunization with Gametocyte Antigens As A Means of Providing Protective Immunity Against Eimeria maxima in Chickens. Infection and Immunity 1992;60:2036-2039.

174. Wallach M, Smith NC, Braun R, Eckert J. Potential Control of Chicken Coccidiosis by Maternal Immunization. Parasitology Today 1995;11:262-265.

175. Watson J, Koya V, Leppla SH, Daniell H. Expression of Bacillus anthracis protective antigen in transgenic chloroplasts of tobacco, a non-food/feed crop. Vaccine 2004;22:4374-4384.

176. West AP, Herr AB, Bjorkman PJ. The chicken yolk sac IgY receptor, a functional equivalent of the mammalian MHC-related Fc receptor, is a phospholipase A(2) receptor homolog. Immunity 2004;20:601-610.

177. Wieland WH, Lammers A, Schots A, Orzaez DV. Plant expression of chicken secretory antibodies derived from combinatorial libraries. Journal of Biotechnology 2006;122:382-391.

178. Williams RB. Epidemiological aspects of the use of live anticoccidial vaccines for chickens. International Journal for Parasitology 1998;28:1089-1098.

179. Williams RB. A compartmentalised model for the estimation of the cost of coccidiosis to the world's chicken production industry. Int J Parasitol 1999;29:1209-1229.

180. Wisher MH and Rose ME. Eimeria-Tenella Sporozoites - the Method of Excystation Affects the Surface-Membrane Proteins. Parasitology 1987;95:479-489.

181. Woodard SL, Mayor JM, Bailey MR, Barker DK, Love RT, Lane JR, Delaney DE, Comas-Wagner JM, Mallubhotla HD, Hood EE, Dangott LJ, Tichy SE, Howard JA. Maize (Zea mays)-derived bovine trypsin: characterization of the first large-scale, commercial protein product from transgenic plants. Biotechnology and Applied Biochemistry 2003;38:123-130.

182. Woods WG, Richards G, Whithear KG, Anderson GR, Jorgensen WK, Gasser RB. High-resolution electrophoretic procedures for the identification of five Eimeria species from chickens, and detection of population variation. Electrophoresis 2000a;21:3558-3563.

183. Woods WG, Whithear KG, Richards DG, Anderson GR, Jorgensen WK, Gasser RB. Single-strand restriction fragment length polymorphism analysis of the second internal transcribed spacer (ribosomal DNA) for six species of Eimeria from chickens in Australia. Int J Parasitol 2000b;30:1019-1023.

184. Wu H, Singh NK, Locy RD, Scissum-Gunn K, Giambrone JJ. Immunization of chickens with VP2 protein of infectious bursal disease virus expressed in Arabidopsis thaliana. Avian Diseases 2004;48:663-668.

References

98

185. Xuamano JC, Aicher WK, Taguchi T, Kiyono H, Mcghee JR. Selective Induction of Th2 Cells in Murine Peyer Patches by Oral Immunization. International Immunology 1992;4:433-445.

186. Youn HJ and Noh JW. Screening of the anticoccidial effects of herb extracts against Eimeria tenella. Veterinary Parasitology 2001;96:257-263.

187. Yun CH, Lillehoj HS, Choi KD. Eimeria tenella infection induces local gamma interferon production and intestinal lymphocyte subpopulation changes. Infection and Immunity 2000a;68:1282-1288.

188. Yun CH, Lillehoj HS, Lillehoj EP. Intestinal immune responses to coccidiosis. Dev Comp Immunol 2000b;24:303-324.

189. Zelada AM, Calarnante G, Santangelo MD, Bigi F, Verna F, Mentaberry A, Cataldi A. Expression of tuberculosis antigen ESAT-6 in Nicotiana tabacum using a potato virus X-based vector. Tuberculosis 2006;86:263-267.

190. Zhao Y and Hammond RW. Development of a candidate vaccine for Newcastle disease virus by epitope display in the Cucumber mosaic virus capsid protein. Biotechnology Letters 2005;27:375-382.

191. Zhou JY, Wu JX, Cheng LQ, Zheng XJ, Gong H, Shang SB, Zhou EM. Expression of immunogenic S1 glycoprotein of infectious bronchitis virus in transgenic potatoes. Journal of Virology 2003;77:9090-9093.

192. Zhou XH, Huang XQ, Zhong RJ, Zhu QZ, Zhao Y, Guo YQ, Chen XG. [Expression of multiepitope antigenic gene of Toxoplasma gondii in transgenic tomatoes]. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 2008;26:432-437.

Acknowldgement

99

Acknowledgements

All praise belongs to Allah, who gave me ability to finish this research work. Heartily, I would

like to express my deep gratitude to my supervisor: Prof. Dr. A. Daugschies for his endless

support, his encouragement and guidance. He always gave generously of his time and provided

me with the confidence that I needed to continue my doctoral study through the more

challenging times. Special thanks to Dr. Viktor Dyachenko for always providing the valuable

guidelines and advices to conduct my reseach work very freely and frankly.

I would like to extend my gratitude to Dr. Ronald Schmaeschke for his kindness and support.

Special thanks go to Prof. Dr. G. Alber and Dr. U. Mueller and all the work staff of Institute of

Immunology (Faculty of Veterinary Medicine, University Leipzig) for their full dedication for

helping me to carry out this study.

I’m thankful to all my colleagues and lab mates for their frank collaboration will always be

remembered. I would especially like to thank Mr. Gert Kunz for al1 of his advices and friendship

during my stay in Germany. He provided me help and support and it was appreciated!

I would also like to acknowledge the Institute for providing me with an interesting place to work

and all kinds of support to carry out this study. Thanks to Mrs. Sandra Gawlowska and Mrs.

Christa Morgeneyer for being available to help and answer my many questions.

However, I received funding from Egyptian government through the ministry of Higher

education and research during my stay, I acknowledge very gratefully the University of Leipzig

for support of my graduate program. Also my deep thanks to the company Novoplant GmbH and

its staff members especially Mrs. Doreen Jahn and Dr. Sergej Kiprijanov for their cooperation

which was very helpful.

I’m indebted to the animal keepers: M. Fritsche and R. Schuhmacher in keeping and feeding my

experimental animals and for their kindness and willingness to help me was always appreciated,

by me and my little chicks!

Finally I dedicate this thesis to my wife for her never-ending support and for keeping me going

when things were difficult and to my children Mohamed, Mariam and Sara for their love and

patience who make it al1 worthwhile and to my parents for prayer and support.

Reda El-Bastaweisy Ibrahim Khalafalla